Compositions, kits, and methods for multiplexed measurements of cellular perturbations

Abstract

Compounds, compositions, kits, methods, devices, and systems for efficient screening of cell perturbation conditions for improved cell structure and / or function, cells produced by one or more such approaches, and cell products produced by such cells. CellCode, a novel functional screening approach, enables multiplexed testing of effects of a variety of environmental perturbations, such as cytokine treatments on T cell state and function, in a pooled manner. Using CellCode, cells subject to different cytokine treatments can be pooled and interrogated for in vivo function after adoptive transfer, enabling massively parallel interrogation of many treatments in animal models.

Description

COMPOSITIONS, KITS, AND METHODS FOR MULTIPLEXED MEASUREMENTS OF CELLULAR PERTURBATIONS CROSS-REFERENCE(S) TO RELATED APPLICATION(S)

[0001] This PCT application claims the benefit of, and priority to, U.S. provisional application 63 / 583,955 filed September 20, 2023; the contents of which are incorporated by reference herein in their entirety for all purposes. STATEMENT REGARDING SEQUENCE LISTING

[0002] The Sequence Listing XML associated with this application is provided in XML format and is hereby incorporated by reference into the specification. The name of the XML file containing the sequence listing is 3915-P1319WOUW Sequence Listing.xml. The XML file is 71,902 bytes; was created on September 17, 2024; and is being submitted electronically via Patent Center with the filing of the specification. STATEMENT OF GOVERNMENT LICENSE RIGHTS

[0003] This invention was made with government support under Grant No. RM1 HG010461, awarded by the National Human Genome Research Institute. The government has certain rights in the invention. BACKGROUND

[0004] Cell therapies, cells utilized as part of product manufacturing processes, and cells in other industrial contexts are functional due at least in part to the culture environments within which they are prepared and / or operate, which can contain nutrients, growth factors, and signaling molecules, among other compounds. Improving and optimizing cell environments for identifying conditions or culture perturbations for effective cell growth and / or function, regardless of context, is a laborious process that requires extensive experimentation across many experimental groups to identify conditions that satisfactorily achieve the desired functionalities. This process can be cost- prohibitive and can be a limiting factor in the improvement of existing cell-based therapies and other products or services.

[0005] Accordingly, there is a need for highly efficient, accurate, high-throughput methods for screening a vast number of culture conditions, or cell perturbations, for their3915-P1319WO.UW -1-ability to improve or optimize cellular structure and / or function, in a variety of contexts, including but not limited to cell therapies utilizing engineered T cells for the treatment of cancers. The present disclosure meets this and other long-felt and unmet needs in the art. SUMMARY

[0006] This summary is provided to introduce a selection of concepts in a simplified form that are further described below in the Detailed Description. This summary is not intended to identify key features of the claimed subject matter, nor is it intended to be used as an aid in determining the scope of the claimed subject matter.

[0007] In an aspect, the disclosure provides a method for parallel testing of a plurality of cell treatment conditions, the method comprising: contacting a plurality of cells with a plurality of deoxyribonucleic acid (DNA) molecules that comprise unique DNA barcodes; splitting the plurality of cells, and any progeny cells thereof, into a plurality of subgroups; exposing subgroups of the plurality of subgroups to cell treatment conditions of the plurality of cell treatment conditions for a production of a treatment- barcode correlation; pooling subgroups of the plurality of subgroups to form a pool; analyzing at least a portion of the pool to correlate one or more observed structures and / or functions of a cell of the pool to a unique barcode of the cell of the pool to produce a barcode-readout correlation; and computing at least one cell treatment condition that is associated with the one or more observed structures and / or functions of the cell by way of the barcode-readout correlation and the treatment-barcode correlation.

[0008] In embodiments, DNA molecules of the plurality of DNA molecules are configured for cellular DNA replication and cellular transcription to produce a plurality of ribonucleic acid (RNA) molecules that comprise unique RNA barcodes.

[0009] In embodiments, the production of the treatment-barcode correlation comprises: sampling the plurality of subgroups to produce a plurality of subgroup samples; and analyzing the plurality of subgroup samples to correlate the unique DNA barcodes, the unique RNA barcodes, or both, to the plurality of cell treatment conditions to produce the treatment-barcode correlation.

[0010] In embodiments, the analyzing the plurality of subgroup samples comprises sequencing DNA barcodes and / or RNA barcodes of cells of subgroups of the plurality of subgroups to construct a barcode dictionary of associations between treatment3915-P1319WO.UW -2-conditions and corresponding barcodes, such that the barcode dictionary of associations comprises the treatment-barcode correlation.

[0011] In embodiments, the contacting the plurality of cells with the plurality of DNA molecules causes at least a portion of the plurality of cells to stably maintain DNA molecules of the plurality of DNA molecules.

[0012] In embodiments, the contacting the plurality of cells with the plurality of DNA molecules comprises transducing the plurality of cells with a plurality of viral particles that comprise the plurality of DNA molecules.

[0013] In embodiments, the cells are alive and are not fixed or permeabilized.

[0014] In embodiments, the analyzing at least the portion of the pool comprises DNA sequencing and / or RNA sequencing to determine sequences of one or more unique DNA barcodes and / or one or more unique RNA barcodes of the cell of the pool.

[0015] In embodiments, the analyzing at least the portion of the pool comprises testing the cell of the pool for: an expression of a gene, a transcription of the gene, a translation of a messenger RNA (mRNA) of the gene, a transcriptome of the cell, a proteome of the cell, a level of a protein of the gene, a tertiary and / or quaternary structure of the protein, a post-translational modification of the protein, a cellular location of the protein, a function of the protein, a function of the cell, or any combination thereof.

[0016] In embodiments, the cell of the pool is a T cell and the function of the cell comprises an effector function, a cytokine secretion, a self-renewal of the cell, a cytolytic activity, an anti-infection function, an anti-cancer function, or any combination thereof.

[0017] In embodiments, the plurality of cell treatment conditions comprises a cell treatment condition comprising: a small molecule, a large molecule, a temperature, an ionic strength, a pH level, an oxygen level, a nitrogen level, a carbon dioxide level, a viscosity, an electrical potential, an electrical current, a magnetic field, an electromagnetic field, a light ray, a sound stimulation, a mechanical stimulation, an atmospheric pressure level, or any combination thereof.

[0018] In embodiments, the plurality of cell treatment conditions comprises a cell treatment condition comprising: a cytokine, a growth factor, a chemoattractant, a chemorepellent, or any combination thereof.

[0019] In embodiments, the method further comprises after the pooling the plurality of subgroups and before the analyzing at least the portion of the pool: culturing at least the cell of the pool in a cell treatment condition that corresponds to a3915-P1319WO.UW -3-physiological context within which the cell of the pool is desired to be operable and exhibits the one or more observed structures and / or functions.

[0020] In embodiments, the cell of the pool is cultured in a biological matrix that corresponds to the physiological context and comprises a model cell, a model tissue, a model organ, and / or a model organism.

[0021] In embodiments, the cell treatment condition corresponds to a rest state, a healthy state, a viral infection, a bacterial infection, a parasitic infection, a genetic disorder, a cancer, or any combination thereof.

[0022] In embodiments, the cell treatment condition comprises an anti-CD3 agent, IL-2, an anti-CD28 agent, IL-12, or any combination thereof.

[0023] In embodiments, the anti-CD3 agent comprises an anti-CD3 antibody, the anti-CD28 agent comprises an anti-CD28 antibody, or both.

[0024] In embodiments, the plurality of cell treatment conditions comprises a cell treatment condition comprising a cytokine selected from the group consisting of: Interleukin-2 (IL-2), Interleukin-12 (IL-12), Interleukin-21 (IL-21), Interferon-gamma (IFN-γ), Interleukin-7 (IL-7), Interleukin-15 (IL-15), Interleukin-18 (IL-18), Interferon- alpha (IFN-α), Tumor necrosis factor alpha (TNF-α), Transforming growth factor beta (TGF-β), Interleukin-10 (IL-10), Interleukin-6 (IL-6), Stem cell factor (SCF), Interleukin- 27 (IL-27), Interleukin-9 (IL-9), Interleukin-25 / Interleukin-17E (IL-25 / IL-17E), Interleukin-17A (IL-17A), Interleukin-23 (IL-23), Interleukin-11 (IL-11), Interleukin-1- beta (IL-1β), Interleukin-33 (IL-33), Interleukin-36-gamma (IL-36γ), Interleukin-37b (IL- 37b), Interleukin-4 (IL-4), Thymic stromal lymphopoietin (TSLP), Tumor necrosis factor superfamily member 14 (TNFSF14 / LIGHT), B-cell activating factor (BAFF), Nerve growth factor (NGF), Tumor necrosis factor-like cytokine 1A (TNFSF15 / TL1A), Interleukin-15 (IL-15), and any combination thereof.

[0025] In embodiments, at least one DNA molecule of the plurality of DNA molecules is produced by a method that uses a DNA molecule comprising a polynucleotide sequence having at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity to a polynucleotide sequence selected from the group consisting of: SEQ ID NOs 1-22.

[0026] In embodiments, the cell is configured for a cell therapy, a cancer cell therapy, an immunotherapy, or any combination thereof.3915-P1319WO.UW -4-

[0027] In an aspect, the disclosure provides a method for engineering a T cell, the method comprising: culturing the T cell with a cell treatment condition comprising a cytokine selected from the group consisting of: IL-2, IL-12, IL-21, IFN-γ, IL-7, IL-15, IL-18, IFN-α, TNF-α, TGF-β, IL-10, IL-6, SCF, IL-27, IL-9, IL-25 / IL-17E, IL-17A, IL- 23, IL-11, IL-1β, IL-33, IL-36γ, IL-37b, IL-4, TSLP, TNFSF14 / LIGHT, BAFF, NGF, TNFSF15 / TL1A, IL-15, and any combination thereof.

[0028] In embodiments, the method engineers the T cell to be configured for a cell therapy, a cancer cell therapy, an immunotherapy, or any combination thereof; and wherein the T cell is cultured in a cell treatment condition that corresponds to a physiological context within which the T cell is to be operable for the cell therapy, the cancer cell therapy, the immunotherapy, or any combination thereof.

[0029] In embodiments, the cell treatment condition comprises a biological factor of the physiological context, a therapeutic agent for treatment of a disease of the physiological context, or both.

[0030] In embodiments, the cell treatment condition corresponds to a rest state, a healthy state, a viral infection, a bacterial infection, a parasitic infection, a genetic disorder, a cancer, or any combination thereof, of the physiological context.

[0031] In embodiments, the cell treatment condition comprises an anti-CD3 treatment, an IL-2 treatment, an anti-CD28 treatment, an IL-12 treatment, or any combination thereof.

[0032] In embodiments, the cell treatment condition comprises an anti-CD3 agent, IL-2, an anti-CD28 agent, IL-12, or any combination thereof.

[0033] In embodiments, the anti-CD3 agent comprises an anti-CD3 antibody, the anti-CD28 agent comprises an anti-CD28 antibody, or both.

[0034] In an aspect, the disclosure provides a therapeutic cell produced by a method for parallel testing of a plurality of cell treatment conditions and / or a method for engineering a T cell.

[0035] In an aspect, the disclosure provides a therapeutic cell product produced by a host cell produced by a method for parallel testing of a plurality of cell treatment conditions and / or a method for engineering a T cell.

[0036] In an aspect, the disclosure provides a DNA molecule configured for replication in a cell and comprising a unique DNA barcode that is configured to be transcribed in the cell to produce a unique RNA barcode. In embodiments, the DNA3915-P1319WO.UW -5-molecule is configured for cellular DNA replication and cellular transcription to produce an RNA molecule that comprises a unique RNA barcode.

[0037] In an aspect, the disclosure provides a composition comprising a DNA molecule configured for replication in a cell and comprising a unique DNA barcode that is configured to be transcribed in the cell to produce a unique RNA barcode. In embodiments, the composition comprises a viral preparation comprising a virus particle that comprises the DNA molecule.

[0038] In an aspect, the disclosure provides a cell comprising a DNA molecule configured for replication in a cell and comprising a unique DNA barcode that is configured to be transcribed in the cell to produce a unique RNA barcode.

[0039] In an aspect, the disclosure provides a plurality of cells comprising a plurality of DNA molecules configured for replication in a cell and comprising unique DNA barcodes that are configured to be transcribed in the cell to produce unique RNA barcodes.

[0040] In an aspect, the disclosure provides a composition comprising a cell comprising a DNA molecule configured for replication in a cell and comprising a unique DNA barcode that is configured to be transcribed in the cell to produce a unique RNA barcode.

[0041] In an aspect, the disclosure provides a non-transitory machine-readable storage medium having stored thereon a barcode-readout correlation, a treatment-barcode correlation, or both.

[0042] In an aspect, the disclosure provides a computational device comprising a non-transitory machine-readable storage medium having stored thereon a barcode-readout correlation, a treatment-barcode correlation, or both.

[0043] In an aspect, the disclosure provides a system comprising a computational device comprising a non-transitory machine-readable storage medium having stored thereon a barcode-readout correlation, a treatment-barcode correlation, or both.

[0044] In an aspect, the disclosure provides a kit, comprising: a therapeutic cell, a therapeutic cell product, a DNA molecule, a composition, a cell, a plurality of cells, a non-transitory machine-readable storage medium, a computational device, a system, or any combination thereof; and an instructional material configured to instruct at least an individual in a use of the kit for: a method for parallel testing of a plurality of cell treatment conditions, a method for engineering a T cell, a method of treatment of a3915-P1319WO.UW -6-subject in need thereof, a method of preparation of a medicament for use in the treatment of the subject in need thereof, a method of diagnosis of a subject with a disease or disorder, a method of prognosis of the disease or disorder, or any combination thereof. DESCRIPTION OF THE DRAWINGS

[0045] The foregoing aspects and many of the attendant advantages of this invention will become more readily appreciated as the same become better understood by reference to the following detailed description, when taken in conjunction with the accompanying drawings.

[0046] FIG.1 shows a diagrammatic overview of approaches to (1) improve ex vivo expansion and conditioning of engineered T cells for therapeutic purposes and (2) generate a comprehensive atlas of combinatorial cytokine effects for CD8 T cells, according to aspects of the present disclosure. The approaches are enabled by CellCode, a method for massively-parallel interrogation of many external perturbations on cell function, according to aspects of the present disclosure.

[0047] FIG.2 shows a sketch of the CellCode schematic and workflow, according to aspects of the present disclosure. A high-complexity viral barcode library is cloned using GoldenGate, virus is produced, and then transduced into cells. The plasmid map corresponding to retroviral MSCV barcode library v2.4 is shown, which contains a nuclear-localized fluorescent marker for tracking and sorting (H2B-mRuby), a WPRE for transcript stability and capture and a U6 and hairpin 5’ to the barcoded sequence to boost expression and capture rates. The cells are split into treatment conditions and cultured for various amounts of time. Conditions are sampled, and then cells are pooled. Barcodes from cells in the pool tie cells back to their original treatment condition. The pool can be subjected to functional and genomic assays, including adoptive transfer into a mouse and single cell RNA sequencing, respectively.

