SNP mutations in MYB gene as markers of resistance to rhizomania

Abstract

The present invention relates to SNP mutations in the MYB gene as markers of plant resistance to rhizomania to be advantageously used in new methods of rhizomania resistance selection that can reduce selection time and costs, and as a source of genetic resistance for the genetic improvement of plants and, in particular, beet, such as sugar beet.

Description

[0001] SNP MUTATIONS IN THE MYB GENE AS MARKERS OF RESISTANCE TO RHIZOMANIA DESCRIPTION

[0002] The present invention relates to SNP mutations in the MYB gene as markers of plants’ resistance to rhizomania to be advantageously used in new methods of rhizomania resistance selection in order to reduce selection time and costs for the genetic improvement of plants and, in particular, beet, such as sugar beet. Rhizomania constitutes one of the main damages to sugar beet production in all climate zones. In Italy, too, the disease strongly affects the profitability of this crop. The disease is caused by the Beet necrotic yellow vein virus (BNYW), present in the soil and transmitted by the fungal vector Polymyxa betae. The main symptoms of rhizomania include rootlet proliferation and leaf yellowing (Tamada 2016). Symptoms of the disease were first detected in Italy in 1953, but the origin of the infection remained unknown until 1973 (Canova et al. 2016). A few years after the first identification of the disease, the same symptoms began to appear, almost simultaneously, in all the most important cultivation areas in the world, even geographically distant from each other. It was hypothesised that the virus and its vector were ubiquitously present in the soil, and that only under particular conditions could they become pathogenic (Asher 1993; Asher 1999). The sudden proliferation of the disease could be linked to the discovery of genetic monogermy and its incorporation into commercial varieties that took place in those very years (late 1950s). Indeed, early monogerm varieties were susceptible to various biotic stresses (Biancardi et al. 2002). The most effective method of combating the disease is the use of resistant varieties. The first selection programme began in the 1960s based on the use of sea beets from Porto Levante (Rovigo). Since then, selection for rhizomania resistance has progressed considerably, culminating in the use of monogenic resistance as of 1980. In the following years, two virus-resistant materials were released: Holly and Rizor (Canova et al. 2016), both based on the resistance gene Rz1. A few years ago it was demonstrated that Holly and Rizor share the same genetic origin: germplasm derived from the Beta maritima harvested by Ottavio Munerati in Porto Levante in 1909 (Stevanato et al. 2015). Resistance to rhizomania is also based on a second gene: Rz2. This gene is derived from Beta maritima harvested in Kalundborg, Denmark, and can be combined with Rz1 to achieve even more effective resistance (Capistrano-Gossmann et al. 2017). Both genetic resistances are found on Chromosome 3 of the sugar beet genome, which is known to be the key chromosome for resistance to rhizomania. The control of rhizomania is becoming increasingly difficult due to the emergence of mutated strains of the virus that can overcome resistance (Resistance Breaking - RB strains).

[0003] Traditional control methods are not effective against BNYW and the only strategy to control the virus is the use of genetic resistance (Scholten and Lange 2000). RNA viruses are known to have a high mutation rate, up to 3 times higher than that of DNA viruses (Santiago and Sanjuan 2005; Hughes and Hughes 2007). How advantageous this feature is for the adaptive capacity of RNA viruses is still a matter of debate in the scientific community. RNA viruses also have a shorter replication time than DNA viruses and this, combined with the high mutation rate, may explain their strong adaptability to changing environmental conditions. In the case of BNYW, these properties may be the reason for the short duration of genetic resistances based on the Rz1 source compared to resistances to other pathogens that can last for much longer periods (Acosta-Leal et al. 2009).

[0004] Three main strains of BNYW can be identified: A, B and P (Koenig et al. 2008). In particular, on the third RNA strand of each of these strains, there is the gene encoding for the virulence factor P25 (Bornemann et al. 2013). This gene shows great variability: each of the three BNYW strains has its own specific amino acid sequence at positions 67 to 70 (hyper-variable tetrad) of the P25 gene (Schirmer et al. 2005). It is precisely this strong variability that allows the virus to overcome resistance. In particular, a BNYW strain A mutation was isolated in which the hyper-variable tetrade has the amino acids “A-Y-P-R” (SEQ ID NO: 10). This sequence makes the virus particularly aggressive and capable of overcoming the genetic resistance obtained to date. It has been observed that commercial strains carrying both Rz1 and Rz2 genes show attenuated symptoms of the virus even in the presence of the mutated AYPR strain (Bornemann et al. 2015).

[0005] Given the speed with which BNYW overcomes resistance gradually introduced into varieties, it can be assumed that new resistant strains will evolve in the future. This is why new sources of resistance to rhizomania are always needed (Richardson et al. 2019).

[0006] The best source of resistance alleles to rhizomania are Crop Wild Relatives (CWRs). By virtue of the process of co-evolution with pathogens, the crop wild relatives (CWRs) of modem crops have resistance alleles that allow them to maintain a kind of equilibrium with the pathogens (Zhang and Batley 2020). This prerogative makes CWRs a natural source of resistance alleles. These populations represent a source of genetic variability that can be used in the genetic improvement of crop species (Capistrano-Gossmann et al. 2017). In the case of Beta vulgaris L., the crop wild relative, Beta maritima, is genetically close to the cultivated subspecies and this allows the introgression of useful traits by crossing (Lewellen and Whitney 1993; Hjerdin et al. 1994). Since the origin of rhizomania resistance comes from plants that vegetate in the coastal areas of the Mediterranean, possible CWRs with rhizomania resistance alleles can be identified in these very areas. In the past, it was difficult to improve resistance to rhizomania through the use of traditional genetic improvement methods. To overcome these difficulties, there is a move towards marker-assisted genetic improvement programmes. The advantages of these techniques include the fact that they make the selection work faster, more precise and less costly. This is also thanks to the support of new high-throughput genomic technologies that enable the timely and simultaneous monitoring of changes induced by genetic improvement processes on thousands of individuals. For many cultivated species, these processes have already made it possible to genetically mark important characteristics in relation to productivity, resistance to plant diseases and root system morphology and development. Previous studies, carried out by the Department of Agronomy, Animals, Food, Natural Resources and Environment - DAFNAE (University of Padua), on segregating progenies obtained by crossing between contrasting relatives with respect to the allelic condition of rhizomania resistance, have led to the development of several molecular markers linked to rhizomania resistance.

[0007] In light of the above, it can be understood how the susceptibility of sugar beet to rhizomania represents a limitation to the crop's competitiveness. There is, therefore, a clear need for new molecular markers linked to rhizomania resistance for use in the selection of resistant species and as sources of genetic resistance for the genetic improvement of sugar beet, which overcome the disadvantages of known resistance markers. This requires the use of recent innovations in the field of molecular biology and, in particular, the use of molecular marker-assisted selection to overcome the current limits to the competitiveness of the crop.

[0008] This is the background to the present invention, which has the specific aim of providing new molecular markers for resistance to rhizomania, one of the most important biotic stresses in sugar beet, for use in new selection methods for rhizomania resistance that reduce selection times and costs, and as a source of genetic resistance for the genetic improvement of beet.

[0009] It is known that SNPs (Single Nucleotide Polymorphisms) can be used as molecular markers. Nucleotide polymorphisms seem to have characteristics of the ideal genetic marker; in fact, they are widespread in the genome and can be easily detected in various laboratories. SNPs can be very useful for population genetics studies and to detect traces of selection and, individually, influence the phenotype of an individual. It is now known that groups of these small variations, when added together, cause susceptibility or resistance to many diseases, including rhizomania. SNPs are DNA sequence variations due to the alteration of a single nucleotide (A, T, C or G) in the genome sequence. They can occur either in intergenic sequences or within the structure of a gene, i.e. we can find them in coding, intronic, promoter and untranslated regions. A first type of classification concerns their presence in coding or non-coding regions. Since only a small percentage of the genome codes for proteins, most SNPs are found in non-coding regions (“non-coding SNPs”). However, those found in the actually expressed regions (“coding SNPs”) are of particular interest as they are more likely to alter the biological function of a protein. However, SNPs within a gene do not necessarily change the coded amino acid sequence, since the genetic code is degenerate. Two different types of SNPs can be distinguished according to the effect they have on the protein:

[0010] - synonymous SNPs that do not lead to changes in the amino acid sequence, i.e. the third base of the codon can vary without leading to changes in the amino acid;

[0011] - non-synonymous SNPs that instead determine amino acid substitution in the protein sequence.

[0012] SNPs that fall within the non-coding sequence (intron) can also modify gene expression by affecting, for example, splicing or DNA binding to transcription factors.

[0013] As a result of the above, SNPs are the molecular markers that are and will be most used and studied in the future. The development of a panel of SNP markers may allow the identification of specific markers associated with rhizomania resistance to be used for assisted selection in genetic improvement programmes.

[0014] Molecular marker technology is constantly improving. Molecular markers are a useful tool for monitoring the presence of genetic traits, especially when the costs of phenotyping far outweigh the costs of genotyping. An increase in the number of available SNP markers has led to an increased demand for SNP genotyping, promoting the development of numerous genotyping methods.

[0015] One of the first methods for genotyping SNPs was the TaqMan approach based on fluorescence-labelled allele-specific probes detectable by real-time PCR analysis. Another leading technology in SNP genotyping is Kompetitive Allele Specific PCR (KASP), which uses endpoint fluorescence detection to discriminate SNP allelic states. TaqMan and KASP assays are widely used for genotyping due to their high sensitivity and tolerance to variation in the quality and quantity of input DNA. A new method called rhAmp has recently been developed in addition to TaqMan and KASP technologies. This method uses the RNase H2 enzyme to limit the formation of primer dimers, which further advances the specificity of the PCR reaction.

[0016] The applicant identified new SNP mutations in the MYB gene that confer high resistance to sugar beet rhizomania. SNP mutations in the MYB gene according to the present invention represent new markers for rhizomania resistance of sugar beet and other plants of Beta vulgaris L. species to be advantageously employed in new methods of rhizomania resistance selection capable of reducing selection time and costs and as a source of genetic resistance for genetic improvement of sugar beet and other plants of Beta vulgaris L. species. According to the present invention, an extensive phenotypic screening of 17 accessions of sea beet (Beta vulgaris L. subsp. maritima) from the Department of Agronomy, Animals, Food, Natural Resources and Environment - DAFNAE (University of Padua) was carried out with the aim of identifying those resistant to rhizomania, and in particular to the mutated strain (AYPR) of the disease. Sequencing of resistant and susceptible materials resulted in several resistance-associated SNP markers that were subsequently validated. These markers can be used in assisted selection to produce parental lines and beet hybrids. In particular, the screening led to the identification of an extremely virus-resistant sea beet accession (SB_L54). SB_L54 was subjected to DNA sequencing together with other rhizomania-resistant and susceptible cultivated beet parental lines with the aim of identifying SNP mutations in genes involved in rhizomania resistance. Sequencing led to obtaining numerous resistance- associated markers, which were subsequently validated by real-time PCR allelic discrimination analysis, performed on a wide range of genotypes characterised by known levels of susceptibility and rhizomania resistance. The validation process led to the confirmation of 3 SNP markers located on a rhizomania resistance gene. These markers can advantageously be used in assisted selection to produce rhizomania-resistant parental lines and beet hybrids.

