Combination therapy

Abstract

A method for treating, inhibiting, or ameliorating cancer, such as KRAS-mutant cancer, including administering a GST-p inhibitor and either a KRAS inhibitor or a chemotherapy drug in therapeutically effective amounts to a subject suffering from the cancer in need thereof.

Description

NDJP.020WO PATENT COMBINATION THERAPY REFERENCE TO SEQUENCE LISTING

[0001] The present application is being filed along with an Electronic Sequence Listing in ST.26 format. The Electronic Sequence Listing is provided as a file entitled NDJP_020WO_SL_ST26.xml created and last saved on July 8, 2024, which is approximately 164.5KB in size. The information in the Electronic Sequence Listing is incorporated herein by reference in its entirety. FIELD

[0002] Provided herein is a method and therapeutic composition for treating, inhibiting, or ameliorating cancer. BACKGROUND

[0003] Mutation of a KRAS gene can be related to malignant tumors such as lung adenocarcinoma, mucinous adenoma, and colorectal carcinoma. Recent observations indicate that elevated levels of the protein Glutathione S-transferase-p (GST-p) is associated with such KRAS mutations.

[0004] GST-p is a member of the Glutathione S-transferase (IUBMB EC 2.5.1.18) family of six isoenzymes that play a role in detoxification by catalyzing the conjugation of hydrophobic and electrophilic compounds with reduced glutathione. The GST-p gene (GST-P1) is a polymorphic gene encoding active, functionally different GST-P1 variant proteins that are thought to function in xenobiotic metabolism. GST-P1 may play a role in susceptibility to cancer and is expressed abundantly in tumor cells. See, e.g., Aliya S. et al. Mol Cell Biochem., 2003 Nov; 253(1-2):319- 327. Glutathione S-transferase-p is an enzyme that in humans is encoded by the GST-P1 gene. See, e.g., Bora PS, et al. (Oct 1991) J. Biol. Chem., 266 (25): 16774-16777. The GST-p isoenzyme has been shown to catalyze the conjugation of GSH with some alkylating anti-cancer agents, suggesting that over-expression of GST-p would result in tumor cell resistance.

[0005] GST-p is strongly up-regulated in many cancer types, specifically KRAS-mutant lung cancer, and is also a known regulator of oncogenic MAPK and PI3K pathways. In cancer cells, overexpression of GST-p regulates apoptosis by inhibiting Jun-p53 complex in JNK pathway.NDJP.020WO PATENT

[0006] Expression of GST-p increases in various cancer cells, which may be related to resistance to some anticancer agents. See, e.g., Ban et al, Cancer Res., 1996, 56(15):3577-82; Nakajima et al., J Pharmacol Exp Ther., 2003, 306(3):861-9.

[0007] It is known that GST-p siRNA (GST-p expression inhibitor) is useful for the treatment of KRAS mutated cancer. See, e.g., US2016 / 0186183 and WO2020 / 102668.

[0008] It is also known that a combination of a GST-p siRNA and a KRAS siRNA (a KRAS expression inhibitor) may be useful for the treatment of a KRAS-mutant cancer. See Niitsu, Y. et al., Proc Natl Acad Sci USA .2020 Aug 11;117(32):19435-19445, and Niitsu. Y., Proc Jpn Acad Ser B Phys Biol Sci.2022;98(2):72-86. However, these references indicate that the effect of such a combination of the GST-p siRNA and KRAS siRNA utilized in that study is merely additive.

[0009] Thus, there is an urgent need to improve the efficacy of the methods and compositions for treating, inhibiting, or ameliorating KRAS-mutant cancer. SUMMARY

[0010] The present disclosure relates to a method for treating, inhibiting, or ameliorating KRAS- mutant cancer, including administering a GST-p inhibitor and a KRAS inhibitor in therapeutically effective amounts to a subject suffering from the KRAS-mutant cancer in need thereof.

[0011] The following provides greater detail on some of the preferred embodiments.

[0012] Embodiment 1. A method for treating, inhibiting, or ameliorating KRAS-mutant cancer, comprising: administering a Glutathione S-transferase-p (GST-p) inhibitor and a KRAS inhibitor in therapeutically effective amounts to a subject suffering from the KRAS-mutant cancer in need thereof, wherein the KRAS inhibitor binds to a KRAS-mutant protein.

[0013] Embodiment 2. The method of Embodiment 1, wherein the GST-p inhibitor is selected from the group consisting of an RNAi molecule, an antisense nucleic acid, and a vector expressing the RNAi molecule or antisense nucleic acid.

[0014] Embodiment 3. The method of Embodiment 1, wherein the GST-p inhibitor is an RNAi molecule.

[0015] Embodiment 4. The method of Embodiment 1, wherein the GST-p inhibitor is an RNAi molecule selected from the following Table 1:NDJP.020WO PATENTwherein upper case A, G, C and U refer to ribo-A, ribo-G, ribo-C and ribo-U, respectively; the lower case letters a, u, g, c, t refer to 2' -deoxy-A, 2' -deoxy-U, 2'-deoxy-G, 2'-deoxy-C, and deoxythymidine (dT = T = t) respectively; underlining refers to 2' -OMe-substituted; the lowerNDJP.020WO PATENT case letter f refers to 2' -deoxy-2' -fluoro substitution; the lower case letter s refers to a phosphorothioate linkage; and N is A, C, G, U, U, a, c, g, u, t, or a modified, inverted, or chemically modified nucleotide.

[0016] Embodiment 5. The method of Embodiment 1, wherein the GST-p inhibitor is an RNAi molecule having: a sense strand sequence GAAGCCUUUUGAGACCCUAUU (SEQ ID NO: 26); and an antisense strand sequence fUAGgGuCuCAAAAGGCUUCUU (SEQ ID NO.52), wherein A, G, C and U refer to ribo-A, ribo-G, ribo-C and ribo-U, respectively; lower case letters a, u, g, c, t refer to 2’-deoxy-A, 2’-deoxy-U, 2’-deoxy-G, 2’-deoxy-C, and deoxythymidine (dT = T = t) respectively; underlining refers to 2’-OMe-substituted; and the lower case letter f refers to 2’-deoxy-2’-fluoro substitution.

[0017] Embodiment 6. The method of any one of Embodiments 1 to 5, wherein the GST-p inhibitor is encapsulated into a lipid nanoparticle.

[0018] Embodiment 7. The method of any one of Embodiments 1 to 5, wherein the GST-p inhibitor is encapsulated into a lipid nanoparticle, and the lipid nanoparticle comprises: a) a compound having the following Formula II:b) a DSPE lipid comprising a poly ethyleneglycol (PEG) region, a multi-branched PEG region, a methoxypoly ethyleneglycol (mPEG) region, a carbonyl- methoxypolyethyleneglycol region, or a polyglycerine region; c) a sterol lipid; and d) one or more neutral lipid(s) other than the DSPE lipid and the sterol lipid.

[0019] Embodiment 8. The method of Embodiment 7, wherein the compound having the Formula II is a compound represented by the formula:NDJP.020WO PATENT

[0020] Embodiment 9. The method of Embodiment 7 or 8, wherein the sterol lipid is cholesterol.

[0021] Embodiment 10. The method of any one of Embodiments 7-9, wherein the DSPE lipid comprises a mPEG region.

[0022] Embodiment 11. The method of any one of Embodiments 7-9, wherein the DSPE lipid comprises a PEG region having a molecular mass from 200Da to 5000Da.

[0023] Embodiment 12. The method of any one of Embodiments 7-9, wherein the DSPE lipid is DSPE-mPEG-2000.

[0024] Embodiment 13. The method of any one of Embodiments 7-12, wherein the one or more neutral lipid(s) other than the DSPE lipid and the sterol lipid are phosphatidyl ethanolamine compound(s) and / or phosphatidyl choline compound(s).

[0025] Embodiment 14. The method of any one of Embodiments 7-12, wherein the one or more neutral lipid(s) other than the DSPE lipid and the sterol lipid are 1, 2-dioleoyl-sn-Glycero-3- Phosphocholine (DOPC) and / or 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE).

[0026] Embodiment 15. The method of any one of Embodiments 1-14, wherein the KRAS inhibitor is a KRAS G12C inhibitor.

[0027] Embodiment 16. The method of any one of Embodiments 1-14, wherein the KRAS inhibitor is a KRAS G12C inhibitor selected from the group consisting of ARS-3248, AMG510 (Sotorasib), MRTX849 (Adagrasib), LY3499446, LY3537982, GDC-6036, D-1553, JDQ443, BI 1823911, FMC-376, and BBO-8520.

[0028] Embodiment 17. The method of any one of Embodiments 1-14, wherein the KRAS inhibitor is Sotorasib or Adagrasib.

[0029] Embodiment 18. The method of any one of Embodiments 1-17, wherein the KRAS- mutant cancer is KRAS-mutant colorectal cancer, KRAS-mutant lung cancer, or KRAS-mutant pancreatic cancer.

[0030] Embodiment 19. The method of any one of Embodiments 1-17, wherein the KRAS- mutant cancer is KRAS-mutant lung cancer.NDJP.020WO PATENT

[0031] Embodiment 20. The method of any one of Embodiments 1-17, wherein the KRAS- mutant cancer is KRAS-mutant non-small cell lung cancer (NSCLC).

[0032] Embodiment 21. The method of any one of Embodiments 1-20, wherein the GST-p inhibitor is administered to the subject before administering the KRAS inhibitor to the subject.

[0033] Embodiment 22. The method of any one of Embodiments 1-20, wherein the GST-p inhibitor is administered to the subject after administering the KRAS inhibitor to the subject.

[0034] Embodiment 23. The method of any one of Embodiments 1-20, wherein the GST-p inhibitor and the KRAS inhibitor are administered to the subject simultaneously.

[0035] Embodiment 24. A method for treating, inhibiting, or ameliorating KRAS-mutant cancer, comprising: administering a GST-p inhibitor and a KRAS inhibitor in therapeutically effective amounts to a subject suffering from the KRAS-mutant cancer in need thereof, wherein the KRAS inhibitor is not a KRAS expression inhibitor.

[0036] Embodiment 25. The method of Embodiment 24, wherein the GST-p inhibitor is selected from the group consisting of an RNAi molecule, an antisense nucleic acid, and a vector expressing the RNAi molecule or antisense nucleic acid.

[0037] Embodiment 26. The method of Embodiment 24, wherein the GST-p inhibitor is an RNAi molecule.

[0038] Embodiment 27. The method of Embodiment 24, wherein the GST-p inhibitor is an RNAi molecule selected from the following Table 1:NDJP.020WO PATENTwherein upper case A, G, C and U refer to ribo-A, ribo-G, ribo-C and ribo-U, respectively; the lower case letters a, u, g, c, t refer to 2' -deoxy-A, 2' -deoxy-U, 2'-deoxy-G, 2'-deoxy-C, and deoxythymidine (dT = T = t) respectively; underlining refers to 2' -OMe-substituted; the lowerNDJP.020WO PATENT case letter f refers to 2' -deoxy-2' -fluoro substitution; the lower case letter s refers to a phosphorothioate linkage; and N is A, C, G, U, U, a, c, g, u, t, or a modified, inverted, or chemically modified nucleotide.

[0039] Embodiment 28. The method of Embodiment 24, wherein the GST-p inhibitor is an RNAi molecule having: a sense strand sequence GAAGCCUUUUGAGACCCUAUU (SEQ ID NO: 26); and an antisense strand sequence fUAGgGuCuCAAAAGGCUUCUU (SEQ ID NO.52), wherein A, G, C and U refer to ribo-A, ribo-G, ribo-C and ribo-U, respectively; lower case letters a, u, g, c, t refer to 2’-deoxy-A, 2’-deoxy-U, 2’-deoxy-G, 2’-deoxy-C, and deoxythymidine (dT = T = t) respectively; underlining refers to 2’-OMe-substituted; and the lower case letter f refers to 2’-deoxy-2’-fluoro substitution.

[0040] Embodiment 29. The method of any one of Embodiments 24 to 28, wherein the GST-p inhibitor is encapsulated into a lipid nanoparticle.

[0041] Embodiment 30. The method of any one of Embodiments 24 to 28, wherein the GST-p inhibitor is encapsulated into a lipid nanoparticle, and the lipid nanoparticle comprises: a) a compound having the following Formula II:b) a DSPE lipid comprising a poly ethyleneglycol (PEG) region, a multi-branched PEG region, a methoxypoly ethyleneglycol (mPEG) region, a carbonyl- methoxypolyethyleneglycol region, or a polyglycerine region; c) a sterol lipid; and d) one or more neutral lipid(s) other than the DSPE lipid and the sterol lipid.

[0042] Embodiment 31. The method of Embodiment 30, wherein the compound having the Formula II is a compound represented by the formula:NDJP.020WO PATENT.

[0043] Embodiment 32. The method of Embodiment 30 or 31, wherein the sterol lipid is cholesterol.

[0044] Embodiment 33. The method of any one of Embodiments 30-32, wherein the DSPE lipid comprises a mPEG region.

[0045] Embodiment 34. The method of any one of Embodiments 30-32, wherein the DSPE lipid comprises a PEG region having a molecular mass from 200Da to 5000Da.

[0046] Embodiment 35. The method of any one of Embodiments 30-32, wherein the DSPE lipid is DSPE-mPEG-2000.