[0048] FIGs 3A-3C show validation of the CellCode workflow, according to aspects of the present disclosure. FIG. 3A shows a collector’s curve plotting unique barcodes versus deep sequencing reads sampled for a sub-library (1 out of 12). Duplication rate for all twelve libraries was used to estimate the total library size. FIG. 3B shows P2C2 cells were infected with barcode retrovirus, sampled at day 2, and the remainder collected and barcodes sequenced instead of pooling at day 4. Heatmap shows that cell barcodes (at Day 4) can be mapped to a barcode-to-well (treatment) map3915-P1319WO.UW -7-generated at an earlier time (Day 2), enabling tracking of cells based on their treatment history. FIG. 3C shows number of unique barcodes in the barcode-to-treatment map for the Pilot experiment, showing that the unique barcodes approaches the theoretical maximum, implying high efficiency recovery (near ~100%).

[0049] FIG. 4 shows a CellCode experimental workflow for a pilot study to test the effects of cytokines and pharmacological drugs on T cells, according to aspects of the present disclosure. CD8 T cells are isolated, barcoded, cultured in various treatment conditions, sampled and pooled, and finally subjected to sort-seq and scRNA-seq assays.

[0050] FIGs 5A-5C show an example multiplexed evaluation of treatment effects on CD8 T cell transcriptome and function in a pilot CellCode assay, according to aspects of the present disclosure. CD8 T cells were barcoded, subject to 8 treatments in 2 contexts in triplicate (48 conditions), then pooled for follow-up assays. FIG. 5A shows bar charts that show, for each treatment condition, clonal persistence (top), given by the fraction of barcodes persisting after 5 days; and Tcf7-YFP mean score (bottom), obtained by cell sorting based on Tcf7-YFP reporter levels. FIG. 5B shows a heatmap showing expression levels of genes dependent on IL-21 signaling, both in the absence (rest) or presence (stim) of TCR stimulation by αCD3 and αCD28 Abs. Strikingly, IL-21 activates genes associated with effector function and exhaustion (Zeb2, Lag3, Prf1) only when stimulation is present. FIG. 5C shows UMAP plots derived from scRNA-seq data show effects of IL-7, IL-12 and IL-21 on cell states with or without TCR stimulation.

[0051] FIGs 6A-6C show how CellCode can be used to reveal stimulation context-dependent effects of cytokines on CD8 T cell transcriptomic state, according to aspects of the present disclosure. FIG. 6A shows a heatmap showing expression levels of genes dependent on IL-21 signaling, both in the absence (rest) or presence (stim) of TCR stimulation by αCD3 and αCD28 Abs. Significantly, IL-21 activates genes associated with effector function and exhaustion (Zeb2, Lag3, Prf1) only when stimulation is present. FIGs 6B-6C show stimulation-dependent IL-21 effects were also measured separately using flow cytometry. Flow plots (FIG.6B) and bar charts (FIG.6C) show that IL-21 mainly elicits a stem-cell memory phenotype (TCF1HICD44-CD62L+) without continued stimulation, but drives effector differentiation (TCF1-Tim3+CD25HI) with persistent stimulation.

[0052] FIG. 7 shows an example exhaustive contextual (Table 1) cytokine screen schematic using CellCode, according to aspects of the present disclosure. CellCode was3915-P1319WO.UW -8-used to screen 192 unique ex vivo T cell expansion conditions (Table 2) in parallel to evaluate their effect on multiple T cell phenotypic and functional traits. On day 0, CD8+T cells were isolated from spleens of mice containing a fluorescent reporter for expression of Tcf7, a canonical marker of T cell self-renewal and memory differentiation. Cells were uniformly activated for 22 hrs with plate-bound aCD3 and aCD28 antibodies. Cells were then transduced with an MSCV vector containing the barcode library. 27 hrs after initial stimulation and transduction, prior to first cell division, cells were split into 576 wells of 6, 96-well plates. Each well contained one of the 192 expansion conditions, with each condition being evaluated in triplicate. The cells were then incubated for 36 hrs, at which point 75% of the cells in each well were removed, and sequenced with next- generation sequencing to identify the set of barcodes contained within each well. This process generates the barcode dictionary. The remaining cells were cultured for an additional 36 hrs for a total of 3 days of ex vivo expansion in the various treatment conditions. At this point, cells were pooled and split into three aliquots. The first aliquot was used for 10X Genomics scRNA-sequencing. The second aliquot was flow sorted into 4 bins based on expression of the Tcf7-YFP reporter as a proxy for degree of memory differentiation, and each bin sequenced with Next-generation sequencing. The third aliquot was further cultured in multiple different media conditions (“follow-up conditions”). Cells were sampled from these conditions after two, five, and nine days of ex vivo culture and subjected to Next-generation sequencing. The 192 conditions screened are shown in Table 2.

[0053] FIG. 8 shows example Tcf7-YFP sort data from a large-scale in vitro screen, showing cytokine effects on Tcf7-YFP as quantified by quartile sort-seq, according to aspects of the present disclosure. Following treatment with the 192 ex vivo conditions listed in Table 2, barcoded cells were pooled and flow sorted based on expression of Tcf7-YFP. This procedure was repeated to collect three replicates. Cells were collected into 4 quartiles of graded YFP expression and their barcodes sequenced with next-generation sequencing. Barcodes were mapped back to the treatment condition and then the log2-fold change with respect to the null condition in each bin was calculated, averaged over replicates, and plotted. The quartiles are arranged from lowest to highest expression of Tcf7-YFP, with upper shade indicating enrichment relative to no cytokine and lower shade indicating depletion.3915-P1319WO.UW -9-

[0054] FIG. 9 shows example cytokine effects on cell growth in follow-up perturbations, according to aspects of the present disclosure. Following treatment with the 192 ex vivo conditions listed in Table 2, barcoded cells were pooled and then plated into one of the “assay” perturbations shown above, with three replicates for each assay. Cells were collected on days 4, 6, 9, and 13, and barcodes were amplified and sequenced via next-generation sequencing. Barcodes were mapped back to the treatment condition and then the total number of reads mapping to each condition on Day 6, 9 and 13 were normalized to the Day 4 reads. Then the log2-fold change with respect to the null condition for each assay was calculated, averaged over replicates, and plotted. Upper shade indicates enrichment and lower shade indicates depletion of a cytokine-base combination relative to that same base without the cytokine, on a particular day and in a particular follow-up assay condition.

[0055] FIGs 10A-10I show experimental results showing context and cytokine effects on mouse CD8+T-cell transcriptomes, according to aspects of the present disclosure. FIG. 10A shows a schematic of a CellCode cytokine-context screen until a single-cell RNA-seq step. FIG. 10B shows a Uniform Manifold Approximation and Projection (UMAP) plot of single cell transcriptomes colored by stimulation context. FIG. 10C shows a UMAP plot of single cell transcriptomes colored by cluster. FIG. 10D shows a cluster enrichment plot of context-treated single cells, with q-value significance for enrichment or depletion computed by randomization test. FIG. 10E shows top differentially expressed genes (DEGs) for each context plotted against aggregated normalized expression from all cells from that context, clustered by k-means into 8 groups. FIG. 10F shows Monocle3-computed marker genes plotted against aggregated expression by cluster, clustered by k-means into 17 groups. Enriched context is annotated for each cluster. FIG. 10G shows UMAP density plots of multiple doses of TGF-b in the context of TCR stimulation (top) and IL-18 in the context of TCR stimulation + IL-12 (bottom). FIG. 10H shows a cluster enrichment plot of cytokine and dose-treated single cells from anti-CD3 and anti-CD3 / 28 contexts, with q-value significance for enrichment or depletion computed by randomization test. FIG. 10I shows a cluster enrichment plot of cytokine and dose-treated single cells from the anti-CD3 / 28 + IL-12 context, with q-value significance for enrichment or depletion computed by randomization test.

[0056] FIG. 11 shows an example 10X single-cell RNA-seq with condition-level correlation plot from a large-scale in vitro screen, according to aspects of the present3915-P1319WO.UW -10-disclosure. Cells were filtered by quality control metrics (as described for FIGs 10A-10I) and only cells uniquely mappable to a single condition were subsetted. Pseudobulk profiles were computed for each of the 192 conditions listed in Table 2. All cells from each replicate of each condition were pooled in the analysis. The correlations between each pairwise pseudobulk profile was computed and plotted, with upper shade indicating high correlation and lower shade indicating low correlation, as indicated in the legend.

[0057] FIG. 12 shows an example schematic for an in vivo CellCode screen, according to aspects of the present disclosure. Following cell barcoding as in the schematic of FIG. 2, pooled cells can be adoptively transferred into mouse models of disease, such as mice infected with a pathogen or mice containing tumors. Cells can be human (e.g. CD3+cells column-purified from human PBMC) or from a mouse. If tumor models are used, a viral vector containing a tumor-specific antigen receptor (i.e., CAR, TCR) along with the barcode library is used for transduction during the barcoding step. At various time points after adoptive transfer, the transferred cells can be harvested and their barcodes sequenced with next generation sequencing. The sequenced barcodes can be mapped back to the initial ex vivo treatment conditions to evaluate which conditions promote T cell fitness, survival, efficacy, etc. upon adoptive transfer and in vivo challenge. A subset of recovered cells can be subjected to scRNA sequencing to connect transcriptional states with function in vivo. DETAILED DESCRIPTION

[0058] Many cell therapies and cell products depend for their function on conditions and treatments during their manufacture, which should be optimized with respect to various relevant conditions for the effective manufacture of these products. An example of relevant conditions includes cytokines, signaling molecules used by the immune system for cell-cell communication, for preparation of T cells for cell therapies. Different cytokines regulate distinct aspects of T cell function that are important for pathogen and tumor control, including tissue homing, effector activity and differentiation, and thus can influence the functional capabilities of T cells to overcome the multifaceted hurdles to chronic stimulation environments, such as the case with tumors and persistent viral infections.

[0059] The present disclosure provides compositions, kits, and methods useful for efficiently evaluating large numbers of cell culture or perturbation conditions, and3915-P1319WO.UW -11-demonstrates the utility of the disclosed aspects and embodiments with examples that show that (1) distinct cytokines can alter the characteristics of T cells, and (2) these cytokines work by exerting distinct, context-dependent effects on T cell transcriptomic state and function.

[0060] In various aspects, to enable testing for many individual and combinatorial cytokine treatment conditions, CellCode, a novel functional screening approach as disclosed herein, can be implemented. CellCode enables the multiplexed testing of effects of environmental perturbations, including but not limited to cytokine treatments, on T cell state and function in a pooled manner. Importantly, with CellCode, cells subject to different cytokine or other treatments can be pooled and efficiently interrogated in a variety of follow up assays. Assays provided herein include assessment of cell state via single cell genomics, pooled clonal growth assays, and pooled fluorescence activated cell sorting assays. CellCode is compatible with a wide range of additional assays to include additional rounds of chemical or genetic perturbation, pooled assessment of cell morphology or behavior via microscopy, and in vivo function after adoptive transfer, thus enabling the massively parallel interrogation of many treatments in animal models.

[0061] In embodiments, ex vivo cytokine combination treatments can be implemented due to their ability to alter T cell characteristics. To demonstrate CellCode and to build a comprehensive resource to facilitate cytokine-enhanced T cell therapies across a range of tumor / disease contexts, CellCode is used to comprehensively map the effects of 192 contextual cytokine treatments on T cell transcriptomic state, self-renewal capacity, and effector function using a series of in vitro signaling environments that mimic different physiological and disease immune contexts (Table 1).

[0062] As such, the present disclosure provides approaches for new cytokine- based immunomodulatory strategies for altering the characteristics of T cells for a variety of purposes, including but not limited to the development and manufacturing of cellular therapies. The present disclosure also provides an atlas of cytokine effects on CD8 T cell state and function, providing a rational framework for T cell engineering, and T cell therapies produced with the framework. NUCLEIC ACIDS, CELLS, AND COMPOSITIONS

[0063] In various aspects, the disclosure provides nucleic acids, including DNA molecules comprising unique DNA barcodes, as well as cells comprising the barcodes,3915-P1319WO.UW -12-compositions comprising the cells, and the like (e.g., as used in screening). The DNA molecules can be configured to be stably maintained by and within cells such that the DNA molecules are replicated and inherited by progeny cells as a result of parent cell division. Since readout assays evaluating structures and functions of cells can vary, in at least some embodiments, the unique DNA barcodes can be configured to be expressed, e.g., conditionally or constitutively, by cells to produce unique RNA barcodes detectible in RNA preparations. In this manner, an experimental readout that utilizes RNA detection, e.g., RNA sequencing, can enable detection and identification of RNA barcodes, without need for separate sample preparation for DNA sequence analysis.

[0064] Accordingly, in various aspects, the disclosure provides a DNA molecule configured for replication in a cell and comprising a unique DNA barcode that is configured to be transcribed in the cell to produce a unique RNA barcode. The DNA molecule can be double stranded and circular, with any of various degrees of writhe, and can include genetic elements for facilitation of replication of the DNA molecule, for example, if maintained by the cell as an extrachromosomal element. The DNA molecule can be configured to be packaged and delivered to a live cell with a suitable viral vector, such as a retrovirus vector for mouse cells or a lentiviral vector for use in human cells. In various embodiments, the unique DNA barcode is present both in the DNA molecule as well as in transcription products resulting from transcription of at least a portion of the DNA molecule. In this manner, the barcode can be detected with downstream DNA sequencing methods and RNA sequencing methods, as well as other molecular biology techniques. However, in alternative embodiments, the unique DNA barcode can be present in the DNA sequence of the DNA molecule, and optionally absent from transcriptional products, without departing from the scope and spirit of the present disclosure.

[0065] In various embodiments, a DNA molecule can be integrated by a cell as a chromosomal element and replicated along with nuclear DNA, or can be integrated by the cell as a mitochondrial DNA element and replicated along with mitochondrial DNA, for example. The DNA molecule, and any genetic element that can result from stable integration of the DNA molecule, can comprise a promoter and optionally one or more additional regulatory elements for transcription by the cell, which can be configured for conditional or constitutive expression, in various embodiments; accordingly, in3915-P1319WO.UW -13-embodiments, the DNA molecule is configured for cellular DNA replication and cellular transcription to produce an RNA molecule that comprises a unique RNA barcode.

[0066] The disclosure also provides various compositions, including those comprising a DNA molecule (e.g., a plurality of DNA molecules with a plurality of unique DNA barcodes). A composition can be formulated for use as a reagent composition for laboratory testing or research, as a composition for preparation of an engineered cell for cell therapy, or the like. In at least some embodiments, a composition comprises a viral preparation comprising a virus particle that comprises a DNA molecule, for example, a retrovirus preparation, a lentivirus preparation, or the like, however, various other virus preparations can be used without departing from the scope and spirit of the disclosure.

[0067] The disclosure also provides various cells, including those comprising a DNA molecule configured for replication in the cell and comprising a unique DNA barcode that is configured to be transcribed in the cell to produce a unique RNA barcode. A cell can be provided as part of a formulation, for example, as a pharmaceutical composition or reagent composition, for administration to an organism or other biological matrix. In at least some instances a plurality of cells can be provided, and the disclosure also provides a plurality of cells comprising a plurality of DNA molecules configured for DNA replication and comprising unique DNA barcodes that are configured to be transcribed to produce unique RNA barcodes. For example, a cell therapy (e.g., experimental or approved) can be comprised of a plurality of T cells.

