Phage particle complex, preparation method therefor, and use thereof

Abstract

Disclosed is a phage particle complex, a preparation method therefor, and a use thereof, the phage particle complex comprising: a polypeptide displayed on the surface of the phage, a nucleic acid sequence encoding the displayed polypeptide inside the phage, and a linking compound, wherein the linking compound and the polypeptide form a bicyclic polypeptide containing at least three discrete ionic bonds.

Description

Phage particle complex, preparation method and use thereof

[0001] Citation of Related Applications

[0002] This disclosure claims all rights and interests in the Chinese invention patent application with application number 202311282073.X filed with the State Intellectual Property Office of the People's Republic of China on September 28, 2023, and entitled "Bacteriophage particle complex, preparation method thereof and use thereof", and incorporates the entire contents thereof into this disclosure by reference.

[0003] field

[0004] The present disclosure relates generally to the field of bioengineering, and more particularly to phage particle complexes, methods for preparing the same, and uses thereof.

[0005] background

[0006] The human body has evolved a complex and precisely regulated network of protein-protein interactions (PPIs), which play a crucial role in cellular processes such as signal transduction, the cell cycle, the immune system, and gene regulation. PPIs directly influence the development and progression of diseases and ultimately determine whether a disease can be cured. Therefore, targeting intracellular protein-protein interactions is considered a highly promising therapeutic strategy. Peptide drugs are considered the most effective molecular form for targeting intracellular protein-protein interactions. Peptide drug molecules have a larger surface area and can form more complex conformations, effectively expanding the chemical space for targeting molecules and minimizing off-target effects compared to small molecule drugs. Similar to biomacromolecules, peptides exhibit high binding affinity and selectivity for their targets. However, compared to biomacromolecules, peptide drugs offer lower cost, lower immunogenicity, and, due to their smaller molecular size, easier tissue penetration.

[0007] Traditional peptide drugs, due to their limited number of amino acid residues, are unable to effectively form complex secondary structures. They exhibit a high degree of freedom and a random linear state in physiological fluids, which not only reduces their specificity but also makes them susceptible to degradation by proteases. Furthermore, peptide drugs have poor cell membrane penetration. Chemically modifying peptides to stabilize them into a conformation with a secondary structure not only increases their stability to proteases but also enhances their cell membrane penetration. Furthermore, it can improve the binding ability of peptides to targets by reducing the entropy change during binding.

[0008] Due to their wide range of active functions, peptides are used to treat a variety of diseases, including diabetes, allergies, anti-infectives, obesity, diagnostics, oncology, arthritis, and cardiovascular disease. The launch of oral semaglutide in 2019 significantly boosted enthusiasm for peptide drug development. Peptide drug development is a complex process, primarily encompassing natural product discovery, rational design, and high-throughput screening. Natural product discovery involves a degree of serendipity, and the natural product ligands for most disease-related proteins remain unknown. Rational design typically relies on existing crystal structures of protein-protein interactions to obtain peptide sequences that target the target protein. These sequences are then evaluated for affinity, stability, and cell penetration. Optimization and modification are then performed to address shortcomings, ultimately yielding peptide molecules with enhanced affinity, strong stability, and suitable physicochemical properties for drug development, demonstrating promising biological functions. However, limitations of existing crystal structures and the varying physicochemical properties of peptide sequences limit their applicability in drug development. Key peptide high-throughput screening technologies include phage display and mRNA display. High-throughput screening technology does not rely on existing protein-protein interactions, and by screening libraries with over 1 billion diversity, it can obtain a wider range of peptide sequences, thus providing more possibilities in peptide drug development. In recent years, more peptide molecules obtained by high-throughput screening methods have entered clinical research.

[0009] Phage display technology is a widely used high-throughput screening method, currently primarily used for screening antibodies and peptides. Adalimumab is a prime example of this technology. Dr. Gregory Winter and Dr. George Smith were awarded the 2018 Nobel Prize in Chemistry for their work on phage display technology. Traditional peptide phage display technology displays linear peptides, which suffer from poor stability and poor cell entry. Subsequently, researchers focused on developing cyclic peptide phage display technology under biocompatible conditions for peptide drug screening. Pegcetacoplan, a complement C3 protein inhibitor, was discovered through cyclic peptide phage display technology and is FDA-approved for the treatment of paroxysmal nocturnal hemoglobinuria (PNH) in adults. The Bicycle phage display technology developed by Professor Winter also holds considerable potential in the development of peptide drugs, with several peptide molecules already entering Phase II / III clinical trials. Furthermore, Professor Wu Chuanliu of Xiamen University has developed phage display technology for bicyclic and tricyclic peptides with diverse structures, including CXC, CPPC, and CPXXC. Professor Matthew Boggio of Stanford University has developed a novel method for screening covalent cyclic peptide drugs using phage display technology, further expanding the scope of peptide phage display technology. Cyclic peptides are more druggable than linear peptides, which means that cyclic peptide phage display technology further expands the applicability of linear peptide phage display technology.

[0010] Overview

[0011] In one aspect, the present disclosure relates to a phage particle complex comprising: a polypeptide displayed on the surface of the phage; and a linking compound, wherein the linking compound forms a bicyclic polypeptide with the polypeptide containing at least three discrete ionic bonds.

[0012] In another aspect, the present disclosure relates to a polypeptide library comprising the phage particle complexes described herein.

[0013] In yet another aspect, the present disclosure relates to a method for preparing a phage particle complex comprising forming a bicyclic polypeptide containing at least three discrete ionic bonds with a linker compound and a polypeptide displayed on the surface of the phage.

[0014] In yet another aspect, the present disclosure relates to a phage particle complex prepared by a method comprising the steps of forming a bicyclic polypeptide containing at least three discrete ionic bonds between a polypeptide displayed on the surface of a phage and a linker compound.

[0015] In another aspect, the present disclosure relates to use of the polypeptide library of the present disclosure in preparing polypeptide inhibitors.

[0016] In yet another aspect, the present disclosure relates to a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 8.

[0017] BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 shows the formation of a bicyclic peptide by methionine alkylation under weakly acidic conditions for a linear polypeptide, wherein A shows a schematic diagram of the formation of a bicyclic peptide by methionine alkylation under weakly acidic conditions for a linear polypeptide; and B shows the efficiency of the formation of a bicyclic peptide by methionine alkylation under weakly acidic conditions for a linear polypeptide at different times.

[0019] FIG2 shows a diagram of the purification of the bacteriophage coat protein pill of the present disclosure.

[0020] Figure 3 shows the primary mass spectrometry of the reaction of the phage coat protein pill with TBMB of the present disclosure, wherein Figure A shows the primary mass spectrometry result of the coat protein with a linear peptide displayed at the N-terminus; and Figure B shows the primary mass spectrometry result of the coat protein after cyclization of the N-terminal peptide.

[0021] FIG4 shows a schematic diagram of the semi-random polypeptide structure displayed by phage according to the present disclosure.

[0022] FIG5 shows a schematic diagram of the construction of a recombinant plasmid in the phage display technology of the present disclosure.

[0023] Figure 6 shows the quality identification results of the E. coli library obtained by the phage display technology of the present invention, wherein Figure A shows the ratio of sequenced sequences; Figure B shows the ratio of different M contained in the semi-random library; Figure C shows the content of A, T, C, and G contained in each position of 10,000 randomly selected sequences; and Figure D shows the comparison of the 19 amino acids (excluding M) translated from the 10,000 sequences with the theoretical amino acid ratio.

[0024] FIG7 shows a group of polypeptide molecules having homology analyzed by partial high-throughput sequencing of the present disclosure.

[0025] FIG8 shows the enzyme activity inhibition IC values ​​of the screened polypeptides W5-3M and C5-3M of the present disclosure. 50 .

[0026] FIG9 shows the affinity of the polypeptides screened targeting STAT3 disclosed herein.