[0017] In the study described in detail below, it was possible to use an innovative virus quantification method based on qRT-PCR, which made it possible to quantify the amount of virus present in a large number of samples. This method, which is both sensitive and efficient, made it possible to detect even minimal differences between the different genotypes. In addition to the sensitivity of the method, the strain used was also decisive in the analysis. The rhizomania strain AYPR is extremely aggressive and, therefore, the study was conducted under strong selection pressure. It turned out that the resistant plants included as controls were not completely resistant - even individuals with both resistance genes Rz1 and Rz2 had a significant amount of virus in their roots. Despite the aggressiveness of the virus, screening enabled the identification of the rhizomania-resistant sea beet accession SB_L54 with the highest level of resistance discovered to date. In the second part of the study, the genetic characteristics that make SB_L54 unique compared to any other existing material were examined. The analysis was performed using two different and complementary sequencing technologies. In a first step, a whole genome analysis of rhizomania resistant and susceptible samples was carried out. In the next step, targeted sequencing of some genes previously identified as potentially linked to resistance was carried out, and a large number of samples with different phenotypes were used for this analysis. The combination of these two datasets made it possible to identify a gene strongly linked to resistance: the MYBgene, already reported in the literature as being involved in pathogen resistance (Chen et al. 2016). The MYB gene has been characterised in some plants such as wheat where it is involved in resistance to Rhizoctonia cerealis (Shan et al. 2016) and tomato, in which it is overexpressed in Tomato yellow leaf curl virus (TYLCV) infections (Li et al. 2018). Gil et al. (2020) confirmed the induction of several MYB genes during rhizomania infections. The exact sequence of the MYBgene, with the 3 SNP markers, presented in this work is not one of those characterised so far.

[0018] Molecular tools according to the present invention offer the possibility of adequately controlling the progeny of rhizomania resistance by its introgression into genotypes with high production performance, bringing certain advantages to the selection work. The use of these molecular markers will allow the definitive genetic fixation in homozygosity of the rhizomania-resistant parental lines, with the elimination of the susceptible segregating plants that are still found to a non- negligible extent in the varieties currently on the market. It would thus be possible to increase the production performance of hybrids, even in the presence of heavy infection. In conclusion, the use of the SNP assays developed according to the present invention will allow unambiguous and reproducible discrimination of homozygous-resistant and heterozygous-resistant genotypes and those susceptible to rhizomania. This approach is applicable on a large scale in genetic improvement programmes aimed at maximising resistance to rhizomania.

[0019] It is therefore a specific aim of the present invention to provide a set of three SNP markers associated with rhizomania resistance in a plant of the species Beta vulgaris L., said SNPs being located in homozygous or heterozygous form on an MYB gene of Chromosome 3 at positions corresponding to positions 44445545, 44445556 and 44445650 of Chromosome 3 of reference genome EL10_1 .0 of Beta vulgaris L., wherein said set of three SNP markers consists of SNP_44445545 wherein G is replaced with A, SNP_44445556 wherein G is replaced with A and SNP_44445650 wherein C is replaced with G.

[0020] It is known to a person skilled in the art that Chromosome 3 of Beta vulgaris L. plants can have a variable sequence in both nucleotides and nucleotide sequence length. Therefore, the positions of the SNPs on Chromosome 3 of each plant of Beta vulgaris L. may vary. This is why the above-mentioned positions 44445545, 44445556 and 44445650 are indicated as positions of a reference genome and specifically of the EL10_1 .0 reference genome of Beta vulgaris L.. A person skilled in the art knows how to identify in a genome of a Beta vulgaris L. plant the positions corresponding to those of a reference genome by aligning the genome of a Beta vulgaris L. plant with the reference genome. Therefore, positions “corresponding” to positions 44445545, 44445556 and 44445650 of Chromosome 3 of the reference genome EL10_1.0 of Beta vulgaris L. are understood to be the positions of a genome of a plant of the species Beta vulgaris L. identified by alignment with the reference genome EL10_1 .0 of Beta vulgaris L.

[0021] In particular, the positions 44445545, 44445556 and 44445650 of the EL10 1.0 reference genome fall within the gene MYB EL10Ac3g06928 (Phytozome database reference, gene link to database: https: / / phytozome- next.jgi.doe.gov / report / gene / Bvulgaris_EL10_1_0 / EL10Ac3g06928). Below is the wild type sequence of the gene MYB EL10Ac3g06928 in which the positions at which the three SNPs are located according to the invention are highlighted in bold:

[0022] ATGCTTCAATTTCAAGAACAACTAGCAGCCATGGCTGAACCACCTTCAA GCTCACCAACTCAAAACACCATCACAACAACAACAACAACAAATACAAATAAT AATACTAGTACTAAATCAAGTTGGGGAACTTTAGAAGAACTCTTGCTAGCGTG CGCCGTTCATCGATACGGCACCAATTCTTGGGACTCCATTGCTAAAGAACTC CAAAACCGCACTACTTTCTCTCTCCTAACCCCTCACATCTGTCAGCAGAAATA TCGTGACATCAAACGCCGTTTCTCCGACGATCGAAACGCCGTCGTCGAAGAT CAAAACGCCGCCGTTCGTTGGCTCGATGAGTTGCGCCGCCTCCGTGTCGCC GAACTCCGTCGCGACCTCCAACGCTACGATCTCTCCATCGTGTACGTATATAT TTACTCTCGATCTCAATTTCTCAAATTCAATTAATTAATTATTAAATTTTTCTTTT TAAGAAATTTGAGTTTAATTAAATTTTTTTTTTTTTTAAAAAAATAATAAACCGCA GGTCGTTACAATTGAAGGTGAAGAGATTGAAGGAGGAGAAAGAAAAAGAGGA GATCAAAGAAGATCTAAACAAAACCGAGGAAAATGAACCGGCGGATGTAAAA GGACCGGTTGAACCGGAAGGAAACAAACCGGACCGGATTAGTGAACCGGAC CGGGTGAGTGAACCGGCGGATGAGGAGGATGACTCGTGCAACGGCAGTTCG AACTCAAAGGAAGAGCGGCGGGAGGGAAGGAGAGAGCGAGTTGACTCGGC CGAGTTGGTGGAATCGGTGGCCGAGTCGAAGGATGAGAGTGGAGGAGAGAG AGGGGTGAAAGAGAGCAGTGACGTGCAAAGCACGGCAAGCTTGTGGAGGAG CGAGAACAATAACGATAACAGTAACGATAAGGATAATAATAATAATAATATTAT TAAAAGGAGGAGAGAGAAAAAGATCGGGTTATTTTCCGGGAGTAGTAGCGGC GATGAGAATCAATCTCCGGCGTTTAAATCAAGTAATGAGAGTAAATCGCAGCC GTTGGTTGAGTTTCTTGAAATTGTTCGGGCTCGTAAACTTGGCTTGTTTTTCG AGCGCCTTGAGTGTCAGGTAAAAATTAAACTCGGATTAATATTAATATGTGTA GTAATATAATGTTTATGTTTTATAATATGTTGATGATTGTACATTATGTACTATT GTTTGTCTTTAAAATGCTATAGGTAAAAGTCGTAGATGTCTGATTATAAATAAT TTAAAGTAATTATAATAGTAAGAACTGCATTTTGGAAAATTAAATATGAAGATG ATACTTCTAATTTTAGAATGGTCCATACTCTACTTGTTGGTATGTGAAAAGTTA CAATATTCTTATAGACGAATGATTGAAGAGATTTTTTTTTTGAAATGTAGAATTT GACTGTATTTCCTTTTTGAAGGAAAATGGACAAAATTTTCAATGCAGTGCAAAA TTGCAATGAATGTTAACGGAAAATCTAATCTAATACCAATGTAAACATACCCTT TTAAATAACGTGGATGCTCACTGTGTATGTAGAAAATGGGTGTAAAGTGCAAA CTCCCGCAGGAGATTAGTCTACTGGTCGAAGGCGAGGAAAATTCTTCGTAAT