[0068] Accordingly, in various aspects, the disclosure also provides a therapeutic cell produced by a method for parallel testing of a plurality of cell treatment conditions, and / or a method for engineering a T cell. While cells can be used in any of various applications, in at least some embodiments, a product produced by a cell can be useful (e.g., antibody, antibody fragment, or another industrial cell product or intermediate), such as can occur during industrial biosynthesis. Accordingly, the disclosure also provides a therapeutic cell product produced by a host cell produced by a method for parallel testing of a plurality of cell treatment conditions and / or a method for engineering a T cell. The host cell can be an expression cell, such as a mammalian expression cell, an insect expression cell, or the like, or alternatively, can be comprised of a T cell or other immune cell.3915-P1319WO.UW -14-

[0069] These and other advantageous aspects of the disclosure can be implemented with CellCode, an improved multiplexed screening method and system of the disclosure, for conducting a screen of cell conditions using a plurality of cells. With CellCode, a particular cell is given a DNA molecule that contains a unique DNA barcode, such that individual mother cells, and daughter cells resulting from division of the mother cells, can be analyzed with nucleic acid sequencing methods for identification of one or more barcodes present in the cell lineage. This can be used to trace back the lineage of the tested cell and identify one or more conditions to which one or more cells of the lineage was exposed during the screen.

[0070] A plurality of cells comprising unique DNA barcodes can be pooled, in embodiments, for comparison of function of one or more such pools, and for identification of particular cell lineages within such pools that outperform the others according to a metric. The metric can include, for example, degree of tumor penetration or persistence, degree of an anti-tumor activity, degree of a beneficial or desired phenotype, degree of robustness of a structure and / or function in the presence of adverse growth or culture conditions, or the like.

[0071] Cells produced by CellCode, or by another method of generating cells according to the disclosure, can be industrially useful in any of a variety of settings. For example, T cells that are beneficially or optimally activated against tumors using cell culture or perturbation conditions identified by a CellCode screen can be formulated as a therapeutic composition for delivery to experimental or clinical subjects (e.g., cell therapy). Accordingly, in another aspect, the disclosure provides a composition, e.g., a therapeutic composition, comprising such a cell or a plurality of such cells. Such compositions can be formulated in a manner that makes them suitable for administration to a subject, such as for cell therapy, using suitable pharmaceutical carriers, excipients, or the like. SCREENING, CELL ENGINEERING, AND TREATMENT METHODS

[0072] In various aspects, the disclosure provides a method for parallel testing or screening of a plurality of cell treatment conditions, including but not limited to large scale screens (e.g., screens having greater than 1,000 conditions). Such a method comprises: contacting a plurality of cells with a plurality of DNA molecules that comprise unique DNA barcodes; splitting the plurality of cells, and any progeny cells3915-P1319WO.UW -15-thereof, into a plurality of subgroups; exposing one or more subgroups of the plurality of subgroups to one or more cell treatment conditions of the plurality of treatment conditions for a production of a treatment-barcode correlation; pooling subgroups to form a pool; analyzing at least a portion of the pool to correlate one or more observed structures and / or functions of a cell of the pool to a unique barcode of the cell of the pool to produce a barcode-readout correlation; and computing at least one cell treatment condition that is associated with the one or more observed structures and / or functions of the cell by way of the barcode-readout correlation and the treatment-barcode correlation. DNA molecules of the plurality of DNA molecules can be configured for cellular DNA replication and, optionally, cellular transcription to produce a plurality of RNA molecules that comprise unique RNA barcodes. The method is advantageously scalable and enables large scale, parallel screening of any of a variety of cell culture treatment conditions, including but not limited to cytokine exposures and perturbations, growth factors or other presence of biological products in a biological matrix, and the like, in a time- and cost- efficient manner.

[0073] As described herein, the conditions used for cell programming matters with respect to the utility of the programmed cells, and the presence of molecular signals of stress, infection, disease, inflammation, or immune response, or the presence of agents associated with treatments (e.g., genetic background of a treatment subject, small molecule drugs, large molecule drugs, antibody drugs, other cell therapies, etc.), can impact the efficacy of cells in a treatment context. Identifying cell programming conditions for the development of therapeutic cells that can withstand these conditions and provide a therapeutic benefit involves testing a large number of cell engineering conditions. Brute force, exhaustive testing of the vast number of cell culture treatments that are possible in various contexts would be time- and cost-prohibitive in many scenarios. Accordingly, methods of the disclosure can significantly reduce barriers to the production of effective cell therapies and can pave the way for more improved, e.g., personalized, cell therapies that are effective for a particular subject with a particular biological context.

[0074] To help ensure that a barcode identified as part of structural and / or functional testing of a cell can be traced back to one or more cell treatment conditions which contributed to the observed structural and / or functional features of the cell, an association or correlation between the one or more treatment conditions and the barcode3915-P1319WO.UW -16-can be known beforehand, by sampling and barcode sequencing of a portion of cells as part of testing the treatment conditions, prior to structural and / or functional tests. Accordingly, in embodiments, as part of a screening method, the production of the treatment-barcode correlation comprises: sampling the plurality of subgroups to produce a plurality of subgroup samples; and analyzing the plurality of subgroup samples to correlate the unique DNA barcodes, the unique RNA barcodes, or both, to the plurality of cell treatment conditions to produce the treatment-barcode correlation. A dictionary of correlations between treatments and barcodes enables knowledge of at least one treatment a cell was exposed to for generation of an observed characteristic, structure, or function. Accordingly, in embodiments, the analyzing the plurality of subgroup samples comprises sequencing DNA barcodes and / or RNA barcodes of cells of subgroups of the plurality of subgroups to construct a barcode dictionary of associations between treatment conditions and corresponding barcodes, such that the barcode dictionary of associations comprises the treatment-barcode correlation.

[0075] In embodiments, the contacting the plurality of cells with the plurality of DNA molecules causes at least a portion of the plurality of cells to stably maintain DNA molecules of the plurality of DNA molecules. This can be achieved, in at least some embodiments, by transducing the plurality of cells with a plurality of viral particles containing a plurality of viral vectors (e.g., DNA molecules). Virus-mediated delivery of DNA is expressly described herein by way of example, however, other means of delivery of DNA into cells can be implemented without departing from the scope and spirit of the disclosure, including but not necessarily limited to transfection, electroporation, use of synthetic carriers such as nanoparticles or the like, etc.

[0076] In embodiments, the cells are alive and are not fixed or permeabilized. By using live cells, the method can help ensure that the DNA molecules are stably maintained by the cells, and the cells can be tested under various conditions for improved cell engineering or programming.

[0077] After exposing a cell of a pool to any of various cell culture treatment conditions, in embodiments, the analyzing at least the portion of the pool comprises DNA sequencing and / or RNA sequencing to determine sequences of one or more unique DNA barcodes and / or one or more unique RNA barcodes of the cell of the pool. This step helps identify which perturbation condition(s) the cell of the pool was exposed to. For example, in embodiments, the analyzing at least the portion of the pool comprises testing the cell of3915-P1319WO.UW -17-the pool for a structure and / or function, e.g., a desired or advantageous structure and / or function. Such characteristics can include, but are not limited to: an expression of a gene, a transcription of the gene, a translation of a mRNA of the gene, a transcriptome of the cell, a proteome of the cell, a level of a protein of the gene, a tertiary and / or quaternary structure of the protein, a post-translational modification of the protein, a cellular location of the protein, a function of the protein, a function of the cell, or any combination thereof. In embodiments, the cell of the pool is a T cell, and the function of the cell comprises an effector function, a cytokine secretion, a self-renewal of the cell, a cytolytic activity, an anti-infection function, an anti-cancer function, or any combination thereof.

[0078] Any of various biological, physical, biophysical, chemical, biochemical, mechanical, biomechanical, thermal, electrical, and other cell culture perturbations can be tested for cell engineering or used in the engineering of a cell. In example embodiments, the plurality of cell treatment conditions comprises a cell treatment condition comprising: a small molecule, a large molecule, a temperature, an ionic strength, a pH level, an oxygen level, a nitrogen level, a carbon dioxide level, a viscosity, an electrical potential, an electrical current, a magnetic field, an electromagnetic field, a light ray, a sound stimulation, a mechanical stimulation, an atmospheric pressure level, or any combination thereof.

[0079] In addition, while T cells can be tested and engineered for cell therapy according to example embodiments of the disclosure, the methods of the disclosure can be extended to other cell types without departing from the scope and spirit of the disclosure, including but not limited to: stem cells, progenitor cells, multipotent stem cells, retinal cells, cardiac cells, neural cells, muscle cells, skin cells, other immune cells, natural killer (NK) cells, B cells, and the like. In various embodiments, the plurality of cell treatment conditions comprises a cell treatment condition comprising: a cytokine, a growth factor, a chemoattractant, a chemorepellent, or any combination thereof.

[0080] In embodiments, the method further comprises, after pooling the plurality of subgroups and before analyzing at least the portion of the pool, culturing at least the cell of the pool in a cell treatment condition that corresponds to a physiological context within which the cell of the pool can be desired to be operable and having the one or more observed structures and / or functions, e.g., self-renewal, persistence in a tumor microenvironment, anti-tumor activities, anti-viral activities, effector functions, and the like. The cell treatment condition can comprise a biological matrix that has features that3915-P1319WO.UW -18-are consistent or correlative with the physiological context and can include a model cell, a model tissue, a model organ, and / or a model organism, in various embodiments.

[0081] In at least some embodiments, the cell treatment condition that corresponds to the physiological context can correspond to a rest state, a healthy state, a viral infection, a bacterial infection, a parasitic infection, a genetic disorder, a cancer, or any combination thereof, of a subject. For example, in embodiments, the cell treatment condition comprises an anti-CD3 agent, IL-2, an anti-CD28 agent, IL-12, or any combination thereof. In embodiments, the anti-CD3 agent comprises an anti-CD3 antibody, the anti-CD28 agent comprises an anti-CD28 antibody, or both. While these agents are disclosed herein by way of non-limiting examples, any molecule, compound, factor, drug, metabolite, vitamin, or other agent can be used with the cell treatment condition that corresponds to the physiological context, without departing from the scope and spirit of the disclosure.

[0082] As disclosed herein, T cells respond differently to various known cytokines, depending on the context, including other cell culture variables that can at least potentially impact T cell programming. Cytokines and any other cell treatment conditions can be tested, en masse and with high-throughput, using CellCode and its equivalents of the disclosure, for development of methods that are reliable and effective to engineer T cells to perform within specific physiological contexts. As such, in embodiments, a plurality of cell treatment conditions that are testable by a screening method comprises a cell treatment condition comprising a cytokine selected from the group including, but not necessarily limited to: IL-2, IL-12, IL-21, IFN-γ, IL-7, IL-15, IL-18, IFN-α, TNF-α, TGF-β, IL-10, IL-6, SCF, IL-27, IL-9, IL-25 / IL-17E, IL-17A, IL-23, IL-11, IL-1β, IL-33, IL-36γ, IL-37b, IL-4, TSLP, TNFSF14 / LIGHT, BAFF, NGF, TNFSF15 / TL1A, IL-15, and any combination thereof.

[0083] In embodiments, at least one DNA molecule of the plurality of DNA molecules is produced by a method that uses a DNA molecule comprising a polynucleotide sequence having at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity to a polynucleotide sequence selected from the group including, but not necessarily limited to: SEQ ID NOs 1-22. As would be understood by the person having ordinary skill in the art, any deviations from the expressly disclosed sequences, namely, SEQ ID NOs 1-22, can be3915-P1319WO.UW -19-made. As a non-limiting example, deviations from the disclosed sequence of SEQ ID NO:11 (MSCV_Barcode_v1) can be made, including deviations within the variable poly- n barcode region as well as those outside of it. Specifically, given the sequence (gtaatgagaattcaccggttaatacgactcactatagggccttagccgctaataggtga gcgagtagggtcgaccaagaaccgctagatgcgtcgctgtacaaatagttnnnnnnnnnn nnnnnnnntgcgagtagtcgtttgctttctcgaggccgctttaaggccggtcctagcaag gccggatccaccaattgatcg (SEQ ID NO:11)), wherein the bolded ‘n’ letters indicate the variable poly-n barcode region, variations can be made within the 18-nucleotide poly- n barcode region, as well as those outside of it. These can include any polynucleotide sequence having at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity to the polynucleotide sequence of SEQ ID NO:11.

[0084] Cells can be produced by screening methods of the disclosure as well as cell engineering methods developed at least in part with use of the screening methods, and used for any of various situations, including but not necessarily limited to cell therapy. As such, in embodiments, a cell produced by a method of the disclosure is configured for a cell therapy, a cancer cell therapy, an immunotherapy, or any combination thereof; however, other types of therapy and other disease indications can be implemented in various embodiments without departing from the scope and spirit of the disclosure.

[0085] Accordingly, in an aspect, the disclosure provides a method for engineering a T cell, the method comprising: culturing the T cell with a cell treatment condition comprising a cytokine selected from the group including, but not necessarily limited to: IL-2, IL-12, IL-21, IFN-γ, IL-7, IL-15, IL-18, IFN-α, TNF-α, TGF-β, IL-10, IL-6, SCF, IL-27, IL-9, IL-25 / IL-17E, IL-17A, IL-23, IL-11, IL-1β, IL-33, IL-36γ, IL- 37b, IL-4, TSLP, TNFSF14 / LIGHT, BAFF, NGF, TNFSF15 / TL1A, IL-15, and any combination thereof. In embodiments, the method engineers the T cell to be configured for a cell therapy, a cancer cell therapy, an immunotherapy, or any combination thereof; and the T cell is cultured in a cell treatment condition that corresponds to a physiological context within which the T cell is to be operable for the cell therapy, the cancer cell therapy, the immunotherapy, or any combination thereof.3915-P1319WO.UW -20-

[0086] In various embodiments, the cell treatment condition comprises a biological factor of the physiological context, a therapeutic agent for treatment of a disease of the physiological context, or both. In embodiments, the cell treatment condition corresponds to a rest state, a healthy state, a viral infection, a bacterial infection, a parasitic infection, a genetic disorder, a cancer, or any combination thereof, of the physiological context. In embodiments, the cell treatment condition comprises an anti-CD3 treatment, an IL-2 treatment, an anti-CD28 treatment, an IL-12 treatment, or any combination thereof. In embodiments, the cell treatment condition comprises an anti- CD3 agent, IL-2, an anti-CD28 agent, IL-12, or any combination thereof. In embodiments, the anti-CD3 agent comprises an anti-CD3 antibody, the anti-CD28 agent comprises an anti-CD28 antibody, or both.

[0087] Methods of the disclosure can be for improving structures or functions of cells, and as such, the readout or end result of a method for testing treatment conditions can include analysis of one or more structures or functions of cell, e.g., presence or absence of a desired phenotype.

[0088] In embodiments, a method for testing a plurality of treatment conditions for their ability to affect cells can be performed once, or alternatively, can be performed multiple times, e.g., a plurality of treatment steps or conditions for screening of a larger number of different treatment methods in combination and with high throughput. A barcode dictionary of associations between treatment conditions and corresponding barcodes, generated with the testing, can be stored with any suitable analog or digital means, including but not necessarily limited to one or more memory or non-transitory machine-readable storage media, one or more computational devices, one or more systems, or the like.