[0047] Embodiment 36. The method of any one of Embodiments 30-35, wherein the one or more neutral lipid(s) other than the DSPE lipid and the sterol lipid are phosphatidyl ethanolamine compound(s) and / or phosphatidyl choline compound(s).

[0048] Embodiment 37. The method of any one of Embodiments 30-35, wherein the one or more neutral lipid(s) other than the DSPE lipid and the sterol lipid are 1, 2-dioleoyl-sn-Glycero-3- Phosphocholine (DOPC) and / or 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE).

[0049] Embodiment 38. The method of any one of Embodiments 24-37, wherein the KRAS inhibitor is a KRAS G12C inhibitor.

[0050] Embodiment 39. The method of any one of Embodiments 24-37, wherein the KRAS inhibitor is a KRAS G12C inhibitor selected from the group consisting of ARS-3248, AMG510 (Sotorasib), MRTX849 (Adagrasib), LY3499446, LY3537982, GDC-6036, D-1553, JDQ443, BI 1823911, FMC-376, and BBO-8520.

[0051] Embodiment 40. The method of any one of Embodiments 24-37, wherein the KRAS inhibitor is Sotorasib or Adagrasib.

[0052] Embodiment 41. The method of any one of Embodiments 24-40, wherein the KRAS- mutant cancer is KRAS-mutant colorectal cancer, KRAS-mutant lung cancer, or KRAS-mutant pancreatic cancer.NDJP.020WO PATENT

[0053] Embodiment 42. The method of any one of Embodiments 24-40, wherein the KRAS- mutant cancer is KRAS-mutant lung cancer.

[0054] Embodiment 43. The method of any one of Embodiments 24-40, wherein the KRAS- mutant cancer is KRAS-mutant non-small cell lung cancer (NSCLC).

[0055] Embodiment 44. The method of any one of Embodiments 24-43, wherein the GST-p inhibitor is administered to the subject before administering the KRAS inhibitor to the subject.

[0056] Embodiment 45. The method of any one of Embodiments 24-43, wherein the GST-p inhibitor is administered to the subject after administering the KRAS inhibitor to the subject.

[0057] Embodiment 46. The method of any one of Embodiments 24-43, wherein the GST-p inhibitor and the KRAS inhibitor are administered to the subject simultaneously.

[0058] Embodiment 47. A method for treating, inhibiting, or ameliorating KRAS-mutant cancer, comprising: administering a GST-p inhibitor and a KRAS inhibitor in therapeutically effective amounts to a subject suffering from the KRAS-mutant cancer, wherein the GST-p inhibitor and the KRAS inhibitor are synergistic as evidenced by a Loewe synergistic response score of 20 or more in a cell-based assay for the KRAS-mutant cancer. Embodiment 48. The method of Embodiment 47, wherein the cell-based assay for the KRAS- mutant cancer comprises contacting the GST-p inhibitor and the KRAS inhibitor with a H358, MiaPaca-2 or H2122 human cell line.

[0059] Embodiment 49. The method of Embodiment 47, wherein the Loewe synergistic response score is determined at least in part by analysis software that (a) generates an experimental dose-response surface by generating a matrix of percentages of control versus a plurality of amounts of the GST-p inhibitor and the KRAS inhibitor, (b) generates a Model-Based dose response surface using single dose-response fitted curves of the GST-p inhibitor and the KRAS inhibitor, and (c) compares the experimental dose-response surface to the Model-Based dose- response surface, resulting in a synergy distribution in the plurality of amounts of the GST-p inhibitor and the KRAS inhibitor.

[0060] Embodiment 50. The method of Embodiment 47, wherein the Loewe synergistic response score is 30 or more.

[0061] Embodiment 51. The method of Embodiment 47, wherein the Loewe synergistic response score is 40 or more.NDJP.020WO PATENT

[0062] Embodiment 52. A method for treating, inhibiting, or ameliorating cancer, such as KRAS-mutant cancer, comprising: administering a GST-p inhibitor and a chemotherapy drug in therapeutically effective amounts to a subject suffering from the cancer, wherein the GST-p inhibitor and the chemotherapy drug are synergistic as evidenced by a Loewe synergistic response score of 20 or more in a cell-based assay for the cancer.

[0063] Embodiment 53. The method of Embodiment 52, wherein the chemotherapy drug is selected from the group consisting of paclitaxel, gemcitabine, and cisplatin.

[0064] Embodiment 54. The method of Embodiment 52, wherein the chemotherapy drug is paclitaxel.

[0065] Embodiment 55. A method for treating, inhibiting, or ameliorating KRAS-mutant cancer, comprising: administering a GST-p inhibitor and a KRAS inhibitor in therapeutically effective amounts to a KRAS-mutant subject suffering from the KRAS-mutant cancer in need thereof.

[0066] Embodiment 56. A pharmaceutical composition for treating, inhibiting, or ameliorating KRAS-mutant cancer, comprising a GST-p inhibitor and a KRAS inhibitor, wherein the KRAS inhibitor binds to a KRAS-mutant protein.

[0067] Embodiment 57. A pharmaceutical composition for treating, inhibiting, or ameliorating KRAS-mutant cancer, comprising a GST-p inhibitor and a KRAS inhibitor, wherein the KRAS inhibitor is not a KRAS expression inhibitor.

[0068] Embodiment 58. A use of a GST-p inhibitor and a KRAS inhibitor in the manufacture of a medicament for treating, inhibiting, or ameliorating KRAS-mutant cancer, wherein the KRAS inhibitor binds to a KRAS-mutant protein.

[0069] Embodiment 59. A use of a GST-p inhibitor and a KRAS inhibitor in the manufacture of a medicament for treating, inhibiting, or ameliorating KRAS-mutant cancer, wherein the KRAS inhibitor is not a KRAS expression inhibitor.

[0070] Embodiment 60. A kit for treating, inhibiting, or ameliorating KRAS-mutant cancer, comprising a GST-p inhibitor and a KRAS inhibitor, wherein the KRAS inhibitor binds to a KRAS-mutant protein.NDJP.020WO PATENT

[0071] Embodiment 61. A kit for treating, inhibiting, or ameliorating KRAS-mutant cancer, comprising a GST-p inhibitor and a KRAS inhibitor, wherein the KRAS inhibitor is not a KRAS expression inhibitor.

[0072] Embodiment 62. A pharmaceutical composition for treating, inhibiting, or ameliorating KRAS-mutant cancer, comprising a GST-p inhibitor, wherein the composition is administered in combination with a KRAS inhibitor, wherein the KRAS inhibitor binds to a KRAS-mutant protein.

[0073] Embodiment 63. A pharmaceutical composition for treating, inhibiting, or ameliorating KRAS-mutant cancer, comprising a KRAS inhibitor, wherein the composition is administered in combination with a GST-p inhibitor, wherein the KRAS inhibitor binds to a KRAS-mutant protein.

[0074] Embodiment 64. A use of a GST-p inhibitor in the manufacture of a medicament for treating, inhibiting, or ameliorating a KRAS-mutant cancer, wherein the medicament is administered in combination with a KRAS inhibitor, and wherein the KRAS inhibitor binds to a KRAS-mutant protein.

[0075] Embodiment 65. A use of a KRAS inhibitor in the manufacture of a medicament for treating, inhibiting, or ameliorating KRAS-mutant cancer, wherein the medicament is administered in combination with a GST-p inhibitor, and wherein the KRAS inhibitor binds to a KRAS-mutant protein.

[0076] Embodiment 66. A GST-p inhibitor for the treatment of KRAS-mutant cancer, wherein the GST-p inhibitor is administered in combination with a KRAS inhibitor, and wherein the KRAS inhibitor binds to KRAS protein.

[0077] Embodiment 67. A KRAS inhibitor for the treatment of KRAS-mutant cancer, wherein the KRAS inhibitor is administered in combination with a GST-p inhibitor, and wherein the KRAS inhibitor binds to KRAS protein.

[0078] Embodiment 68. A combination of KRAS inhibitor and a GST-p inhibitor for the treatment of KRAS-mutant cancer, wherein the KRAS inhibitor binds to KRAS protein.

[0079] Embodiment 69. A combination of KRAS inhibitor and a GST-p inhibitor for the treatment of KRAS-mutant cancer, wherein the KRAS inhibitor is not a KRAS expression inhibitor.

[0080] Embodiment 70. A pharmaceutical composition for treating, inhibiting, or ameliorating cancer, such as KRAS-mutant cancer, comprising a GST-p inhibitor and a chemotherapy drug in therapeutically effective amounts, wherein the GST-p inhibitor and the chemotherapy drug areNDJP.020WO PATENT synergistic as evidenced by a Loewe synergistic response score of 20 or more in a cell-based assay for the cancer.

[0081] Embodiment 71. A use of a GST-p inhibitor and a chemotherapy drug in therapeutically effective amounts in the manufacture of a medicament for treating, inhibiting, or ameliorating cancer, such as KRAS-mutant cancer, wherein the GST-p inhibitor and the chemotherapy drug are synergistic as evidenced by a Loewe synergistic response score of 20 or more in a cell-based assay for the cancer.

[0082] Embodiment 72. A kit for treating, inhibiting, or ameliorating cancer, such as KRAS- mutant cancer, comprising a GST-p inhibitor and a chemotherapy drug in therapeutically effective amounts, wherein the GST-p inhibitor and the chemotherapy drug are synergistic as evidenced by a Loewe synergistic response score of 20 or more in a cell-based assay for the cancer.

[0083] Embodiment 73. A pharmaceutical composition for treating, inhibiting, or ameliorating cancer, such as KRAS-mutant cancer, comprising a GST-p inhibitor in a therapeutically effective amount, wherein the composition is administered in combination with a chemotherapy drug in a therapeutically effective amount, wherein the GST-p inhibitor and the chemotherapy drug are synergistic as evidenced by a Loewe synergistic response score of 20 or more in a cell-based assay for the cancer.

[0084] Embodiment 74. A pharmaceutical composition for treating, inhibiting, or ameliorating cancer, such as KRAS-mutant cancer, comprising a chemotherapy drug in a therapeutically effective amount, wherein the composition is administered in combination with a GST-p inhibitor in a therapeutically effective amount, wherein the GST-p inhibitor and the chemotherapy drug are synergistic as evidenced by a Loewe synergistic response score of 20 or more in a cell-based assay for the cancer.

[0085] Embodiment 75. A use of a GST-p inhibitor in a therapeutically effective amount in the manufacture of a medicament for treating, inhibiting, or ameliorating cancer, such as KRAS- mutant cancer, wherein the medicament is administered in combination with a chemotherapy drug in a therapeutically effective amount, and wherein the GST-p inhibitor and the chemotherapy drug are synergistic as evidenced by a Loewe synergistic response score of 20 or more in a cell-based assay for the cancer.

[0086] Embodiment 76. A use of a chemotherapy drug in a therapeutically effective amount in the manufacture of a medicament for treating, inhibiting, or ameliorating cancer, such as KRAS-NDJP.020WO PATENT mutant cancer, wherein the medicament is administered in combination with a GST-p inhibitor in a therapeutically effective amount, and wherein the GST-p inhibitor and the chemotherapy drug are synergistic as evidenced by a Loewe synergistic response score of 20 or more in a cell-based assay for the cancer.

[0087] Embodiment 77. A GST-p inhibitor in a therapeutically effective amount for the treatment of cancer, such as KRAS-mutant cancer, wherein the GST-p inhibitor is administered in combination with a chemotherapy drug in a therapeutically effective amount, and wherein the GST-p inhibitor and the chemotherapy drug are synergistic as evidenced by a Loewe synergistic response score of 20 or more in a cell-based assay for the cancer.

[0088] Embodiment 78. A chemotherapy drug in a therapeutically effective amount for the treatment of cancer, such as KRAS-mutant cancer, wherein the chemotherapy drug is administered in combination with a GST-p inhibitor in a therapeutically effective amount, and wherein the GST- p inhibitor and the chemotherapy drug are synergistic as evidenced by a Loewe synergistic response score of 20 or more in a cell-based assay for the cancer.

[0089] Embodiment 79. A combination of a GST-p inhibitor and a chemotherapy drug in therapeutically effective amounts for the treatment of cancer, such as KRAS-mutant cancer, wherein the GST-p inhibitor and the chemotherapy drug are synergistic as evidenced by a Loewe synergistic response score of 20 or more in a cell-based assay for the cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0090] Fig. 1 schematically illustrates a cell viability assay for a combination study of GST-p siRNA (siRNA No.1) with KRAS G12C inhibitor (Sotorasib or Adagrasib).

[0091] Figs. 2A and 2B illustrate plots showing that GST-p siRNA (siRNA No. 1), Sotorasib, and Adagrasib each individually impaired cellular viability in NSCLC. The data in Fig.2A shows that GST-p siRNA (siRNA No. 1) caused >80% cell death in H358 human cell lines, and that a viability IC50 was 0.004 nM in H358 human cell lines. The data in Fig. 2B shows that 72 hours post-treatment with either Sotorasib or Adagrasib achieved cell death close to the maximal level in MiaPaca-2 and H2122 cell lines, and that viabilities IC50 of Sotorasib and Adagrasib was respectively 0.07 nM and 0.01 nM in H358 human cell lines.