[0023] AAGACAAAGTATATATATATATATATATATATATATATATATATATATATATATAT

[0024] ATATATATATAAATGGGTAGAGTTAAAAAAAATAAAAAATAAAAAATTCCGGAC

[0025] TACAAATTATTGATAATAATTTCATAATATGAAATGATACCTGATTTATTGTTCA

[0026] CATGCACTTAACTATAACTAGACGTTTTTTTTTATAATTTTTTTTCTTTCTTTTCT

[0027] TTTTTTTTTTTTAATAATTTGCAGTTAACTATAGGACTTCTTTTTTATAAAAAAAA

[0028] AAAATTGAGGTGTTCAAACCAACTGAGTAAAATATTTGAACAATAAAGTTAATC

[0029] AAGGTAAGAGTGATTTATACTTTCTCTGGTTTTTTCTTTGTATCGTATTATTTTT

[0030] TTACACTATTTACTTATCTCACTTATCCTTGTTAATTTTTTCTACTATATAAAGAA

[0031] AAATATAATTATGTAAAATTTTCATATATTCATCTTGTGATATAGTTTTATAATAT

[0032] TATTTTTTTATAATTTTTACATATATATAATTAGAGATATTGGTATTTAAAGTTAT

[0033] ATATTTAAAGAACGTGTTAATATGTGTGAGTTTAACAAGAGGTACTCCCTCCG

[0034] TCCTATAATATAGTGCCTATTTCATTTTTGGTGGTCAAACTTTAAAATCTTTGAC

[0035] CGAATATTCTCATTTGTATATATAAAAAAAACATATTCATGTAGGATCTTGTTAG

[0036] ATTCGTCTCAATGTGTAGTTTCATAATATCAACTTTTTATATTTTTTATCAATAA

[0037] GGAATTGAAGATATTAAAGGTCAAAGTTACGTTTTGGAGACCGTGAAAAAAGA

[0038] AACAAGCACTATATTATGGGACGGAGGGAGTAGAAAGGAAGTAATAAATAAG

[0039] TGTGAGAAAATTATGAAGAGGAAGAGAGTTGAATAGTTGTGAAAATGTGATGA

[0040] GTGCTTGAGGCTGGGGTCTGGATTGGAGTGCCTTAAAATGGACAAAGATTTG

[0041] TGGAATAGTAGTAAATGAGTGCATTTTACTGTGCATTCCAATACATATTATAAA

[0042] TATTTAATTAGTTATTAGGCCAGGTTATGTCCTAGGTAAGAAAAAAATCATTTA

[0043] TTAATATAATACTTTATAATAATAACACTAAATACAACTTAGTCTAGTGGTTCAA

[0044] CTTTAGTATATGTACTTGAGGTCTTGGGATCAAACCCTATACTTTGCAATTTTT

[0045] TAATTTTTTTATTGTACATGAATTATATGAACTAAAACTCTCTAGGGAGAGCGC

[0046] CACGTGGCACAATTTCTTATTTTCGCACGCCTTTTAATATATTTGTATAGATAG

[0047] ATTGATCGAGTGATCTTAATTGTTGCCAACTTTCTTATTATTGAACTTTCATTAG

[0048] TTAGGAATACATTAAAATATTATTTTTACATTTTTTTTCTCATTTATTACATACAT

[0049] ATTAATGTTTAATTTAATGTGTCTAAAAGGGTTGACAATTATAAGGATCACTCA

[0050] AACATTTTTCTTAAGAGATATACTACATCCGTTCCCTAAATATCTTCCTTGATA

[0051] CTGTTATTACATGTACCAATGAGAATTAATTTGTGTGGGGTGTAGGTGGTAAA

[0052] GTAGGAGAGAGAAAGGAGTTAATATAAATAAACAAATAAAAAGAAATTAAAGT

[0053] AGGAGAGAAAAAGGGAGTAAATAATGTAATGGTGAACCATATGATAGGGATA

[0054] TAAGAGGGTAAAAAAAGGAAAAAAATTCGAAATAAAGAATAAAATAAAAGAGG

[0055] GAAGGGTTTTTTGAAAACACACTTAAACAGAAAGAGGGAAAACCTTTAAAAAA TGGAGGTAGTTAACTTAACAAAAATAATAATGGTAGTCTATTCATTGGGTAAGT

[0056] TTGTAACTTTGTCAATTGAAAAGGGTATTTAATTGTTTGGAGGAAAGAGAAAG

[0057] AGTGGAGTATAGTGATTTAGATTGGAATCTATAGTGGATGAAAGGAGAGTAAA

[0058] AGAGGAAGATAAACTAACTTGAAAAGTTAAAAGTGAAAATAGCATAACATAAA

[0059] GAATAGATAAATATGAAAATTAACCTTATGAAAAAAGTAAGTAAAAAAAAAAAA

[0060] AAGAAAAATTATATTATATAATTTCTTCGTTAATTTTCTATTATAACAATTGAATT

[0061] TTCATGCATGTCAATACGCAACTTTAATTATTAATATTTTTTATTATCTTTTAGTA

[0062] AAAATTATAAAAATTTGATATTTTCAAAGTATGTTTTTCCTTATATAAAATTTACA

[0063] ATAGTTAGTGAAAATACAATTGTTGTAATTGAAAAAAAAAAGAGAAAATAGTTG

[0064] CTTAATAATTTTCTTGTTATGCGTGTCTTGTTCCTTTAGGTTTAAGCACATATAT

[0065] TAAGAGAAAGATAAAATACTTCATTAAGAGAAAGAGAGTTAGTGGGTTATTTG

[0066] ACAGCGCATATTCTAATATTGACATAGAGTTAAAGACATACTTCCTCCGTTTTT

[0067] TTATAGATGCTACATTTCTCTTAAATGGAAATGTCATAATAGATGCTACATACC

[0068] ATAAATGGATTCCTTTTCACCATAAAAATCTTAAAATACTATTAAAAAGTTGGT

[0069] GGTCCCCCACCTTCTCTTTTAAAATACTCATACTTTTTCCTTAACAAATGTTTTT

[0070] TAATTCAAAAAGTGGTGGTCCCCTACTTTCTCTCTCTACCTTTCTTAAAAACCC

[0071] TCCACTTTCTCTATGTAGCAAGAATAAAAACACGGAGGAAGTAATATAATAGA

[0072] TATTTTATACTTCATTTGTTTTTAGATATTTTTTTTATAAAGTTTTAAGTTAGAGG

[0073] TTATACTTTTATTTTGGGTAATAACTTCTCTCTATCTCTCTTAGTAAATGTTCAC

[0074] ATGGGACCCTTTTGTTTCCATTCTCTCTATTTCTCTCCTCTCCAAAAATTACAT

[0075] AGGAGTCCGTAATTTAAAAAATGTAACATCTAATAAAAAACGGAGGAAGTATA

[0076] TAGAACTATTTCAGTAATTCTCTTTAATCCAAGTAAGCCCCTTTATTTTACCTTT

[0077] AAAAATATAAAAAATATAAATACCTTATCACATGGATTAAGCAAGTTGTTGATTT

[0078] ATGAATGGGTGAAGTTTCCATCAAAGGTAGACAATAGTTTATGATTTTTTTTTA

[0079] CTTCTTCCGGGAATCCGTGGTAAGATGAATTTTCTCTCGATTGCCCTCGCACA

[0080] AGGCTGGCCCAACAAGCCCCAACCTCCCCTTATGAATTGACCAAATCAGTTTA

[0081] AAAGATAATTATTAAATATTAATTTACTGATCAAAATACATAGATTACGCATATA

[0082] AGAATCTGTGATAGCAAATTATGGGTTATAAAATATTTGAAAAATTTATATATC

[0083] CATCATATTTTTGGTGCCAGGTAAACTCAATAATGGTCATATTGGATTATCTAA

[0084] ATTAATGGCAAAAGGACCACTTTAGGATATCAATAATAACCAATTCTTATATTT

[0085] ACTTCTGAGTTCTGACCATCAAATGTGATTCTTTTTCCCATTTTTGCAGGAAAC

[0086] TCCCAAGTACACTAGCTTAATAAAACAGCATATAGATCTAGGAGCAATCCAGA

[0087] GAAGGCTGGAAGAAGGCCAATACGCAGATTGTCATACCAAATTCTACCGTGA

[0088] CCTTATGCTCCTCATCAACAACACCATTATCTTCTTTCCCAAAAATTCCCCAGA ATACAAAGCAGCACTCGAGCTCCGCCAACTGCTGAACAAACAATACCAACCG CGCTTATCTTCCAAGCCTGCCCAACCAGCACCCTTACCAAAGCCAACAAAGC CCGAACCAAAACAAGTTGATCAATCTGACCTCAAGCCGAAATTAACCATAAAT GGCCCAGTAATTGCTTGTAGAAAACGGAGTTCAATTGCAGGAAAATCGTCAA GAGGAGTAAGTGATAGAAAGGAGCGAGCAGTGGTGGCCCTAGAGGATGAAA AACCAGCTATTACTCTTGGGGAAATGGTGAAGAAACGAACAAGAGATCAGAG TTTTGGATCAAGGAGCTCATCGAGCAAGAACAATAACAGCAACCCCAGTCCA AGCAATACTGTTTCTGGCAAGGGTGAAAATTCCGGGGCTAAGGCAGATAAGA AAAAACCAACTCTTGGAAACTTGTCGAATAAGATGAAGCAGGGGTCAGGATC AGGTAAAAGTTTGTTGTTGGAGTCATTGAAGAGCTCGGATAAGAGAAAGACC AGTAATGATGGCAATGTTAAGAGTGAAAGGAGGAAAGATGAAGGTTTACAAA ATGTGCTAGGTAGTAGTAAACTTGGTAAGGAAAAGGCAAAGGCGAAGGAGGA GAAAGAGAGTCTTGAGAATAGGAGCAATAGACGGCCACCAAAGAGGGCAGC AGCAATTGCAGCTATGGGTAAGAGGGGCCGTGATGGTGGTGGAGAAGGAGA CTCACAGTCAAAGAAACGACAGAGGAAATAG (SEQ ID NO: 11 ).

[0089] Thus, according to the invention, a B. vulgaris plant resistant to rhizomania is characterised by an MYB EL10Ac3g06928 gene comprising the three SNP mutations mentioned above. In particular, the mutated gene MYB EL10Ac3g06928, i.e. including the three SNPs, has the following sequence (where the SNP mutations are indicated in bold):

[0090] ATGCTTCAATTTCAAGAACAACTAGCAGCCATGGCTGAACCACCTTCAA GCTCACCAACTCAAAACACCATCACAACAACAACAACAACAAATACAAATAAT AATACTAGTACTAAATCAAGTTGGGGAACTTTAGAAGAACTCTTGCTAGCGTG CGCCGTTCATCGATACGGCACCAATTCTTGGGACTCCATTGCTAAAGAACTC CAAAACCGCACTACTTTCTCTCTCCTAACCCCTCACATCTGTCAGCAGAAATA TCGTGACATCAAACGCCGTTTCTCCGACGATCGAAACGCCGTCGTCGAAGAT CAAAACGCCGCCGTTCGTTGGCTCGATGAGTTGCGCCGCCTCCGTGTCGCC GAACTCCGTCGCGACCTCCAACGCTACGATCTCTCCATCGTGTACGTATATAT TTACTCTCGATCTCAATTTCTCAAATTCAATTAATTAATTATTAAATTTTTCTTTT TAAGAAATTTGAGTTTAATTAAATTTTTTTTTTTTTTAAAAAAATAATAAACCGCA GGTCGTTACAATTGAAGGTGAAGAGATTGAAGGAGGAGAAAGAAAAAGAGGA GATCAAAGAAGATCTAAACAAAACCGAGGAAAATGAACCGGCAGATGTAAAA GAACCGGTTGAACCGGAAGGAAACAAACCGGACCGGATTAGTGAACCGGAC CGGGTGAGTGAACCGGCGGATGAGGAGGATGACTCGTGCAACGGGAGTTCG AACTCAAAGGAAGAGCGGCGGGAGGGAAGGAGAGAGCGAGTTGACTCGGC