[0027] FIG. 10 shows the affinity of the polypeptides screened targeting ERa according to the present disclosure.

[0028] FIG11 shows a schematic diagram of the phage display technology of sulfonium salt-stabilized bicyclic peptides disclosed in the present invention.

[0029] FIG12 shows the nucleotide sequences of SEQ ID NO: 1 to SEQ ID NO: 8, SEQ ID NO: 24, and SEQ ID NO: 25 of the present disclosure.

[0030] FIG13 shows the polypeptide sequences of SEQ ID NO: 9 to SEQ ID NO: 23 of the present disclosure.

[0031] FIG14 shows the polypeptide sequences of SEQ ID NO: 26 to SEQ ID NO: 57 of the present disclosure.

[0032] FIG15 shows the polypeptide sequences of SEQ ID NO: 58 to SEQ ID NO: 76 of the present disclosure.

[0033] Details

[0034] In the following description, certain specific details are included to provide a comprehensive understanding of each disclosed embodiment. However, one skilled in the relevant art will recognize that the embodiments can still be implemented without one or more of these specific details and with other methods, components, materials, etc.

[0035] Unless otherwise required in this application, throughout the specification and the appended claims, the words "including," "comprising," "containing," and "having" should be interpreted in an open, inclusive sense, that is, "including but not limited to."

[0036] As used in this disclosure and the appended claims, singular references without indications of quantity include plural references unless the context clearly dictates otherwise.

[0037] Reference throughout this specification to "one embodiment," "an embodiment," "in another embodiment," or "in certain embodiments" means that at least one embodiment includes the specific referenced elements, structures, or features described in connection with that embodiment. Thus, appearances of the phrases "in one embodiment," "in an embodiment," "in another embodiment," or "in certain embodiments" in various places throughout this specification are not necessarily all referring to the same embodiment. Furthermore, the specific elements, structures, or features may be combined in any suitable manner in one or more embodiments.

[0038] It should be understood that the singular articles "a," "an," and "the" as used in the specification of this disclosure and the appended claims include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to a composition comprising "a cyclic-closed polypeptide comprising at least two methionine amino acids and at least two sulfonium salt centers" includes one cyclic-closed polypeptide comprising at least two methionine amino acids and at least two sulfonium salt centers, or two or more cyclic-closed polypeptides comprising at least two methionine amino acids and at least two sulfonium salt centers.

[0039] definition

[0040] In the present disclosure, the term "phage" refers to a general term for viruses that infect microorganisms such as bacteria, fungi, algae, actinomycetes or spirochetes. Some of them are called phages because they can cause lysis of the host bacteria.

[0041] In this disclosure, the term "phagemid" refers to a plasmid with a filamentous bacteriophage origin of replication.

[0042] In the present disclosure, the term "plasmid" refers to a type of nucleic acid molecule inherent in biological cells that can replicate autonomously and stably independently of the host chromosome.

[0043] In the present disclosure, the term "phage display technology" refers to a technology that uses phage or phagemid as a carrier to fuse exogenous proteins or peptides with capsid proteins and display them on the phage surface while maintaining the biological activity and spatial conformation of the exogenous proteins or peptides.

[0044] In the present disclosure, the term "ionic bond" refers to a chemical bond formed when two or more atoms or chemical groups lose or gain electrons to become ions.

[0045] In the present disclosure, the term "residue" refers to the portion remaining after dehydration condensation of amino and carboxyl groups in a protein or polypeptide.

[0046] In this disclosure, the term "polypeptide" refers to a polymer formed by covalently linking two or more amino groups via peptide bonds. It represents a novel nutrient intermediate between macromolecular proteins and amino acids, offering the most active, easily absorbed, and physiologically potent properties. It is generally composed of L-α-amino acids.

[0047] In the present disclosure, the term "peptide bond" refers to an amide bond formed by condensing the carboxyl group of one amino acid with the amino group of another amino acid, with the removal of a molecule of water.

[0048] In this disclosure, the term "natural amino acid" refers to an amino acid synthesized by organisms. DETAILED DESCRIPTION

[0049] In one aspect, the present disclosure relates to a phage particle complex comprising: a polypeptide displayed on the surface of the phage, a nucleic acid sequence encoding the displayed polypeptide within the phage, and a linker compound, wherein the linker compound forms a bicyclic polypeptide with the polypeptide containing at least three discrete ionic bonds.

[0050] In certain embodiments, linker compounds useful in the present disclosure have a molecular symmetry corresponding to the number of ionic bonds.

[0051] In certain embodiments, linker compounds useful in the present disclosure possess three-fold molecular symmetry.

[0052] In certain embodiments, each ionic bond is formed with a separate amino acid residue on the polypeptide.

[0053] In certain embodiments, linking compounds useful in the present disclosure are linked to a polypeptide via three discrete ionic bonds.

[0054] In certain embodiments, linker compounds useful in the present disclosure comprise chemical groups with rigid structures.

[0055] In certain embodiments, linker compounds useful in the present disclosure comprise a benzene ring structure.

[0056] In certain embodiments, linker compounds useful in the present disclosure comprise an olefin structure.

[0057] In certain embodiments, illustrative examples of linker compounds that can be used in the present disclosure include, but are not limited to, 1,3,5-tribromotoluene, 1,3,5-tris(bromomethyl)-2,4,6-triethylbenzene, and 1,3,5-tris(bromomethyl)cyclohexene.

[0058] In certain embodiments, polypeptides useful in the present disclosure comprise at least 3 methionine residues.

[0059] In certain embodiments, a discrete ionic bond is formed by linking the linking compound to a methionine in the polypeptide.

[0060] In certain embodiments, the polypeptide sequences useful in the present disclosure include MXmMXnM, wherein X represents a natural amino acid residue, M represents methionine, m is an integer selected from 2 to 20, and n is an integer selected from 2 to 20.

[0061] In certain embodiments, R is selected from the group consisting of glycine (G), alanine (A), valine (V), leucine (L), isoleucine (I), methionine (M), proline (P), tryptophan (W), serine (S), tyrosine (Y), cysteine ​​(C), phenylalanine (F), asparagine (N), glutamine (Q), threonine (T), aspartic acid (D), glutamic acid (E), lysine (K), arginine (R), and histidine (H).

[0062] In certain embodiments, m is an integer selected from 3 to 10.

[0063] In certain embodiments, m is an integer selected from 3 to 6.

[0064] In certain embodiments, n is an integer selected from 3 to 10.

[0065] In certain embodiments, n is an integer selected from 3 to 6.

[0066] In certain embodiments, illustrative examples of polypeptides that can be displayed on the surface of phage of the present disclosure include, but are not limited to, SEQ ID NO: 9 to SEQ ID NO: 23.

[0067] In certain embodiments, the structure of the bicyclic polypeptide is:

[0068] wherein R is selected from the residues of natural amino acids, m is an integer selected from 2 to 20, and n is an integer selected from 2 to 20.

[0069] In certain embodiments, R is selected from the group consisting of glycine (G), alanine (A), valine (V), leucine (L), isoleucine (I), methionine (M), proline (P), tryptophan (W), serine (S), tyrosine (Y), cysteine ​​(C), phenylalanine (F), asparagine (N), glutamine (Q), threonine (T), aspartic acid (D), glutamic acid (E), lysine (K), arginine (R), and histidine (H).

[0070] In certain embodiments, m is an integer selected from 3 to 10.

[0071] In certain embodiments, m is an integer selected from 3 to 6.

[0072] In certain embodiments, n is an integer selected from 3 to 10.

[0073] In certain embodiments, n is an integer selected from 3 to 6.

[0074] In another aspect, the present disclosure relates to a polypeptide library comprising the phage particle complexes described herein.