[0092] Fig.3 illustrates determining a Loewe synergistic response score using analysis software that (a) generated an experimental dose-response surface by generating a matrix of percentages ofNDJP.020WO PATENT control versus the various concentrations of the GST-p inhibitor and the KRAS inhibitor or chemotherapy agents, (b) generated a Model-Based dose response surface using single dose- response fitted curves of the GST-p inhibitor and the KRAS inhibitor or chemotherapy agents, and (c) compared the experimental dose-response surface to the Model-Based dose-response surface, resulting in a synergy distribution in the various concentrations of the GST-p inhibitor and the KRAS inhibitor or chemotherapy agents.

[0093] Figs.4A-H summarize data showing that GST-p inhibitor (siRNA No.1) combined with Adagrasib or Sotorasib resulted in synergistic killing of H358 cells, as indicated by Loewe synergistic response scores of 53 for GST-p inhibitor with Adagrasib or 26 for GST-p inhibitor with Sotorasib. Fig.4A is a plot of GST-p siRNA (siRNA No.1) data used for determining Loewe synergistic response in combination with Adagrasib. Fig.4B is a plot of Adagrasib data used for determining Loewe synergistic response in combination with GST-p siRNA (siRNA No.1). Fig. 4C is a plot of GST-p siRNA (siRNA No.1) data used for determining Loewe synergistic response in combination with Sotorasib. Fig. 4D is a plot of Sotorasib data used for determining Loewe synergistic response in combination with GST-p siRNA (siRNA No. 1). Fig. 4E is a plot illustrating Loewe synergy distribution in amounts of GST-p siRNA (siRNA No.1) and Adagrasib. Fig. 4F is a table summarizing Loewe synergy data, including a Loewe synergistic response score of 53 for combination of GST-p siRNA (siRNA No.1) and Adagrasib. Fig.4G is a plot illustrating Loewe synergy distribution in amounts of GST-p siRNA (siRNA No. 1) and Sotorasib. Fig. 4H is a table summarizing Loewe synergy data, including a Loewe synergistic response score of 26 for combination of GST-p siRNA (siRNA No.1) and Sotorasib.

[0094] Fig. 5 is a table showing the greatest Loewe synergistic response scores of GST-p inhibitor (siRNA No. 1) combined with Adagrasib or Sotorasib resulted in killing of MiaPaca-2 cells or H2122 cells.

[0095] Fig. 6 is a table showing the greatest Loewe synergistic response scores of GST-p inhibitor (siRNA No. 1) combined with a chemotherapy drug resulted in killing of tumor cells. DETAILED DESCRIPTION

[0096] The present disclosure relates to a method for treating, inhibiting, or ameliorating KRAS- mutant cancer, including administering a GST-p inhibitor and a KRAS inhibitor in therapeutically effective amounts to a subject suffering from the KRAS-mutant cancer in need thereof.NDJP.020WO PATENT

[0097] KRAS inhibitor

[0098] In some embodiments, the KRAS inhibitor used in combination with the GST-p inhibitor for treating, inhibiting, or ameliorating KRAS-mutant cancer may be a KRAS inhibitor which binds to a KRAS-mutant protein. The KRAS inhibitor may reversibly or irreversibly bind to KRAS-mutated protein to decrease the activity or function of the KRAS-mutant protein. In some embodiments, the KRAS inhibitor irreversibly binds to a KRAS-mutant protein. The KRAS- mutant protein may be defined as a protein where a KRAS gene is mutated, resulting in the production of an altered KRAS protein that behaves differently than the normal, non-mutated version of a protein, and / or the altered behavior contributes to the unchecked growth and survival of cancer cells, leading to the development and progression of tumors. In some embodiments, the KRAS-mutant protein has G12 mutation. In some embodiments, the KRAS-mutant protein has G12C, G12D or G12V mutation. In some embodiments, the KRAS-mutant protein has G12C mutation.

[0099] In some embodiments, the KRAS inhibitor used in combination with the GST-p inhibitor for treating, inhibiting, or ameliorating KRAS-mutant cancer may not be KRAS expression inhibitor. The KRAS expression inhibitor may be defined as an inhibitor which decreases or prevents the production (expression) of KRAS protein, whether mutant or wild-type. For example, KRAS expression inhibitor includes, but not limited to, an RNAi molecule that binds to KRAS mRNA, an antisense nucleic acid that binds to KRAS mRNA, and a vector expressing the RNAi molecule or antisense nucleic acid.

[0100] In some embodiments, a KRAS G12C inhibitor, which are a class of drugs designed to specifically target and inhibit the KRAS protein with the G12C mutation, may be used as a KRAS inhibitor in combination with a GST-p inhibitor for treating, inhibiting, or ameliorating KRAS-mutant cancer. The KRAS G12C mutation, a specific form of KRAS mutation, may be a target of the KRAS G12C inhibitor for therapeutic intervention, which has been found in a significant portion of lung adenocarcinomas and in smaller percentages of other tumor types. In some embodiments, the KRAS G12C inhibitor is more effective in non-small cell lung cancer (NSCLC) patients with the KRAS G12C mutation when used in combination with a GST-p inhibitor for treating, inhibiting, or ameliorating KRAS-mutant cancer.

[0101] In some embodiments, the KRAS G12C inhibitor may be ARS-3248 of Janssen, AMG510 (Sotorasib) of Amgen, MRTX849 (Adagrasib) of Mirati Therapeutics Inc., LY3499446NDJP.020WO PATENT of Eli Lilly and Company, LY3537982 of Eli Lilly and Company, GDC-6036 of Genentech, Inc., D-1553 of InventisBio Inc., JDQ443 of Novartis Pharmaceuticals, BI 1823911 of Boehringer Ingelheim, FMC-376 of Frontier Medicines, or BBO-8520 of BridgeBio. These KRAS G12C inhibitors are disclosed in Kwan et al. J Exp Clin Cancer Res (2022) 41:27, Snahel Patel et al. Cancer Res (2023) 83 (7_Supplement): 1142, which are hereby expressly incorporated by reference in its entirety.

[0102] In some embodiments, AMG510 (Sotorasib) or MRTX849 (Adagrasib) may be most effectively used in combination with a GST-p inhibitor for treating, inhibiting, or ameliorating KRAS-mutant cancer:

[0103] In some embodiments, several other type of cancer drugs (such as a chemotherapy drug as shown below) may be used in combination with GST-p inhibitor and KRAS inhibitor for treating, inhibiting, or ameliorating KRAS-mutant cancer. Combining drugs can increase their effectiveness and decrease the chance of the cancer developing resistance.

[0104] In some embodiments, the KRAS inhibitor in combination with a GST-p inhibitor can be used alone or in combination with other treatments such as surgery, radiation therapy, targeted therapy, or immunotherapy for treating, inhibiting, or ameliorating KRAS-mutant cancer.

[0105] Chemotherapy drug

[0106] Chemotherapy drugs of this disclosure may be a group of medications used to treat cancer by targeting and killing rapidly dividing cells. Chemotherapy drugs can be very effective in treating malignancies although they might affect normal, healthy cells that divide rapidly, which can lead to side effects.

[0107] The types of chemotherapy drugs which may be used in combination with a GST- p inhibitor in the compositions and methods of this disclosure may be:NDJP.020WO PATENT 1. Alkylating agents (e.g., cyclophosphamide, ifosfamide) which work by interfering with the DNA in the cancer cell, 2. Antimetabolites (e.g., gemcitabine, methotrexate, 5-FU) which mimic nutrients the cell needs to survive, preventing the cell from carrying out normal functions, 3. Anti-tumor antibiotics (e.g., doxorubicin, bleomycin) which interfere with enzymes involved in DNA replication, 4. Topoisomerase inhibitors (e.g., irinotecan, etoposide) which target enzymes needed for DNA replication, 5. Mitotic inhibitors (e.g., paclitaxel, vincristine) which interfere with the structures involved in cell division, or 6. Corticosteroids (e.g., prednisone, dexamethasone) which are used in conjunction with other chemotherapy drugs or to treat nausea related to chemotherapy.

[0108] In some embodiments, paclitaxel, gemcitabine, or cisplatin may be preferably used as a chemotherapy drug in combination with a GST-p inhibitor for treating, inhibiting, or ameliorating KRAS-mutant cancer.

[0109] In some embodiments, paclitaxel may be more preferably used as a chemotherapy drug in combination with a GST-p inhibitor for treating, inhibiting, or ameliorating cancer.

[0110] In some embodiments, a combination of several chemotherapy drugs may be used in combination with a GST-p inhibitor for treating, inhibiting, or ameliorating cancer. Combining drugs can increase their effectiveness and decrease the chance of the cancer developing resistance.

[0111] In some embodiments, chemotherapy drug in combination with a GST-p inhibitor can be used alone or in combination with other treatments such as surgery, radiation therapy, targeted therapy, or immunotherapy for treating, inhibiting, or ameliorating cancer.

[0112] Synergistic effect of drug combinations

[0113] In some embodiments, a KRAS inhibitor may be administered in combination with a GST-p inhibitor to a subject suffering from the KRAS-mutant cancer in therapeutically effective amounts for treating, inhibiting, or ameliorating KRAS-mutant cancer. In some embodiments, a chemotherapy drug may be administered in combination with a GST-p inhibitor to a subject suffering from the cancer in therapeutically effective amounts for treating, inhibiting, or ameliorating cancer.NDJP.020WO PATENT

[0114] In some embodiments, whether or not the KRAS inhibitor in combination with the GST-p inhibitor has a synergistic effect may be determined by using a cell-based assay for KRAS- mutant cancer and analyzing the resulting data using a Loewe model. See, e.g., Lederer et al., “Additive Dose Response Models: Defining Synergy”, Frontiers in Pharmacology (2019), which is hereby incorporated herein by reference in its entirety. In some embodiments, whether or not the chemotherapy drug in combination with the GST-p inhibitor has a synergistic effect may be determined by using a cell-based assay for cancer and analyzing the resulting data using a Loewe model. In general, analysis of the data using a Loewe model involves (a) generating an experimental dose-response surface by generating a matrix of percentages of control versus a plurality of amounts of the GST-p inhibitor and either the KRAS inhibitor or chemotherapy drug, (b) generating a model-based dose response surface using single dose-response fitted curves of the GST-p inhibitor and either the KRAS inhibitor or chemotherapy drug, and (c) comparing the experimental dose-response surface to the model-based dose-response surface, resulting in a synergy distribution in the plurality of amounts of the GST-p inhibitor and either the KRAS inhibitor or chemotherapy drug. Use of a Loewe model is appropriate when the drugs have similar modes of action and / or act on similar targets or pathways. The results of the analysis may include determination of a Loewe synergistic response score, where a score less than 10 indicates antagonism, a score greater than or equal to 10 and less than 20 indicates additivity, and a score greater to or equal to 20 indicates synergism. Analysis of the data obtained from the cell-based assay may be aided by the use of analysis software that utilizes a Loewe model. For example, use of publicly available CombenefitTManalysis software to aid in the analysis and output a Loewe synergistic response score is described in the working examples below.

[0115] In some embodiments, whether or not the KRAS inhibitor in combination with the GST-p inhibitor has a synergistic effect may be determined and evidenced by a Loewe synergistic response score of 20 or more in a cell-based assay for the KRAS-mutant cancer. In some embodiments, whether or not the chemotherapy drug in combination with the GST-p inhibitor has a synergistic effect may be determined and evidenced by a Loewe synergistic response score of 20 or more in a cell-based assay for the cancer.

[0116] In some embodiments, it may be determined and evidenced that the KRAS inhibitor or chemotherapy drug in combination with the GST-p inhibitor has a synergistic effectNDJP.020WO PATENT when the Loewe synergistic response score is 25 or more, 30 or more, 35 or more, 40 or more, 45 or more, or 50 or more.

[0117] As used herein, the term "therapeutically effective amount" may refer to the total amounts of the GST-p inhibitor and either the KRAS inhibitor or chemotherapy drug effective to achieve an intended purpose, e.g., treating, inhibiting, or ameliorating cancer. In some embodiments, the therapeutically effective amount may be the total amounts of the GST-p inhibitor and the KRAS inhibitor required to exert synergistic effect. In some embodiments, the therapeutically effective amount may be the total amounts of the GST-p inhibitor and the chemotherapy drug required to exert synergistic effect.

[0118] An effective dose of the GST-p inhibitor and the KRAS inhibitor or the chemotherapy drug may be administered from 1 to 12 times per day, or once per week. The duration of administration can be 1, 2, 3, 4, 5, 6 or 7 days, or can be 1, 2, 3, 4, 5, 6, 8, 10 or 12 weeks.

[0119] Methods for treating, inhibiting, or ameliorating KRAS-mutant cancer

[0120] Embodiments provided herein relate to a method of treating, inhibiting, or ameliorating KRAS-mutant cancer by administering a GST-p inhibitor and a KRAS inhibitor in therapeutically effective amounts to a subject suffering from the KRAS-mutant cancer in need thereof.

[0121] A KRAS-mutant cancer is defined herein as (a) a cancer cell or tumor cell containing a somatic KRAS mutation, or (b) a cancer cell or tumor cell with an abnormal expression level of KRAS including, but not limited to, amplification of the KRAS encoding DNA, or over-expression of the KRAS gene, or under-expression of the KRAS gene when compared to level found in normal, non-cancer cells.

[0122] KRAS is a gene that encodes a protein critical for transmitting signals within cells that promote cell growth and survival. Mutations in the KRAS gene are commonly found in human cancers, and such mutations cause the KRAS protein to be permanently activated, thereby promoting unchecked cell growth and tumor formation (KRAS-mutant cancer). The methods described herein can be used for treating, inhibiting, or ameliorating such KRAS-mutant cancer.