[0089] In embodiments analyzing the pool comprises DNA sequencing or RNA sequencing to determine sequences of one or more unique DNA barcodes or unique RNA barcodes of the cell of the pool. However, in embodiments, any molecular assay can be used as a readout, for example, an assay for transposase-accessible chromatin with high- throughput sequencing (ATAC-Seq) can be used, which is a method for determining chromatin accessibility across the genome.3915-P1319WO.UW -21-DEVICES, SYSTEMS, AND KITS

[0090] In various instances, cell treatment screening methods can result in the identification of one or more singular or combinatorial treatment conditions that give rise to a desired phenotype in a certain setting or context. For example, one or more culture conditions can be identified, based on a screen, that produce T cells with a desired level of robustness and / or anti-tumor activity across physiological contexts. This information can be stored and retrieved in electronic computer-readable storage media for use in preparation of a T cell therapy based on this information. Accordingly, the disclosure also provides a non-transitory machine-readable storage medium having stored thereon data comprising an association between a unique DNA barcode and a treatment condition and / or an observed structure and / or function of a cell or plurality of cells and one or more treatment conditions of the cell or plurality of cells. The association can include a link between the treatment conditions and the desired and / or observed phenotype, which facilitates consistent replication of cells having the phenotype. In embodiments, the non- transitory machine-readable storage medium can have stored thereon data comprising a plurality of associations between a plurality of unique DNA barcodes and a plurality of treatment conditions, for example, that relate to a plurality of screens and / or a plurality of desired phenotypes.

[0091] Computational devices (e.g., computers, desktop computers, laptop computers, tablets, smartphones, workstations, and the like) are envisioned as being part of the disclosure; the disclosure contemplates aspects and embodiments encompassing these and other computational devices. Accordingly, in an aspect, the disclosure provides a computational device comprising a non-transitory machine-readable storage medium, for example, a non-transitory machine-readable storage medium having stored thereon data comprising one or more associations between one or more unique DNA barcodes and one or more treatment conditions. These and other computational devices can be used to facilitate storage, retrieval, and analysis of volumes of experimental data and determination of improved or optimal cell perturbation conditions.

[0092] Since more than one computational device (e.g., a system of computational devices) can be used to make and use various aspects of the disclosure, in an aspect, the disclosure provides a system comprising one or more computational devices comprising one or more non-transitory machine-readable storage media having3915-P1319WO.UW -22-stored thereon, in whole or in part, data comprising one or more associations between one or more unique DNA barcodes and one or more treatment conditions.

[0093] In an aspect, the disclosure provides a non-transitory machine-readable storage medium having stored thereon a barcode-readout correlation, a treatment-barcode correlation, or both. In another aspect, the disclosure provides a computational device comprising a non-transitory machine-readable storage medium having stored thereon a barcode-readout correlation, a treatment-barcode correlation, or both. In another aspect, the disclosure provides a system comprising a computational device comprising a non- transitory machine-readable storage medium having stored thereon a barcode-readout correlation, a treatment-barcode correlation, or both.

[0094] In a further aspect, the disclosure provides a kit, comprising: a therapeutic cell, a therapeutic cell product, a DNA molecule, a composition, a cell, a plurality of cells, a non-transitory machine-readable storage medium, a computational device, a system, or any combination thereof; and an instructional material. The instructional material can be configured to instruct at least an individual in a use of the kit for: a method for parallel testing of a plurality of cell treatment conditions, a method for engineering a T cell, a method of treatment of a subject in need thereof, a method of preparation of a medicament for use in the treatment of the subject in need thereof, a method of diagnosis of a subject with a disease or disorder, a method of prognosis of the disease or disorder, or any combination thereof. The instructional material can be in any suitable form, including but not limited to print, electronic, or the like. TABLES

[0095] Table 1. Signaling contexts defined by combinations of signal 1 (S1; anti- CD3 (αCD3)), signal 2 (S2; anti-CD28 (αCD28)) and signal 3 (S3; cytokines) (Example 1), according to aspects of the present disclosure. Ph i l i l 1 23915-P1319WO.UW -23-Physiological Context S1 S2 S3

[0096] Table. xampe con ons screene n-v ro, combining physiological contexts and cytokines at a particular dose (Example 1). Base condition Cytokine Concentration Unique3915-P1319WO.UW -24-Base condition Cytokine Concentration Unique iCD3 IL2 TGFb 1 / L iCD3 IL2 TGF3915-P1319WO.UW -25-Base condition Cytokine Concentration Unique iCD3 IL2 IL1b 10 / L iCD3 IL2 IL3915-P1319WO.UW -26-Base condition Cytokine Concentration Unique iCD3 IL2 IFN 10 / L iCD3 IL2 IFN3915-P1319WO.UW -27-Base condition Cytokine Concentration Unique iCD3 / 28 IL2 TSLP 100 / L iCD3 / 28 IL2 - - -3915-P1319WO.UW -28-Base condition Cytokine Concentration Unique iCD3 / 28 IL2 TL1A 10 / L iCD3 / 28 IL2 - - - - - -3915-P1319WO.UW -29-Base condition Cytokine Concentration Unique iCD3 / 28 IL2 IFN 01 / L iCD3 / 28 IL2 IFN- - - + + + +3915-P1319WO.UW -30-Base condition Cytokine Concentration Unique iCD3 / 28 IL2 / IL12 IFN 1 / L iCD3 / 28 IL2 / IL12 + + + + + + + + + + + + + + +3915-P1319WO.UW -31-Base condition Cytokine Concentration Unique iCD3 / 28 IL2 / IL12 IL11 10 / L iCD3 / 28 IL2 / IL12 + + + + + + + + + + + + + + +3915-P1319WO.UW -32-Base condition Cytokine Concentration Unique iCD3 / 28 IL2 / IL12 IL9 10 / L iCD3 / 28 IL2 / IL12 + + + + + + + + + + +3915-P1319WO.UW -33-Base condition Cytokine Concentration Unique R IL2 TGFb 10 / L R IL2 TGF3915-P1319WO.UW -34-Base condition Cytokine Concentration Unique R IL2 IL12 10 / L R IL2 IL3915-P1319WO.UW -35-Base condition Cytokine Concentration Unique R IL 2 IL 21 10 / L R IL 2 IL L

[0097] Table 3. Example combinations of two cytokines that can be systematically evaluated for their ability to modulate therapeutic engineered T cell performance using CellCode, according to aspects of the present disclosure.3915-P1319WO.UW -36-Group Group

[0098] Table 4. Cytokine conditions. Cytokine Concentrations Manufacturer Product Number3915-P1319WO.UW -37-Cytokine Concentrations Manufacturer Product Number ®®

[0099] Table 5. Primers. Primer Sequence SEQ ID NO. Comments ry3915-P1319WO.UW -38-Primer Sequence SEQ ID NO. Comments g y- g y- g y- g y- he n3915-P1319WO.UW -39-Primer Sequence SEQ ID NO. Comments he n g y- p es3915-P1319WO.UW -40-Primer Sequence SEQ ID NO. Comments p es e e he f3915-P1319WO.UW -41-Primer Sequence SEQ ID NO. Comments f R R f d

[0100] Table 6. Perturbation conditions. Perturbation Concentration Manufacturer Product Number3915-P1319WO.UW -42-

[0101] Table 7. Index sequences. Well Name Sequence SEQ Index Reverse Index RC A A C3915-P1319WO.UW -43-Well Name Sequence SEQ Index Reverse Index RC P ID T G3915-P1319WO.UW -44-Well Name Sequence SEQ Index Reverse Index RC P ID C C C3915-P1319WO.UW -45-Well Name Sequence SEQ Index Reverse Index RC P ID T3915-P1319WO.UW -46-Well Name Sequence SEQ Index Reverse Index RC P ID A G G C3915-P1319WO.UW -47-Well Name Sequence SEQ Index Reverse Index RC P ID G A A C3915-P1319WO.UW -48-Well Name Sequence SEQ Index Reverse Index RC P ID G G C3915-P1319WO.UW -49-Well Name Sequence SEQ Index Reverse Index RC P ID C T3915-P1319WO.UW -50-Well Name Sequence SEQ Index Reverse Index RC P ID C G T G3915-P1319WO.UW -51-Well Name Sequence SEQ Index Reverse Index RC P ID C A3915-P1319WO.UW -52-Well Name Sequence SEQ Index Reverse Index RC P ID G G3915-P1319WO.UW -53-Well Name Sequence SEQ Index Reverse Index RC P ID3915-P1319WO.UW -54-Well Name Sequence SEQ Index Reverse Index RC P ID3915-P1319WO.UW -55-Well Name Sequence SEQ Index Reverse Index RC P ID3915-P1319WO.UW -56-

[0102] Table 8. H2B-mRuby gBlock®ordered from IDT. Name Sequence SEQ O.3915-P1319WO.UW -57-EXAMPLES

[0103] Example 1. CellCode, a novel functional screening approach, enables the multiplexed testing of effects of environmental perturbations, such as cytokine treatments, on T cell state and function in a pooled manner.

[0104] T cells engineered to recognize and destroy cancer cells have great potential as cancer-fighting agents against solid cancers, but are still limited in their ability to enter and eliminate tumors. This example systematically tests many immune signaling molecules, called cytokines, for their ability to alter T cell characteristics during ex vivo expansion for the purposes of enhancing cell therapy efficacy.

[0105] A novel pooled screening approach, termed CellCode, is disclosed that can be used to comprehensively evaluate effects of cytokine combinations on T cell state and tumor control after adoptive transfer, among many other applications. Environmental factors, such as signaling molecules or pharmacological inhibitors, are typically screened at high throughput in conventional multi-well plate assays; however, such approaches are not easily scaled to enable interrogation of combinations of factors, and are confined to an in vitro context. With CellCode, cells, including activated T cells, are subject to viral genetic barcoding and treatments, including cytokine treatments. Treated cells are pooled for downstream assays, and sequenced to reveal treatment history of each cell. Importantly, barcoded cells remain alive permitting highly parallel interrogation of many treatments in animal models. To facilitate the identification of synergistic combinations relevant to a range of disease contexts, and to build a resource for cytokine biology, CellCode was used to generate an atlas of single cytokine effects across different signaling contexts (FIG.7).

[0106] With their potent and far-reaching effects on multiple aspects of T cell function, cytokines can have a broader impact on different immunotherapies, if appropriately deployed in optimal combinations for a particular disease setting. However, there is a lack of a basis for the rational design of cytokine-based therapeutic strategies, as the combinatorial action of cytokines on cell function across different contexts remains poorly understood. While much is known about the ~30 cytokines that can be sensed by T cells, the vast majority of studies focus on studying single cytokines, usually within a specific physiological or disease context. Single-cell genomics is being used to compare the effects of many cytokines, but these efforts profile only single cytokines in a specific context (i.e. injection into healthy mice). The results herein (FIGs 6, 8-10) demonstrate3915-P1319WO.UW -58-that context matters, and so the findings from prior studies cannot necessarily be extrapolated for any expectation of results in other contexts. Many cytokines have distinct and even opposing effects on immune cell function, depending on what other cytokines and signaling factors are present in the extracellular milieu, even for a single receiver cell type.

[0107] Thus, to lay a foundation for rational design of cytokine-enhanced T cell immunotherapies, an atlas of combinatorial, context-dependent cytokine effects on CD8 T cell transcriptome state and function can be generated. Here, CellCode is envisioned to be used to test the effect of ex vivo activation of CD8 T cells with all ~28 responsive cytokines singly or in combination under a number of defined signaling environments, giving rise to a total of ~2 x 103conditions (FIG. 1). Results are read out, in a pooled manner, for the impact of these context-dependent cytokine treatments on T cell transcriptomic state, measured using single-cell RNA-sequencing; effector function, measured by the ability to secrete cytokines after re-stimulation; and self-renewal potential, measured by persistence of single barcoded T cell clones and by expression of TCF1 (Tcf7), a transcription factor important for memory self-renewal. Using these genomic and functional data, the transcriptomic programs elicited by all cytokines perceived by the T cell can be defined, and the impact of these cytokine-driven programs on T cell fitness and function can be determined. In addition, these results help understanding of how these programs are impacted due to interactions with other cytokines or signaling context.

[0108] The atlas of cytokine effects on CD8 T cells disclosed herein can define – with an unprecedented degree of completeness – how cytokines work together to control CD8 T cell programming and function within rigorously defined environmental contexts. From a basic immunology standpoint, such an atlas empowers a bottom-up understanding of how the complex cytokine milieu present in vivo impacts T cell state and function, providing a starting point for predicting complex system-level responses of the immune system from signaling responses of individual cells. From a therapeutic standpoint, such an atlas facilitates the development of cytokine-based strategies for boosting engineered T cell function in diverse settings. For instance, given a specific tumor setting with a particular cytokine milieu, such an atlas enables a practitioner to predict cytokine combinations that would most strongly enhance tumor-infiltrating lymphocyte effector3915-P1319WO.UW -59-function and / or persistence, and would thus be potential candidates for intratumoral administration and / or expression by tumor-targeting engineered T cells.

[0109] Assays measuring effects of environmental perturbations on living cells, including cytokine treatments, are difficult to scale because each perturbation requires its own physically separate experiment. Through current state of the art methods like sciPlex, which uses nuclear hashing with RNA barcodes, it is possible to pool cells from thousands of individual conditions for single cell RNA sequencing. However, in sciPlex, cells are fixed before pooling, preventing any pooled analyses that require living cells, such as functional assays and in vivo adoptive transfers.

[0110] To overcome these limitations, CellCode, a method that uses viral barcoding of live cells to encode thousands of treatment conditions, is disclosed herein. Unlike sciPlex, the barcodes are written into each cell’s genome and expressed, meaning that live cells can be pooled and assayed en masse. This unique capability is leveraged to measure the effect of hundreds of different conditioning treatments on T cell transcriptional state and phenotypic traits. These first-of-their-kind examples are only possible because of CellCode and the aspects and embodiments of this disclosure.

[0111] Materials and Methods:

[0112] Methods

[0113] GGv2.4 Barcode Library Cloning

[0114] Unless otherwise indicated, all PCR reactions were carried out using Q5®polymerase (New England Biolabs, Inc. (NEB®) #M0491) in a 50 µL reaction and all Gibson Assembly®reactions were carried out using NEBuilder®HiFi DNA Assembly MasterMix (NEB®#E2621) in a 10 µL reaction. All primers and gBlocks®were ordered from Integrated DNA Technologies, Inc. (IDT).

[0115] The plasmid backbone carrying the MSCV viral sequences was obtained. To prepare MSCV_H2B-mRuby, this plasmid was cut with MfeI (NEB®#R3589) and MluI-HF (NEB®#R3189) and the resultant fragment was Gibson-assembled with a H2B- mRuby gBlock®ordered from IDT (Table 8; SEQ ID NO:76) to generate MSCV_H2B- mRuby. The resultant plasmid was PCR reacted with SP_130 and SP_132 (Table 5), and the corresponding fragment was Gibson-assembled with a WPRE fragment PCR reacted from LentiGuide-Puro (Addgene #52963) using primers SP_128 and SP_129 (Table 5) to generate MSCV_H2B-mRuby-WPRE. This plasmid was cut with EcoRI-HF (NEB®#R3101) and BamHI-HF (NEB®#R3136) and Gibson-assembled with the ultramer3915-P1319WO.UW -60-MSCV_GoldenGateSites_v2 (Table 5) to generate MSCV_H2B-mRuby-WPRE- GGsites_v2, which has the BbsI sites used for GoldenGate assembly of the barcode library v2.4 in the correct orientation.

[0116] For the construction of library v2.4, the ultramer MSCV_GGv2_Template_v4 (Table 5) was PCR reacted with SP_184 and MSCV_GGv2_Rev (Table 5) for 6 cycles with an annealing temperature of 58 °C to generate a high-complexity barcoded fragment with BbsI sites in the complementary orientation for assembly. 50 ng of this PCR fragment was mixed with 500 ng of plasmid MSCV_H2B-mRuby-WPRE-GGsites_v2 in the presence of T4 ligase (NEB®#M0202T) and BbsI-HF (NEB®#R3539) in eight 25 µL reactions each and cycled between 5 minutes at 37 °C and 16 °C thirty times in GoldenGate assembly before pooling and concentrating into 15 µL. 1 µL of that assembled ligation was transformed into 12-14 cuvettes of 25 µL NEB®10-beta electrocompetent E coli (NEB®#C3020K) each. After pooling, transformed cells were plated onto three large 25 cm square LB-agar with 100 µg / mL carbenicillin plates and grown at 30 °C overnight. Each plate was scraped and maxiprepped (Zymo Research (Zymo) #D4203) to generate one library portion. This procedure was repeated four times to generate twelve portions of the MSCV_GGv2.4_BC_Library.