[0075] In yet another aspect, the present disclosure relates to a method for preparing a phage particle complex comprising forming a bicyclic polypeptide containing at least three discrete ionic bonds with a linker compound and a polypeptide displayed on the surface of the phage.

[0076] In certain embodiments, the bicyclic polypeptide is formed in a polar solvent.

[0077] In certain embodiments, illustrative examples of polar solvents that can be used in the present disclosure include, but are not limited to, aqueous solutions of acetonitrile, aqueous solutions of methanol, and any mixtures thereof.

[0078] In certain embodiments, the bicyclic polypeptide is formed at about 4 to 40°C.

[0079] In certain embodiments, the bicyclic polypeptide is formed at a pH of about 3 to about 10.

[0080] In certain embodiments, the reaction time between the polypeptide and the linker compound to form the bicyclic polypeptide is about 1 to 36 hours.

[0081] In yet another aspect, the present disclosure relates to a phage particle complex prepared by a method comprising the steps of forming a bicyclic polypeptide containing at least three discrete ionic bonds between a polypeptide displayed on the surface of a phage and a linker compound.

[0082] In certain embodiments, the phage particle complex produced by the methods of the present disclosure further comprises a nucleic acid sequence encoding the polypeptide.

[0083] In certain embodiments, the polypeptide in the phage particle complex produced by the methods of the present disclosure comprises at least three methionine residues.

[0084] In certain embodiments, in the phage particle complex prepared by the methods of the present disclosure, a discrete ionic bond is formed between the linking compound and the methionine in the polypeptide.

[0085] In another aspect, the present disclosure relates to use of the polypeptide library of the present disclosure in preparing polypeptide inhibitors.

[0086] In certain embodiments, illustrative examples of polypeptide inhibitors that can be prepared from the polypeptide library of the present disclosure include, but are not limited to, infectious disease polypeptide inhibitors, tumor polypeptide inhibitors, endocrine disease polypeptide inhibitors, and digestive system disease polypeptide inhibitors.

[0087] In certain embodiments, exemplary examples of polypeptide inhibitors that can be prepared from the polypeptide library of the present disclosure include, but are not limited to, novel coronavirus PLpro polypeptide inhibitors, breast cancer polypeptide inhibitors, leukemia polypeptide inhibitors, nutritional and metabolic disease polypeptide inhibitors, and enteritis polypeptide inhibitors.

[0088] In certain embodiments, illustrative examples of polypeptide inhibitors that can be prepared from the polypeptide library of the present disclosure include, but are not limited to, SEQ ID NO: 9 to SEQ ID NO: 23 and SEQ ID NO: 26 to SEQ ID NO: 76.

[0089] In yet another aspect, the present disclosure relates to a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 8.

[0090] Hereinafter, the present disclosure will be explained in detail through the following examples in order to better understand the various aspects and advantages of the present disclosure. However, it should be understood that the following examples are non-limiting and are only used to illustrate certain embodiments of the present disclosure.

[0091] Example

[0092] The reagents and equipment used in the examples of this disclosure are conventional and commercially available. For example:

[0093] Example 1

[0094] Preparation and purification of sulfonium salt-stabilized bicyclic peptides

[0095] The core steps for preparing sulfonium salt-stabilized bicyclic peptides by solid-phase synthesis of peptides according to their amino acid sequences are as follows (taking the peptide sequence: Ac-YMGSGGSGMGSGGSGM-NH2 as an example):

[0096] (1) Peptide solid phase synthesis: Weigh Rink amide MBHA resin into a peptide tube, add dichloromethane (DCM), and swell with nitrogen for 30 minutes. Add 50% (v / v) morpholine solution in N,N-dimethylformamide (DMF) and sparge with nitrogen for 30 minutes to remove the Fmoc protecting group. After washing the resin alternately with DMF and DCM, mix the prepared Fmoc-protected amino acid (5eq, 0.4M, DMF) solution, 6-chlorobenzotriazole-1,1,3,3-tetramethyluronium hexafluorophosphate (HCTU) (5eq, 0.38M, DMF) solution, and N,N-diisopropylethylamine (DIPEA) (10eq) and add them to the resin and sparge with nitrogen for 1 hour. Drain the reaction solution, wash the resin as above, and proceed to the next step. The subsequent amino acids are treated in the same manner as above. The N-terminus of the peptide was acetylated with acetic anhydride and DIPEA (1:1.8, dissolved in DCM) for 30 min (twice).

[0097] (2) Double alkylation addition reaction: After the linear peptide containing three methionines is synthesized on the solid phase, 50 mg of the synthesized resin is taken and placed in an EP tube. 1 mL of shearing solution (trifluoroacetic acid / triisopropylsilane / water / EDT (v:v:v = 9.5:0.25:0.25)) is added and sheared for 1 hour. The shearing solution is blown dry with nitrogen gas, and then 0.5 mL of cold ether is added to precipitate for 2 minutes. The supernatant is removed by centrifugation, and the precipitated peptide is evaporated in air to dry the ether. The peptide is then dissolved in a 30% acetonitrile / water solution to form a peptide solution with a concentration of approximately 10 mM. 1% volume of formic acid is added to acidify (pH approximately equal to 3). At the same time, 1.2 peptide equivalents of alkylating agent are weighed, dissolved in about one-tenth of the solvent volume of DMF, and added to the peptide solution. The solution is then placed on a shaker for reaction for 24 hours (Figure 1).

[0098] (3) Peptide purification and reaction efficiency identification: The peptide after the reaction was purified by high performance liquid chromatography, and the product conversion rate was calculated based on the ratio of the peak area integral of the product peak on the high performance liquid chromatogram to the total peak area integral of the raw material and product.

[0099] Example 2

[0100] Sulfonium Salt-Stabilized Bicyclization of a Linear Peptide Displayed at the N-Terminus of a Phage Coat Protein 1. Protein Sequence Design

[0101] Based on the C-free phage coat protein pill protein developed by Professor Franz X. Schmid through directed evolution (J Mol Biol. 2005, 2; 354(3): 666-78), a new pill protein sequence was designed. The D1-D2 domain of pill protein was truncated, and the M in the protein was mutated to A. The new protein sequence is:

[0102] 2. Construction of recombinant plasmid pET28a / pIII

[0103] Based on the protein sequence designed above, prokaryotic cell (E. coli) codon optimization was performed to determine the DNA gene sequence encoding the new protein. The sequence is as follows:

[0104] The synthesis steps of the DNA gene sequence encoding the new protein are divided into: scheme design, primer synthesis, oligonucleotide splicing, gene assembly, and finished product quality inspection.

[0105] Program design: The sequence was further analyzed. Based on the characteristics of codon incompatibility, some deoxynucleotides were replaced to avoid the occurrence of highly repetitive sequences, reduce complex secondary structures, and ensure that the GC content was between 40 and 60.

[0106] Primer synthesis: Oligo chemical synthesis was used to synthesize small primers with overlapping regions ranging from 40 to 200 nt.

[0107] Oligonucleotide splicing: Using overlapping PCR technology, single-stranded primers are assembled into double-stranded gene fragments. For genes within 3Kb and without complex secondary structures, they can directly proceed to step 4 full-length assembly; if the full length of the gene exceeds 3Kb, fragment assembly is required.

[0108] Gene assembly: Through seamless cloning or enzyme digestion and other assembly techniques, the fragments are further spliced ​​into the full-length sequence and inserted into the pUC series vector. After ligation transformation, clone screening, sequencing verification, and mutation repair, a recombinant vector with a completely correct sequence is obtained. Genes larger than 3Kb need to be divided into multiple fragments and inserted into multiple pUC series vectors. After ligation transformation, clone screening, sequencing verification, and mutation repair, a recombinant vector with a completely correct sequence is obtained.

[0109] Finished product quality inspection: Final quality inspection of the finished product is carried out through sequencing verification, enzyme digestion electrophoresis, etc.