[0123] KRAS mutations are particularly prevalent in certain types of cancers:NDJP.020WO PATENT 1. Colorectal cancer: Up to 40% of colorectal cancers contain KRAS mutations. These mutations have been linked to resistance to certain types of targeted therapies (e.g., anti-EGFR therapies like cetuximab and panitumumab). 2. Lung cancer: About 25% of non-small cell lung cancer (NSCLC) have KRAS mutations. They have historically been challenging to target with specific therapies. 3. Pancreatic cancer: More than 90% of pancreatic ductal adenocarcinomas, the most common type of pancreatic cancer, carry KRAS mutations. These cancers are known for their aggressive nature and poor prognosis.

[0124] The methods described herein can be used for treating, inhibiting, or ameliorating KRAS-mutant colorectal cancer, KRAS-mutant lung cancer including KRAS-mutant non-small cell lung cancer (NSCLC), or KRAS-mutant pancreatic cancer in some embodiments.

[0125] Non-small cell lung cancer (NSCLC) is the most common type of lung cancer, making up about 85-90% of all lung cancer cases. NSCLC is generally divided into three main subtypes based on the type of cells found in the tumor: 1. Adenocarcinoma: Adenocarcinomas are the most common type of NSCLC. They are found in several common cancers, including lung, prostate, breast, and colorectal. In the context of lung cancer, adenocarcinoma tumors typically originate in the outer part of the lung. It is the most common form of lung cancer among non-smokers and is the most common type of lung cancer among women. 2. Squamous Cell Carcinoma (also called Epidermoid Carcinoma): Squamous cell carcinoma of the lungs is typically found in the central chest area in the bronchi, which are the airway branches leading directly from the trachea to the lungs. It is closely correlated with a history of smoking. 3. Large Cell (Undifferentiated) Carcinoma: This type of NSCLC can appear in any part of the lung and tends to grow and spread quickly, which can make it more challenging to treat. The term “large cell” refers to the large, round, and open appearance of the cancer cells when viewed under a microscope.

[0126] The methods described herein can be used for treating, inhibiting, or ameliorating KRAS-mutant non-small cell lung cancer (NSCLC) including these three subtypes in some embodiments.NDJP.020WO PATENT

[0127] The GST-p inhibitor combined with the KRAS inhibitor of embodiments of this disclosure can be used individually, or in combination, or in conjunction with other known drugs for treating, inhibiting, or ameliorating KRAS-mutant cancer.

[0128] An inhibitory nucleic acid molecule that "corresponds" to a GST-p gene comprises at least a fragment of the double-stranded gene, such that each strand of the double-stranded inhibitory nucleic acid molecule is capable of binding to the complementary strand of the target GST-p gene. The inhibitory nucleic acid molecule need not have perfect correspondence to the reference GST-p sequence.

[0129] In one embodiment, a siRNA has at least about 85%, 90%, 95%, 96%, 97%, 98%, or even 99% sequence identity with the target nucleic acid. For example, a 19 base pair duplex having 1-2 base pair mismatch is considered useful in the methods described herein. In other embodiments, the nucleotide sequence of the inhibitory nucleic acid molecule exhibits 1, 2, 3, 4, 5 or more mismatches.

[0130] The inhibitory nucleic acid molecules provided by embodiments described herein are not limited to siRNAs, but include any nucleic acid molecule sufficient to decrease the expression of a GST-p nucleic acid molecule or polypeptide. The DNA sequences provided herein may be used, for example, in the discovery and development of therapeutic antisense nucleic acid molecule to decrease the expression of the encoded protein. Embodiments provided herein further provide catalytic RNA molecules or ribozymes. Such catalytic RNA molecules can be used to inhibit expression of a target nucleic acid molecule in vivo. The inclusion of ribozyme sequences within an antisense RNA confers RNA-cleaving activity upon the molecule, thereby increasing the activity of the constructs. The design and use of target RNA-specific ribozymes is described in Haseloff et al., Nature 334:585-591 (1988), and US 2003 / 0003469 A1, each of which is incorporated by reference.

[0131] Suppression of a target may be determined by the expression or activity of the corresponding protein in cells being suppressed, as compared to cells in which a suppressing agent is not utilized. Expression of protein may be evaluated by any known technique; examples thereof include an immunoprecipitation method utilizing an antibody, EIA, ELISA, IRA, IRMA, a western blot method, an immunohistochemical method, an immunocytochemical method, a flow cytometry method, various hybridization methods utilizing a nucleic acid that specifically hybridizes with a nucleic acid encoding the protein or a unique fragment thereof, or a transcription product (e.g.,NDJP.020WO PATENT mRNA) or splicing product of said nucleic acid, a northern blot method, a Southern blot method, and various PCR methods.

[0132] The activity of the protein may be evaluated by analyzing a known activity of the protein including binding to a protein such as, for example, Raf-1 (in particular phosphorylated Raf-1) or EGFR (in particular phosphorylated EGFR) by means of any known method such as for example an immunoprecipitation method, a western blot method, amass analysis method, a pull- down method, or a surface plasmon resonance (SPR) method.

[0133] Examples of the mutated KRAS include, but are not limited to, those having a mutation that causes constant activation of KRAS, such as a mutation that inhibits endogenous GTPase or a mutation that increases the guanine nucleotide exchange rate. Specific examples of such mutation include, but are not limited to, for example, mutation in amino acids 12, 13 and / or 61 in human KRAS (inhibiting endogenous GTPase) and mutation in amino acids 116 and / or 119 in human KRAS (increasing guanine nucleotide exchange rate) (Bos, Cancer Res. 1989; 49 (17): 4682-9, Levi et al., Cancer Res. 1991; 51 (13): 3497-502).

[0134] In some embodiments , the mutated KRAS can be a KRAS having a mutation in at least one of amino acids 12, 13, 61, 116, and 119 of human KRAS. In one embodiment, the mutated KRAS has a mutation at amino acid 12 of human KRAS. In some embodiments, the mutated KRAS may be one that induces overexpression of GST-p. Cells having mutated KRAS may exhibit overexpression of GST-p.

[0135] Detection of mutated KRAS may be carried out using any known technique, e.g., selective hybridization by means of a nucleic acid probe specific to a known mutation sequence, an enzyme mismatch cleavage method, sequencing (Bos, Cancer Res.1989; 49 (17): 4682-9), and a PCR-RFLP method (Miyanishi et al., Gastroenterology.2001; 121 (4): 865-74).).

[0136] Detection of target expression may be carried out using any known technique. Whether or not the target is being overexpressed may be evaluated by for example comparing the degree of expression of the target in cells having mutated KRAS with the degree of expression of the target in the same type of cells having normal KRAS. In this situation, the target is being overexpressed if the degree of expression of the target in cells having mutated KRAS exceeds the degree of expression of the target in the same type of cells having normal KRAS.

[0137] In one aspect, an embodiment features a vector encoding an inhibitory nucleic acid molecule of any of the above aspects. In a particular embodiment, the vector is a retroviral,NDJP.020WO PATENT adenoviral, adeno-associated viral, or lentiviral vector. In another embodiment, the vector contains a promoter suitable for expression in a mammalian cell.

[0138] The amount of active RNA interference inducing ingredient formulated in a composition of an embodiment provided herein may be an amount that does not cause an adverse effect exceeding the benefit of administration. Such an amount may be determined by an in vitro test using cultured cells, or a test in a model animal or mammal such as a mouse, a rat, a dog, or a pig, etc., and such test methods are known to those skilled in the art. The methods of various embodiments can be applicable to any animal, including humans.

[0139] The amount of active ingredient formulated can vary according to the manner in which the agent or composition is administered. For example, when a plurality of units of the composition is used for one administration, the amount of active ingredient to be formulated in one unit of the composition may be determined by dividing the amount of active ingredient necessary for one administration by said plurality of units.

[0140] Embodiments of described herein further relate to a method for controlling the activity or growth of KRAS-mutant cancer, the method including administering an effective amount of the composition to a subject in need thereof. The effective amount referred to here is, in a method for treating, inhibiting, or ameliorating KRAS-mutant cancer, an amount that alleviates its symptoms, or delays or stops its progression, and is preferably an amount that prevents the onset or recurrence of KRAS-mutant cancer, or cures it. It is also preferably an amount that does not cause an adverse effect that exceeds the benefit from administration. Such an amount may be determined as appropriate by an in vitro test using cultured cells or by a test in a model animal or mammal such as a mouse, a rat, a dog, or a pig, and such test methods are well known to a person skilled in the art. Moreover, the dose of the active agents in the carrier and the dose of the active agents used in the disclosed methods are known to a person skilled in the art, or may be determined as appropriate by the above-mentioned tests.

[0141] The frequency of administration depends on the properties of the composition used and the above-mentioned conditions of the subject, and may be a plurality of times per day (that is, 2, 3, 4, 5, or more times per day), once a day, every few days (that is, every 2, 3, 4, 5, 6, or 7 days, etc.), a few times per week (e.g.2, 3, 4 times, etc. per week), every other week, or every few weeks (that is, every 2, 3, 4 weeks, etc.).NDJP.020WO PATENT

[0142] In some embodiments, the present application also relates to a method for delivering a drug to KRAS-mutant cancer cell, by utilizing a liposome nanoparticle carrier as described herein. This method includes a step of administering or adding the carrier having the GST-p inhibitor and KRAS inhibitor to be delivered thereon and / or encapsulated therein to a living being or a medium, for example a culture medium, containing an extracellular matrix-producing cell in the lung. These steps may be achieved as appropriate in accordance with any known method or a method described herein. Moreover, the above method includes a mode carried out in vitro and a mode in which a KRAS-mutant cancer cell in the lung inside the body is targeted.

[0143] GST-p inhibitor

[0144] One of ordinary skill in the art would understand that a reported sequence may change over time and to incorporate any changes needed in the nucleic acid molecules herein accordingly.

[0145] In some embodiments, the GST-p inhibitor may be a nucleic acid molecule for gene silencing of GST-p expression.

[0146] In some embodiments, the GST-p inhibitor may be an RNAi molecule, an antisense nucleic acid, or a vector expressing the RNAi molecule or antisense nucleic acid.

[0147] Examples of nucleic acid molecules capable of mediating RNA interference include molecules active in RNA interference (RNAi molecules), including a duplex RNA such as an siRNA (small interfering RNA), miRNA (micro RNA), shRNA (short hairpin RNA), ddRNA (DNA-directed RNA), piRNA (Piwi-interacting RNA), saRNA (small activating RNA), or rasiRNA (repeat associated siRNA), and modified forms thereof.

[0148] The nucleic acid molecules of the GST-p inhibitor described herein may be pooled, or used in combination to down regulate the expression of genes that encode GST-p.

[0149] The methods and compositions of embodiments described herein can include one or more nucleic acid molecules, which can modulate or regulate the expression of GST-p proteins and / or genes encoding the proteins that are associated with the maintenance and / or development of diseases, as well as conditions or disorders associated with GST-p, such as KRAS-mutant cancer.

[0150] The methods and compositions of embodiments described herein are described with reference to exemplary sequences of GST-p. A person of ordinary skill in the art would understand that various aspects and embodiments described herein are directed to any related GST-p genes,NDJP.020WO PATENT sequences, or variants, such as homolog genes and transcript variants, and polymorphisms, including single nucleotide polymorphism (SNP) associated with any GST-p genes.

[0151] In some embodiments, the methods and compositions described herein can provide a double-stranded short interfering nucleic acid (siRNA) molecule that downregulates the expression of a GST-p gene, for example human GST-p.

[0152] An RNAi molecule of the GST-p inhibitor described herein can be targeted to GST- p, and any homologous sequences, for example, using complementary sequences or by incorporating non-canonical base pairs, for example, mismatches and / or wobble base pairs, that can provide additional target sequences.

[0153] In instances where mismatches are identified, non-canonical base pairs, for example, mismatches and / or wobble bases can be used to generate nucleic acid molecules that target more than one gene sequence.

[0154] For example, non-canonical base pairs such as UU and CC base pairs can be used to generate nucleic acid molecules that are capable of targeting sequences for differing targets that share sequence homology. Thus, a RNAi molecule can be targeted to a nucleotide sequence that is conserved between homologous genes, and a single RNAi molecule can be used to inhibit expression of more than one gene.

[0155] In some aspects, the methods and compositions of embodiments described herein include RNAi molecules that are active against any portion of GST-p mRNA. The RNAi molecule can include a sequence complementary to any mRNA encoding a GST-p sequence.

[0156] In some embodiments, a RNAi molecule of this disclosure can have activity against GST-p RNA, where the RNAi molecule includes a sequence complementary to an RNA having a variant GST-p encoding sequence, for example, a mutant GST-p gene known in the art to be associated with KRAS-mutant cancer.

[0157] In further embodiments, a RNAi molecule of this disclosure can include a nucleotide sequence that can mediate silencing of GST-p gene expression.