[0117] v1 Barcode Library Cloning

[0118] To generate the first iteration of the barcode library for the pilot experiments, the ultramer MSCV_Barcode_v1 was annealed with SP_140 in CutSmart buffer and then Klenow fragment (NEB®#0212) and dNTPs were added for double stranded fill-in. 10 ng of MSCV_H2B-mRuby-WPRE (above) was PCR reacted using SP_175 and SP_176 (Table 5) and then Gibson-assembled with this dsDNA barcode- containing fragment in a 40 µL 0.1 pmol scale assembly which was subsequently concentrated. That concentrate was transformed into NEB®10-beta electrocompetent E. coli as above and grown in three 150 mL LB liquid cultures containing 100 µg / mL carbenicillin at 30 °C shaking overnight. Each culture was maxiprepped (Zymo #D4203) to generate one library portion, for three library portions total.

[0119] Barcode Virus Preparation

[0120] To prepare barcode virus, twelve 10 cm plates were plated with 1M HEK 293T cells each and then transfected after 3-4 days of growth when ~50% confluent using 25.5 µL of FuGENE®6 reagent (Promega), 2.55 µg of pCL-Eco (Addgene #12371), and3915-P1319WO.UW -61-5.95 µg of the corresponding portion of the barcode library v2.4. After replacing media the next day, viral supernatant was collected at ~60 hours, filtered using a 0.45 µm filter, and then all twelve supernatants were mixed and used for transduction.

[0121] Barcode Amplification from gDNA and Amplicon Sequencing

[0122] T-cell pellets collected either at sampling or after pooling were lysed in a lysis buffer containing 30 mM Tris, 10 mM EDTA, and 0.4 mg / mL proteinase K (Qiagen®#19157) shaking at 56 °C for 1 hour, followed by a 94 °C inactivation step for 15 minutes. AMPure XP purification (Beckman Coulter, Inc. (Beckman Coulter) #A63882) was performed at a 1 vol beads / 1 vol lysate ratio to concentrate lysate. For the pilot experiment using barcode library v1, the first PCR step was performed using MSCV_F_v1 and MSCV_R_v1 (Table 5) primers and for the cytokine screen experiment using barcode library v2.4 the first PCR step was performed using MSCV_hU6_F_v2 and MSCV_R_v1 (Table 5) primers. After amplification, a second AMPure XP purification was performed using a ratio of 1.4 vol beads / 1 vol reaction. A second indexing PCR using primers PTEN_R_seq_Na (N between 1 to 48) and Custom_FM (M between 1 to 36) was performed (see Table 7 for index sequences), followed by pooling and 0.8 vol beads / 1 vol reaction ampure XP purification to generate the final libraries. Barcode amplicon libraries were sequenced using a 27 (read 1) - 8 (index 1) - 8 (index 2) - 27 (read 2) configuration on an P350 cycle kit (Illumina®#20046810) on a NextSeq®2000 machine.

[0123] Mice

[0124] All animal use was in accordance with the Institutional Care and Use Committee at the University of Washington, approved protocol #4397-01. P14 mice were purchased from The Jakson Laboratory (Jackson labs), Tcf7-YFP mice were previously described. All mice were 8-16 weeks of age, both male and female mice were utilized for experiments.

[0125] CD8 T cell isolation

[0126] Spleens were extracted from Tcf7-YFPxP14 mice and smashed between rough glass slides to generate a single cell suspension, which was filtered over 50 µm nylon mesh. Cells were centrifuged at 300 g for 5 minutes and resuspended in red blood cell (RBC) lysis buffer (1 mM EDTA, 10 mM NaHCO3, 150 mM NH4Cl) for 3-5 minutes at room temperature, and quenched with HBH (Hank’s Balanced Salt Solution (HBSS, Gibco®), 0.5% Bovine Serum Albumin (BSA, VWR International, LLC3915-P1319WO.UW -62-(VWR®)), 10 mM HEPES, pH 7.4). Cells were subsequently centrifuged at 300 g for 5 minutes and resuspended in Fc blocking buffer (2.4G2 supernatant in HBH) for 15-30 minutes on ice. CD8 T cells were isolated from splenocytes using the CD8a+T cell isolation kit (Miltenyi Biotec #130-104-075) following the manufacturer’s instructions.

[0127] CD8 T cell activation and transduction

[0128] One day prior to activation (day -1), plates were coated with anti-CD3e (Cytek®#40-0031-U500) and anti-CD28 in PBS (Cytek®#40-0281-U100) at 1 µg / mL and 0.5 µg / mL respectively. On the day of stimulation (day 0), coated 24-well plates were rinsed 2x with PBS and CD8 T cells were plated at 1M cells / mL in 500 uL of T cell medium (TCM) (Roswell Park Memorial Institute Medium (RPMI) 1640 + L-Glutamine (Gibco®), 10% heat inactivated FBS (VWR®), 1% Non-essential amino acids (Gibco®), 1% Sodium Pyruvate (Gibco®), 2% HEPES (Gibco®), 1% Pen-Strep-Glutamine (Gibco®) and 50 µM 2-Mercaptoethanol (BME). Cells were centrifuged onto the coated plates at 50 g for 1 minute to allow for adhesion.

[0129] Cells were incubated for 22 hours at 37 °C, 5% CO2 prior to transduction. Barcode sublibraries were mixed in equal amounts to generate a supermix, along with 2x the final desired concentration of polybrene, IL-2, and BME. 500 µL of virus was added to each well of the 24 well plate for a final concentration of 1x polybrene (4 µg / mL), IL-2 (10 ng / mL) and BME (50 µM). Cells were spinfected at 30 °C, 2000 g (no acceleration, no brake) for 60 minutes, then incubated at 37 °C, 5% CO2 for 4 hours.

[0130] Large scale ex vivo screen

[0131] Cells were pooled, centrifuged at 300 g for 7 minutes, and washed twice with TCM containing no BME or cytokines. Cells were resuspended in TCM at 0.3x106 / mL and 100 uL (0.03x106cells) were seeded into 96 well plates already containing 2x cytokine and BME, for a final concentration of 1x. Individual cytokine media were prepared at 4x in TCM, and mixed 50 / 50 with 4x base medium containing 4x BME and 4x IL-2 or IL-2+IL / 12. Cytokine manufacturers and product numbers are listed in Table 4. Where applicable, plates were coated with anti-CD3e only or anti-CD3 and anti-CD28 as described above and rinsed 2x prior to cell seeding. Cells not requiring continued stimulation were seeded into uncoated tissue culture treated 96 well plates. 2.5 days after initial activation (1.5 days after spinfection) 75% of the cells were sampled for barcode sequencing and centrifuged at 700 g for 5 minutes, rinsed 1x with HBH, centrifuged again at 700 g for 5 minutes, and flash frozen in liquid nitrogen prior to3915-P1319WO.UW -63-storage at -80 °C. The remaining cells were topped off with fresh TCM containing the appropriate cytokines and base medium and cultured until day 4 at 37 °C, 5% CO2. On day 4, 25 µL of culture from one replicate of each condition was sampled and counted using an Attune®NxT flow cytometer (Thermo®). Cells from each replicate were subsequently pooled by plate for single cell RNA sequencing (scRNAseq, see below), ranging from 2,000-12,500 cells per condition being pooled. The remaining cells were pooled separately by replicate (without normalization by cell number). 25% of the pool was sampled for barcode sequencing, 33% of the pool was used for sorting on Tcf7-YFP, and the remaining cells were used for pooled follow-up perturbations.

[0132] Extracellular staining, fluorescence-activated cell sorting (FACS), and flow cytometry

[0133] Sorting was performed on a FACSAriaTMIII (Becton, Dickinson and Company (BD), UW Pathology Flow Core). Analyses were performed in FlowjoTM(Treestar, Inc.). Each pool for scRNAseq was resuspended in Fc blocking buffer and stained with 1 uL of hashtag antibody (Biolegend®, TotalSeqTMB Mouse Hashtag 1-6 #:155831, 155833, 155835, 155837, 155839, 155841) for 15-30 minutes on ice. Prior to sorting, cells were resuspended in 100 ng / mL DAPI (Abcam®) in HBH. Live, barcoded cells were sorted as Dapi-Mruby+and taken immediately for processing for 10x sequencing (see below). For Tcf7-YFP sorting, each replicate was resuspended in HBH and sorted based on live (FSC / SSC gated), mRuby+into quartiles based on YFP expression.

[0134] For other extracellular stains, cells were resuspended in Fc blocking buffer and incubated on ice for 10-15 minutes, then stained with the following antibodies: anti- CD366 / Tim-3 (Biolegend, Inc. #119706, APC, 1:100), anti-PD-1 (Thermo #12-9981-82, PE eBioscienceTM, 1:100), anti-CD25 (Biolegend, Inc. #102029, PerCP-Cy5.5 1:1200), anti-CD62L (Thermo #47-0621-82, APC-eFluorTM780, eBioscienceTM, 1:1200) for 15- 30 minutes on ice. Cells were resuspended in HBH and analyzed on an AttuneTMNxT flow cytometer.

[0135] Pooled ex vivo assays

[0136] Replicates were pooled separately as described and split into 3 follow-up perturbations: (1) no TCR stimulation with low IL-2 (1 ng / mL), IL-7 (5 ng / mL) and IL- 15 (50 ng / mL). (2) + TCR stimulation (anti-CD3 (1 µg / mL) coating only) + IL-2 (10 ng / mL) and +TCR stimulation + Costimulation (anti-CD3 (1 µg / mL) and anti-CD28 (0.53915-P1319WO.UW -64-µg / mL) coating). Plates were coated as described in CD8 T cell activation and where applicable, cells were transferred to freshly coated plates on day 4, day 6, and day 9. At day 4, day 6, day 9, and day 13, cells were counted and sampled for DNA sequencing, then resuspended in fresh 1x cytokine medium and transferred to a new culture plate. On day 13, all cells in conditions 2 and 3 were saved for DNA sequencing. Cells in condition 1 only were cultured until day 17.

[0137] Single cell sequencing

[0138] Sorted cells were resuspended in PBS + 1% BSA and loaded into 8 separate 10x Chromium Next GEM Single Cell 3’ HT v3.1 reactions (10x Genomics, Inc.) at 45,000 cells / reaction. Then the 10x protocol for HT v3.1 reactions was followed. A small portion of the unfragmented cDNA from supernatant and bead fractions was taken for amplification of RNA barcodes via a three-step PCR (primers in Table 5). Supernatant fraction unfragmented cDNA captured via captureseq1 was PCR-ed in a two- step process: in the first step with primers F_INNER_NR2_v3 and NR1_P5e and in the second step with a NexteraTMindex primer and NR1_P5e. Bead fraction unfragmented cDNA captured via polydT priming was PCR-ed in a three-step process: in the first step with primers CS2_RevComp_PCR1 and TR1_PCR1, second step with primers F_INNER_NR2_v3 and TR1_P5, and the third step with a NexteraTMindex primer and TR1_P5. (Table 5) RNA barcode amplicon PCRs were annealed at 65 °C except the indexing step which was annealed at 72 °C and were conducted using Kapa®HiFi polymerase (F. Hoffmann-La Roche Ltd. (Roche) KK2601). Transcriptome and barcode libraries were sequenced using a 28 (read 1) - 8 (index 1) - 8 (index 2) - 94 (read 2) configuration on an Illumina P3 100 cycle kit (Illumina, Inc. #20040559) on the NextSeqTM2000 instrument.

[0139] Intracellular cytokine staining

[0140] Cells were counted and 0.1x106cells were transferred to a round bottom 96 well plate and resuspended in TCM containing 1x Cell stimulation cocktail (Thermo / eBioscience #00-4970-93). Cells were incubated at 37°C, 5% CO2 for 1 hour, and then 500x Protein Transport Inhibitor (Thermo / eBioscienceTM#00-4980-93) was added to a final concentration of 1x. Cells were incubated at 37 °C, 5% CO2 for an additional 4 hours, then stained with Zombie YellowTM(BioLegend®#00-4980-93) at 1:1,000 dilution for 15 minutes at room temperature (protected from light). Cells were centrifuged at 300 g for 5 minutes and resuspended in Fc blocking buffer and incubated3915-P1319WO.UW -65-for 10-15 minutes on ice, then fixed in 4% paraformaldehyde (Electron Microscopy Sciences) in PBS for 15 minutes on ice. Cells were rinsed 2x and stored in HBH 4°C before processing. Cells were subsequently centrifuged at 300 g for 5 minutes at 4 °C, then permeabilized for 15 minutes in 1x Perm / Wash buffer (BD #554714) on ice. Cells were washed 2x in 1x Perm / Wash buffer, then resuspended in the following antibodies at 1:100 dilution in Perm / Wash buffer: anti-Granzyme B (BioLegend®#515407, Pacific BlueTM), anti-IFN-gamma (BioLegend®#505850, APC-Cy7), anti-TNF-alpha (BioLegend®#506308, APC), and anti-IL-2 (BioLegend®#503840, PE / DazzleTM594).

[0141] Cytokines

[0142] Methods

[0143] Pilot ex vivo screen

[0144] One day prior to stimulation (day -1) plates were coated with 2 µg / mL anti-CD3 (Cytek Biosciences, Cytek®) and 1 µg / mL anti-CD28 (Cytek®). CD8 T cell transduction was performed as described in Methods with the addition of 1 ng / mL IL-12 for the initial CD8 T cell activation and priming. After transduction, cells were pooled, rinsed 1x and plated at 0.190x106cells / well in 24 well plates with and without continued TCR stimulation and co-stimulation, and with the perturbation of interest, listed in Table 6. Small molecules were prepared in DMSO prior to addition to culture medium. On day 2.5, 75% of the volume from each well was sampled for barcode sequencing. Sampled cells were centrifuged at 500 g for 5 minutes, washed 1x with HBH, centrifuged at 500 g for 5 minutes, and flash frozen in liquid nitrogen prior to storage at -80 °C. The remaining 25% of the cells were brought up to full volume with the appropriate culture media and incubated at 37 °C, 5% CO2until day 4. On day 4, cells were counted using the Attune®NxT and pooled based on cell number, then sorted based on FSC vs SSC for live, single, mRuby+cells for scRNAseq. The mRuby+cells were then gated on Tcf7-YFP levels by quartiles and flash frozen for DNAseq for barcode capture. The remaining cells were seeded at 0.150x106cells / mL with and without continued TCR stimulation and costimulation (2 µg / mL anti-CD3, 1 µg / mL anti-CD28) and with and without IL-2 (10 ng / mL) in the presence of IL-7 (5 ng / mL) and IL-15 (50 ng / mL). On day 7, 50% of the cells were sampled, washed 1x and flash frozen for DNAseq. The remaining 50% were replenished with the appropriate cytokine medium and cultured until day 8 and frozen for DNAseq. Example 2. Human T-cells with Lentiviral Barcode Library.3915-P1319WO.UW -66-

[0145] A lentiviral barcode library is prepared using a GoldenGate cloning scheme as described in the methods. The viral vector contains the barcode library and a fluorescent marker, with or without a chimeric antigen receptor (CAR). The human T- cells are purified from PBMC and can be activated with aCD3 / 28 beads, infected with the barcode virus, and split into conditions before division. Each well can include cytokines, synthetic cytokines, small molecules, or any other conditions which will or may influence T-cell division, fate commitment, or persistence. Cells are sampled and barcodes amplified into libraries which are then sequenced via next-generation sequencing. Cells are later pooled and can be 1) immediately sequenced to determine the effect of each perturbation on cell numbers; 2) stained and sorted for any intra- or extracellular markers; 3) exposed to follow-up perturbations and then sequenced to assess treatment conditions for persistence / dropout; 4) input into any genomic assay where RNA / DNA barcodes can be captured; or 5) adoptively transferred into a model organism. This approach can be used to evaluate different production strategies for engineered human T-cells which are used in human therapies, and is compatible with integration into current therapeutic protocols for preparing engineered T-cells. Example 3. CellCode optimization of stem-cell differentiation using non-viral barcode libraries.