[0110] 3. Design primers and connect the new gene to the pET28a plasmid by homologous recombination

[0111] The specific primer design steps include: designing primers using primer design software CE Design.

[0112] The Fdg3p-MG-XIN-F primer consists of three parts: homology arm (AGAAGGAGATATACC, 15 bp, homologous to the linearized vector fragment pET28a plasmid) + introduced exogenous DNA (ATGGGCATGGGCTCTGGCATGGGCTCTGGCATGGGCGGCTCTGGT) + specific primer (GCTGAAACTGTTGAAAGTTCT, homologous to the pill gene).

[0113] The fdg3p-3M-R primer consists of two parts: a homology arm (TTTCGGGCTTTGTTA, 15 bp, homologous to the linearized vector fragment pET28a plasmid) + a specific primer (GTGATGATGATGATGATGAGCATT, homologous to the pill gene).

[0114] Pet28-3M-F and Pet28-3M-R are a pair of primers for inverse PCR amplification of the linearized vector pET28a plasmid.

[0115] Table 1. Primer sequences for constructing recombinant plasmids

[0116] 4. Amplify gene fragments and linear plasmid fragments by PCR

[0117] Table 2. Standard PCR amplification system

[0118] Table 3. PCR reaction conditions

[0119] 5. Identification and purification of PCR products by agarose gel electrophoresis

[0120] Prepare 1% agarose gel, mix the PCR sample with 10× loading buffer and add it to the sample well. Power on at 120V for 30 minutes and observe and take pictures.

[0121] After confirming that the PCR product size is consistent with the predicted result, purification is performed. The PCR product is recovered using a gel excision recovery kit to obtain a pure PCR product.

[0122] 6. Homologous recombination to construct recombinant plasmids, the system is as follows:

[0123] Table 3. Homologous recombination system

[0124] 7. Recombinant plasmid transformation and clone selection

[0125] The plasmid constructed by homologous recombination was transformed into competent cells and cultured overnight at 37°C. Single clones were then picked and sequenced to confirm the success of the construction.

[0126] 8. Inducible expression of recombinant proteins

[0127] After confirming successful recombinant plasmid construction, transform the plasmid into the expression strain BL21 pLysS. Pick a single colony and transfer it to 5 ml of LB medium (50 μg / mL kanamycin) and culture overnight at 37°C, 200 rpm. Then transfer the culture to 1000 mL of LB medium (50 μg / mL kanamycin) and culture at 37°C, 200 rpm to an OD600 of 0.4 to 0.6. Then, add IPTG solution to a final concentration of 0.5 mM and culture overnight at 16°C, 150 rpm (12 to 18 hours). After induction, centrifuge at 5000 rpm for 10 minutes at 4°C, collect the bacteria, and freeze at -80°C.

[0128] 9. Purification of Recombinant Protein

[0129] Add 30 to 50 mL of protein purification buffer A to the collected cells, vortex, and pipette to thoroughly resuspend the cells. Disrupt the cells using an ultrasonic disruptor. After ultrasonic disruption, centrifuge at 14,000 rpm for 30 minutes at 4°C and collect the supernatant. Filter the supernatant through a 0.22 μm or 0.45 μm filter to obtain the protein supernatant. Affinity chromatography is then performed using a 5 mL His Trap™ FF Crude column. Separation is then performed using a Superdex™ 200 10 / 300 GL molecular sieve. The different fractions are analyzed by SDS-PAGE (Figure 2).

[0130] 10. Sulfonium salt ring closure of the N-terminal peptide of bacteriophage coat protein

[0131] The purified phage coat protein pIII was reacted with 1,3,5-tribromomethylbenzene (TBMB) at 37°C for 2 to 24 hours. The reaction system was as follows:

[0132] Table 4. Phage coat protein and TBMB reaction system

[0133] After the reaction, the reaction solution was centrifuged at 10,000 rpm for 30 minutes using an ultrafiltration centrifuge tube and ultrafiltration was repeated three times with ddH2O. The protein's N-terminal three M residues were then identified by mass spectrometry to determine whether they reacted with TBMB (Figure 3).

[0134] Example 3

[0135] Construction of Sulfonium Salt-Stabilized Bicyclic Peptide Phage Particle Complex

[0136] A sulfonium salt-stabilized bicyclic peptide phage particle complex was constructed, in which a random peptide sequence was introduced between the signal peptide of the phage coat protein pill and the N-terminal sequence of pill (Figure 4). The specific steps are as follows:

[0137] 1. Primer Design

[0138] Using pCANTAB5E as a template, primers shown in Table 5 were designed.

[0139] The new gene was ligated into the pCANTAB5E plasmid by homologous recombination.

[0140] The specific primer design steps include: designing primers using primer design software CE Design.

[0141] The NNK-N1N2-F primer consists of three parts: homology arm (GCGAGTGCTATGGGA, homologous to the linearized vector fragment pCANTAB5E plasmid) + introduced exogenous DNA (ATGNNKNNKNNKNNKNNKNNKATGNNKNNKNNKNNKNNKNNKATG) + specific primer (GGCGGCTCTGGTGCTGAAAC, homologous to the pIII gene).

[0142] The NNK-N1N2-R primer consists of two parts: a homology arm (AGCATTGACAGGAGG, 15 bp, homologous to the linearized vector fragment pCANTAB5E plasmid) + a specific primer (TTGAGGCA, homologous to the pill gene).

[0143] P1-F and P1-R are a pair of primers for inverse PCR amplification of the linearized vector pCANTAB5E plasmid.

[0144] Table 5. Recombinant phagemid primer sequences

[0145] 2. Using the recombinant plasmid in Example 2 as a template, amplify the insert fragment by PCR and purify the product. A linear fragment of the pCANTAB5E plasmid was amplified by PCR and recovered by gel excision.

[0146] 3. Use the ClonExpress II kit for recombination reaction. The optimal amount of cloning vector used is 0.03 pmol, and the optimal molar ratio of cloning vector to insert fragment is 1:2, that is, the optimal amount of insert fragment used is 0.06 pmol. The reaction system is as follows:

[0147] Table 6. Homologous recombination system

[0148] After the reaction system is prepared, flick it slightly to mix well and centrifuge it. Incubate at 37°C for 30 minutes. Use DpnI enzyme to remove the vector template from the recombinant product.

[0149] 4. Preparation of Primary E. coli Library by Electroporation

[0150] According to the method 3, a large number of polypeptide recombinant phagemids were obtained, and the E. coli library was obtained by electroporation (Figure 5). Specific electroporation steps:

[0151] (1) The electroporation program of the electroporator was adjusted to Ec2, which represents Escherichia coli as the host bacteria. The size of the electroporation cuvette was 0.2 cm, and the built-in electroporation parameters were: resistance: 200 Ω, capacitance: 25 μF, and voltage: 2.5 kV.

[0152] (2) Add 400 ng of purified, salt-free recombinant phagemid to 300 μL of electrocompetent E. coli TG1, mix well, and incubate on ice for 1 min; set up negative controls for enzyme-digested Affibody DNA sequence and enzyme-digested phagemid.

[0153] (3) Transfer the competent cell and plasmid mixture to a pre-cooled electroporation cup. Tap the bottom of the electroporation cup gently to cover the bottom of the cup. Avoid bubbles, as this will cause arcing under instantaneous high voltage, which will seriously affect the electroporation effect.

[0154] (4) Wipe the cuvette dry, ensuring it is dry, and place it in the electroporator. Start the pulse. When you hear the tone indicating the completion of the electroporation, remove the cuvette immediately. Once completed, add 1 mL of SOC medium to the cuvette, mix thoroughly, and transfer to a centrifuge tube.