[0158] Examples of RNAi molecules of embodiments of this disclosure targeted to GST- p mRNA are shown in Table 1 below.NDJP.020WO PATENT Table 1: RNAi molecule sequences for GST-p SEQ SENSE STRAND SEQ ANTISENSE STRAND ID (5'-->3') ID (5'-->3') NO SEQ ID NOS:1 to 26 NO SEQ ID NOS:27 to 52 1 GAAGCCUUUUGAGACCCUANN 27 UAGGGUCUCAAAAGGCUUCNN 2 GAAGCCUUUUGAGACCCUAUU 28 UAGGGUCUCAAAAGGCUUCUU 3 GAAGCCUUUUGAGACCCUAUU 29 uagggucuCAAAAGGCUUCUU 4 GAAGCCUUUUGAGACCCUAUU 30 UagggucuCAAAAGGCUUCUU 5 GAAGCCUUUUGAGACCCUAUU 31 UAgggucuCAAAAGGCUUCUU 6 GAAGCCUUUUGAGACCCUAUU 32 UAGggucuCAAAAGGCUUCUU 7 GAAGCCUUUUGAGACCCUAUU 33 UAGGgucuCAAAAGGCUUCUU 8 GAAGCCUUUUGAGACCCUAUU 34 uAgGgUcUCAAAAGGCUUCUU 9 GAAGCCUUUUGAGACCCUAUU 35 UAgGgUcUCAAAAGGCUUCUU 10 GAAGCCUUUUGAGACCCUAUU 36 UaGgGuCuCAAAAGGCUUCUU 11 GAAGCCUUUUGAGACCCUAUU 37 UAGgGuCuCAAAAGGCUUCUU 12 GAAGCCUUUUGAGACCCUAtt 38 UagggucuCAAAAGGCUUCUU 13 GAAGCCUUUUGAGACCCUAUU 39 UAGGGUCUCAAAAGGCUUCUU 14 GAAGCCUUUUGAGACCCUAUU 40 fUAGGGUCUCAAAAGGCUUCUU 15 GAAGCCUUUUGAGACCCUAUU 41 uAGGGUCUCAAAAGGCUUCUU 16 GAAGCCUUUUGAGACCCUAUU 42 UsAGGGUCUCAAAAGGCUUCUU 17 GAAGCCUUUUGAGACCCUfAUU 43 fUAGGGUCUfCAAAAGGCfUUCUU 18 GAAGCCUUUUGAGfACCCUfAUU 44 fUAGGGUCUfCAfAfAAGGCfUUCUU 19 GAAGCCUUUUGAGACCCUAUU 45 UAGGGUCUCAAAAGGCUUCUU 20 GAAGCCUUUUGAGACCCUAUU 46 fUAGGGUCUCAAAAGGCUUCUU 21 GAAGCCUUUUGAGACCCUAUU 47 UAGGGUCUCAAAAGGCUUCUU 22 GAAGCCUUUUGAGACCCUAUU 48 UAGgGuCuCAAAAGGCUUCUU 23 GAAGCCUUUUGAGACCCUAUU 49 UAGgGuCuCAAAAGGCUUCUU 24 GAAGCCUUUUGAGACCCUAUU 50 UAGgGuCuCAAAAGGCUUCUU 25 GAAGCCUUUUGAGACCCUAUU 51 UAGgGuCuCAAAAGGCUUCUU 26 GAAGCCUUUUGAGACCCUAUU 52 fUAGgGuCuCAAAAGGCUUCUU

[0159] Key for Table 1: Upper case A, G, C and U refer to ribo-A, ribo-G, ribo-C and ribo-U, respectively. The lower case letters a, u, g, c, t refer to 2’-deoxy-A, 2’-deoxy-U, 2’-deoxy- G, 2’-deoxy-C, and deoxythymidine (dT = T = t) respectively. Underlining refers to 2’-OMe- substituted, e.g., U. The lower case letter f refers to 2’-deoxy-2’-fluoro substitution, e.g. fU is 2’- deoxy-2’-fluoro-U. The lower case letter s refers to a phosphorothioate linkage. N is A, C, G, U, U, a, c, g, u, t, or a modified, inverted, or chemically modified nucleotide.NDJP.020WO PATENT

[0160] In further aspects, a nucleic acid molecule of an embodiment of this disclosure can have each strand of the molecule being from 18 to 22 nucleotides in length. A nucleic acid molecule can have a duplex region of 19 nucleotides in length.

[0161] In certain embodiments, a nucleic acid molecule can have a polynucleotide sense strand and the polynucleotide antisense strand that are connected as a single strand, and form a duplex region connected at one end by a loop.

[0162] The nucleic acid molecules of embodiments of this disclosure can have a blunt end, or can have one or more 3’ overhangs.

[0163] The nucleic acid molecules of embodiments of this disclosure can be RNAi molecules that are active for gene silencing, for example, a dsRNA that is active for gene silencing, a siRNA, a micro-RNA, or a shRNA active for gene silencing, as well as a DNA-directed RNA (ddRNA), a Piwi-interacting RNA (piRNA), and a repeat associated siRNA (rasiRNA).

[0164] This disclosure further contemplates compositions containing one or more inventive nucleic acid molecules and a pharmaceutically acceptable carrier. The carrier can be a lipid molecule or liposome.

[0165] In some embodiments, this disclosure provides a range of nucleic acid molecules, wherein: a) the molecule has a polynucleotide sense strand and a polynucleotide antisense strand; b) each strand of the molecule is from 15 to 30 nucleotides in length; c) a contiguous region of from 15 to 30 nucleotides of the antisense strand is complementary to a sequence of an mRNA encoding GST-p; d) at least a portion of the sense strand is complementary to at least a portion of the antisense strand, and the molecule has a duplex region of from 15 to 30 nucleotides in length.

[0166] In some embodiments, the nucleic acid molecule can have contiguous region of from 15 to 30 nucleotides of the antisense strand that is complementary to a sequence of an mRNA encoding GST-p is located in the duplex region of the molecule.

[0167] In additional embodiments, the nucleic acid molecule can have a contiguous region of from 15 to 30 nucleotides of the antisense strand that is complementary to a sequence of an mRNA encoding GST-p.

[0168] In certain embodiments, each strand of the nucleic acid molecule can be from 18 to 22 nucleotides in length. The duplex region of the nucleic acid molecule can be 19 nucleotides in length.NDJP.020WO PATENT

[0169] In alternative forms, the nucleic acid molecule can have a polynucleotide sense strand and a polynucleotide antisense strand that are connected as a single strand, and form a duplex region connected at one end by a loop.

[0170] Some embodiments of a nucleic acid molecule of this disclosure can have a blunt end. In certain embodiments, a nucleic acid molecule can have one or more 3’ overhangs.

[0171] Embodiments of this disclosure provide a range of nucleic acid molecules that are RNAi molecules active for gene silencing. The inventive nucleic acid molecules can be a dsRNA, a siRNA, a micro-RNA, or a shRNA active for gene silencing, as well as a DNA-directed RNA (ddRNA), Piwi-interacting RNA (piRNA), or a repeat associated siRNA (rasiRNA). The nucleic acid molecules can be active for inhibiting expression of GST-p.

[0172] Embodiments of this disclosure further provide nucleic acid molecules having an IC50 for knockdown of GST-p of less than 100 pM.

[0173] Additional embodiments of this disclosure provide nucleic acid molecules having an IC50 for knockdown of GST-p of less than 50 pM.

[0174] This disclosure further contemplates compositions containing one or more of the inventive nucleic acid molecules, along with a pharmaceutically acceptable carrier. In certain embodiments, the carrier can be a lipid molecule or liposome.

[0175] The compositions of embodiments of this disclosure are useful in methods for treating, inhibiting, or ameliorating a GST-p associated disease, by administering a composition to a subject in need.

[0176] As used herein, the RNAi molecule denotes any molecule that causes RNA interference, including a duplex RNA such as siRNA (small interfering RNA), miRNA (micro RNA), shRNA (short hairpin RNA), ddRNA (DNA-directed RNA), piRNA (Piwi-interacting RNA), or rasiRNA (repeat associated siRNA) and modified forms thereof. These RNAi molecules may be commercially available or may be designed and prepared based on known sequence information, etc. The antisense nucleic acid includes RNA, DNA, PNA, or a complex thereof. As used herein, the DNA / RNA chimera polynucleotide includes a double-strand polynucleotide composed of DNA and RNA that inhibits the expression of a target gene.

[0177] In one embodiment, the agents of embodiments of this disclosure contain siRNA as a therapeutic agent. An siRNA molecule can have a length from about 10-50 or more nucleotides. An siRNA molecule can have a length from about 15-45 nucleotides. An siRNANDJP.020WO PATENT molecule can have a length from about 19-40 nucleotides. An siRNA molecule can have a length of from 19-23 nucleotides. An siRNA molecule of the present application can mediate RNAi against a target mRNA. Commercially available design tools and kits, such as those available from Ambion, Inc. (Austin, TX), and the Whitehead Institute of Biomedical Research at MIT (Cambridge, MA) allow for the design and production of siRNA.

[0178] The GST-p inhibitors described herein include those disclosed in U.S. Patent No. 11,708,575, which is hereby incorporated by reference in its entirety and particularly for the purpose of describing such GST-p inhibitors, formulations thereof and methods of making and using them.

[0179] Formulations

[0180] Embodiments of a pharmaceutical composition of this disclosure may contain an ionizable lipid of the Formula I or II (such as Compound A) for delivering the GST-p inhibitor and / or KRAS inhibitor to cells of KRAS-mutant cancer. The ionizable lipid of the Formula I or II (e.g., Compound A), along with additional lipid components in a formulation of this disclosure can be used to form nanoparticles to deliver and distribute the active GST-p inhibitor and / or KRAS inhibitor for treating or ameliorating KRAS-mutant cancer.

[0181] Embodiments of a pharmaceutical composition of this disclosure can contain a 1,2- distearoyl-sn-glycero-3-phosphoethanolamine (DSPE) lipid compound for delivering the GST-p inhibitor and KRAS inhibitor to cells of KRAS-mutant cancer. The DSPE lipid compound, which can be DSPE-mPEG-2000, along with additional lipid components in a formulation of this disclosure can be used to form nanoparticles to deliver and distribute the GST-p inhibitor and KRAS inhibitor for treating or ameliorating KRAS-mutant cancers.

[0182] In some embodiments, a pharmaceutical composition of this disclosure containing the GST-p inhibitor and / or KRAS inhibitor, along with an ionizable lipid of the Formula I or II (e.g., Compound A) and a DSPE-mPEG-2000 lipid component, can exhibit enhanced distribution of the active agent (GST-p inhibitor and / or KRAS inhibitor) to lung by parenteral administration.

[0183] Embodiments of this disclosure include a pharmaceutical solution of a pharmaceutical composition, which is suitable for lyophilization. A pharmaceutical solution of a pharmaceutical composition may contain solvents, for example, ethanol and water for injection, as well as protective agents, for example, sucrose and 2-hydroxypropyl-ȕ-cyclodextrin, which protect the active agent during lyophilization. A pharmaceutical solution can also contain a buffer.NDJP.020WO PATENT A pharmaceutical solution allows a suspension of a pharmaceutical composition to be made, which can be maintained during lyophilization.

[0184] In further embodiments, this disclosure includes a solid lyophile composition made from a pharmaceutical solution. The pharmaceutical solution can be lyophilized to a solid cake or powder, which maintains the activity of the active agent of the pharmaceutical solution.

[0185] Various embodiments of a solid lyophile composition of this disclosure can be prepared in a vial or other container for use as a drug product. A kit utilizing the vial of the solid lyophile composition can contain instructions for using the drug product, and for preparing a reconstituted drug from the solid lyophile composition.

[0186] In further embodiments, an active agent of this disclosure can be delivered using a reconstituted form of a solid lyophile composition. The reconstituted solution form of a solid lyophile composition, which may be prepared with a sterile diluent, can be used as a drug for parenteral delivery.

[0187] Lyophilized nanoparticle formulations

[0188] In some aspects, delivery of an active agent in vivo can surprisingly be accomplished with a nanoparticle formulation provided herein that can be lyophilized, reconstituted, and injected intravenously.

[0189] Embodiments of this disclosure further provide lyophile forms of nanoparticles that can be reconstituted into effective therapeutic compositions, which can be used to deliver therapeutic nucleic acid agents for transfection.

[0190] In some aspects, this disclosure provides compositions for forming solutions or suspensions of therapeutic lipid nanoparticles (LNP) that are stable in lyophilization processes. The therapeutic lipid nanoparticles can encapsulate GST-p inhibitor and / or KRAS inhibitor, and can be transformed and stored in solid lyophile forms. The lyophile forms can be reconstituted to provide therapeutic lipid nanoparticles with encapsulated GST-p inhibitor and / or KRAS inhibitor. The reconstituted lipid nanoparticles can have surprisingly advantageous transfection properties, including particle size and distribution.

[0191] Embodiments of this disclosure include a range of compositions for forming solutions or suspensions of therapeutic lipid nanoparticles that can undergo a lyophilization process to provide stable, solid lyophile forms for long-term storage of GST-p inhibitor and / or KRAS inhibitor.NDJP.020WO PATENT

[0192] In further aspects, this disclosure provides compositions and methods for forming solutions or suspensions of therapeutic lipid nanoparticles that are stable in lyophilization processes. The lyophilization processes of the present application can provide stable lyophile forms of therapeutic lipid nanoparticles, in which the nanoparticles can encapsulate GST-p inhibitor and / or KRAS inhibitor. The lyophile forms can be stored for a period of time, and reconstituted to provide therapeutic lipid nanoparticles with encapsulated GST-p inhibitor and / or KRAS inhibitor.