[0091] CGAGTTGGTGGAATCGGTGGCCGAGTCGAAGGATGAGAGTGGAGGAGAGAG

[0092] AGGGGTGAAAGAGAGCAGTGACGTGCAAAGCACGGCAAGCTTGTGGAGGAG

[0093] CGAGAACAATAACGATAACAGTAACGATAAGGATAATAATAATAATAATATTAT

[0094] TAAAAGGAGGAGAGAGAAAAAGATCGGGTTATTTTCCGGGAGTAGTAGCGGC

[0095] GATGAGAATCAATCTCCGGCGTTTAAATCAAGTAATGAGAGTAAATCGCAGCC

[0096] GTTGGTTGAGTTTCTTGAAATTGTTCGGGCTCGTAAACTTGGCTTGTTTTTCG

[0097] AGCGCCTTGAGTGTCAGGTAAAAATTAAACTCGGATTAATATTAATATGTGTA

[0098] GTAATATAATGTTTATGTTTTATAATATGTTGATGATTGTACATTATGTACTATT

[0099] GTTTGTCTTTAAAATGCTATAGGTAAAAGTCGTAGATGTCTGATTATAAATAAT

[0100] TTAAAGTAATTATAATAGTAAGAACTGCATTTTGGAAAATTAAATATGAAGATG

[0101] ATACTTCTAATTTTAGAATGGTCCATACTCTACTTGTTGGTATGTGAAAAGTTA

[0102] CAATATTCTTATAGACGAATGATTGAAGAGATTTTTTTTTTGAAATGTAGAATTT

[0103] GACTGTATTTCCTTTTTGAAGGAAAATGGACAAAATTTTCAATGCAGTGCAAAA

[0104] TTGCAATGAATGTTAACGGAAAATCTAATCTAATACCAATGTAAACATACCCTT

[0105] TTAAATAACGTGGATGCTCACTGTGTATGTAGAAAATGGGTGTAAAGTGCAAA

[0106] CTCCCGCAGGAGATTAGTCTACTGGTCGAAGGCGAGGAAAATTCTTCGTAAT

[0107] AAGACAAAGTATATATATATATATATATATATATATATATATATATATATATATAT

[0108] ATATATATATAAATGGGTAGAGTTAAAAAAAATAAAAAATAAAAAATTCCGGAC

[0109] TACAAATTATTGATAATAATTTCATAATATGAAATGATACCTGATTTATTGTTCA

[0110] CATGCACTTAACTATAACTAGACGTTTTTTTTTATAATTTTTTTTCTTTCTTTTCT

[0111] TTTTTTTTTTTTAATAATTTGCAGTTAACTATAGGACTTCTTTTTTATAAAAAAAA

[0112] AAAATTGAGGTGTTCAAACCAACTGAGTAAAATATTTGAACAATAAAGTTAATC

[0113] AAGGTAAGAGTGATTTATACTTTCTCTGGTTTTTTCTTTGTATCGTATTATTTTT

[0114] TTACACTATTTACTTATCTCACTTATCCTTGTTAATTTTTTCTACTATATAAAGAA

[0115] AAATATAATTATGTAAAATTTTCATATATTCATCTTGTGATATAGTTTTATAATAT

[0116] TATTTTTTTATAATTTTTACATATATATAATTAGAGATATTGGTATTTAAAGTTAT

[0117] ATATTTAAAGAACGTGTTAATATGTGTGAGTTTAACAAGAGGTACTCCCTCCG

[0118] TCCTATAATATAGTGCCTATTTCATTTTTGGTGGTCAAACTTTAAAATCTTTGAC

[0119] CGAATATTCTCATTTGTATATATAAAAAAAACATATTCATGTAGGATCTTGTTAG

[0120] ATTCGTCTCAATGTGTAGTTTCATAATATCAACTTTTTATATTTTTTATCAATAA

[0121] GGAATTGAAGATATTAAAGGTCAAAGTTACGTTTTGGAGACCGTGAAAAAAGA

[0122] AACAAGCACTATATTATGGGACGGAGGGAGTAGAAAGGAAGTAATAAATAAG

[0123] TGTGAGAAAATTATGAAGAGGAAGAGAGTTGAATAGTTGTGAAAATGTGATGA GTGCTTGAGGCTGGGGTCTGGATTGGAGTGCCTTAAAATGGACAAAGATTTG

[0124] TGGAATAGTAGTAAATGAGTGCATTTTACTGTGCATTCCAATACATATTATAAA

[0125] TATTTAATTAGTTATTAGGCCAGGTTATGTCCTAGGTAAGAAAAAAATCATTTA

[0126] TTAATATAATACTTTATAATAATAACACTAAATACAACTTAGTCTAGTGGTTCAA

[0127] CTTTAGTATATGTACTTGAGGTCTTGGGATCAAACCCTATACTTTGCAATTTTT

[0128] TAATTTTTTTATTGTACATGAATTATATGAACTAAAACTCTCTAGGGAGAGCGC

[0129] CACGTGGCACAATTTCTTATTTTCGCACGCCTTTTAATATATTTGTATAGATAG

[0130] ATTGATCGAGTGATCTTAATTGTTGCCAACTTTCTTATTATTGAACTTTCATTAG

[0131] TTAGGAATACATTAAAATATTATTTTTACATTTTTTTTCTCATTTATTACATACAT

[0132] ATTAATGTTTAATTTAATGTGTCTAAAAGGGTTGACAATTATAAGGATCACTCA

[0133] AACATTTTTCTTAAGAGATATACTACATCCGTTCCCTAAATATCTTCCTTGATA

[0134] CTGTTATTACATGTACCAATGAGAATTAATTTGTGTGGGGTGTAGGTGGTAAA

[0135] GTAGGAGAGAGAAAGGAGTTAATATAAATAAACAAATAAAAAGAAATTAAAGT

[0136] AGGAGAGAAAAAGGGAGTAAATAATGTAATGGTGAACCATATGATAGGGATA

[0137] TAAGAGGGTAAAAAAAGGAAAAAAATTCGAAATAAAGAATAAAATAAAAGAGG

[0138] GAAGGGTTTTTTGAAAACACACTTAAACAGAAAGAGGGAAAACCTTTAAAAAA

[0139] TGGAGGTAGTTAACTTAACAAAAATAATAATGGTAGTCTATTCATTGGGTAAGT

[0140] TTGTAACTTTGTCAATTGAAAAGGGTATTTAATTGTTTGGAGGAAAGAGAAAG

[0141] AGTGGAGTATAGTGATTTAGATTGGAATCTATAGTGGATGAAAGGAGAGTAAA

[0142] AGAGGAAGATAAACTAACTTGAAAAGTTAAAAGTGAAAATAGCATAACATAAA

[0143] GAATAGATAAATATGAAAATTAACCTTATGAAAAAAGTAAGTAAAAAAAAAAAA

[0144] AAGAAAAATTATATTATATAATTTCTTCGTTAATTTTCTATTATAACAATTGAATT

[0145] TTCATGCATGTCAATACGCAACTTTAATTATTAATATTTTTTATTATCTTTTAGTA

[0146] AAAATTATAAAAATTTGATATTTTCAAAGTATGTTTTTCCTTATATAAAATTTACA

[0147] ATAGTTAGTGAAAATACAATTGTTGTAATTGAAAAAAAAAAGAGAAAATAGTTG

[0148] CTTAATAATTTTCTTGTTATGCGTGTCTTGTTCCTTTAGGTTTAAGCACATATAT

[0149] TAAGAGAAAGATAAAATACTTCATTAAGAGAAAGAGAGTTAGTGGGTTATTTG

[0150] ACAGCGCATATTCTAATATTGACATAGAGTTAAAGACATACTTCCTCCGTTTTT

[0151] TTATAGATGCTACATTTCTCTTAAATGGAAATGTCATAATAGATGCTACATACC

[0152] ATAAATGGATTCCTTTTCACCATAAAAATCTTAAAATACTATTAAAAAGTTGGT

[0153] GGTCCCCCACCTTCTCTTTTAAAATACTCATACTTTTTCCTTAACAAATGTTTTT

[0154] TAATTCAAAAAGTGGTGGTCCCCTACTTTCTCTCTCTACCTTTCTTAAAAACCC

[0155] TCCACTTTCTCTATGTAGCAAGAATAAAAACACGGAGGAAGTAATATAATAGA

[0156] TATTTTATACTTCATTTGTTTTTAGATATTTTTTTTATAAAGTTTTAAGTTAGAGG TTATACTTTTATTTTGGGTAATAACTTCTCTCTATCTCTCTTAGTAAATGTTCAC ATGGGACCCTTTTGTTTCCATTCTCTCTATTTCTCTCCTCTCCAAAAATTACAT AGGAGTCCGTAATTTAAAAAATGTAACATCTAATAAAAAACGGAGGAAGTATA TAGAACTATTTCAGTAATTCTCTTTAATCCAAGTAAGCCCCTTTATTTTACCTTT

[0157] AAAAATATAAAAAATATAAATACCTTATCACATGGATTAAGCAAGTTGTTGATTT ATGAATGGGTGAAGTTTCCATCAAAGGTAGACAATAGTTTATGATTTTTTTTTA CTTCTTCCGGGAATCCGTGGTAAGATGAATTTTCTCTCGATTGCCCTCGCACA

[0158] AGGCTGGCCCAACAAGCCCCAACCTCCCCTTATGAATTGACCAAATCAGTTTA AAAGATAATTATTAAATATTAATTTACTGATCAAAATACATAGATTACGCATATA AGAATCTGTGATAGCAAATTATGGGTTATAAAATATTTGAAAAATTTATATATC

[0159] CATCATATTTTTGGTGCCAGGTAAACTCAATAATGGTCATATTGGATTATCTAA ATTAATGGCAAAAGGACCACTTTAGGATATCAATAATAACCAATTCTTATATTT ACTTCTGAGTTCTGACCATCAAATGTGATTCTTTTTCCCATTTTTGCAGGAAAC

[0160] TCCCAAGTACACTAGCTTAATAAAACAGCATATAGATCTAGGAGCAATCCAGA GAAGGCTGGAAGAAGGCCAATACGCAGATTGTCATACCAAATTCTACCGTGA CCTTATGCTCCTCATCAACAACACCATTATCTTCTTTCCCAAAAATTCCCCAGA

[0161] ATACAAAGCAGCACTCGAGCTCCGCCAACTGCTGAACAAACAATACCAACCG CGCTTATCTTCCAAGCCTGCCCAACCAGCACCCTTACCAAAGCCAACAAAGC CCGAACCAAAACAAGTTGATCAATCTGACCTCAAGCCGAAATTAACCATAAAT

[0162] GGCCCAGTAATTGCTTGTAGAAAACGGAGTTCAATTGCAGGAAAATCGTCAA GAGGAGTAAGTGATAGAAAGGAGCGAGCAGTGGTGGCCCTAGAGGATGAAA AACCAGCTATTACTCTTGGGGAAATGGTGAAGAAACGAACAAGAGATCAGAG

[0163] TTTTGGATCAAGGAGCTCATCGAGCAAGAACAATAACAGCAACCCCAGTCCA AGCAATACTGTTTCTGGCAAGGGTGAAAATTCCGGGGCTAAGGCAGATAAGA AAAAACCAACTCTTGGAAACTTGTCGAATAAGATGAAGCAGGGGTCAGGATC AGGTAAAAGTTTGTTGTTGGAGTCATTGAAGAGCTCGGATAAGAGAAAGACC AGTAATGATGGCAATGTTAAGAGTGAAAGGAGGAAAGATGAAGGTTTACAAA ATGTGCTAGGTAGTAGTAAACTTGGTAAGGAAAAGGCAAAGGCGAAGGAGGA GAAAGAGAGTCTTGAGAATAGGAGCAATAGACGGCCACCAAAGAGGGCAGC AGCAATTGCAGCTATGGGTAAGAGGGGCCGTGATGGTGGTGGAGAAGGAGA

[0164] CTCACAGTCAAAGAAACGACAGAGGAAATAG (SEQ ID NO: 12).

[0165] Thus, the present invention relates to a set of three SNP markers associated with rhizomania resistance in a plant of Beta vulgaris L species, said SNPs being located in homozygous form or in heterozygous form on the MYB EL10Ac3g06928 gene of Chromosome 3 respectively in positions 623, 634 and 728 of said gene, wherein the first SNP in position 623 consists of the replacement of G with A, the second SNP in position 634 consists of the replacement of G with A and the third SNP in position 728 consists of the replacement of C with G.

[0166] Table A below shows the positions of the three SNP markers in both Chromosome 3 and the MYB EL10Ac3g06928 gene contained in Chromosome 3:

[0167] Table A

[0168] According to the present invention, the gene MYB EL10Ac3g06928 refers to the wild type sequence of the gene MYB EL10Ac3g06928 disclosed above (SEQ ID NO:11 ) or to variants of the gene MYB EL10Ac3g06928 comprising mutations at positions other than the positions of the SNPs covered by the present invention in which the functionality of the gene is not impaired, said variants being for example due to mutations or polymorphisms naturally occurring in different individuals of the same species B. vulgaris. Indeed, according to the present invention, resistance to rhizomania is specifically associated with the presence of the three SNPs mentioned above, regardless of other sequence variations that may be present in the aforementioned gene MYB EL10Ac3g06928.