[0155] (5) Culture at 270 rpm and 37°C for 1 hour, and combine the electroporation culture medium of the same type. Take 1 μL of the experimental group culture medium and serially dilute (10 -3 -10 -8 ), 100 μL of bacterial solution was inoculated on 2×YTE / A100 / G2 plates (three replicates) to calculate the total number of colonies (because the number of competent cells is much greater than the recombinant plasmids, the average number of recombinant phagemids contained in each competent cell is less than 1).

[0156] (6) Inoculate the remaining culture medium onto three 150 mm 2×YTE / A100 / G2 plates and culture at 37°C overnight.

[0157] (7) Add 5 mL of 2×YT / A100 / G2 liquid medium to the plate. Carefully scrape and collect the bacteria on the plate. Add another 5 mL and repeat the collection. Finally, add glycerol to a final concentration of 20% and store in a -80°C freezer.

[0158] (8) Quality identification of primary E. coli library

[0159] More than 100 single clones were randomly selected and tested by PCR. The E. coli library was then subjected to high-throughput sequencing to confirm the diversity of the library (Figure 6).

[0160] 5. Amplification of Helper Phage M13K07

[0161] (1) Dilute the purchased helper phage with 2×YT liquid medium for 10 dilutions. Take 10 μL of phage from each dilution gradient and add it to 200 μL of newly cultured OD 600 Infect about 0.4% Escherichia coli TG1 bacterial solution in a 37°C water bath for 30 minutes. Do not shake during the water bath.

[0162] (2) While in the water bath, pour 10 2×YTE plates for use. Pipette 100 μL of the above infection solution and add 3 mL of warm semi-solid 2×YT medium to each plate. Mix thoroughly and quickly pour onto the 2×YTE plates. Incubate in a 37°C incubator overnight.

[0163] (3) Pick a small plaque and inoculate it into 5 mL of freshly cultured OD 600 Incubate approximately 0.4 mL of E. coli TG1 culture at 37°C with shaking for 2 hours. Add the culture to 500 mL of 2×YT liquid medium and incubate at 37°C with shaking for 1 hour. Then, add kanamycin to a final concentration of 50 μg / mL and incubate at 30°C with shaking overnight.

[0164] (4) Centrifuge the overnight culture at 4000 rpm for 15 minutes. Collect the supernatant and add 100 mL of pre-chilled PEG / NaCl solution to 400 mL of the supernatant. Let stand on ice for at least 1 hour. After standing, centrifuge at 4000 rpm at 4°C for 30 minutes.

[0165] (5) After centrifugation, remove the supernatant and resuspend the pellet in 8 mL of PBS. Add 2 mL of PEG / NaCl solution, mix well, and continue to incubate on ice for 20 min. Centrifuge again at 4°C and 4000 rpm for 30 min. Remove the PEG / NaCl solution completely with a pipette.

[0166] (6) Resuspend the precipitate in 10 mL of PBS. Aliquot the precipitate into microcentrifuge tubes and centrifuge at 13,000 rpm for 10 min to completely remove bacterial cells and debris. The supernatant containing the helper phage can then be stored temporarily at 4°C or added with 15% glycerol for long-term storage at 80°C.

[0167] (7) Determination of the concentration of helper phage M13K07

[0168] After helper phage amplification, the concentration needs to be determined.

[0169] (1) Take 1 μL of the prepared helper phage and dilute it in 2×YT liquid medium for 10 dilutions. Take 1 μL of the phage in each dilution gradient and add it to 500 μL of the newly cultured OD 600 Infect about 0.4% Escherichia coli TG1 bacterial solution in a 37°C water bath for 30 minutes. Do not shake during the water bath.

[0170] (2) While in the water bath, pour 30 2×YTE plates for use. Pipette 30 μL of the above infection solution and add 3 mL of warm semi-solid 2×YT medium to each plate. Mix thoroughly and quickly pour onto the 2×YTE plates. Perform three parallel experiments per group. Incubate in a 37°C incubator overnight.

[0171] (3) Count the plaques and calculate the phage titer.

[0172] Because the experiment required a large number of helper phages, the helper phage amplification method was subsequently used for multiple preparations.

[0173] 6. Preparation of Phage Library

[0174] The prepared primary E. coli library needs to be infected with helper phage M13K07 to release phages carrying the fusion protein. The specific method for preparing the phage library is as follows (Figure 5):

[0175] (1) Add the E. coli library to 200 mL of 2×YT / A100 / G2 medium. Culture at 37°C with shaking for about 12 h until the OD 600 Reaching around 0.4 to 0.6 (logarithmic growth period).

[0176] (2) Take 50 mL of the above culture and add 2×10 10 Incubate in a 37°C water bath for 30 min.

[0177] (3) After water bathing, centrifuge at 3600 rpm for 10 min and discard the supernatant. Resuspend the pellet in 100 mL of 2×YT / A100 / K50 / G0.1 medium. Incubate at 30°C with shaking overnight.

[0178] (4) Continue shaking the remaining culture from step 2 at 37°C for 2 h. Centrifuge at 4000 rpm for 10 min and resuspend the pellet in 10 mL of 2×YT medium containing 15% glycerol. Aliquot into 500 μL EP tubes and store at -80°C.

[0179] (5) Collect the overnight culture medium from step 3 and centrifuge at 4000 rpm for 30 min at 4°C. Transfer 40 mL of the supernatant to two 50 mL sterile centrifuge tubes. Add 10 mL of PEG / NaCl solution to each tube, mix thoroughly, and incubate on ice for at least 1 h.

[0180] (6) Centrifuge at 4000 rpm, 4°C for 30 min. Discard the supernatant and remove all PEG / NaCl solution. Resuspend the phage precipitate in 2 mL of sterile PBS. Aliquot 1 mL of the sample solution into 1.5 mL EP tubes and centrifuge at 13000 rpm for 10 min to remove bacterial cells and cell debris. Transfer the supernatant to a sterile centrifuge tube and temporarily store at 4°C. If long-term storage is required, add 15% glycerol and store at -80°C. This is the primary generation phage display library.

[0181] 7. Construction of phage-displayed sulfonium salt-stabilized peptide library

[0182] The primary phage library was removed and reacted with 10 μM 1,3,5-tribromomethylbenzene (TBMB) in an acidic buffer (70% PBS, pH = 6.0, 30% acetonitrile) at 37°C for 24 h. The peptide at the N-terminus of the phage coat protein was stabilized by a sulfonium salt, thereby obtaining a phage-displayed sulfonium salt-stabilized bicyclic peptide library ( Figure 5 ).

[0183] 8. Phage Library Enumeration

[0184] The titer of the prepared phage library needs to be measured because the phage genes in the phage library are recombinant phagemids and cannot assemble into phage particles on their own. In other words, plaques cannot be obtained by infecting E. coli TG1. Therefore, the counting method of phage library is different from that of phage. After infecting E. coli TG1, it is inoculated on a plate containing ampicillin and the number of colonies is calculated to obtain the number of phage libraries. The specific experimental steps are as follows:

[0185] (1) The phage display library was prepared according to 10 -1 to 10 -12 Perform 10-fold serial dilutions, i.e., add 10 μL of the text library to 90 μL of 2×YT, then add another 10 μL to 90 μL of 2×YT, and repeat this process 12 times. Take 10 μL of each serial dilution and add it to 90 μL of E. coli TG1 (OD 600 The cells were placed in an EP tube with a pH value of 0.4 and incubated in a 37°C water bath for 30 min. 10 μL of the infection solution was then spread on a 2×YTE / A100 / G1 solid culture plate (triplicate) and incubated at 30°C overnight.

[0186] (2) The next day, count the colonies on the solid culture plate and calculate the concentration of the phage library.