[0193] In some embodiments, this disclosure includes a range of compositions for solutions or suspensions of lipid nanoparticles that can undergo a lyophilization process to provide stable, solid lyophile forms for long-term storage of a nucleic acid therapeutic. Compositions and processes of this disclosure can provide lyophile forms that can be reconstituted and provide advantageous activity, particle size, storage time, and serum stability.

[0194] In an embodiment, this disclosure provides a range of lipid compounds and ionizable compounds for delivering active agents to cells. The lipid compounds and ionizable compounds of this disclosure can be used to form nanoparticles to deliver and distribute active agents.

[0195] In an embodiment, this disclosure contemplates lipid nanoparticle drug formulations containing, for example, GST-p inhibitor and / or KRAS inhibitor, which can be prepared by lyophilization of a suspension of the nanoparticles, and reconstitution of the nanoparticles into a suspension.

[0196] In some embodiments, lipid nanoparticles can be synthesized by high speed injection of lipid / ethanol solution into an siRNA buffer solution. A second buffer can be diafiltered and used as an external buffer through TFF cartridges to make a final product aqueous suspension.

[0197] In some embodiments, the nanoparticles can have an average diameter of from 45 nm to 110 nm. The concentration of the active agents can be from 1 mg / mL to 10 mg / mL.

[0198] It was found that lipid nanoparticles can survive lyophilization of the suspension, when the suspension is made into a protected composition.

[0199] In some embodiments, a protected composition of this disclosure can be composed of an aqueous suspension of the lipid nanoparticles in a pharmaceutically acceptable solution, a dextrin compound, and a saccharide sugar compound. The lipid nanoparticles can encapsulate an active agent.NDJP.020WO PATENT

[0200] Lyophilization of the protected suspension can provide a solid lyophile product, which can be reconstituted into a suspension of lipid nanoparticles.

[0201] The reconstituted suspension can contain lipid nanoparticles, which encapsulate the active agent and are comparable to the lipid nanoparticles before lyophilization.

[0202] In certain embodiments, the reconstituted suspension can provide activity of the encapsulated agent, which is comparable to that of the suspension before lyophilization.

[0203] In further aspects, the reconstituted suspension can provide stable nanoparticles comparable to that of the suspension before lyophilization. In certain aspects, the average particle size of the nanoparticles can be nearly equal to the size of the nanoparticles in the suspension before lyophilization.

[0204] In an embodiment, the compositions and processes of this disclosure can provide surprising activity and stability of a reconstituted suspension composed of nanoparticles having an encapsulated agent.

[0205] In further aspects, the protected suspension, which can be lyophilized and reconstituted, can contain a protectant composition for lyophilization. A protectant composition of this disclosure can be composed of a dextrin compound and a saccharide sugar compound. The total amount of the dextrin and sugar compounds may be from 2% to 20% (w / v) of the protected suspension.

[0206] In some embodiments, the dextrin compound can be from 40 % to 70% (w / v) of the total amount of the dextrin and sugar compounds in the protectant composition. In certain embodiments, the dextrin compound can be from 40 % to 55% (w / v) of the total amount of the dextrin and sugar compounds in the protectant composition. In further embodiments, the dextrin compound may be from 40% to 45% (w / v) of the total amount of the dextrin and sugar compounds in the protectant composition. These compositions can provide unexpectedly advantageous properties of a reconstituted nanoparticle suspension, for example, insignificant change of the nanoparticle size or activity.

[0207] In some aspects, upon lyophilization and reconstitution of a protected suspension of nanoparticles, the average size of the nanoparticles can be within 10% of their size in the original composition, before lyophilization. In certain aspects, upon lyophilization and reconstitution of a protected suspension of nanoparticles, the average size of the nanoparticles can be within 5% of their size in the original composition, before lyophilization.NDJP.020WO PATENT

[0208] This disclosure contemplates lipid nanoparticle drug formulations containing, for example, GST-p inhibitor and / or KRAS inhibitor, which can be prepared by lyophilization of a suspension of the nanoparticles, and reconstitution of the nanoparticles into a suspension after a period of storage. The reconstituted suspension can provide activity of the encapsulated agent, which is comparable to that of the suspension before lyophilization.

[0209] The reconstituted suspension, prepared after a period of storage, can contain lipid nanoparticles, which encapsulate the active agent and are comparable to the lipid nanoparticles before lyophilization.

[0210] In certain embodiments, the reconstituted suspension, prepared after a period of storage, can provide activity of the encapsulated agent, which is comparable to that of the suspension before lyophilization.

[0211] In further aspects, the reconstituted suspension, prepared after a period of storage, can provide stable nanoparticles comparable to that of the suspension before lyophilization. In certain aspects, the average particle size of the nanoparticles can be nearly equal to the size of the nanoparticles in the suspension before lyophilization.

[0212] Lyophilization processes

[0213] Lyophilization processes can be carried out in any suitable vessel, such as glass vessels, or, for example, glass vials, or dual-chamber vessels, as are known in the pharmaceutical arts.

[0214] A stabilized lipid nanoparticle composition of this disclosure containing a protectant compound can be introduced into to the glass vessel. The volume of the composition added to the vessel can be from 0.1-20 mL, or from 1-10 mL.

[0215] Any lyophilization process can be used, including those known in the pharmaceutical arts. See, e.g., Remington's Pharmaceutical Sciences, 18th Ed., Mack Publishing Co., Easton, Penn. (1990).

[0216] The lyophilization process can include freezing the protectant-stabilized lipid nanoparticle composition at a temperature of from about í40°C to about í30°C. The frozen composition can be dried form a lyophilized composition.

[0217] In some embodiments, the freezing step can ramp the temperature from ambient to the final temperature over several minutes. The temperature ramp can be about 1°C / minute.NDJP.020WO PATENT

[0218] In some embodiments, the drying step can be performed at a pressure in a range of about 0-250 mTorr, or 50-150 mTorr, at a temperature of from about í15°C to about í38°C. The drying step can be continued at a higher temperature, up to ambient temperature, over a period of up to several days. The level of residual water in the solid lyophile can be less than about 5%, or less than 4%, or less than 3%, or less than 2%, or less than 1% (w / v).

[0219] The protectant-stabilized lipid nanoparticle compositions of embodiments of this disclosure, after lyophilization, can be reconstituted by methods known in the pharmaceutical arts.

[0220] In some aspects, this disclosure provides methods for inhibiting the level of aggregated particles in a reconstituted drug product, made from a protectant-stabilized lipid nanoparticle composition of the present application after lyophilization.

[0221] In some embodiments, the reconstituted drug product, made from a protectant- stabilized lipid nanoparticle composition of the present application after lyophilization, can have reduced levels of aggregate particles.

[0222] In certain embodiments, the reconstituted drug product, made from a protectant- stabilized lipid nanoparticle composition of the present application after lyophilization, can have reduced levels of aggregate particles with a size greater than about 0.2 ^m, or greater than about 0.5 ^m, or greater than about 1 ^m.

[0223] Lipid compositions

[0224] In some embodiments, three lipid-like components, i.e. one or more ionizable molecules, a structural lipid, and one or more lipids for reducing immunogenicity of the nanoparticles can be 100% of the lipid components of the composition.

[0225] Ionizable lipid-like molecules

[0226] Examples of on ionizable lipid include compounds having the structure shown in Formula Iwherein R1and R2are R1= CH2(CH2)nOC(=O)R4wherein n and m are from 1 to 2; and R4and R5are independently for each occurrence a C(12-20)NDJP.020WO PATENT alkyl group, or a C(12-20) alkenyl group having from zero to two double bonds; wherein R3is selected fromwherein R6is selected from H, alkyl, hydroxy, hydroxyalkyl, alkoxy, alkoxyalkoxy, aminoalkyl; R7is selected from H, alkyl, hydroxyalkyl; Q is O or NR7; p is from 1 to 4.

[0227] Examples of ionizable lipids include compounds of the following Formula II:NDJP.020WO PATENT

[0228] The following Compound A, which is ((2-((3S,4R)-3,4-dihydroxypyrrolidin-1- yl)acetyl)azanediyl)bis(ethane-2,1-diyl) (9Z,9'Z,12Z,12'Z)-bis(octadeca-9,12-dienoate), is an example of an ionizable lipid of the Formula II:COMPOUND A

[0229] Structural lipids

[0230] Examples of structural lipids include cholesterols, sterols, and steroids.

[0231] Examples of structural lipids include cholanes, cholestanes, ergostanes, campestanes, poriferastanes, stigmastanes, gorgostanes, lanostanes, gonanes, estranes, androstanes, pregnanes, and cycloartanes.

[0232] Examples of structural lipids include sterols and zoosterols such as cholesterol, lanosterol, zymosterol, zymostenol, desmosterol, stigmastanol, dihydrolanosterol, and 7^dehydrocholesterol. In an embodiment, the structural lipid is a sterol lipid such as cholesterol.

[0233] Examples of structural lipids include pegylated cholesterols, and cholestane 3^oxo- (C1-22)acyl compounds, for example, cholesteryl acetate, cholesteryl arachidonate, cholesteryl butyrate, cholesteryl hexanoate, cholesteryl myristate, cholesteryl palmitate, cholesteryl behenate, cholesteryl stearate, cholesteryl caprylate, cholesteryl n-decanoate, cholesteryl dodecanoate, cholesteryl nervonate, cholesteryl pelargonate, cholesteryl n-valerate, cholesteryl oleate, cholesteryl elaidate, cholesteryl erucate, cholesteryl heptanoate, cholesteryl linolelaidate, and cholesteryl linoleate.

[0234] Examples of structural lipids include sterols such as phytosterols, beta-sitosterol, campesterol, ergosterol, brassicasterol, delta-7-stigmasterol, and delta-7-avenasterol.

[0235] Stabilizer lipids

[0236] Examples of stabilizer lipids include neutral lipids and zwitterionic lipids.

[0237] Examples of stabilizer lipids include compounds such as phospholipids.

[0238] Examples of phospholipids include phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid,NDJP.020WO PATENT palmitoyloleoyl phosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine, dipalmitoylphosphatidylcholine, dioleoylphosphatidylcholine, distearoylphosphatidylcholine and ordilinoleoylphosphatidylcholine.

[0239] Examples of stabilizer lipids include neutral lipids such as phosphatidyl ethanolamine compounds and phosphatidyl choline compounds.

[0240] Examples of stabilizer lipids include the neutral lipid 1,2-Dioleoyl-sn-Glycero-3- Phosphocholine (DOPC).

[0241] Examples of stabilizer lipids include diphytanoyl phosphatidyl ethanolamine (DPhPE) and 1,2-Diphytanoyl-sn-Glycero-3-Phosphocholine (DPhPC).

[0242] Examples of stabilizer lipids include neutral lipids such as 1,2-distearoyl-sn- glycero-3-phosphocholine (DSPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2- dipalmitoyl-sn-glycero-3-phosphoethanolamine (DPPE), and 1,2-dioleoyl-sn-glycero-3- phosphoethanolamine (DOPE).

[0243] Examples of stabilizer lipids include neutral lipids such as 1,2-dilauroyl-sn-glycerol (DLG); 1,2^dimyristoyl-sn-glycerol (DMG); 1,2-dipalmitoyl-sn-glycerol (DPG); 1,2^distearoyl- sn-glycerol (DSG); 1,2-diarachidoyl-sn-glycero-3-phosphocholine (DAPC); 1,2^dilauroyl-sn- glycero-3-phosphocholine (DLPC); 1,2^dimyristoyl-sn-glycero-3-phosphocholine (DMPC); 1,2- dipalmitoyl-sn-glycero-O-ethyl-3-phosphocholine (DPePC); 1,2^dilauroyl-sn-glycero-3- phosphoethanolamine (DLPE); 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine (DMPE); 1,2- distearoyl-sn-glycero-3-phosphoethanolamine (DSPE); 1-palmitoyl-2-linoleoyl-sn-glycero-3- phosphocholine; 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC); 1-palmitoyl-2-lyso- sn-glycero-3-phosphocholine (P-Lyso-PC); and 1-Stearoyl-2-lyso-sn-glycero-3-phosphocholine (S-Lyso-PC).

[0244] As used herein, the term DMPE-mPEG-2000 refers to 1,2-distearoyl-sn-glycero-3- phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000].

[0245] The neutral lipids may be other than the DSPE lipid and the sterol lipid.

[0246] Lipids for reducing immunogenicity

[0247] Examples of lipids for reducing immunogenicity include polymeric compounds and polymer-lipid conjugates.

[0248] Examples of lipids for reducing immunogenicity include pegylated lipids having polyethyleneglycol (PEG) regions. In some embodiments, the lipid for reducing immunogenicityNDJP.020WO PATENT is a DSPE lipid comprising a poly ethyleneglycol (PEG) region, a multi-branched PEG region, a methoxypoly ethyleneglycol (mPEG) region, a carbonyl-methoxypolyethyleneglycol region, or a polyglycerine region. The PEG regions can be of any molecular mass. In some embodiments, a PEG region can have an average molecular mass of 200, 300, 350, 400, 500, 550, 750, 1000, 1500, 2000, 3000, 3500, 4000 or 5000 Da.

[0249] Examples of lipids for reducing immunogenicity include compounds having a methoxypolyethyleneglycol region.

[0250] Examples of lipids for reducing immunogenicity include compounds having a carbonyl-methoxypolyethyleneglycol region.

[0251] Examples of lipids for reducing immunogenicity include compounds having a multi-branched PEG region.

[0252] Examples of lipids for reducing immunogenicity include compounds having a polyglycerine region.