[0146] Site-specific recombinases like phiC31 or Bxb1 can be used to integrate DNA cargo into cells containing a transgenic “landing pad” and one or more enzymes, such as piggybac transposase, can be used to integrate DNA cargo randomly into the genome of cells. CRISPR / Cas9 or another DNA editing method can also be used to knock-in DNA sequences into a safe-harbor locus where transgene expression is maintained without effects on other cellular genes. The CellCode barcode plasmid can contain sequences for binding of the recombinase / transposase and integration into the genome or homology arms for CRISPR / Cas9 knock-in into a safe-harbor locus, a barcode library prepared using GoldenGate cloning or other high-complexity-enabling methods, a fluorescent marker, and can also have a drug selection marker like the puromycin resistance gene. Then embryonic stem (ES) cells, induced pluripotent stem (iPS) cells, or any other cell line can be transfected with the barcode plasmid and a plasmid expressing the recombinase, integrase, or Cas9 and split into conditions before division.

[0147] An advantage of this virus-free system for integrating DNA barcodes expressed as RNA is compatibility with a wider variety of RNA expression methods,3915-P1319WO.UW -67-including circular RNA barcodes which have the advantage of high steady-state levels in the cell and thus higher capture efficiency. Once plated, stem cells can be treated with many medias / small molecules / ligands to induce differentiation, and then sampled and repooled. This procedure can be repeated for integration of multiple rounds of barcodes into each cell, so that many such “condition timecourses” are tested and read out via identification with a combination of barcodes. After pooling, cells can be subject to genomic assays to determine differentiation state or sorted for marker genes indicating a desired cell type. Combinations of RNA or DNA barcodes captured in the cell are interpreted as a combination of conditions over split-pool cycles. CellCode can enable the multiplexed optimization of protocols for differentiating stem cells into any desired cell type. Example 4. Testing cell function in organoid systems not amenable to traditional high throughput screening, such as embryonic or neural organoids.

[0148] After CellCode barcode libraries are virally or non-virally integrated into stem cells, those cells can be differentiated into multicellular organoids which are models used to study human disease or engraftable therapies. Conditions used to test organoid production can be tested in multiplex before pooling followed by single cell genomic assays or sorting with barcode capture after pooling, with barcodes mapping to conditions indicating performance in production of desired cell types. Alternatively, chimeric organoids formed from a plurality of conditions can be generated after pooling and then transplanted into a model organism for evaluation. Cells that remain alive, acquire function, and / or integrate into tissues of the model organism are desired. Those cells can be assayed, barcodes identified and then mapped back to pre-treatment conditions. Example 5. CellCode used to screen combinations of genetic and chemical perturbations.

[0149] Viral or non-viral barcode libraries can be prepared via GoldenGate cloning containing both random barcodes and open reading frame (ORF) transgenes or guide RNAs. Guide RNA expression in a system expressing CRISPR / Cas proteins enables targeting cellular genetic sequences for knock-out, knock-down or activation.

[0150] Thus, CellCode enables combinatorial screens in T-cells or other cells that combine both cytokine / small-molecule perturbations and genetic engineering for therapeutic purposes.3915-P1319WO.UW -68-TERMINOLOGY

[0151] The complete disclosure of all patents, patent applications, and publications, and electronically available material cited herein are incorporated by reference in their entirety. Supplementary materials referenced in publications (such as supplementary tables, supplementary figures, supplementary materials and methods, and / or supplementary experimental data) are likewise incorporated by reference in their entirety. In the event that any inconsistency exists between the disclosure of the present application and the disclosure(s) of any document incorporated herein by reference, the disclosure of the present application shall govern. The foregoing detailed description and examples have been given for clarity of understanding only. No unnecessary limitations are to be understood therefrom. The disclosure is not limited to the exact details shown and described, for variations obvious to one skilled in the art will be included within the disclosure defined by the claims.

[0152] The description of embodiments of the disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. While the specific embodiments of, and examples for, the disclosure are described herein for illustrative purposes, various equivalent modifications are possible within the scope of the disclosure.

[0153] Specific elements of any foregoing embodiments can be combined or substituted for elements in other embodiments. Moreover, the inclusion of specific elements in at least some of these embodiments can be optional, wherein further embodiments can include one or more embodiments that specifically exclude one or more of these specific elements. Furthermore, while advantages associated with certain embodiments of the disclosure have been described in the context of these embodiments, other embodiments can also exhibit such advantages, and not all embodiments need necessarily exhibit such advantages to fall within the scope of the disclosure.

[0154] As used herein, the term “DNA barcode” refers to a DNA form of a barcode, i.e., barcode sequence having DNA nucleotide bases. “RNA barcode” refers to an RNA form of the barcode, i.e., barcode sequence having RNA nucleotide bases. A large number of unique DNA barcodes on DNA molecules of the disclosure can be efficiently generated, by way of non-limiting example, using Golden Gate Cloning (also known as Golden Gate assembly), a molecular cloning method that allows one to simultaneously and directionally assemble multiple DNA fragments into a single piece3915-P1319WO.UW -69-using Type IIS restriction enzymes and T4 DNA ligase. However, other methods can be used to generate a large number of unique DNA barcodes, without departing from the scope and spirit of the disclosure.

[0155] As used herein, the term “treatment-barcode correlation” includes one or more correlations of a barcode dictionary of associations between treatment conditions and corresponding barcodes, e.g., a condition-barcode map. With such a dictionary, if a barcode is known, a corresponding treatment can be identified by referencing the dictionary.

[0156] As used herein, the term “barcode-readout correlation” includes one or more correlations between a readout or observed experimental result with a barcode of a cell that produced the readout or observed experimental result. With such a correlation, if a barcode is known for the readout, the readout can be linked to a treatment with use of the barcode-readout correlation and a treatment-barcode correlation.

[0157] As used herein, the term “agent” as used in “anti-X agent” and similar terms, refers to a molecule that has a structure and function that is antagonistic to at least one structure or function of the element “X” (e.g., an anti-CD3 agent is antagonistic to at least one structure or function of CD3).

[0158] As used herein, the term “antibody” collectively refers to immunoglobulins or immunoglobulin-like molecules including by way of example and without limitation, IgA, IgD, IgE, IgG and IgM, combinations thereof, and similar molecules produced during an immune response in any vertebrate, for example, in mammals such as humans, goats, rabbits and mice, as well as non-mammalian species, such as shark immunoglobulins. The term “antibody” includes intact immunoglobulins and “antibody fragments” or “antigen binding fragments” that specifically bind to a molecule of interest (or a group of highly similar molecules of interest) to the substantial exclusion of binding to other molecules (for example, antibodies and antibody fragments that have a binding constant for the molecule of interest that is at least 103M−1or greater, at least 104M−1or greater or at least 105M−1or greater than a binding constant for other molecules in a biological sample). The term “antibody” also includes genetically engineered forms of intact antibodies or antibody fragments such as chimeric antibodies, humanized antibodies (e.g., humanized murine antibodies), multispecific antibodies (whether heteroconjugate or fusion proteins; e.g., bispecific antibodies), and single chain antibodies (e.g., single chain Fvs (scFvs)), diabodies, minibodies, and nanobodies. The3915-P1319WO.UW -70-term “antibody” is thus used expansively to include any protein that comprises an antigen-binding site and is capable of binding to its antigen.

[0159] In typical variations, an antibody comprises at least a light chain or heavy chain immunoglobulin variable region which specifically recognizes and binds an epitope of an antigen. In embodiments, an antibody is composed of both a heavy chain and a light chain, each of which has a variable region, termed the variable heavy (VH) region and the variable light (VL) region.

[0160] Typically, an intact immunoglobulin has heavy (H) chains and light (L) chains interconnected by disulfide bonds. There are two types of light chain, lambda (λ) and kappa (κ). There are five main heavy chain classes (or isotypes) which determine the functional activity of an antibody molecule: IgM, IgD, IgG, IgA and IgE. Each heavy and light chain contains a constant region and a variable region, (the regions are also known as “domains”). In combination, the heavy and the light chain variable regions specifically bind the antigen. Light and heavy chain variable regions contain a “framework” region interrupted by three hypervariable regions, also called “complementarity-determining regions” or “CDRs.” The extent of the framework region and CDRs have been defined; the Kabat database is now maintained online. The sequences of the framework regions of different light or heavy chains are relatively conserved within a species. The framework region of an antibody, that is the combined framework regions of the constituent light and heavy chains, largely adopt β-sheet conformation and the CDRs form loops which connect, and in some cases form part of, the β-sheet structure. Thus, framework regions act to form a scaffold that provides for positioning the CDRs in correct orientation by inter-chain, non-covalent interactions.

[0161] The CDRs are primarily responsible for binding to an epitope of an antigen. The CDRs of each chain are typically referred to as CDR1, CDR2, and CDR3, numbered sequentially starting from the N-terminus, and are also typically identified by the chain in which the particular CDR is located. Thus, a VHCDR3 is located in the variable domain of the heavy chain of the antibody in which it is found, whereas a VLCDR1 is the CDR1 from the variable domain of the light chain of the antibody in which it is found. Antibodies that bind IFN-γ or IL-6 will have specific VHand / or VLregion sequences, and thus specific CDR sequences for the antigen to which the antibody binds. Antibodies with different specificities (i.e., different combining sites for different antigens) have different CDRs. Although it is the CDRs that vary from antibody to3915-P1319WO.UW -71-antibody, only a limited number of amino acid positions within the CDRs are directly involved in antigen binding. These positions within the CDRs are called specificity determining residues (SDRs).

[0162] The term “antibody” is further intended to encompass digestion fragments, specified portions, derivatives, and variants thereof, including antibody mimetics or comprising portions of antibodies that mimic the structure and / or function of an antibody or specified fragment or portion thereof, including single chain antibodies and fragments thereof. Examples of binding fragments encompassed within the term “antigen binding portion” of an antibody include a Fab fragment, a monovalent fragment consisting of the VL, VH, CLand CHdomains; a F(ab′)2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; a Fd fragment consisting of the VHand CHdomains; a Fv fragment consisting of the VLand VHdomains of a single arm of an antibody, a dAb fragment, which consists of a VHdomain; and an isolated complementarity determining region (CDR). Furthermore, although the two domains of the Fv fragment, VLand VH, are coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VLand VHregions pair to form monovalent molecules (known as single chain Fv (scFv)). Single chain antibodies are also intended to be encompassed within the term “fragment of an antibody.” Any of the above-noted antibody fragments can be obtained using molecular biological techniques, and the fragments can be screened for binding specificity and neutralization activity in the same manner as are intact antibodies.

[0163] “Antibody fragments” or “antigen binding fragments” include proteolytic antibody fragments (such as F(ab′)2 fragments, Fab′ fragments, Fab′-SH fragments, and Fab fragments), recombinant antibody fragments (such as sFv fragments, dsFv fragments, bispecific sFv fragments, bispecific dsFv fragments, F(ab)′2 fragments, single chain Fv proteins (“scFv”), disulfide stabilized Fv proteins (“dsFv”), diabodies, and triabodies, and camelid antibodies. An scFv protein is a fusion protein in which a light chain variable region of an immunoglobulin and a heavy chain variable region of an immunoglobulin are bound by a linker, while in dsFvs, the chains have been mutated to introduce a disulfide bond to stabilize the association of the chains.

[0164] As used herein, the term “antibody derivative” is intended to encompass molecules that bind an epitope as defined herein and which are modifications or3915-P1319WO.UW -72-derivatives of an isolated antibody. Derivatives include, but are not limited to, for example, bispecific, heterospecific, trispecific, tetraspecific, multispecific antibodies, diabodies, chimeric, recombinant, and humanized. As used herein, the term “bispecific molecule” is intended to include any agent, e.g., a protein, peptide, or protein or peptide complex, which has two different binding specificities. As used herein, “multispecific molecule” or “heterospecific molecule” is intended to include any agent, e.g., a protein, peptide, or protein or peptide complex, which has more than two different binding specificities. As used herein, the term “heteroantibodies” refers to two or more antibodies, antibody binding fragments (e.g., Fab), derivatives thereof, or antigen binding regions linked together, at least two of which have different specificities.

[0165] The term “antibody variant” is intended to include antibodies produced in a species other than a rabbit. It also includes antibodies containing post-translational modifications to the linear polypeptide sequence of the antibody or fragment. It further encompasses fully human antibodies.

[0166] As used herein, the term “antigen” refers to a compound, composition, or substance that can be specifically bound by the products of specific humoral or cellular immunity, such as an antibody molecule or T-cell receptor. Antigens can be any type of molecule including, for example, haptens, simple intermediary metabolites, sugars (e.g., oligosaccharides), lipids, and hormones as well as macromolecules such as complex carbohydrates (e.g., polysaccharides), phospholipids, and proteins. Common categories of antigens include, but are not limited to, protein-based biological factors, cytokines, viral antigens, bacterial antigens, fungal antigens, protozoa and other parasitic antigens, tumor antigens, antigens involved in autoimmune disease, allergy and graft rejection, toxins, and other miscellaneous antigens.

[0167] As used herein, “binding affinity” refers to the tendency of one molecule to bind (typically non-covalently) with another molecule, such as the tendency of a member of a specific binding pair for another member of a specific binding pair. A binding affinity can be measured as a binding constant, which binding affinity for a specific binding pair (such as an antibody / antigen pair) can be at least 1×10−5M, at least 1×10−6M, at least 1×10−7M, at least 1×10−8M, at least 1×10−9M, at least 1×10−10M, at least 1×10−11M or at least 1×10−12M. Binding affinity can be calculated by a modification of the Scatchard method, an antigen / antibody dissociation rate, or a competition radioimmunoassay. A high binding affinity for an antibody / antigen pair can3915-P1319WO.UW -73-be at least about 1×10−8M, at least about 1.5×10−8M, at least about 2.0×10−8M, at least about 2.5×10−8M, at least about 3.0×10−8M, at least about 3.5×10−8M, at least about 4.0×10−8M, at least about 4.5×10−8M, or at least about 5.0×10−8M.

[0168] A composition of the disclosure can be formulated as a pharmaceutical composition. As used herein, “pharmaceutical composition” can be a cell therapy or medication and refers to a composition that includes at least one pharmacologically active cell or compound in combination with a buffer, a pharmaceutical excipient, a surfactant, a salt, a solvate, a lipid, a phospholipid, a carrier, a diluent, or any combination thereof that preserves and configures the at least one pharmacologically active cell or compound for storage, transport, and pharmacologically activity upon administering the pharmaceutical composition to a subject.