[0187] Example 4

[0188] Screening of peptide inhibitors targeting PLpro of novel coronavirus

[0189] 1. Expression, purification and biotinylation of target protein (PLpro)

[0190] Pick a single clone into 5 mL of the corresponding resistance culture medium and shake at 37 ° C overnight. Pour the bacterial solution into 1 L of the corresponding resistance culture medium and shake at 37 ° C until OD 600 When the pH value is between 0.6 and 0.8, the culture is stopped and IPTG is added for induction at 16°C for 16 to 18 hours. The cells are collected by centrifugation, resuspended in PBS, and disrupted by sonication with an appropriate amount of protease inhibitors. After disruption, the bacterial solution is centrifuged at 18,000 rpm for 50 minutes, and the supernatant is filtered through a 0.45 μM filter membrane. The His-tagged protein is first purified using a His Trap™ FF Crude column. The column is first equilibrated with ultrapure water and protein buffer. The protein solution is applied to the column three times and washed with protein buffer containing a low concentration of imidazole (less than 50 mM) to remove impurities. The imidazole concentration is then gradually increased and the protein is collected. During this period, detection is performed using Coomassie Blue G250. The collected protein solution is concentrated by ultrafiltration using an appropriate ultrafiltration tube and further purified using molecular sieves. The purified protein is biotinylated.

[0191] 2. First round of phage panning

[0192] The target protein was diluted to 5 μg / mL with PBS, and 100 μL was prepared. The streptavidin magnetic beads were coated at 37°C for at least 3 hours (or at 4°C overnight). The coating buffer was discarded and the streptavidin magnetic beads were washed 3 times with PBS solution. Then 100 μL of PBS solution containing 2% skim milk powder was added and the beads were incubated at 37°C for 3 hours (or blocked at 4°C overnight). The streptavidin magnetic beads were then rinsed 3 times with PBS. About 10 μL of the streptavidin magnetic beads were added to the MPBS buffer. 11 to 10 12 pfu phage library was placed in a 37°C incubator for 2 hours. The phage library was discarded and washed 5 times with PBST and then 5 times with PBS. 100 μL of strong acid solution (pH = 2.2) was added to the streptavidin magnetic bead tube and repeatedly flipped for 10 minutes to elute the phage that specifically binds to the antigen. Then 34 μL of 1M Tris-HCl was immediately added to the streptavidin magnetic bead tube to neutralize the phage that was eluted, flipped to mix, and the solution in the streptavidin magnetic bead tube was aspirated into a 1.5mL EP tube and stored at 4°C. 130 μL of the above solution was used to infect 10mL OD 600 = 0.4 E. coli TG1 solution, incubate in a 37°C water bath for 45 min. Add 4 mL of OD 600= 0.4 Escherichia coli TG1 solution, incubate in a 37°C water bath for 45 minutes. Then mix the two. Take out 100μL of TG1 bacterial solution and dilute it 10 times in a gradient, and take 100μL each to spread on 2×YT / A100 / G2 culture medium. Centrifuge the remaining bacterial solution at 4°C, 4000rpm for 10 minutes, and discard the supernatant. Resuspend the bacteria with a small amount of 2×YT (500μL) and spread on 3 to 10 large bacterial culture dishes. Use a scraper to collect the bacteria on the plate, dissolve the scraped bacteria in 5mL 2×YT, take 100μL of the suspension and inoculate it into 50mL of 2×YT / A100 / G2 culture medium, add 20% glycerol to the remaining bacterial solution, and store it in aliquots at -80°C. Culture the above culture solution in a 37°C incubator until OD 600 =0.4 to 0.6, add helper phage M13K07 at a 20-fold concentration. Incubate at 37°C for 30 minutes. Centrifuge at 4000 rpm for 10 minutes, discard the supernatant, and resuspend the pellet in 50 mL of 2×YT / A100 / K50 / G0.1 and incubate at 30°C with shaking overnight. The next day, collect the phage and titer them. After titration, ring-close the phage for the second round of panning.

[0193] 3. Second round of phage panning

[0194] The steps are almost the same as those in the first round. In specific operations, the target protein can be moderately reduced by 3 to 5 μg, and the magnetic beads can be replaced with neutralizing avidin magnetic beads or neutralizing avidin 96-well plates to reduce the adsorption and aggregation of the same type of magnetic beads.

[0195] 4. The third round of phage panning

[0196] The steps are almost the same as those in the first round. In specific operations, the target protein can be moderately reduced by 1 to 3 μg, and the magnetic beads can be replaced with streptavidin magnetic beads.

[0197] Focus on whether and how much phage is enriched in each of the three rounds of panning. Adjust the target protein concentration and phage quantity in each panning round based on specific circumstances. After three rounds of panning, the enrichment is typically tens to hundreds of times greater.

[0198] Table 6. Number and enrichment of phages obtained in each of the three rounds of panning

[0199] 5. High-throughput sequencing to determine the selected peptide sequence

[0200] A portion of the E. coli phage library from the third round of enrichment was removed and used for plasmid extraction. PCR was performed on random peptide fragments from the plasmids, followed by high-throughput sequencing to confirm the enriched peptide sequences. The peptides from the high-throughput sequencing were then analyzed. A total of 35 homologous peptide groups were discovered (Figure 7).

[0201] Example 5

[0202] Detection of the inhibitory effect of sulfonium salt-stabilized bicyclic peptide on PLpro enzyme activity

[0203] To determine the inhibition of protease activity by sulfonium salt-stabilized bicyclic peptide inhibitors, the LRGG-ACC substrate was used. Different concentrations of inhibitors (0 to 800 μM) were mixed with PLpro protein (0.1 μM) in an experimental buffer (5 mM NaCl, 20 mM tris, 5 mM DTT, pH = 8.0) and reacted in a 37 ° C water bath for 1 hour. After that, the substrate LRGG-ACC (1 μM) was added and the fluorescence emission intensity (λEX: 355 nm, λEM: 460 nm) was measured using a microplate reader in a black bottom 96-well plate. Nonlinear regression analysis was performed using Origin software to obtain the half-inhibitory concentration (IC) 50 .

[0204] Table 7. The peptides screened have completed peptide synthesis and enzyme activity inhibition assay

[0205] The obtained peptides were subjected to enzyme inhibition experiments to detect their activity. Among them, the bicyclic peptides W5-3M and C5-3M showed good enzyme inhibition effects, and their IC 50 The values ​​were 2.604 and 2.783 μM, respectively ( FIG8 ).

[0206] Example 6

[0207] Screening of peptide inhibitors targeting signal transducer and activator of transcription 3 (STAT3) 1. Expression, purification and biotinylation of target protein (STAT3)

[0208] Pick a single clone into 5 mL of the corresponding resistance culture medium and shake at 37 ° C overnight. Pour the bacterial solution into 1 L of the corresponding resistance culture medium and shake at 37 ° C until OD 600When the pH value is between 0.6 and 0.8, the culture is stopped and IPTG is added for induction at 16°C for 16 to 18 hours. The cells are collected by centrifugation, resuspended in PBS, and disrupted by sonication with an appropriate amount of protease inhibitors. After disruption, the bacterial solution is centrifuged at 18,000 rpm for 50 minutes, and the supernatant is filtered through a 0.45 μM filter membrane. The His-tagged protein is first purified using a His Trap™ FF Crude column. The column is first equilibrated with ultrapure water and protein buffer. The protein solution is applied to the column three times and washed with protein buffer containing a low concentration of imidazole (less than 50 mM) to remove impurities. The imidazole concentration is then gradually increased and the protein is collected. During this period, detection is performed using Coomassie Blue G250. The collected protein solution is concentrated by ultrafiltration using an appropriate ultrafiltration tube and further purified using molecular sieves. The purified protein is biotinylated.