[0169] Accordingly, the present invention relates to a marker associated with rhizomania resistance in a plant of the species Beta vulgaris L., wherein said marker consists of the gene MYB EL10Ac3g06928 in Chromosome 3 of the species Beta vulgaris L., said gene being characterised in that it comprises three SNPs respectively at positions 623, 634 and 728 of said gene, wherein the first SNP at position 623 consists of the replacement of G with A, the second SNP at position 634 consists of the replacement of G with A and the third SNP at position 728 consists of the replacement of C with G. According to the present invention, the numbers indicated as SNP_44445545, SNP_44445556 and SNP_44445650 denote the first, second and third SNP markers, respectively, and, in particular, indicate the position of the mutation on Chromosome 3 in the reference genome of the species Beta vulgaris L. This information allows precise identification of the SNP mutation and the sequences flanking the mutation in any plant belonging to this species.

[0170] According to an embodiment of the present invention, the set of three SNP markers is associated with the rhizomania resistance of a plant of the species Beta vulgaris L. which can be selected from the group consisting of sugar beet, red beet and leaf beet. According to an embodiment of the present invention said plant of the species Beta vulgaris L. is a sea beet (Beta vulgaris L. subsp. maritima).

[0171] According to the present invention, the term “set of three markers” means that resistance to rhizomania is conferred by the three markers together. Furthermore, according to a preferred embodiment of the present invention, said three resistance alleles (markers located on the MYB gene of Chromosome 3) are all in homozygous form or all in heterozygous form to provide resistance to rhizomania. According to the present invention, said three resistance alleles are preferably all in homozygous form, this form conferring greater resistance.

[0172] According to the present invention, the rhizomania can be rhizomania caused by the Beet necrotic yellow vein virus (e.g. by the AYPR strain).

[0173] The present invention further relates to a plant of the species Beta vulgaris L. or a cell of said plant comprising the set of three markers or the marker as defined above, said plant being resistant to rhizomania, wherein said plant of the species Beta vulgaris L. or cell of said plant is not obtained exclusively by an essentially biological method. According to a further embodiment, the plant of the species Beta vulgaris L. is a transgenic plant.

[0174] According to the present invention, the plant of the species Beta vulgaris L. may be a beet plant (choice between sugar beet, red beet and leaf beet).

[0175] A further aim of the present invention is a method for selecting a plant of the species Beta vulgaris L. resistant to rhizomania, said method comprising or consisting of detecting, in a DNA sample of said plant, the set of three SNP markers as defined above, wherein when said set of three SNP markers is present, the plant is resistant to rhizomania.

[0176] According to a preferred embodiment of the method of the present invention, the set of three markers comprises all three SNP markers in homozygous form. According to a further embodiment, the set of three markers comprises all three SNP markers in heterozygous form.

[0177] The method according to the present invention can advantageously be used to select parental lines and hybrids of plants, such as plants of the species Beta vulgaris L., resistant to rhizomania.

[0178] According to the present invention, the method may further comprise obtaining a DNA sample of said plant of the species Beta vulgaris L. prior to the step of detecting the set of three SNP markers.

[0179] According to an embodiment of the method according to the present invention, the plant of the species Beta vulgaris L. may be a beet plant selected from sugar beet, red beet and leaf beet.

[0180] The method according to the present invention can be carried out using primers and / or probes.

[0181] In particular, according to the present invention, the step of the method of detecting the set of three SNP markers can be carried out by sequencing or allelic discrimination assay, e.g. by a technique selected from the group consisting of PCR, pyrosequencing, Sanger sequencing, real-time PCR or allele-specific competitive PCR, e.g. by rhAmp technology.

[0182] According to an embodiment of the method of the present invention, said step of detecting the set of three SNP markers can be carried out by amplifying a sequence comprising or consisting of GTCGTTACAATTGAAGGTGAAGAGATTGAAGGAGGAGAAAGAAAAAGAGGAG ATCAAAGAAGATCTAAACAAAACCGAGGAAAATGAACCGGCGGATGTAAAAG GACCGGTT (SEQ ID NO: 13) for the detection of the first SNP (SNP_44445545); a sequence comprising or consisting of

[0183] AACCGGCGGATGTAAAAGGACCGGTTGAACCGGAAGGAAACAAACCG GACCGGATTAGTGAACCGGACCGGGTGAGTGAACCGGCGGATGAGGAGGAT GACTCGTGCAACGGCAGTTCGAACTCAAAGGAAGAGCGGCG (SEQ ID NO: 14) for the detection of the second SNP (SNP_44445556); and a sequence comprising or consisting of

[0184] TCTAAACAAAACCGAGGAAAATGAACCGGCGGATGTAAAAGGACCGGT

[0185] TGAACCGGAAGGAAACAAACCGGACCGGATTAGTGAACCGGACCGGGTGAG

[0186] TGAACCGGCGGATGAGGAGGATGACTCGTGCAACGGCAGTTCGAACTCAAA GGAAGAG (SEQ ID NO: 15) for the detection of the third SNP (SNP_44445650).

[0187] According to a further embodiment of the method according to the present invention, said step of detecting the set of three SNP markers can be conducted using the following primers:

[0188] Allele Specific Primer 1 : AACCGGTNCTTTTACATCC (SEQ ID NO: 16)

[0189] Allele Specific Primer 2: TCAACCGGTNCTTTTACATCT (SEQ ID NO: 17)

[0190] Locus Specific Primer: GCCGCAGGTCGTTACAATTGAA (SEQ ID NO:18) for the detection of the first SNP (SNP_44445545);

[0191] Allele Specific Primer 1 : AACCGGCNGATGTAAAAGG (SEQ ID NO: 19) Allele Specific Primer 2: GAACCGGCNGATGTAAAAGA (SEQ ID NQ:20) Locus Specific Primer: GCGCCGCTCTTCCTTTGAGTT (SEQ ID NO:21 ) for the detection of the second SNP (SNP_44445556); and

[0192] Allele Specific Primer 1 : CTCTTCCTTTGAGTTCGAACTG (SEQ ID

[0193] NO:22)

[0194] Allele Specific Primer 2: CTCTTCCTTTGAGTTCGAACTG (SEQ ID

[0195] NO:23)

[0196] Locus Specific Primer: GCTCTAAACAAAACCGAGGAAAATGAA (SEQ ID NO:24) for the detection of the third SNP (SNP_44445650) or by the use of primers having a homology of at least 90% with respect to the primers mentioned above.

[0197] In particular, SEQ ID NO: 16, 17 and 18 sequence primers, which are used for the detection of the first SNP, amplify the SEQ ID NO: 13 sequence mentioned above, SEQ ID NO: 19, 20 and 21 sequence primers, which are for the detection of the second SNP, amplify the SEQ ID NO: 14 sequence mentioned above and SEQ ID NO:22, 23 and 24 sequence primers, which are for the detection of the third SNP, amplify the SEQ ID NO: 15 sequence mentioned above.

[0198] According to a further embodiment of the method of the present invention, the step of detecting the set of three SNP markers can be carried out using the following primers: rhAmp-FF AACCGGTNCTTTTACATCCrGCCGG (SEQ ID NO:1 ) rhAmp-FY TCAACCGGTNCTTTTACATCTrGCCGG (SEQ ID NO:2) Sequence GCCGCAGGTCGTTACAATTGAArGGTGA (SEQ ID NO:3) for the first SNP (SNP_44445545); rhAmp-FF AACCGGCNGATGTAAAAGGrACCGG (SEQ ID NO:4) rhAmp-FY GAACCGGCNGATGTAAAAGArACCGG (SEQ ID NO:5) Sequence GCGCCGCTCTTCCTTTGAGTTrCGAAC (SEQ ID N0:6) for the second SNP (SNP_44445556); and rhAmp-FF CTCTTCCTTTGAGTTCGAACTGrCCGTT (SEQ ID NO:7) rhAmp-FY CTCTTCCTTTGAGTTCGAACTGrCCGTT (SEQ ID NO:8) Sequence GCTCTAAACAAAACCGAGGAAAATGAArCCGGC (SEQ ID NO:9)

[0199] For the third SNP (SNP_44445650); or by using primers having at least 90% homology with respect to the above- mentioned primers, e.g. primers with at least 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% and 99% homology to the above-mentioned primers.

[0200] In particular, SEQ ID NO:1 , 2 and 3 sequence primers, which are used for the detection of the first SNP, amplify the SEQ ID NO: 13 sequence mentioned above, SEQ ID NO:4, 5 and 6 sequence primers, which are for the detection of the second SNP, amplify the SEQ ID NO: 14 sequence mentioned above and SEQ ID NO:7, 8 and 9 sequence primers, which are for the detection of the third SNP, amplify the SEQ ID NO: 15 sequence mentioned above.

[0201] The primers mentioned above are particularly suitable for use in genotyping by real-time PCR, more specifically with rhAmp technology.

[0202] The present invention also relates to the use of the set of three SNP markers as defined above for selecting a plant of Beta vulgaris L. species resistant to rhizomania, wherein when said set of three SNP markers is present, the plant is resistant to rhizomania.

[0203] As mentioned above, according to an embodiment of the present invention, the plant of Beta vulgaris L. species may be a beet plant selected from sugar beet, red beet and leaf beet.

[0204] Furthermore, the present invention relates to the use of a plant of Beta vulgaris L. species or a cell of said plant as defined above, for the preparation of a new plant, such as a plant of Beta vulgaris L. species, resistant to rhizomania. According to an embodiment of the present invention, the use of said plant of Beta vulgaris L. species or the plant cell does not exclusively include an essentially biological method. According to a further embodiment, the new resistant plant is a transgenic plant.

[0205] Furthermore, the present invention relates to a kit for selecting a rhizomania- resistant plant of Beta vulgaris L. species, said kit comprising or consisting of primers capable of detecting the set of three SNP markers as defined in any one of claims 1 -3.

[0206] According to the present invention, said kit may comprise primers capable of amplifying a sequence comprising or consisting of

[0207] GTCGTTACAATTGAAGGTGAAGAGATTGAAGGAGGAGAAAGAAAAAGA GGAGATCAAAGAAGATCTAAACAAAACCGAGGAAAATGAACCGGCGGATGTA AAAGGACCGGTT (SEQ ID NO: 13) for the detection of the first SNP (SNP_44445545); a sequence comprising or consisting of

[0208] AACCGGCGGATGTAAAAGGACCGGTTGAACCGGAAGGAAACAAACCG GACCGGATTAGTGAACCGGACCGGGTGAGTGAACCGGCGGATGAGGAGGAT GACTCGTGCAACGGCAGTTCGAACTCAAAGGAAGAGCGGCG (SEQ ID NO: 14) for the detection of the second SNP (SNP_44445556); and a sequence comprising or consisting of

[0209] TCTAAACAAAACCGAGGAAAATGAACCGGCGGATGTAAAAGGACCGGT TGAACCGGAAGGAAACAAACCGGACCGGATTAGTGAACCGGACCGGGTGAG TGAACCGGCGGATGAGGAGGATGACTCGTGCAACGGCAGTTCGAACTCAAA GGAAGAG (SEQ ID NO: 15) for the detection of the third SNP (SNP_44445650).