[0253] Examples of lipids for reducing immunogenicity include polymeric lipids such as DSPE-mPEG, DMPE-mPEG, DPPE-mPEG, and DOPE-mPEG.

[0254] Examples of lipids for reducing immunogenicity include PEG-phospholipids and PEG-ceramides.

[0255] Lipid compositions

[0256] In some embodiments, a composition can contain the ionizable lipid of the Formula II (e.g., Compound A), the structural lipid cholesterol, the stabilizer lipids DOPC and DOPE, and the lipid for reducing immunogenicity DSPE-mPEG. In certain embodiments, the ionizable lipid of the Formula II (e.g., Compound A) can comprise 15 mol% to 35 mol%, or 15 mol% to 25 mol%, or 20 mol% to 30 mol% of the composition; the cholesterol can comprise from 25 mol% to 35 mol% of the total lipids of the composition; the DOPC and DOPE combined can comprise from 30 mol% to 50 mol% of the total lipids of the composition; the cholesterol, DOPC, and DOPE combined can comprise 50 mol% to 85 mol%, or 60 mol% to 80 mol %, or 75 mol% to 85 mol% of the composition; and DSPE-mPEG can comprise from 1 mol% to 8 mol%, or from 4 mol% to 6 mol%, or 5 mol%, of the total lipids of the composition. In various embodiments, the compound of Formula II, cholesterol, DOPC, DOPE, and DSPE-mPEG-2000 combined comprise at least 97 mol% of the total lipids of the composition. For example, in an embodiment the compound ofNDJP.020WO PATENT Formula II, cholesterol, DOPC, DOPE, and DSPE-mPEG-2000 combined comprise about 100 mol% of the total lipids of the composition.

[0257] In one embodiment, the ionizable lipid of the Formula II (e.g., Compound A) can be 25 mol% of the total lipids of the composition; cholesterol can be 30 mol% of the total lipids of the composition, DOPC can be 20 mol% of the total lipids of the composition, DOPE can be 20 mol% of the total lipids of the composition; and DSPE-mPEG(2000) can be 5 mol% of the total lipids of the composition.

[0258] Nanoparticles

[0259] Embodiments of this disclosure can provide liposome nanoparticle compositions. The ionizable molecules of embodiments of this disclosure can be used to form liposome compositions, which can have a bilayer of lipid-like molecules.

[0260] A nanoparticle composition can have one or more of the ionizable molecules of this disclosure in a liposomal structure, a bilayer structure, a micelle, a lamellar structure, or a mixture thereof.

[0261] In some embodiments, a composition can include one or more liquid vehicle components. A liquid vehicle suitable for delivery of active agents of the present application can be a pharmaceutically acceptable liquid vehicle. A liquid vehicle can include an organic solvent, or a combination of water and an organic solvent.

[0262] Embodiments of this disclosure can provide lipid nanoparticles having a size of from 10 nm to 1000 nm. In some embodiments, the liposome nanoparticles can have a size of from 10 nm to 150 nm.

[0263] In certain embodiments, the liposome nanoparticles of this disclosure can encapsulate the RNAi molecule and retain at least 80% of the encapsulated RNAi molecules after 1 hour exposure to human serum.

[0264] As used herein, the term “encapsulate” refers to the ability of a nanoparticle to carry an active agent within its structure, or on its surface, such that the active agent is not removed by solvent or mobile phase exterior to the particle.

[0265] Pharmaceutical compositions

[0266] A pharmaceutical formulation herein can include an active agent, as well as a drug carrier, or a lipid of this disclosure, along with a pharmaceutically acceptable carrier or diluent. In general, active agents of this description include any active agents for cancer (such as KRAS-NDJP.020WO PATENT mutant cancer), including any inhibitory nucleic acid molecules and any small molecular drugs. Examples of inhibitory nucleic acid molecules include ribozymes, anti-sense nucleic acids, and RNA interference molecules (RNAi molecules).

[0267] Examples of anti-malignant tumor and anti-cancer drugs include oncogenes-related factors, tumor angiogenesis factor, metastatic related factors, cytokines such as TGF-Beta, growth factor, proteinase such as MMP, caspase, and immunization^suppression factor.

[0268] A pharmaceutical formulation of this disclosure may contain one or more of each of the following: a surface active agent, a diluent, an excipient, a preservative, a stabilizer, a dye, and a suspension agent.

[0269] Some pharmaceutical carriers, diluents and components for a pharmaceutical formulation, as well as methods for formulating and administering the compositions of the present application are described in Remington's Pharmaceutical Sciences, 18th Ed., Mack Publishing Co., Easton, Penn. (1990).

[0270] Examples of preservatives include sodium benzoate, ascorbic acid, and esters of p- hydroxybenzoic acid.

[0271] Examples of surface active agents include alcohols, esters, sulfated aliphatic alcohols.

[0272] Examples of excipients include sucrose, glucose, lactose, starch, crystallized cellulose, mannitol, light anhydrous silicate, magnesium aluminate, magnesium metasilicate aluminate, synthetic aluminum silicate, calcium carbonate, sodium acid carbonate, calcium hydrogen phosphate, and calcium carboxymethyl cellulose.

[0273] A therapeutic formulation of this disclosure for the delivery of one or more molecules active for gene silencing can be administered to a mammal in need thereof. A therapeutically effective amount of the formulation and active agent, which may be encapsulated in a liposome, can be administered to a mammal for preventing or treating KRAS-mutant cancer.

[0274] The route of administration may be local or systemic.

[0275] A therapeutically-effective formulation of the present application can be administered by various parenteral routes, including intravenous, intraperitoneal, intramuscular, and subcutaneous.NDJP.020WO PATENT

[0276] Routes of administration may include, for example, parenteral delivery, including intramuscular, subcutaneous, intravenous, intramedullary injections, as well as intrathecal, direct intraventricular, intraperitoneal, or intraocular injections.

[0277] The formulation can also be administered in sustained or controlled release dosage forms, including depot injections, osmotic pumps, and the like, for prolonged and / or timed, pulsed administration at a predetermined rate.

[0278] Embodiments of compositions of the present disclosure may be administered via various routes including parenteral routes, and examples thereof include, but are not limited to, intravenous, intramuscular, subcutaneous, local, intrapulmonary, intraarterial, intraportal, intraventricular, intramedullar, intra-lymph-node, intralymphatic, intrabrain, intrathecal, intracerebroventricular, percutaneous, and intraperitoneal routes, and it may be formulated into a dosage form suitable for each administration route. Such a dosage form and formulation method may be selected as appropriate from any known dosage forms and methods. See e.g. Hyojun Yakuzaigaku, Standard Pharmaceutics, Ed. by Yoshiteru Watanabe et al., Nankodo, 2003.

[0279] Examples of the dosage form suitable for parenteral administration include injections such as an injectable solution, an injectable suspension, an injectable emulsion, and a ready-to-use injection. Formulations for parenteral administration may be a form such as an aqueous or nonaqueous isotonic sterile solution or suspension.

[0280] Pharmaceutical formulations for parenteral administration, e.g., by bolus injection or continuous infusion, include aqueous solutions of the active formulation in water-soluble form. Suspensions of the active agents may be prepared as appropriate oily injection suspensions. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, the suspension may also contain suitable stabilizers or agents that increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.

[0281] Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The formulations may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulary agents such as suspending, stabilizing and / or dispersing agents. Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.NDJP.020WO PATENT

[0282] In addition to the preparations described previously, the formulations may also be formulated as a depot preparation. Such long acting formulations may be administered by intramuscular injection. Thus, for example, the formulation may be formulated with suitable polymeric or hydrophobic materials, for example as an emulsion in an acceptable oil, or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.

[0283] Embodiments of compositions and formulations of this disclosure may also be formulated for topical delivery and may be applied to the subject's skin using any suitable process for application of topical delivery vehicle. For example, the formulation may be applied manually, using an applicator, or by a process that involves both. Following application, the formulation may be worked into the subject's skin, e.g., by rubbing. Application may be performed multiple times daily or on a once-daily basis. For example, the formulation may be applied to a subject's skin once a day, twice a day, or multiple times a day, or may be applied once every two days, once every three days, or about once every week, once every two weeks, or once every several weeks.

[0284] The formulations or pharmaceutical compositions described herein may be administered to the subject by for example parenteral routes. Examples of methods of administration include, among others, administration via injection, subcutaneously, intraperitoneally, intravenously, intramuscularly, intradermally, intraorbitally, intracapsularly, intraspinally, intrasternally, or the like, including infusion pump delivery; administration locally such as by injection.

[0285] The exact formulation, route of administration and dosage for the pharmaceutical compositions can be chosen by the individual physician in view of the patient's condition. See, e.g., Goodman & Gilman’s The Pharmacological Basis of Therapeutics, 12thEd., Sec. 1, 2011. Typically, the dose range of the composition administered to the patient can be from about 0.5 mg / kg to about 1000 mg / kg of the patient's body weight. The dosage may be a single one or a series of two or more given in the course of one or more days, as is needed by the patient. In instances where human dosages for compounds have been established for at least some condition, the dosages will be about the same, or dosages that are about 0.1% to about 500%, more preferably about 25% to about 250% of the established human dosage. Where no human dosage is established, as will be the case for newly-discovered pharmaceutical compositions, a suitable human dosage can be inferred from ED50 or ID50 values, or other appropriate values derived from in vitro or in vivo studies, as qualified by toxicity studies and efficacy studies in animals.NDJP.020WO PATENT

[0286] In some embodiments, the active agent, for example GST-p inhibitor and KRAS inhibitor, may be administered at a dose of 0.05 mg / kg to 50 mg / kg, or 0.01 mg / kg to 5 mg / kg, or 1 mg / kg to 2.5 mg / kg bodyweight of the subject, or at a dose of 1 mg / kg, 2.5 mg / kg, or 5 mg / kg bodyweight of the subject.

[0287] In some embodiments, the active agent, for example GST-p inhibitor and KRAS inhibitor, may be administered weekly, biweekly, or monthly.

[0288] Structures of lipid tails

[0289] Embodiments of a lipid-like compound of the present application may have one or more lipophilic tails that contain one or more alkyl or alkenyl groups. Examples of lipophilic tails include C(14:1(5))alkenyl, C(14:1(9))alkenyl, C(16:1(7))alkenyl, C(16:1(9))alkenyl, C(18:1(3))alkenyl, C(18:1(5))alkenyl, C(18:1(7))alkenyl, C(18:1(9))alkenyl, C(18:1(11))alkenyl, C(18:1(12))alkenyl, C(18:2(9,12))alkenyl, C(18:2(9,11))alkenyl, C(18:3(9,12,15))alkenyl, C(18:3(6,9,12))alkenyl, C(18:3(9,11,13))alkenyl, C(18:4(6,9,12,15))alkenyl, C(18:4(9,11,13,15))alkenyl, C(20:1(9))alkenyl, C(20:1(11))alkenyl, C(20:2(8,11))alkenyl, C(20:2(5,8))alkenyl, C(20:2(11,14))alkenyl, C(20:3(5,8,11))alkenyl, C(20:4(5,8,11,14))alkenyl, C(20:4(7,10,13,16))alkenyl, C(20:5(5,8,11,14,17))alkenyl, C(20:6(4,7,10,13,16,19))alkenyl, C(22:1(9))alkenyl, C(22:1(13))alkenyl, and C(24:1(9))alkenyl.

[0290] Chemical definitions

[0291] The term "alkyl" as used herein refers to a hydrocarbyl radical of a saturated aliphatic group, which can be of any length. An alkyl group can be a branched or unbranched, substituted or unsubstituted aliphatic group containing from 1 to 22 carbon atoms. This definition also applies to the alkyl portion of other groups such as, for example, cycloalkyl, alkoxy, alkanoyl, and aralkyl, for example.

[0292] As used herein, a term such as “C(1-5)alkyl” includes C(1)alkyl, C(2)alkyl, C(3)alkyl, C(4)alkyl, and C(5)alkyl. Likewise, for example, the term “C(3-22)alkyl” includes C(1)alkyl, C(2)alkyl, C(3)alkyl, C(4)alkyl, C(5)alkyl, C(6)alkyl, C(7)alkyl, C(8)alkyl, C(9)alkyl, C(10)alkyl, C(11)alkyl, C(12)alkyl, C(13)alkyl, C(14)alkyl, C(15)alkyl, C(16)alkyl, C(17)alkyl, C(18)alkyl, C(19)alkyl, C(20)alkyl, C(21)alkyl, and C(22)alkyl.

[0293] As used herein, an alkyl group may be designated by a term such as Me (methyl), Et (ethyl), Pr (any propyl group),nPr (n-Pr, n-propyl),iPr (i-Pr, isopropyl), Bu (any butyl group),nBu (n-Bu, n-butyl),iBu (i-Bu, isobutyl),sBu (s-Bu, sec-butyl), andtBu (t-Bu, tert-butyl).NDJP.020WO PATENT

[0294] The term "alkenyl" as used herein refers to hydrocarbyl radical having at least one carbon-carbon double bond. An alkenyl group can be branched or unbranched, substituted or unsubstitutedhydrocarbylradical having 2 to 22 carbon atoms and at least one carbon-carbon double bond.

[0295] The term "substituted" as used herein refers to an atom having one or more substitutions or substituents which can be the same or different and may include a hydrogen substituent. Thus, the terms alkyl, cycloalkyl, alkenyl, alkoxy, alkanoyl, and aryl, for example, refer to groups which can include substituted variations. Substituted variations include linear, branched, and cyclic variations, and groups having a substituent or substituents replacing one or more hydrogens attached to any carbon atom of the group.