[0209] 2. First round of phage panning

[0210] The target protein was diluted to 5 μg / mL with PBS, and 100 μL was prepared. The streptavidin magnetic beads were coated at 37°C for at least 3 hours (or at 4°C overnight). The coating buffer was discarded and the streptavidin magnetic beads were washed 3 times with PBS solution. Then 100 μL of PBS solution containing 2% skim milk powder was added and the beads were incubated at 37°C for 3 hours (or blocked at 4°C overnight). The streptavidin magnetic beads were then rinsed 3 times with PBS. About 10 μL of the streptavidin magnetic beads were added to the MPBS buffer. 11 to 10 12 pfu phage library was placed in a 37°C incubator for 2 hours. The phage library was discarded and washed 5 times with PBST and then 5 times with PBS. 100 μL of strong acid solution (pH = 2.2) was added to the streptavidin magnetic bead tube and repeatedly flipped for 10 minutes to elute the phage that specifically binds to the antigen. Then 34 μL of 1M Tris-HCl was immediately added to the streptavidin magnetic bead tube to neutralize the phage that was eluted, flipped to mix, and the solution in the streptavidin magnetic bead tube was aspirated into a 1.5mL EP tube and stored at 4°C. 130 μL of the above solution was used to infect 10mL OD 600 = 0.4 E. coli TG1 solution, incubate in a 37°C water bath for 45 min. Add 4 mL of OD 600= 0.4 Escherichia coli TG1 solution, incubate in a 37°C water bath for 45 minutes. Then mix the two. Take out 100μL of TG1 bacterial solution and dilute it 10 times in a gradient, and take 100μL each to spread on 2×YT / A100 / G2 culture medium. Centrifuge the remaining bacterial solution at 4°C, 4000rpm for 10 minutes, and discard the supernatant. Resuspend the bacteria with a small amount of 2×YT (500μL) and spread on 3 to 10 large bacterial culture dishes. Use a scraper to collect the bacteria on the plate, dissolve the scraped bacteria in 5mL 2×YT, take 100μL of the suspension and inoculate it into 50mL of 2×YT / A100 / G2 culture medium, add 20% glycerol to the remaining bacterial solution, and store it in aliquots at -80°C. Culture the above culture solution in a 37°C incubator until OD 600 =0.4 to 0.6, add helper phage M13K07 at a 20-fold concentration. Incubate at 37°C for 30 minutes. Centrifuge at 4000 rpm for 10 minutes, discard the supernatant, and resuspend the pellet in 50 mL of 2×YT / A100 / K50 / G0.1 and incubate at 30°C with shaking overnight. The next day, collect the phage and titer them. After titration, ring-close the phage for the second round of panning.

[0211] 3. Second round of phage panning

[0212] The steps are almost the same as those in the first round. In specific operations, the target protein can be moderately reduced by 3 to 5 μg, and the magnetic beads can be replaced with neutralizing avidin magnetic beads or neutralizing avidin 96-well plates to reduce the adsorption and aggregation of the same type of magnetic beads.

[0213] 4. The third round of phage panning

[0214] The steps are almost the same as those in the first round. In specific operations, the target protein can be moderately reduced by 1 to 3 μg, and the magnetic beads can be replaced with streptavidin magnetic beads.

[0215] Focus on whether and how much phage is enriched in each of the three rounds of panning. Adjust the target protein concentration and phage quantity in each panning round based on specific circumstances. After three rounds of panning, the enrichment is typically tens to hundreds of times greater.

[0216] Table 8. Number and enrichment of phages obtained in each of the three rounds of panning

[0217] 5. High-throughput sequencing to determine the selected peptide sequence

[0218] A portion of the E. coli phage library from the third round of enrichment was removed and used for plasmid extraction. PCR was performed on random peptide fragments within the plasmids, followed by high-throughput sequencing to confirm the enriched peptide sequences. The peptides from the high-throughput sequencing were then analyzed, ultimately identifying a highly homologous peptide group (Figure 9).

[0219] Example 7

[0220] Detection of the affinity between sulfonium salt-stabilized bicyclic peptide and protein STAT3

[0221] The affinity of the sulfonium salt-stabilized bicyclic peptide inhibitor for STAT3 protein was determined using the MST method. 10 μL of purified STAT3 protein solution (approximately 100 μM) was diluted 2-fold to create 16 concentration gradients. The FAM-tagged peptide was diluted to a final concentration of 40 nM. 10 μL of this was mixed with the protein gradient dilutions. The mixture was aspirated using a capillary tube and subjected to the MST experiment.

[0222] Table 9. Screened peptides have completed peptide synthesis and affinity determination

[0223] The obtained peptides were subjected to affinity testing (Table 9 and Figure 9). Among them, the bicyclic peptides ST1-3M and ST31-3M both showed good affinity effects, with Kd values ​​of 1.09 and 0.54 μM, respectively (Figure 9).

[0224] Example 8

[0225] Screening of peptide inhibitors targeting estrogen receptor α (ERα)

[0226] 1. Expression, purification and biotinylation of target protein (ERα)

[0227] Pick a single clone into 5 mL of the corresponding resistance culture medium and shake at 37 ° C overnight. Pour the bacterial solution into 1 L of the corresponding resistance culture medium and shake at 37 ° C until OD 600 When the pH value is between 0.6 and 0.8, the culture is stopped and IPTG is added for induction at 16°C for 16 to 18 hours. The cells are collected by centrifugation, resuspended in PBS, and disrupted by sonication with an appropriate amount of protease inhibitors. After disruption, the bacterial solution is centrifuged at 18,000 rpm for 50 minutes, and the supernatant is filtered through a 0.45 μM filter membrane. The His-tagged protein is first purified using a His Trap™ FF Crude column. The column is first equilibrated with ultrapure water and protein buffer. The protein solution is applied to the column three times and washed with protein buffer containing a low concentration of imidazole (less than 50 mM) to remove impurities. The imidazole concentration is then gradually increased and the protein is collected. During this period, detection is performed using Coomassie Blue G250. The collected protein solution is concentrated by ultrafiltration using an appropriate ultrafiltration tube and further purified using molecular sieves. The purified protein is biotinylated.

[0228] 2. First round of phage panning

[0229] The target protein was diluted to 5 μg / mL with PBS, and 100 μL was prepared. The streptavidin magnetic beads were coated at 37°C for at least 3 hours (or at 4°C overnight). The coating buffer was discarded and the streptavidin magnetic beads were washed 3 times with PBS solution. Then 100 μL of PBS solution containing 2% skim milk powder was added and the beads were incubated at 37°C for 3 hours (or blocked at 4°C overnight). The streptavidin magnetic beads were then rinsed 3 times with PBS. About 10 μL of the streptavidin magnetic beads were added to the MPBS buffer. 11 to 10 12 pfu phage library was placed in a 37°C incubator for 2 hours. The phage library was discarded and washed 5 times with PBST and then 5 times with PBS. 100 μL of strong acid solution (pH = 2.2) was added to the streptavidin magnetic bead tube and repeatedly flipped for 10 minutes to elute the phages that specifically bind to the antigen. Then 34 μL of 1M Tris-HCl was immediately added to the streptavidin magnetic bead tube to neutralize the phages that were eluted, flipped to mix, and the solution in the streptavidin magnetic bead tube was aspirated into a 1.5mL EP tube and stored at 4°C. 130 μL of the above solution was used to infect 10mL OD 600 = 0.4 E. coli TG1 solution, incubate in a 37°C water bath for 45 min. Add 4 mL of OD 600 = 0.4 Escherichia coli TG1 solution, incubate in a 37°C water bath for 45 minutes. Then mix the two. Take out 100μL of TG1 bacterial solution and dilute it 10 times in a gradient, and take 100μL each to spread on 2×YT / A100 / G2 culture medium. Centrifuge the remaining bacterial solution at 4°C, 4000rpm for 10 minutes, and discard the supernatant. Resuspend the bacteria with a small amount of 2×YT (500μL) and spread on 3 to 10 large bacterial culture dishes. Use a scraper to collect the bacteria on the plate, dissolve the scraped bacteria in 5mL 2×YT, take 100μL of the suspension and inoculate it into 50mL of 2×YT / A100 / G2 culture medium, add 20% glycerol to the remaining bacterial solution, and store it in aliquots at -80°C. Culture the above culture solution in a 37°C incubator until OD 600 =0.4 to 0.6, add helper phage M13K07 at a 20-fold concentration. Incubate at 37°C for 30 minutes. Centrifuge at 4000 rpm for 10 minutes, discard the supernatant, and resuspend the pellet in 50 mL of 2×YT / A100 / K50 / G0.1 and incubate at 30°C with shaking overnight. The next day, collect the phage and titer them. After titration, ring-close the phage for the second round of panning.