[0210] According to an embodiment, the primers of said kit can be as follows:

[0211] Allele Specific Primer 1 : AACCGGTNCTTTTACATCC (SEQ ID NO: 16)

[0212] Allele Specific Primer 2: TCAACCGGTNCTTTTACATCT (SEQ ID NO: 17)

[0213] Locus Specific Primer: GCCGCAGGTCGTTACAATTGAA (SEQ ID NO:18) for the detection of the first SNP (SNP_44445545);

[0214] Allele Specific Primer 1 : AACCGGCNGATGTAAAAGG (SEQ ID NO: 19) Allele Specific Primer 2: GAACCGGCNGATGTAAAAGA (SEQ ID NQ:20) Locus Specific Primer: GCGCCGCTCTTCCTTTGAGTT (SEQ ID NO:21 ) for the detection of the second SNP (SNP_44445556); and

[0215] Allele Specific Primer 1 : CTCTTCCTTTGAGTTCGAACTG (SEQ ID

[0216] NO:22) Allele Specific Primer 2: CTCTTCCTTTGAGTTCGAACTC (SEQ ID NO:23)

[0217] Locus Specific Primer: GCTCTAAACAAAACCGAGGAAAATGAA (SEQ ID NO:24) for the detection of the third SNP (SNP_44445650) or primers with at least 90% homology with respect to the primers mentioned above.

[0218] As mentioned above, SEQ ID NO: 16, 17 and 18 sequence primers, which are used for the detection of the first SNP, amplify the SEQ ID NO: 13 sequence mentioned above, SEQ ID NO: 19, 20 and 21 sequence primers, which are for the detection of the second SNP, amplify the SEQ ID NO: 14 sequence mentioned above and SEQ ID NO:22, 23 and 24 sequence primers, which are for the detection of the third SNP, amplify the SEQ ID NO: 15 sequence mentioned above.

[0219] According to a further embodiment, the primers of said kit can be as follows: rhAmp-FF AACCGGTNCTTTTACATCCrGCCGG (SEQ ID NO:1 ) rhAmp-FY TCAACCGGTNCTTTTACATCTrGCCGG (SEQ ID NO:2) Sequence GCCGCAGGTCGTTACAATTGAArGGTGA (SEQ ID NO:3) For the detection of the first SNP (SNP_44445545); rhAmp-FF AACCGGCNGATGTAAAAGGrACCGG (SEQ ID NO:4) rhAmp-FY GAACCGGCNGATGTAAAAGArACCGG (SEQ ID NO:5) Sequence GCGCCGCTCTTCCTTTGAGTTrCGAAC (SEQ ID NO:6) for the detection of the second SNP (SNP_44445556); and rhAmp-FF CTCTTCCTTTGAGTTCGAACTGrCCGTT (SEQ ID NO:7) rhAmp-FY CTCTTCCTTTGAGTTCGAACTGrCCGTT (SEQ ID NO:8) Sequence GCTCTAAACAAAACCGAGGAAAATGAArCCGGC (SEQ ID NO:9)

[0220] For the detection of the third SNP (SNP_44445650) or primers having at least 90% homology with respect to the above- mentioned primers, e.g. the primers can have at least 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% and 99% homology to the above-mentioned primers.

[0221] As mentioned above, SEQ ID NO:1 , 2 and 3 sequence primers, which are used for the detection of the first SNP, amplify the SEQ ID NO: 13 sequence mentioned above, SEQ ID NO:4, 5 and 6 sequence primers, which are for the detection of the second SNP, amplify the SEQ ID NO: 14 sequence mentioned above and SEQ ID NO:7, 8 and 9 sequence primers, which are for the detection of the third SNP, amplify the SEQ ID NO: 15 sequence mentioned above.

[0222] The primers mentioned above are particularly suitable for use in genotyping by real-time PCR, more specifically with rhAmp technology.

[0223] According to an embodiment of the kit of the present invention, the plant of Beta vulgaris L. species may be a beet plant selected from sugar beet, red beet and leaf beet.

[0224] According to an embodiment of the present invention, the kit does not comprise primers for the detection of SNPs other than the set of three SNP markers according to the present invention. According to a further embodiment of the present invention, the kit does not comprise primers for the detection of rhizomania resistance SNPs other than the set of three SNP markers according to the present invention.

[0225] The present invention will now be described, by way of a non-limiting illustrative example, with particular reference to some illustrative examples and the figures in the accompanying drawings, wherein:

[0226] - Figure 1 shows plants grown on rhizomania-infected soil using containers with an air filtration system; these containers allow gas exchange by limiting water loss;

[0227] - Figure 2 shows the distribution of SNPs selected for AmpliSeq analysis on the EL10 sugar beet reference genome;

[0228] - Figure 3 shows the workflow for identifying the unique alleles (SNPs) of SB_L54 from WGS sequencing data;

[0229] - Figure 4 shows the relative quantification of BNYW by qRT-PCR in 17 sea beet accessions and in resistant and susceptible checks (SB: Sea Beet, RC: Resistant Check, SC: Susceptible Check);

[0230] - Figure 5 shows the phylogenetic tree obtained from the WGS data;

[0231] - Figure 6 shows the phylogenetic tree obtained from the AmpliSeq data;

[0232] - Figure 7 shows the resulting Melting Temperature (Tm) in the resistant and susceptible phenotypes; the phenotypes labelled “Grey” show an intermediate Tm between that of the resistant and susceptible genotypes;

[0233] - Figure 8 shows the “allelic discrimination plot” obtained from homozygous resistant samples, heterozygous samples and samples susceptible to rhizomania.

[0234] EXAMPLE 1 : Phenotypic screening of sea beet (Beta vulgaris L. subsp. maritima) accessions for the identification of those resistant to rhizomania by selection and validation of SIMP markers according to the present invention associated with resistance.

[0235] Materials and Methods

[0236] Plant material and breeding conditions

[0237] For the purposes of Article 170a I PC, it is declared that the plants used in this study originate from Italy.

[0238] 17 accessions of Beta maritima from the Department of Agronomy, Animals, Food, Natural Resources and Environment - DAFNAE (University of Padua, Italy).

[0239] In addition to these accessions, 5 lines (L1 , L12, L21 , L22, L31 ) from the DAFNAE Department (Italy) were included in the experiment as controls: 3 resistant lines (Resistant Control - RC: RC1_Rz1Rz1Rz2Rz2, RC2_Rz1Rz2Rz2, RC3_Rz1Rz1rz2rz2) and two susceptible lines (Susceptible Control - SC: SC1_rz1rz1rz2rz2, SC2_rz1rz1rz2rz2).

[0240] The seeds were disinfected with ethanol and hydrogen peroxide and placed to germinate. Once germinated, the seeds were planted on infected soil using specific polypropylene containers with a filtration system (Fig. 1 ). The soil used for the experiment was infected with the AYPR strain (Broccanello et al. 2018). The plants were bred for 4 weeks in a climate cell at the DAFNAE department of the University of Padua.

[0241] Nucleic acid extraction

[0242] Depending on the type of analysis to be performed, nucleic acids were extracted using different techniques:

[0243] Extraction of viral RNA for phenotyping: 0.2 g of root tissue was used for RNA extraction using the BioSprint 96 station (Qiagen, Hilden, Germany), following the method described by Chiodi et al. (2020).

[0244] DNA extraction for Whole Genome Sequencing (WGS): after the plant tissue was homogenised, genomic DNA was isolated using the Qiagen Genomic-tip procedure (Qiagen). Subsequently, the DNA was quantified using a Qubit 2.0 (Invitrogen).

[0245] DNA extraction for target amplicon sequencing (AmpliSeq): DNA extraction and quantification were performed using the Quant-iT using 1X dsDNA HS assay kit.

[0246] DNA extraction for validation: 0.2 g of leaf tissue was used to extract DNA using the BioSprint 96 station (Qiagen, Hilden, Germany).

[0247] Virus quantification by qRT-PCR

[0248] Each sample was phenotyped, i.e. the amount of virus present was detected. Phenotyping was performed in each sample by examining the P25 gene in the third RNA strand of BNYW by quantitative PCR (qRT-PCR) (Chiodi et al. 2020). Virus quantification was based on the “Ct” (=Threshold Cycle) value, which is inversely proportional to the amount of initial template DNA. The amount of virus in each sample was calculated using the ACt (Ct-sample - Ct-reference) method. As a reference, a susceptible control was used.

[0249] Sequencing

[0250] • Library preparation and WGS sequencing: 7 samples of SB_L54 (Beta maritima found to be resistant by phenotyping analysis) and 8 susceptible samples were sequenced. Genomic DNA libraries were run with NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs, 2016) using the manufacturer's recommended protocol. Briefly, 50 ng of DNA, previously digested to generate 200 bp long fragments using Adaptive Focused Acoustic technology (Covaris, Inc.), was used to prepare the libraries. The quality and quantity of the libraries were evaluated using Qubit (Invitrogen) and TapeStation (Agilent).

[0251] • Library preparation and AmpliSeq sequencing: 10 commercial varieties and one resistant sea beet were sequenced for a total of 460 samples. After extraction, the DNA of the samples was normalised to 3.3 ng / pL. The libraries were prepared using the AgriSeq HTS Library Kit (18 amplification cycles) using a panel containing 120 target SNPs distributed throughout the genome (Fig. 2).

[0252] Analysis of sequencing data

[0253] • Analysis of WGS data: SNPs were identified using FastQC (version 0.11.5), Bowtie2 (version 2.3.5.1 ), Picard-tools (version 2.18.12), Samtools (version 1.9) mpileup and BCFtools (version 1.9) to extract the variants. The files containing the variants were integrated with each other to create a genotype matrix and construct a phylogenetic tree using the R package “SNPRelate”. The variants were filtered to obtain only those unique to SB_L54 (Fig. 3).

[0254] • AmpliSeq data analysis. The data were processed with the Ion Torrent Suite software (version 5.4). The Torrent Mapping Alignment Program (version 5.2) was used to align sequences to the beet reference genome (EL10), while the Torrent Variant Caller (version 5.4) was used to call the variants. The panel containing the 120 targets allowed 430 positions to be genotyped. The file containing the variants was again used to create a genotype matrix and construct a phylogenetic tree using the R package “SNPRelate”.

[0255] • Integration of WGA and AmpliSeq datasets. The bam files of the 15 samples sequenced with WGS and the 460 sequenced with AmpliSeq were normalised. The regions covered by both datasets were extracted using Bedtools. Bcftools isec was used to extract SNPs identified on SB_L54 only.

[0256] Validation of SNPs (HRM)

[0257] Candidate SNPs were tested by High-Resolution Melting (HRM) following the method described by De Lucchi et al. (2017).

[0258] Validation of SNPs (Sanger)

[0259] As further reconfirmation of candidate SNPs, Sanger sequencing was performed. PCR reactions were performed in 50 pl volume, using PCRBIO Taq DNA Polymerase (PCR Biosystems, UK). The mix consisted of 10 pl of 5x PCRBIO Reaction Buffer, 2 pl of each primer, 0.5 pl of PCRBIO Taq DNA Polymerase, 33.5 pl of sterilised water and 2 pl of DNA. The thermal profile used is the one suggested by the manufacturer. The resulting PCR products were checked by electrophoresis and purified with ExoSAP-IT PCR Product Cleanup Reagent (Applied Biosystems, USA). Finally, Sanger sequencing was performed by Eurofins MWG Operon (Ebersberg, Germany).