[0169] As used herein, “administering” refers to the physical introduction of a composition comprising an agent, such as a therapeutic cell or agent, to a subject, using any of the various methods and delivery systems known to those skilled in the art. Example routes of administration for antibodies include intravenous, intraperitoneal, intramuscular, subcutaneous, spinal, or other parenteral routes of administration, for example by injection or infusion. The phrase “parenteral administration” as used herein means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intraperitoneal, intramuscular, intraarterial, intrathecal, intralymphatic, intralesional, intracapsular, intraorbital, intracardiac, intradermal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion, as well as in vivo electroporation. Alternatively, an antibody described herein can be administered via a non-parenteral route, such as a topical, epidermal, or mucosal route of administration, for example, intranasally, orally, vaginally, rectally, sublingually, or topically. Administering can also be performed, for example, once, a plurality of times, and / or over one or more extended periods.

[0170] As used herein, the terms “antagonize”, “inhibit”, and “block” are used interchangeably and encompass both partial and complete inhibition / blocking of a structure or function of a given target molecule, pathway, or biological activity. As a non- limiting example, the inhibition / blocking can be by at least about 50%, for example, at least about 60%, 70%, 80%, 90%, 95%, or 99%, or 100%.3915-P1319WO.UW -74-

[0171] As used herein, an “instructional material” includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of one or more elements of a kit of the disclosure for carrying out a testing method, a screening method, a treatment method, or other method of the disclosure, including methods for alleviation of one or more diseases or disorders as described herein or as known in the art. Optionally, or alternately, the instructional material can describe one or more methods of alleviating the diseases or disorders in a cell or a tissue of a mammal. The instructional material of the kit can, for example, be affixed to a container which contains an identified compound or can be shipped together with a container which contains the identified compound. Alternatively, the instructional material can be shipped separately from the container with the intention that the instructional material and the compound be used cooperatively.

[0172] As used herein, the term “non-transitory machine-readable storage medium”, refers to a computer readable medium or processor readable medium that can store information as data, as well as instructions for performance of logic operations by one or more processors for manipulation of the data. The non-transitory machine-readable storage medium can include any type of memory, such as volatile memory like random access memory (RAM), dynamic random-access memory (DRAM), static random-access memory (SRAM), or non-volatile memory like read-only memory (ROM), flash memory, magnetic or optical disks, or compact-disc read-only memory (CD-ROM), among other devices used to store data or programs on a temporary or permanent basis. The non- transitory machine-readable storage medium can be configured to store instructions. The instructions are executable by the one or more processors to cause the computing device to perform any of the functions or methods described herein. The non-transitory machine- readable storage medium can also be configured to store a computational model. The computational model can take the form of a convolutional neural network or any other type of artificial neural network. The computational model can take other forms as well.

[0173] As used herein, the term “computational device” refers to a device, e.g., an electronic device, capable of performing logic operations. Example computational devices include computers, laptops, and tablets, as are known in the art. A computing device includes one or more processors, a non-transitory computer readable medium, a communication interface, a display, and a user interface. Components of the computing device are linked together by a system bus, network, or other connection mechanism. The3915-P1319WO.UW -75-one or more processors can be any type of processor(s), such as a microprocessor, a digital signal processor, a multicore processor, etc., coupled to the non-transitory computer readable medium. The communication interface can include hardware to enable communication within the computational device and / or between the computational device and one or more other devices. The hardware can include transmitters, receivers, and antennas, for example. The communication interface can be configured to facilitate communication with one or more other devices, in accordance with one or more wired or wireless communication protocols. For example, the communication interface can be configured to facilitate wireless data communication for the computational device according to one or more wireless communication standards, such as one or more Institute of Electrical and Electronics Engineers (IEEE) 801.11 standards, ZigBee standards, Bluetooth standards, etc. As another example, the communication interface can be configured to facilitate wired data communication with one or more other devices. The communication interface can also include analog-to-digital converters (ADCs) or digital- to-analog converters (DACs) that the computational device can use to control various components. The display can be any type of display component configured to display data. As one example, the display can include a touchscreen display. As another example, the display can include a flat-panel display, such as a liquid-crystal display (LCD) or a light-emitting diode (LED) display. A user interface can be included as part of the computational device and can include one or more pieces of hardware used to provide data and control signals to the computing device. For instance, the user interface can include a mouse or a pointing device, a keyboard or a keypad, a microphone, a touchpad, or a touchscreen, among other possible types of user input devices. Generally, the user interface can enable an operator to interact with a graphical user interface (GUI) provided by the computing device (e.g., displayed by the display)

[0174] As used herein, the term “system” refers to one or more computational devices, or one or more elements thereof, configured to perform one or more tasks, methods, or processes. A system of the disclosure can comprise a computing device. The computing device includes one or more processors, a non-transitory computer readable medium, a communication interface, a display, and a user interface. Components of the computing device are linked together by a system bus, network, or other connection mechanism.3915-P1319WO.UW -76-

[0175] As used herein and unless otherwise indicated, the terms “a” and “an” are taken to mean “one”, “at least one” or “one or more.” Unless otherwise required by context, singular terms used herein shall include pluralities and plural terms shall include the singular.

[0176] Unless the context clearly requires otherwise, throughout the description and the claims, the words “comprise”, “comprising”, and the like are to be construed in an inclusive sense as opposed to an exclusive or exhaustive sense; that is to say, in the sense of “including, but not limited to.”

[0177] Unless the context clearly requires otherwise, the phrase “consisting essentially of” limits the scope of a claim to the specified materials or steps and those that do not materially affect the basic and novel characteristic(s) of the claim.

[0178] Unless the context clearly requires otherwise, the phrase “consisting of” excludes any element, step, or ingredient not specified.

[0179] If an element is described or claimed herein such that it “comprises” a feature, that description or claim also includes embodiments wherein the element “consists essentially of” and embodiments wherein the element “consists of” the feature, unless something else is specifically stated to the contrary.

[0180] Words using the singular or plural number also include the plural and singular number, respectively. Additionally, the words “herein,” “above,” and “below” and words of similar import, when used in this application, shall refer to this application as a whole and not to any particular portions of the application.

[0181] Unless otherwise indicated, all numbers expressing quantities of components, molecular weights, and so forth used in the specification and claims are to be understood as being modified in all instances by the term “about.” Accordingly, unless otherwise indicated to the contrary, the numerical parameters set forth in the specification and claims are approximations that can vary depending upon the desired properties sought to be obtained by the present disclosure. At the very least, and not as an attempt to limit the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

[0182] Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the disclosure are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. All numerical values, however,3915-P1319WO.UW -77-inherently contain a range necessarily resulting from the standard deviation found in their respective testing measurements.

[0183] All headings are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading, unless so specified.

[0184] All of the references cited herein are incorporated by reference. Aspects of the disclosure can be modified, if necessary, to employ the systems, functions, and concepts of the above references and application to provide yet further embodiments of the disclosure. These and other changes can be made to the disclosure in light of the detailed description.

[0185] It will be appreciated that, although specific embodiments of the disclosure have been described herein for purposes of illustration, various modifications can be made without deviating from the spirit and scope of the disclosure. Accordingly, the disclosure is not limited except as stated by the claims. NON-LIMITING EMBODIMENTS

[0186] While general features of the disclosure are described and shown and particular features of the disclosure are set forth in the claims, the following non-limiting embodiments relate to features, and combinations of features, that are explicitly envisioned as being part of the disclosure. The following non-limiting Embodiments contain elements that are modular and can be combined with each other in any number, order, or combination to form a new non-limiting Embodiment, which can itself be further combined with other non-limiting Embodiments.

[0187] Embodiment 1. A method for parallel testing of a plurality of cell treatment conditions, the method comprising: contacting a plurality of cells with a plurality of deoxyribonucleic acid (DNA) molecules that comprise unique DNA barcodes; splitting the plurality of cells, and any progeny cells thereof, into a plurality of subgroups; exposing subgroups of the plurality of subgroups to cell treatment conditions of the plurality of cell treatment conditions for a production of a treatment-barcode correlation; pooling subgroups of the plurality of subgroups to form a pool; analyzing at least a portion of the pool to correlate one or more observed structures and / or functions of a cell of the pool to a unique barcode of the cell of the pool to produce a barcode-readout correlation; and computing at least one cell treatment condition that is associated with the3915-P1319WO.UW -78-one or more observed structures and / or functions of the cell by way of the barcode- readout correlation and the treatment-barcode correlation.

[0188] Embodiment 2. The method of Embodiment 1 or any other Embodiment, wherein DNA molecules of the plurality of DNA molecules are configured for cellular DNA replication and cellular transcription to produce a plurality of ribonucleic acid (RNA) molecules that comprise unique RNA barcodes.

[0189] Embodiment 3. The method of any one of Embodiments 1-2 or any other Embodiment, wherein the production of the treatment-barcode correlation comprises: sampling the plurality of subgroups to produce a plurality of subgroup samples; and analyzing the plurality of subgroup samples to correlate the unique DNA barcodes, the unique RNA barcodes, or both, to the plurality of cell treatment conditions to produce the treatment-barcode correlation.

[0190] Embodiment 4. The method of Embodiment 3 or any other Embodiment, wherein the analyzing the plurality of subgroup samples comprises sequencing DNA barcodes and / or RNA barcodes of cells of subgroups of the plurality of subgroups to construct a barcode dictionary of associations between treatment conditions and corresponding barcodes, wherein the barcode dictionary of associations comprises the treatment-barcode correlation.

[0191] Embodiment 5. The method of any one of Embodiments 1-4 or any other Embodiment, wherein the contacting the plurality of cells with the plurality of DNA molecules causes at least a portion of the plurality of cells to stably maintain DNA molecules of the plurality of DNA molecules.

[0192] Embodiment 6. The method of any one of Embodiments 1-5 or any other Embodiment, wherein the contacting the plurality of cells with the plurality of DNA molecules comprises transducing the plurality of cells with a plurality of viral particles that comprise the plurality of DNA molecules.

[0193] Embodiment 7. The method of any one of Embodiments 1-6 or any other Embodiment, wherein the cells are alive and are not fixed or permeabilized.

[0194] Embodiment 8. The method of any one of Embodiments 1-7 or any other Embodiment, wherein the analyzing at least the portion of the pool comprises DNA sequencing and / or RNA sequencing to determine sequences of one or more unique DNA barcodes and / or one or more unique RNA barcodes of the cell of the pool.3915-P1319WO.UW -79-

[0195] Embodiment 9. The method of any one of Embodiments 1-8 or any other Embodiment, wherein the analyzing at least the portion of the pool comprises testing the cell of the pool for: an expression of a gene, a transcription of the gene, a translation of a messenger RNA (mRNA) of the gene, a transcriptome of the cell, a proteome of the cell, a level of a protein of the gene, a tertiary and / or quaternary structure of the protein, a post-translational modification of the protein, a cellular location of the protein, a function of the protein, a function of the cell, or any combination thereof.

[0196] Embodiment 10. The method of Embodiment 9 or any other Embodiment, wherein the cell of the pool is a T cell and the function of the cell comprises an effector function, a cytokine secretion, a self-renewal of the cell, a cytolytic activity, an anti-infection function, an anti-cancer function, or any combination thereof.

[0197] Embodiment 11. The method of any one of Embodiments 1-10 or any other Embodiment, wherein the plurality of cell treatment conditions comprises a cell treatment condition comprising: a small molecule, a large molecule, a temperature, an ionic strength, a pH level, an oxygen level, a nitrogen level, a carbon dioxide level, a viscosity, an electrical potential, an electrical current, a magnetic field, an electromagnetic field, a light ray, a sound stimulation, a mechanical stimulation, an atmospheric pressure level, or any combination thereof.

[0198] Embodiment 12. The method of any one of Embodiments 1-10 or any other Embodiment, wherein the plurality of cell treatment conditions comprises a cell treatment condition comprising: a cytokine, a growth factor, a chemoattractant, a chemorepellent, or any combination thereof.

[0199] Embodiment 13. The method of any one of Embodiments 1-12 or any other Embodiment, further comprising after the pooling the plurality of subgroups and before the analyzing at least the portion of the pool: culturing at least the cell of the pool in a cell treatment condition that corresponds to a physiological context within which the cell of the pool is desired to be operable and exhibits the one or more observed structures and / or functions.

[0200] Embodiment 14. The method of Embodiment 13 or any other Embodiment, wherein the cell of the pool is cultured in a biological matrix that corresponds to the physiological context and comprises a model cell, a model tissue, a model organ, and / or a model organism.3915-P1319WO.UW -80-

[0201] Embodiment 15. The method of any one of Embodiments 13-14 or any other Embodiment, wherein the cell treatment condition corresponds to a rest state, a healthy state, a viral infection, a bacterial infection, a parasitic infection, a genetic disorder, a cancer, or any combination thereof.

[0202] Embodiment 16. The method of Embodiment 15 or any other Embodiment, wherein the cell treatment condition comprises an anti-CD3 agent, IL-2, an anti-CD28 agent, IL-12, or any combination thereof.

[0203] Embodiment 17. The method of Embodiment 16 or any other Embodiment, wherein the anti-CD3 agent comprises an anti-CD3 antibody, the anti- CD28 agent comprises an anti-CD28 antibody, or both.

[0204] Embodiment 18. The method of any one of Embodiments 1-17 or any other Embodiment, wherein the plurality of cell treatment conditions comprises a cell treatment condition comprising a cytokine selected from the group consisting of: Interleukin-2 (IL-2), Interleukin-12 (IL-12), Interleukin-21 (IL-21), Interferon-gamma (IFN-γ), Interleukin-7 (IL-7), Interleukin-15 (IL-15), Interleukin-18 (IL-18), Interferon- alpha (IFN-α), Tumor necrosis factor alpha (TNF-α), Transforming growth factor beta (TGF-β), Interleukin-10 (IL-10), Interleukin-6 (IL-6), Stem cell factor (SCF), Interleukin- 27 (IL-27), Interleukin-9 (IL-9), Interleukin-25 / Interleukin-17E (IL-25 / IL-17E), Interleukin-17A (IL-17A), Interleukin-23 (IL-23), Interleukin-11 (IL-11), Interleukin-1- beta (IL-1β), Interleukin-33 (IL-33), Interleukin-36-gamma (IL-36γ), Interleukin-37b (IL- 37b), Interleukin-4 (IL-4), Thymic stromal lymphopoietin (TSLP), Tumor necrosis factor superfamily member 14 (TNFSF14 / LIGHT), B-cell activating factor (BAFF), Nerve growth factor (NGF), Tumor necrosis factor-like cytokine 1A (TNFSF15 / TL1A), Interleukin-15 (IL-15), and any combination thereof.

[0205] Embodiment 19. The method of any one of Embodiments 1-18 or any other Embodiment, wherein at least one DNA molecule of the plurality of DNA molecules is produced by a method that uses a DNA molecule comprising a polynucleotide sequence having at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity to a polynucleotide sequence selected from the group consisting of: SEQ ID NOs 1-22.3915-P1319WO.UW -81-

[0206] Embodiment 20. The method of any one of Embodiments 1-19 or any other Embodiment, wherein the cell is configured for a cell therapy, a cancer cell therapy, an immunotherapy, or any combination thereof.