[0230] 3. Second round of phage panning

[0231] The steps are almost the same as those in the first round. In specific operations, the target protein can be moderately reduced by 3 to 5 μg, and the magnetic beads can be replaced with neutralizing avidin magnetic beads or neutralizing avidin 96-well plates to reduce the adsorption and aggregation of the same type of magnetic beads.

[0232] 4. The third round of phage panning

[0233] The steps are almost the same as those in the first round. In specific operations, the target protein can be moderately reduced by 1 to 3 μg, and the magnetic beads can be replaced with streptavidin magnetic beads.

[0234] Focus on whether and how much phage is enriched in each of the three rounds of panning. Adjust the target protein concentration and phage quantity in each panning round based on specific circumstances. After three rounds of panning, the enrichment is typically tens to hundreds of times greater.

[0235] Table 10. Number and enrichment of phages obtained in each of the three rounds of panning

[0236] 5. High-throughput sequencing to determine the selected peptide sequence

[0237] A portion of the E. coli phage library from the third round of enrichment (Table 10) was removed and subjected to plasmid extraction. PCR was performed on random peptide fragments within the plasmids, followed by high-throughput sequencing to confirm the enriched peptide sequences. The peptides from the high-throughput sequencing were then analyzed, ultimately identifying 20 highly homologous peptide groups.

[0238] Example 9

[0239] Detection of the affinity between sulfonium salt-stabilized bicyclic peptide and ERα protein

[0240] The affinity of the sulfonium salt-stabilized bicyclic peptide inhibitor for ERα protein was determined using the MST method. 10 μL of purified STAT3 protein solution (approximately 100 μM) was diluted two-fold to create 16 concentration gradients. The FAM-tagged peptide was diluted to a final concentration of 40 nM, and 10 μL of the protein gradient dilutions was mixed. The mixture was aspirated using a capillary tube and subjected to the MST experiment.

[0241] Table 11. Screened peptides have completed peptide synthesis and affinity determination

[0242] The obtained peptides were subjected to affinity testing (Table 11 and Figure 10). Among them, the bicyclic peptides ER-R2-3M and ER-X2-3M both showed good affinity effects, with Kd values ​​of 0.26 and 0.36 μM, respectively (Figure 10).

[0243] In this disclosure, relational terms such as first and second, etc. are used merely to distinguish one entity or operation from another entity or operation, but do not necessarily require or imply any actual relationship or order between these entities or operations.

[0244] It will be appreciated from the foregoing that, although specific embodiments of the present disclosure have been described for illustrative purposes, various modifications or variations may be made by those skilled in the art without departing from the spirit and scope of the present disclosure. Such modifications or variations are intended to fall within the scope of the appended claims of the present disclosure.

Claims

1. A phage particle complex comprising: a polypeptide displayed on the surface of the phage, a nucleic acid sequence encoding the displayed polypeptide inside the phage, and a linking compound, wherein the linking compound forms a bicyclic polypeptide containing at least three discrete ionic bonds with the polypeptide. 2 . The phage particle complex of claim 1 , wherein the linking compound has a molecular symmetry corresponding to the number of the ionic bonds.

3. The phage particle complex of claim 1 or 2, wherein the linking compound has a three-fold molecular symmetry, and the linking compound is linked to the polypeptide via three discrete ionic bonds.

4. The phage particle complex according to any one of claims 1 to 3, wherein the linking compound comprises a chemical group with a rigid structure, preferably a benzene ring structure or a cycloolefin structure, more preferably 1,3,5-tribromotoluene, 1,3,5-tris(bromomethyl)-2,4,6-triethylbenzene, 1,3,5-tris(bromomethyl)cyclohexene.

5. The phage particle complex according to any one of claims 1 to 4, wherein the polypeptide comprises at least 3 methionine residues, and the linking compound is preferably linked to the methionine residues in the polypeptide via discrete ionic bonds.

6. The phage particle complex according to any one of claims 1 to 5, wherein the polypeptide sequence comprises MXmMXnM, wherein X represents a natural amino acid residue, M represents methionine, m is an integer selected from 2 to 20, and n is an integer selected from 2 to 20.

7. The phage particle complex according to any one of claims 1 to 6, wherein the structure of the bicyclic polypeptide is: in, R is selected from the side chains of 20 natural amino acids, m is an integer selected from 2 to 20, and n is an integer selected from 2 to 20.

8. The phage particle complex of any one of claims 1 to 6, wherein the bicyclic polypeptide is selected from SEQ ID NO: 9 to SEQ ID NO:

23.

9. A polypeptide library comprising the phage particle complex according to any one of claims 1 to 8.

10. A method for preparing a phage particle complex, comprising forming a bicyclic polypeptide containing at least three discrete ionic bonds with a linker compound and a polypeptide displayed on the surface of a phage.

11. The method of claim 10, wherein the bicyclic polypeptide is formed in a polar solvent, preferably an aqueous solution of acetonitrile, an aqueous solution of methanol or any mixture thereof.

12. The method of claim 10 or 11, wherein the bicyclic polypeptide is formed at 4 to 40°C.

13. The method of any one of claims 10 to 12, wherein the bicyclic polypeptide is formed at a pH of 3 to 10.

14. The method according to any one of claims 10 to 13, wherein the reaction time of the polypeptide and the linking compound to form the bicyclic polypeptide is 1 to 36 hours.

15. The method according to any one of claims 10 to 14, wherein the linking compound comprises a chemical group with a rigid structure, preferably a benzene ring structure or an olefin structure, more preferably 1,3,5-tribromotoluene, 1,3,5-tris(bromomethyl)-2,4,6-triethylbenzene, 1,3,5-tris(bromomethyl)cyclohexene.

16. The method of any one of claims 10 to 15, wherein the bicyclic polypeptide has the structure: in, R is selected from the residues of natural amino acids, m is an integer selected from 2-20, and n is an integer selected from 2-20.

17. The method of any one of claims 10 to 16, wherein the bicyclic polypeptide is selected from SEQ ID NO: 9 to SEQ ID NO:

23.

18. A phage particle complex prepared by the method according to any one of claims 10 to 17. The phage particle complex of claim 18 , further comprising a nucleic acid sequence encoding the polypeptide.

20. The phage particle complex of claim 18 or 19, wherein the polypeptide comprises at least 3 methionine residues, and preferably discrete ionic bonds are formed by the linking compound and the methionine residues in the polypeptide.

21. Use of the polypeptide library according to claim 9 in preparing polypeptide inhibitors.

22. The use according to claim 21, wherein the polypeptide inhibitor is selected from the group consisting of infectious disease polypeptide inhibitors, tumor polypeptide inhibitors, endocrine disease polypeptide inhibitors and digestive system disease polypeptide inhibitors.

23. The use as claimed in claim 21, wherein the polypeptide inhibitor is selected from the group consisting of novel coronavirus PLpro polypeptide inhibitors, breast cancer polypeptide inhibitors, leukemia polypeptide inhibitors, nutrition and metabolic disease polypeptide inhibitors, and enteritis polypeptide inhibitors.

24. The use according to any one of claims 21 to 23, wherein the polypeptide inhibitor is selected from SEQ ID NO: 9 to SEQ ID NO:

76.

25. A nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 8.

Images