[0260] Validation of SNPs (rhAmp)

[0261] The selected SNPs were finally genotyped using rhAmp technology. Genotyping was performed using 5 ng of DNA mixed with the rhAmp Genotyping Mix, consisting of rhAmp Genotyping Master Mix (catalogue number: 1076017, Integrated DNA Technology, Coralville, Iowa, USA), rhAmp Reporter Mix (catalogue number: 1076028, Integrated DNA Technology) and rhAmp SNP primers (Table 1 ). Table 1 shows the nucleotide sequences of the 3 rhAmp SNP molecular assays. Table 1

[0262] Results

[0263] The identification of a new rhizomania-resistant accession The amount of virus present in 17 sea beet accessions was detected by qRT-

[0264] PCR. SB_L54 was extremely resistant to BNYW, with a Ct of 21 ,53±0.26; while the susceptible control was confirmed as such with a Ct of 14.16±0.18 (Fig. 4). The resistant controls RC1_Rz1 Rz1 Rz2Rz2, RC2_Rz1 Rz2Rz2 and RC3_Rz1 Rz1 rz2rz2 showed a Ct of 20.69±0.50, 19.56±0.36, and 18.26±0.13, respectively.

[0265] The identification of SNP markers linked to rhizomania resistance

[0266] Two sequencing strategies were used to identify SNPs. On the one hand, a resistant accession (SB_L54) and a susceptible variety (SC1_rz1rz2rz2) were sequenced by whole-genome sequencing (Illumina WGS), and on the other hand, target amplicon sequencing (AmpliSeq) was performed on the resistant accession SB_L54 and on 10 lines with various degrees of resistance and susceptibility. Illumina WGS sequencing produced 60,650,029 SNP markers. Looking at the distribution of SNPs, it can be seen that SB_L54 (resistant) and SC1_rz1rz2rz2 (susceptible) are separate from each other (Fig. 5). Taking into account that resistance to rhizomania is mainly located on Chromosome 3 initially, the SNPs present on that chromosome were analysed. The SNPs were then filtered according to their impact on the final protein. The analysis led to the identification of 44 SNPs in regions close to the resistance genes Rz1 and Rz2.

[0267] AmpliSeq sequencing of 120 target regions (Fig. 2) generated 605 genetic variants. The analysis allowed the genotyping of already known SNPs and the identification of 492 new SNPs and 113 INDELS. Also in this analysis, the phylogenetic tree obtained shows that SB_L54 is genotypically distinct from the other materials examined (Fig. 6). The two datasets were finally integrated with each other to identify regions of interest in rhizomania resistance. Ideally, regions with homologies between cultivated lines and sea beet accessions can be used directly for introgression into the cultivated material. 19 SNPs were thus identified, including three on Chromosome 3 and in particular on the EL10Ac3g06928 gene that encodes for a transcription factor MYB.

[0268] Marker validation by HRM

[0269] The identified SNPs were validated using the HRM technique. For analysis, the SNPs were tested on additional cultivated material stabilised for resistance to rhizomania and supplied by the USDA. These samples exhibited a known rhizomania phenotype, showing varying degrees of susceptibility / resistance. Of the various candidates tested, 2 SNPs were confirmed to be associated with extremely resistant sea beet individuals (p < 0.01 ) (Fig. 7) and both are located on the EL10Ac3g06928 gene.

[0270] Marker validation by Sanger

[0271] For further verification, these markers were sequenced using the Sanger method. The analysis detected a third SNP on the same gene EL10Ac3g06928 associated with resistance. Through sequence alignment analysis, it was observed that these markers are only present in extremely resistant genotypes, while genotypes with intermediate levels of resistance only present a combination of some of these 3 SNPs.

[0272] Marker validation using rhAmp

[0273] The results of the genotyping of the 3 allelic discrimination assays are reported (Table 2). The test provided the expected result (correct assignment of genotypes) in the 3 control samples L54, CMS and F1 (L54 x CMS) and, therefore, the test was performed on all the extracted samples. Analysis of the data showed that the allelic call obtained with the 3 assays perfectly matched the expected phenotype. In particular, the genotypes indicated with the letter “R” are resistant to rhizomania while those indicated with the letter “S” are susceptible. On the genotype obtained from the cross between the resistant (pollinating) accessions, which transmitted the 3 resistance alleles, and a susceptible line (male sterile-CMS), no symptoms of infection were previously detected.

[0274] The table shows the analysis of the 3 SNP molecular markers in sugar beet individuals with resistant (R) and susceptible (S) phenotypes.

[0275] Table 2

[0276] Phenotyp SNP_444455 SNP_4444555 SNP_4444565

[0277] Name e 4 6 0

[0278] L54 R A / A A / A G / G

[0279] CMS S G / G G / G C / C

[0280] F1 (L54xCMS) R G / A G / A G / C

[0281] 1 S A / A A / A C / C

[0282] 2 S A / A A / A C / C

[0283] 3 S A / A - G / C

[0284] 4 S A / A - G / C

[0285] 5 S A / A G / G G / C

[0286] 6 S A / A G / G G / C

[0287] 7 S A / A G / G C / C

[0288] 8 S A / A A / A C / C

[0289] 9 S A / A A / A C / C

[0290] 10 S A / A A / A C / C

[0291] 11 S A / A A / A C / C

[0292] 12 S A / A A / A C / C

[0293] 13 S A / A A / A C / C

[0294] 14 S A / A A / A C / C

[0295] 15 S G / A A / A G / C

[0296] 16 S G / A A / A G / C

[0297] 17 S A / A G / G G / C

[0298] 18 S A / A G / G G / C The amplification diagram shows the results obtained from the amplification of homozygous resistant samples, heterozygous samples and samples susceptible to rhizomania (Fig. 8). In the case of resistant and susceptible homozygotes, the fluorescence signals for the resistance allele and susceptibility allele, respectively, are detected. In the case of heterozygotes, the fluorescence signals of the two alleles are detected in the same amplification diagram. The y-axis shows the fluorescence values relative to the resistance allele, and the x-axis those for the susceptibility allele. Clusters of fluorescence signals are determined:

[0299] • Resistant homozygotes (1 / 1 allele).

[0300] • Heterozygotes (both alleles 1 / 2).

[0301] • Susceptible homozygotes (2 / 2 allele).

[0302] • NTD (samples containing the reaction mixture without the DNA).

[0303] References

[0304] • Acosta-Leal R, Bryan BK, Smith JT, Rush CM (2009) Breakdown of host resistance by independent evolutionary lineages of Beet necrotic yellow vein virus involves a parallel C / U mutation in its P25 gene. The American Phytopathological Society 100(2): 127-133.

[0305] • Asher MJC (1993) Rhizomania. In: Cook DA and Scott RK “The Sugar Beet Crop” (pp. 311-346). London: Chapman & Hall.

[0306] • Asher MJC (1999) Sugar-beet rhizomania: the spread of a soilborne disease. Microbiology Today 26: 120-122.

[0307] • Biancardi E, Lewellen RT, De Biaggi M, Erichsen AW, Stevanato P (2002) The origin of rhizomania resistance in sugar beet. Euphytica 127: 383-397.

[0308] • Bornemann K, Varrelmann M (2013) Effect of sugar beet genotype on the Beet necrotic yellow vein virus P25 pathogenicity factor and evidence for a fitness penalty in resistance-breaking strains. Molecular Plant Pathology 14(4): 356-364.

[0309] • Bornemann K, Hanseb B, Varrelmann M, Stevens M (2015) Occurrence of resistance-breaking strains of Beet necrotic yellow vein virus in sugar beet in northwestern Europe and identification of a new variant of the viral pathogenicity factor P25. Plant Pathology 64: 25-34. • Broccanello C, McGrath JM, Panella L, Richardson, K, Funk A, Chiodi C, Biscarini F, Barone V, Baglieri A, Squartini A, Concheri G, Stevanato P (2018) A SNP mutation affects rhizomania-virus content of sugar beets grown on resistance-breaking soils. Euphytica, 214 (1 ): 14.

[0310] • Canova A, Giunchedi L, Biancardi E (2016) History and current status. In: Biancardi E and Tamada T “Rhizomania” (pp. 29-51 ). Cham: Springer International Publishing.

[0311] • Capistrano-Gossmann GG, Ries D, Holtgrawe D, Minoche A, Kraft T, Frerichmann SLM, Rosleff Soerensen T, Dohm JC, Gonzalez I, Schilhabel M, Varrelmann M, Tschoep H, llphoff H, Schutze K, Borchardt D, Toerjek 0, Mechelke W, Lein JC, Schechert AW, Frese L, Himmelbauer H, Weisshaar B, Kopisch-Obuch FJ (2017) Crop wild relative populations of Beta vulgaris allow direct mapping of agronomically important genes. Nature Communications 8: 15708.

[0312] • Chen B, Niu F, Liu W, Yang B, Zhang J, Ma J, Cheng H, Han F, Jiang Y (2016) Identification, cloning and characterization of R2R3-MYB gene family in canola (Brassica napus L.) identify a novel member modulating ROS accumulation and hypersensitive-like cell death. DNA Research 23(2): 101 -114.

[0313] • Chiodi C, Moro M, Squartini A, Concheri G, Occhi F, Fornasier F, Cagnin M, Bertoldo G, Broccanello C, Stevanato P (2020) High- Throughput isolation of nucleic acids from soil. Soil Systems, 4, 3.

[0314] • Chiodi C, Concheri G, Squartini A, Ravi S, Broccanello C, Moro M, Stevanato P (2021 ) Quantification of rhizomania virus by automated RNA isolation and PCR based methods in sugar beet. Virus Disease, 32 (1 ): 161-166.

[0315] • De Lucchi C, Stevanato P, Hanson L, McGrath JM, Panella L, De Biaggi M, Broccanello C, Bertaggia M, Sella M, Concheri G (2017) Molecular markers for improving control of soil-borne pathogen Fusarium oxysporum in sugar beet. Euphytica 213:71 .

[0316] • Gil JF, Wibberg D, Eini O, Savenkov El, Varrelmann M, Liebe S (2020) Comparative transcriptome analysis provides molecular insights into the interaction of Beet necrotic yellow vein virus and Beet soil-borne mosaic virus with their host sugar beet. Viruses 12: 76.

[0317] • Hjerdin A, Sall T, Nilsson NO, Bornman CH, Hallden C (1994) Genetic variation among wild and cultivated beets of the section Beta as revealed by RFLP analysis. Journal of Sugar Beet Research 31 (1 ,2): 59-67.

[0318] • Hughes AL, Hughes MAK (2007) More effective purifying selection on RNA viruses than in DNA viruses. Gene 404: 117-125.

[0319] • Koenig R, Kastirr U, Holtschulte B, Deml G, Varrelmann M (2008) Distribution of various types and P25 subtypes of Beet necrotic yellow vein virus in Germany and other European countries. Archives Virology 153: 2139-2144.