[0207] Embodiment 21. A method for engineering a T cell, the method comprising: culturing the T cell with a cell treatment condition comprising a cytokine selected from the group consisting of: IL-2, IL-12, IL-21, IFN-γ, IL-7, IL-15, IL-18, IFN- α, TNF-α, TGF-β, IL-10, IL-6, SCF, IL-27, IL-9, IL-25 / IL-17E, IL-17A, IL-23, IL-11, IL-1β, IL-33, IL-36γ, IL-37b, IL-4, TSLP, TNFSF14 / LIGHT, BAFF, NGF, TNFSF15 / TL1A, IL-15, and any combination thereof.

[0208] Embodiment 22. The method of Embodiment 21 or any other Embodiment, wherein the method engineers the T cell to be configured for a cell therapy, a cancer cell therapy, an immunotherapy, or any combination thereof; and wherein the T cell is cultured in a cell treatment condition that corresponds to a physiological context within which the T cell is to be operable for the cell therapy, the cancer cell therapy, the immunotherapy, or any combination thereof.

[0209] Embodiment 23. The method of Embodiment 22 or any other Embodiment, wherein the cell treatment condition comprises a biological factor of the physiological context, a therapeutic agent for treatment of a disease of the physiological context, or both.

[0210] Embodiment 24. The method of any one of Embodiments 22-23 or any other Embodiment, wherein the cell treatment condition corresponds to a rest state, a healthy state, a viral infection, a bacterial infection, a parasitic infection, a genetic disorder, a cancer, or any combination thereof, of the physiological context.

[0211] Embodiment 25. The method of any one of Embodiments 22-24 or any other Embodiment, wherein the cell treatment condition comprises an anti-CD3 treatment, an IL-2 treatment, an anti-CD28 treatment, an IL-12 treatment, or any combination thereof.

[0212] Embodiment 26. The method of any one of Embodiments 22-25 or any other Embodiment, wherein the cell treatment condition comprises an anti-CD3 agent, IL-2, an anti-CD28 agent, IL-12, or any combination thereof.

[0213] Embodiment 27. The method of Embodiment 26 or any other Embodiment, wherein the anti-CD3 agent comprises an anti-CD3 antibody, the anti- CD28 agent comprises an anti-CD28 antibody, or both.3915-P1319WO.UW -82-

[0214] Embodiment 28. A therapeutic cell produced by the method of any one of Embodiments 1-27 or any other Embodiment.

[0215] Embodiment 29. A therapeutic cell product produced by a host cell produced by the method of any one of Embodiments 1-27 or any other Embodiment.

[0216] Embodiment 30. A DNA molecule configured for replication in a cell and comprising a unique DNA barcode that is configured to be transcribed in the cell to produce a unique RNA barcode.

[0217] Embodiment 31. The DNA molecule of Embodiment 30 or any other Embodiment, wherein the DNA molecule is configured for cellular DNA replication and cellular transcription to produce an RNA molecule that comprises a unique RNA barcode.

[0218] Embodiment 32. A composition comprising the DNA molecule of any one of Embodiments 30-31 or any other Embodiment.

[0219] Embodiment 33. The composition of Embodiment 32 or any other Embodiment, wherein the composition comprises a viral preparation comprising a virus particle that comprises the DNA molecule.

[0220] Embodiment 34. A cell comprising the DNA molecule of any one of Embodiments 30-31 or any other Embodiment.

[0221] Embodiment 35. A plurality of cells comprising a plurality of DNA molecules of any one of Embodiments 30-31 or any other Embodiment.

[0222] Embodiment 36. A composition comprising the cell of Embodiment 34 or the plurality of cells of Embodiment 35 or any other Embodiment.

[0223] Embodiment 37. A non-transitory machine-readable storage medium having stored thereon the barcode-readout correlation of any one of Embodiments 1-27 or any other Embodiment, the treatment-barcode correlation of any one of Embodiments 1- 27 or any other Embodiment, or both.

[0224] Embodiment 38. A computational device comprising the non- transitory machine-readable storage medium of Embodiment 37 or any other Embodiment.

[0225] Embodiment 39. A system comprising the computational device of Embodiment 38 or any other Embodiment.

[0226] Embodiment 40. A kit, comprising: the therapeutic cell of Embodiment 28 or any other Embodiment, the therapeutic cell product of Embodiment 29 or any other Embodiment, the DNA molecule of any one of Embodiments 30-31 or3915-P1319WO.UW -83-any other Embodiment, the composition of any one of Embodiments 32-33 and 36 or any other Embodiment, the cell of Embodiment 34 or any other Embodiment, the plurality of cells of Embodiment 35 or any other Embodiment, the non-transitory machine-readable storage medium of Embodiment 37 or any other Embodiment, the computational device of Embodiment 38 or any other Embodiment, the system of Embodiment 39 or any other Embodiment, or any combination thereof; and an instructional material configured to instruct at least an individual in a use of the kit for: the method of any one of Embodiments 1-27 or any other Embodiment, a method of treatment of a subject in need thereof, a method of preparation of a medicament for use in the treatment of the subject in need thereof, a method of diagnosis of a subject with a disease or disorder, a method of prognosis of the disease or disorder, or any combination thereof.

[0227] While illustrative embodiments have been illustrated and described, it will be appreciated that various changes can be made therein without departing from the spirit and scope of the disclosure.3915-P1319WO.UW -84-

Claims

CLAIMS The embodiments of the invention in which an exclusive property or privilege is claimed are defined as follows:

1. A method for parallel testing of a plurality of cell treatment conditions, the method comprising: contacting a plurality of cells with a plurality of deoxyribonucleic acid (DNA) molecules that comprise unique DNA barcodes; splitting the plurality of cells, and any progeny cells thereof, into a plurality of subgroups; exposing subgroups of the plurality of subgroups to cell treatment conditions of the plurality of cell treatment conditions for a production of a treatment-barcode correlation; pooling subgroups of the plurality of subgroups to form a pool; analyzing at least a portion of the pool to correlate one or more observed structures and / or functions of a cell of the pool to a unique barcode of the cell of the pool to produce a barcode-readout correlation; and computing at least one cell treatment condition that is associated with the one or more observed structures and / or functions of the cell by way of the barcode-readout correlation and the treatment-barcode correlation.

2. The method of claim 1, wherein DNA molecules of the plurality of DNA molecules are configured for cellular DNA replication and cellular transcription to produce a plurality of ribonucleic acid (RNA) molecules that comprise unique RNA barcodes.

3. The method of any one of claims 1-2, wherein the production of the treatment-barcode correlation comprises: sampling the plurality of subgroups to produce a plurality of subgroup samples; and analyzing the plurality of subgroup samples to correlate the unique DNA barcodes, the unique RNA barcodes, or both, to the plurality of cell treatment conditions to produce the treatment-barcode correlation.3915-P1319WO.UW -85-4. The method of claim 3, wherein the analyzing the plurality of subgroup samples comprises sequencing DNA barcodes and / or RNA barcodes of cells of subgroups of the plurality of subgroups to construct a barcode dictionary of associations between treatment conditions and corresponding barcodes, wherein the barcode dictionary of associations comprises the treatment-barcode correlation.

5. The method of any one of claims 1-4, wherein the contacting the plurality of cells with the plurality of DNA molecules causes at least a portion of the plurality of cells to stably maintain DNA molecules of the plurality of DNA molecules.

6. The method of any one of claims 1-5, wherein the contacting the plurality of cells with the plurality of DNA molecules comprises transducing the plurality of cells with a plurality of viral particles that comprise the plurality of DNA molecules.

7. The method of any one of claims 1-6, wherein the cells are alive and are not fixed or permeabilized.

8. The method of any one of claims 1-7, wherein the analyzing at least the portion of the pool comprises DNA sequencing and / or RNA sequencing to determine sequences of one or more unique DNA barcodes and / or one or more unique RNA barcodes of the cell of the pool.

9. The method of any one of claims 1-8, wherein the analyzing at least the portion of the pool comprises testing the cell of the pool for: an expression of a gene, a transcription of the gene, a translation of a messenger RNA (mRNA) of the gene, a transcriptome of the cell, a proteome of the cell, a level of a protein of the gene, a tertiary and / or quaternary structure of the protein, a post-translational modification of the protein, a cellular location of the protein, a function of the protein, a function of the cell, or any combination thereof.

10. The method of claim 9, wherein the cell of the pool is a T cell and the function of the cell comprises an effector function, a cytokine secretion, a self-renewal of the cell, a cytolytic activity, an anti-infection function, an anti-cancer function, or any combination thereof.3915-P1319WO.UW -86-11. The method of any one of claims 1-10, wherein the plurality of cell treatment conditions comprises a cell treatment condition comprising: a small molecule, a large molecule, a temperature, an ionic strength, a pH level, an oxygen level, a nitrogen level, a carbon dioxide level, a viscosity, an electrical potential, an electrical current, a magnetic field, an electromagnetic field, a light ray, a sound stimulation, a mechanical stimulation, an atmospheric pressure level, or any combination thereof.

12. The method of any one of claims 1-10, wherein the plurality of cell treatment conditions comprises a cell treatment condition comprising: a cytokine, a growth factor, a chemoattractant, a chemorepellent, or any combination thereof.

13. The method of any one of claims 1-12, further comprising after the pooling the plurality of subgroups and before the analyzing at least the portion of the pool: culturing at least the cell of the pool in a cell treatment condition that corresponds to a physiological context within which the cell of the pool is desired to be operable and exhibits the one or more observed structures and / or functions.

14. The method of claim 13, wherein the cell of the pool is cultured in a biological matrix that corresponds to the physiological context and comprises a model cell, a model tissue, a model organ, and / or a model organism.

15. The method of any one of claims 13-14, wherein the cell treatment condition corresponds to a rest state, a healthy state, a viral infection, a bacterial infection, a parasitic infection, a genetic disorder, a cancer, or any combination thereof.

16. The method of claim 15, wherein the cell treatment condition comprises an anti-CD3 agent, IL-2, an anti-CD28 agent, IL-12, or any combination thereof.

17. The method of claim 16, wherein the anti-CD3 agent comprises an anti- CD3 antibody, the anti-CD28 agent comprises an anti-CD28 antibody, or both.

18. The method of any one of claims 1-17, wherein the plurality of cell treatment conditions comprises a cell treatment condition comprising a cytokine selected from the group consisting of: Interleukin-2 (IL-2), Interleukin-12 (IL-12), Interleukin-21 (IL-21), Interferon-gamma (IFN-γ), Interleukin-7 (IL-7), Interleukin-15 (IL-15),3915-P1319WO.UW -87-Interleukin-18 (IL-18), Interferon-alpha (IFN-α), Tumor necrosis factor alpha (TNF-α), Transforming growth factor beta (TGF-β), Interleukin-10 (IL-10), Interleukin-6 (IL-6), Stem cell factor (SCF), Interleukin-27 (IL-27), Interleukin-9 (IL-9), Interleukin- 25 / Interleukin-17E (IL-25 / IL-17E), Interleukin-17A (IL-17A), Interleukin-23 (IL-23), Interleukin-11 (IL-11), Interleukin-1-beta (IL-1β), Interleukin-33 (IL-33), Interleukin-36- gamma (IL-36γ), Interleukin-37b (IL-37b), Interleukin-4 (IL-4), Thymic stromal lymphopoietin (TSLP), Tumor necrosis factor superfamily member 14 (TNFSF14 / LIGHT), B-cell activating factor (BAFF), Nerve growth factor (NGF), Tumor necrosis factor-like cytokine 1A (TNFSF15 / TL1A), Interleukin-15 (IL-15), and any combination thereof.

19. The method of any one of claims 1-18, wherein at least one DNA molecule of the plurality of DNA molecules is produced by a method that uses a DNA molecule comprising a polynucleotide sequence having at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity to a polynucleotide sequence selected from the group consisting of: SEQ ID NOs 1-22.

20. The method of any one of claims 1-19, wherein the cell is configured for a cell therapy, a cancer cell therapy, an immunotherapy, or any combination thereof.

21. A method for engineering a T cell, the method comprising: culturing the T cell with a cell treatment condition comprising a cytokine selected from the group consisting of: IL-2, IL-12, IL-21, IFN-γ, IL-7, IL-15, IL-18, IFN-α, TNF- α, TGF-β, IL-10, IL-6, SCF, IL-27, IL-9, IL-25 / IL-17E, IL-17A, IL-23, IL-11, IL-1β, IL- 33, IL-36γ, IL-37b, IL-4, TSLP, TNFSF14 / LIGHT, BAFF, NGF, TNFSF15 / TL1A, IL- 15, and any combination thereof.

22. The method of claim 21, wherein the method engineers the T cell to be configured for a cell therapy, a cancer cell therapy, an immunotherapy, or any combination thereof; and wherein the T cell is cultured in a cell treatment condition that corresponds to a physiological context within which the T cell is to be operable for the cell therapy, the cancer cell therapy, the immunotherapy, or any combination thereof.3915-P1319WO.UW -88-23. The method of claim 22, wherein the cell treatment condition comprises a biological factor of the physiological context, a therapeutic agent for treatment of a disease of the physiological context, or both.

24. The method of any one of claims 22-23, wherein the cell treatment condition corresponds to a rest state, a healthy state, a viral infection, a bacterial infection, a parasitic infection, a genetic disorder, a cancer, or any combination thereof, of the physiological context.

25. The method of any one of claims 22-24, wherein the cell treatment condition comprises an anti-CD3 treatment, an IL-2 treatment, an anti-CD28 treatment, an IL-12 treatment, or any combination thereof.

26. The method of any one of claims 22-25, wherein the cell treatment condition comprises an anti-CD3 agent, IL-2, an anti-CD28 agent, IL-12, or any combination thereof.

27. The method of claim 26, wherein the anti-CD3 agent comprises an anti- CD3 antibody, the anti-CD28 agent comprises an anti-CD28 antibody, or both.

28. A therapeutic cell produced by the method of any one of claims 1-27.

29. A therapeutic cell product produced by a host cell produced by the method of any one of claims 1-27.

30. A DNA molecule configured for replication in a cell and comprising a unique DNA barcode that is configured to be transcribed in the cell to produce a unique RNA barcode.

31. The DNA molecule of claim 30, wherein the DNA molecule is configured for cellular DNA replication and cellular transcription to produce an RNA molecule that comprises a unique RNA barcode.

32. A composition comprising the DNA molecule of any one of claims 30-31.

33. The composition of claim 32, wherein the composition comprises a viral preparation comprising a virus particle that comprises the DNA molecule.3915-P1319WO.UW -89-34. A cell comprising the DNA molecule of any one of claims 30-31.

35. A plurality of cells comprising a plurality of DNA molecules of any one of claims 30-31.

36. A composition comprising the cell of claim 34 or the plurality of cells of claim 35.

37. A non-transitory machine-readable storage medium having stored thereon the barcode-readout correlation of any one of claims 1-27, the treatment-barcode correlation of any one of claims 1-27, or both.

38. A computational device comprising the non-transitory machine-readable storage medium of claim 37.

39. A system comprising the computational device of claim 38.

40. A kit, comprising: the therapeutic cell of claim 28, the therapeutic cell product of claim 29, the DNA molecule of any one of claims 30-31, the composition of any one of claims 32-33 and 36, the cell of claim 34, the plurality of cells of claim 35, the non-transitory machine-readable storage medium of claim 37, the computational device of claim 38, the system of claim 39, or any combination thereof; and an instructional material configured to instruct at least an individual in a use of the kit for: the method of any one of claims 1-27, a method of treatment of a subject in need thereof, a method of preparation of a medicament for use in the treatment of the subject in need thereof, a method of diagnosis of a subject with a disease or disorder, a method of prognosis of the disease or disorder, or any combination thereof.3915-P1319WO.UW -90-

Images