[0320] • Lewellen RT, Whitney ED (1993) Registration of germplasm lines developed from composite crosses of sugarbeet x Beta maritima. Crop Science, 33(4): 882-883.

[0321] • Li T, Zhang X, Huang Y, Xu Z, Wang F, Xiong A (2018) An R2R3-MYB transcription factor, SIMYB28, involved in the regulation of TYLCV infection in tomato. Scientia Horticulturae 237: 192-200.

[0322] • Richardson KL, Mackey B, Hellier B (2019) Resistance in Beta vulgaris L. subsp. maritima (L.) Thell. to the Rz7-breaking strain of rhizomania. Genetic Resources and Crop Evolution 66: 929-939.

[0323] • Santiago FE, Sanjuan R (2005) Adaptive value of high mutation rates of RNA viruses: separating causes from consequences. Journal of Virology 79(18): 11555-11558.

[0324] • Schirmer A, Link D, Cognat V, Moury B, Beuve M, Meunier A, Bragard C, Gilmer D, Lemaire O (2005) Phylogenetic analysis of isolates of Beet necrotic yellow vein virus collected worldwide. Journal of General Virology 86: 2897-2911.

[0325] • Scholten OE, Lange W (2000) Breeding for resistance to rhizomania in sugar beet: a review. Euphytica 112, 219-231.

[0326] • Shan T, Rong W, Xu H, Du L, Liu X, Zhang Z (2016) The wheat R2R3- MYB transcription factor TaRIMI participates in resistance response against the pathogen Rhizoctonia cerealis infection through regulating defense genes. Scientific Reports 6:28777. • Stevanato P, De Biaggi M, Broccanello C, Biancardi E, Saccomani M (2015) Molecular Genotyping of “Rizor” and “Holly” rhizomania resistances in sugar beet. Euphytica 206: 427-431 .

[0327] • Tamada T (2016) General features of Beet necrotic yellow vein virus. In: Biancardi E and Tamada T “Rhizomania” (pp. 55-83). Cham: Springer International Publishing.

[0328] • Zhang F, Batley J (2020) Exploring the application of wild species for crop improvement in a changing climate. Current Opinion in Plant Biology 56: 218-222.

Claims

CLAIMS1 ) Set of three SNP markers associated with rhizomania resistance in a plant of Beta vulgaris L species, said SNPs being located in homozygous form or in heterozygous form on the MYB EL10Ac3g06928 gene of Chromosome 3 respectively in positions 623, 634 and 728 of said gene, wherein the first SNP in position 623 consists of the replacement of G with A, the second SNP in position 634 consists of the replacement of G with A and the third SNP in position 728 consists of the replacement of C with G.2) Set according to claim 1 , wherein the plant of Beta vulgaris L species is selected from the group consisting of sugar beet, red beet, and leaf beet.3) Set according to any one of claims 1 -2, wherein the rhizomania is rhizomania caused by Beet necrotic yellow vein virus.4) Plant of Beta vulgaris L. species or cell of said plant comprising the set of three markers as defined in any one of claims 1 -3, said plant being resistant to rhizomania, provided that said plant or cell is not obtained exclusively by an essentially biological method.5) Method for selecting a rhizomania-resistant plant of Beta vulgaris L species, said method comprising detecting, in a DNA sample of said plant, the set of three SNP markers as defined in any one of claims 1 -3, wherein when said set of three SNP markers is present, the plant is resistant to rhizomania.6) Method according to claim 5, wherein said method further comprises obtaining a DNA sample of said plant before the step of detecting the set of three SNP markers.7) Method according to any of claims 5-6, wherein the plant of Beta vulgaris L species is selected from the group consisting of sugar beet, red beet, and leaf beet.8) Method according to any one of claims 5-7, wherein the step of detecting the set of three SNP markers is carried out by sequencing or allelic discrimination assay, such as by a technique selected from the group consisting of PCR, pyrosequencing, Sanger sequencing, real-time PCR or allele-specific competitive PCR.9) Method according to any one of claims 5-8, wherein the step of detecting the set of three SNP markers is carried out by amplifying a sequence comprising or consisting ofGTCGTTACAATTGAAGGTGAAGAGATTGAAGGAGGAGAAAGAAAAAGAGGAG ATCAAAGAAGATCTAAACAAAACCGAGGAAAATGAACCGGCGGATGTAAAAG GACCGGTT (SEQ ID NO: 13) for the detection of the first SNP; a sequence comprising or consisting ofAACCGGCGGATGTAAAAGGACCGGTTGAACCGGAAGGAAACAAACCGGACCGGATTAGTGAACCGGACCGGGTGAGTGAACCGGCGGATGAGGAGGATGACTCGTGCAACGGCAGTTCGAACTCAAAGGAAGAGCGGCG (SEQ ID NO: 14) for the detection of the second SNP; and a sequence comprising or consisting ofTCTAAACAAAACCGAGGAAAATGAACCGGCGGATGTAAAAGGACCGGTTGAACCGGAAGGAAACAAACCGGACCGGATTAGTGAACCGGACCGGGTGAGTGAACCGGCGGATGAGGAGGATGACTCGTGCAACGGCAGTTCGAACTCAAA GGAAGAG (SEQ ID NO: 15) for the detection of the third SNP.10) Method according to any one of claims 5-9, wherein the step of detecting the set of three SNP markers is carried out using the following primers:AACCGGTNCTTTTACATCC (SEQ ID NO: 16)TCAACCGGTNCTTTTACATCT (SEQ ID NO: 17)GCCGCAGGTCGTTACAATTGAA (SEQ ID NO: 18) for the detection of the first SNP;AACCGGCNGATGTAAAAGG (SEQ ID NO: 19)GAACCGGCNGATGTAAAAGA (SEQ ID NQ:20)GCGCCGCTCTTCCTTTGAGTT (SEQ ID NO:21 ) for the detection of the second SNP; andCTCTTCCTTTGAGTTCGAACTG (SEQ ID NO:22)CTCTTCCTTTGAGTTCGAACTC (SEQ ID NO:23)GCTCTAAACAAAACCGAGGAAAATGAA (SEQ ID NO:24) for the detection of the third SNP; or by the use of primers having a homology of at least 90% with respect to the primers mentioned above.11 ) Method according to any one of claims 5-9, wherein the step of detecting the set of three SNP markers is carried out using the following primers:AACCGGTNCTTTTACATCCrGCCGG (SEQ ID NO:1 )TCAACCGGTNCTTTTACATCTrGCCGG (SEQ ID NO:2)GCCGCAGGTCGTTACAATTGAArGGTGA (SEQ ID NO:3)for the first SNP;AACCGGCNGATGTAAAAGGrACCGG (SEQ ID NO:4)GAACCGGCNGATGTAAAAGArACCGG (SEQ ID NO:5)GCGCCGCTCTTCCTTTGAGTTrCGAAC (SEQ ID NO:6)For the second SNP; andCTCTTCCTTTGAGTTCGAACTGrCCGTT (SEQ ID NO:7)CTCTTCCTTTGAGTTCGAACTCrCCGTT (SEQ ID NO:8)GCTCTAAACAAAACCGAGGAAAATGAArCCGGC (SEQ ID NO:9)For the third SNP or by the use of primers having a homology of at least 90% with respect to the primers mentioned above.12) Use of the set of three SNP markers as defined in any one of claims 1 -3 for the selection of a rhizomania-resistant plant of Beta vulgaris L species, wherein when said set of three SNP markers is present, the plant is resistant to rhizomania.13) Use according to claim 10, wherein the plant of Beta vulgaris L species is selected from the group consisting of sugar beet, red beet, and leaf beet.14) Use of a plant of Beta vulgaris L species or a cell of said plant as defined in claim 4, for the preparation of a rhizomania-resistant plant of Beta vulgaris L species.15) Kit for selecting a rhizomania-resistant plant of Beta vulgaris L species, said kit comprising the following primers capable of detecting the set of three SNP markers as defined in any one of claims 1 -3.16) Kit according to claim 15, wherein said primers are primers capable of amplifying a sequence comprising or consisting ofGTCGTTACAATTGAAGGTGAAGAGATTGAAGGAGGAGAAAGAAAAAGAGGAG ATCAAAGAAGATCTAAACAAAACCGAGGAAAATGAACCGGCGGATGTAAAAG GACCGGTT (SEQ ID NO: 13) for the detection of the first SNP; a sequence comprising or consisting ofAACCGGCGGATGTAAAAGGACCGGTTGAACCGGAAGGAAACAAACCG GACCGGATTAGTGAACCGGACCGGGTGAGTGAACCGGCGGATGAGGAGGAT GACTCGTGCAACGGCAGTTCGAACTCAAAGGAAGAGCGGCG (SEQ ID NO: 14) for the detection of the second SNP; and a sequence comprising or consisting ofTCTAAACAAAACCGAGGAAAATGAACCGGCGGATGTAAAAGGACCGGTTGAACCGGAAGGAAACAAACCGGACCGGATTAGTGAACCGGACCGGGTGAG TGAACCGGCGGATGAGGAGGATGACTCGTGCAACGGCAGTTCGAACTCAAA GGAAGAG (SEQ ID NO: 15) for the detection of the third SNP.17) Kit according to any one of claims 15-16, wherein said primers are as follows:AACCGGTNCTTTTACATCC (SEQ ID NO: 16)TCAACCGGTNCTTTTACATCT (SEQ ID NO: 17)GCCGCAGGTCGTTACAATTGAA (SEQ ID NO: 18) for the detection of the first SNP;AACCGGCNGATGTAAAAGG (SEQ ID NO: 19)GAACCGGCNGATGTAAAAGA (SEQ ID NQ:20)GCGCCGCTCTTCCTTTGAGTT (SEQ ID NO:21 ) for the detection of the second SNP; andCTCTTCCTTTGAGTTCGAACTG (SEQ ID NO:22)CTCTTCCTTTGAGTTCGAACTC (SEQ ID NO:23)GCTCTAAACAAAACCGAGGAAAATGAA (SEQ ID NO:24) for the detection of the third SNP, or primers with at least 90% homology with respect to the primers mentioned above.18) Kit according to any one of claims 15-16, wherein said primers are as follows:AACCGGTNCTTTTACATCCrGCCGG (SEQ ID NO:1 )TCAACCGGTNCTTTTACATCTrGCCGG (SEQ ID NO:2)GCCGCAGGTCGTTACAATTGAArGGTGA (SEQ ID NO:3) for the detection of the first SNP;AACCGGCNGATGTAAAAGGrACCGG (SEQ ID NO:4)GAACCGGCNGATGTAAAAGArACCGG (SEQ ID NO:5)GCGCCGCTCTTCCTTTGAGTTrCGAAC (SEQ ID NO:6) for the detection of the second SNP; andCTCTTCCTTTGAGTTCGAACTGrCCGTT (SEQ ID NO:7)CTCTTCCTTTGAGTTCGAACTCrCCGTT (SEQ ID NO:8)GCTCTAAACAAAACCGAGGAAAATGAArCCGGC (SEQ ID NO:9) for the detection of the third SNPor primers having a homology of at least 90% with respect to the primers mentioned above.19) Kit according to any one of claims 15-18, wherein the plant of Beta vulgaris L species is selected from the group consisting of sugar beet, red beet, and leaf beet.

Images