[0296] In general, a compound may contain one or more chiral centers. Compounds containing one or more chiral centers may include those described as an "isomer," a "stereoisomer," a "diastereomer," an "enantiomer," an "optical isomer," or as a "racemic mixture." Conventions for stereochemical nomenclature, for example the stereoisomer naming rules of Cahn, Ingold and Prelog, as well as methods for the determination of stereochemistry and the separation of stereoisomers are known in the art. See, for example, Michael B. Smith and Jerry March, March’s Advanced Organic Chemistry, 5th edition, 2001. The compounds and structures of this disclosure are meant to encompass all possible isomers, stereoisomers, diastereomers, enantiomers, and / or optical isomers that would be understood to exist for the specified compound or structure, including any mixture, racemic or otherwise, thereof. EXAMPLES

[0297] NBF-006 is a lyophilized lipid nanoparticle formulation, encapsulating a small interfering ribonucleic acid (siRNA) designed to inhibit the expression of GST-p in lung tumors. NBF-006 has been very well tolerated with early signs of efficacy in NSCLC patients in a phase 1 dose escalation and expansion study. As NBF-006 is well tolerated and unlikely to have drug-drug interactions, combination strategies have been developed. Due to the detoxifying role of GST-p, combinations of GST-p inhibitors with chemotherapy agents have been used to treat NSCLC in the experiments to see whether or not the combinations increase the sensitivity of cancer cells resulting in apoptosis and / or reduced resistance. As GST-p and KRAS enhance tumor growth andNDJP.020WO PATENT survival, combinations of GST-p inhibitors with KRAS inhibitors have also been used in the experiments to see whether or not inhibition of GST-p and KRAS may be synergistic.

[0298] Anti-tumor activity of siRNA(siRNA No.1) when combined with KRAS inhibitors or chemotherapy agents was assessed in a panel of KRAS mutant NSCLC lines in the experiments below. Anti-tumor activity of siRNA(siRNA No. 1) when combined with KRAS inhibitors or chemotherapy agents was evaluated using a Loewe model using CombenefitTManalysis software.

[0299] Preparation of GST-p siRNA (siRNA No.1)

[0300] Where the source of a reagent is not specifically given herein, such a reagent may be obtained from any supplier of the reagent for molecular biology at a quality / purity standard for application in molecular biology. Single-stranded RNAs were synthesized by oligo synthesizer (Cytiva ÄKTA oligopilot) following a standard solid-phase phosphonamidite protocol. After cleaved from solid support and desilylated, each strand was then purified by ion-exchange chromatography. Double stranded RNA was generated by annealing an equimolar solution of complementary strands at 75-80 °C for 1 minute and slowly cooled to ambient temperature. After lyophilization, the annealed dsRNA powder was stored at -20 °C. SiRNA No.1 has a sense strand sequence of SEQ ID NO: 26 and an antisense strand sequence of SEQ ID NO: 52.

[0301] Example 1: Combination study with GST-p siRNA and KRAS G12C inhibitor

[0302] One day before the transfection, H358 human cell lines, which are G12C mutant cell line and have sensitivity to KRAS G12C inhibitors, were plated in a 96-well plate at 3 x 103cells / well with 100 ^l of the appropriate medium containing 10% FBS and cultured in a 37ÛC incubator containing a humidified atmosphere of 5% CO2 in air.

[0303] SiRNA No.1 was used at the following concentrations: 0.01 nM, 0.03 nM, 0.1 nM, 0.3 nM, 1.0 nM, and 3.0 nM. For one well: 0.2 ^l of RNAiMAX was mixed with 4.8 ^l of Opti- MEM I for 5 minutes at room temperature. For one well: 1 ^l of siRNA was mixed with 4 ^l of Opti-MEM and combined with the RNAiMAX solution and then mixed gently. Mixture was left for 5 minutes at room temperature. The mixture was incubated for 15 minutes at room temperature to allow the RNA-RNAiMAX complexes to form. (These steps were done simultaneously. The idea is that both the cells and the reagent should be normalized to room temperature before adding the reagent on the top of the cells.) 10 ^l of RNAi-RNAiMAX complexes was added to each well and the plate was gently shaken by hand. Incubate the cells in a 37ÛC incubator containing a humidified atmosphere of 5% CO2in air for five days.NDJP.020WO PATENT

[0304] On day 2, H358 human cell lines were treated with Adagrasib (MRTX-849, Selleckchem, USA) obtained from Mirati Therapeutics, Inc. or Sotorasib (AMG-510, Selleckchem, USA) obtained from Amgen in separate plates as follows: H358 cell lines were treated with Adagrasib or Sotorasib at the following concentrations: 0.00001 nM, 0.0001 nM, 0.001 nM, 0.01 nM, 0.1 nM, 1 nM, 10 nM, 100 nM. The cell lines were returned to the 37ÛC incubator for additional 3 days. To quantitate ATP generated by metabolically active cells, cell viability assay was performed using a CellTiter-Glo luminescent cell viability assay (Promega) per the manufacturer’s instruction. The cell titer glow reagents were taken out from the -20ÛC. They were 15 ml flacon tubes containing 11 ml reagent. The reagents were thawed by placing the tube inside a beaker containing room temperature water and placing in a dark area. Frequently the water in the beaker was replaced with fresh water for faster thawing. It was kept in the drawer protected from light for 30 mins prior to starting the assay. The 96-well black cell culture plate was taken out from the incubator. The 96-well black cell culture plate was kept on the desk for 30 mins prior to starting the process.

[0305] 100 μl CellTiter-Glo reagent (Promega, USA) was added to lyse the cells. After a 20-min incubation at room temperature, the luminescence was recorded in a plate reader (BioTek, Winooski, VT) with an integration time of 1 second per well. The luminescence signals for the siRNA transfected cells were normalized by the luminescence signal obtained from mock cells.

[0306] Data from three plates including replicates were analyzed by Loewe model by loading the data into publicly available CombenefitTManalysis software (see www.cruk.cam.ac.uk / research-groups / jodrell-group / combenefit) and using it to generate Loewe response synergistic scores. CombenefitTManalysis software was first used to generate an experimental dose-response surface by generating a matrix of percentages of control versus the various concentrations of the GST-p inhibitor and the KRAS inhibitor. These single agent dose- response fitted curves were then used to generate a Loewe model-based dose-response surface. This surface provided a “reference” dose-response surface. The experimental dose-response surface was then compared to the mathematical model-based dose-response, resulting in synergy distribution in the various concentrations of the GST-p inhibitor and the KRAS inhibitor.

[0307] Cell viability assays above using the combination of siRNA No. 1 with Adagrasib or Sotorasib were also conducted in different model of cell lines H2122 and MiaPaca-2, that are KRAS G12C mutant cell lines.NDJP.020WO PATENT

[0308] Results

[0309] Results of the cell viability assays and Loewe modeling demonstrated that the combination of siRNA No. 1 with Adagrasib or Sotorasib resulted in strong synergistic, anti- proliferative effects at low doses in the H358, MiaPaca-2 and H2122 cell lines as shown in Figs. 4A-H and Fig. 5. As seen in Figs. 4F and 4H, the greatest Loewe response scores for Adagrasib and Sotorasib were respectively 53 and 26. When the Loewe response score calculated by CombenefitTManalysis software in a cell-based assay is 20 or more, the combination of the agents are evidenced for having synergistic effect for treating, inhibiting, or ameliorating KRAS-mutant cancer. Since the greatest Loewe response scores with Adagrasib and Sotorasib were 20 or more as seen in Figs. 4A-H and Fig. 5, it was determined that the combination of siRNA No. 1 with Adagrasib or Sotorasib resulted in synergistic effect in the cell-based assay.

[0310] Example 2: Combination study with GST-p siRNA and chemotherapy agents

[0311] One day before the transfection, A549, H1373, H358, or H1792 cell lines, that are KRAS mutant cell lines, were plated in a 96-well plate at 3 x 103cells / well with 100 ^l of the appropriate medium containing 10% FBS and cultured in a 37ÛC incubator containing a humidified atmosphere of 5% CO2in air.

[0312] SiRNA No.1 was used at the following concentrations: 0.01 nM, 0.03 nM, 0.1 nM, 0.3 nM, 1.0 nM, and 3.0 nM. For one well: 0.2 ^l of RNAiMAX was mixed with 4.8 ^l of Opti- MEM I for 5 minutes at room temperature. For one well: 1 ^l of siRNA was mixed with 4 ^l of Opti-MEM and combined with the RNAiMAX solution and then mixed gently. Mixture was left for 5 minutes at room temperature. The mixture was incubated for 15 minutes at room temperature to allow the RNA-RNAiMAX complexes to form. (These steps were done simultaneously. The idea is that both the cells and the reagent should be normalized to room temperature before adding the reagent on the top of the cells.) 10 ^l of RNAi-RNAiMAX complexes was added to each well and the plate was gently shaken by hand. Incubate the cells in a 37ÛC incubator containing a humidified atmosphere of 5% CO2 in air for five days.

[0313] On day 2, A549, H1373, H358, or H1792 cell lines were treated with paclitaxel obtained from Bristol-Myers Squibb, gemcitabine obtained from Eli Lilly and Company, cisplatin obtained from Qilu Pharmaceutical, or pemetrexed obtained from LillyMedical in separate plates as follows: A549, H1373, H358, or H1792 cell lines were treated with paclitaxel, gemcitabine, cisplatin, or pemetrexed at the following concentrations: 0.00001 nM, 0.0001 nM, 0.001 nM, 0.01NDJP.020WO PATENT nM, 0.1 nM, 1 nM, 10 nM, 100 nM. The cell lines were returned to the 37ÛC incubator for additional 3 days. To quantitate ATP generated by metabolically active cells, cell viability assay was performed using a CellTiter-Glo luminescent cell viability assay (Promega) per the manufacturer’s instruction. The cell titer glow reagents were taken out from the -20ÛC. They were 15 ml flacon tubes containing 11 ml reagent. The reagents were thawed by placing the tube inside a beaker containing room temperature water and placing in a dark area. Frequently the water in the beaker was replaced with fresh water for faster thawing. It was kept in the drawer protected from light for 30 mins prior to starting the assay. The 96-well black cell culture plate was taken out from the incubator. The 96-well black cell culture plate was kept on the desk for 30 mins prior to starting the process.

[0314] 100 μl CellTiter-Glo reagent (Promega, USA) was added to lyse the cell lines. After a 20-min incubation at room temperature, the luminescence was recorded in a plate reader (BioTek, Winooski, VT) with an integration time of 1 second per well. The luminescence signals for the siRNA transfected cells were normalized by the luminescence signal obtained from mock cells.

[0315] Data from the plates including replicates were loaded into CombenefitTManalysis software to assess Loewe response synergistic scores. CombenefitTManalysis software first generated an experimental dose-response surface by generating a matrix of percentages of control versus the various concentrations of the GST-p inhibitor and the chemotherapy agents. These single agent dose-response fitted curves were then used to generate a Loewe model-based dose- response surface. This surface provided a “reference” dose-response surface. The experimental dose-response surface was then compared to the mathematical Loewe model-based dose-response, resulting in synergy distribution in the various concentrations of the GST-p inhibitor and the chemotherapy agents.

[0316] Results

[0317] Results of the cell viability assays demonstrated that the combinations of siRNA No. 1 with chemotherapy agents (paclitaxel, gemcitabine, cisplatin) controlled tumor cell growth significantly better than either siRNA No. 1 alone or the chemotherapy agent alone. In A549, H1373, H358, or H1792 cell lines that are KRAS mutant cell lines, paclitaxel combined with siRNA No. 1 at low doses resulted in synergistic cell killing effect (Loewe response score calculated by CombenefitTManalysis software was >20 as shown in Fig. 6). Gemcitabine orNDJP.020WO PATENT Cisplatin combination with siRNA No.1 in H1373 cell lines also resulted in synergistic cell killing effect (Loewe response scores calculated by CombenefitTManalysis software were >20 as shown in Fig.6). Pemetrexed combined with siRNA No.1 resulted in additive cell killing effect in A549 and H1373 cell lines (Loewe response score calculated by CombenefitTManalysis software was >10 and <20). Thus, it has been concluded that paclitaxel, gemcitabine, or cisplatin when combined with siRNA No. 1 exhibited synergistic effect in treating, inhibiting, or ameliorating KRAS-mutant cancer while Pemetrexed combined with siRNA No. 1 exhibited additive effect.

[0318] The inventors of the present application have concluded based on the results of the experiments above that siRNA No. 1, a very well tolerated monotherapy, can be used in combination with other drugs currently indicated for treating KRAS-mutant NSCLC to achieve more potent antitumor effects.

[0319] The term “comprising” as used herein is synonymous with “including,” “containing,” or “characterized by,” and is inclusive or open-ended and does not exclude additional, unrecited elements or method steps.

[0320] The above description discloses several methods and materials of the present application. This application is susceptible to modifications in the methods and materials, as well as alterations in the fabrication methods and equipment. Such modifications will become apparent to those skilled in the art from a consideration of this disclosure or practice of the embodiments disclosed herein. Consequently, it is not intended that this application be limited to the specific embodiments disclosed herein, but that it covers all modifications and alternatives coming within the true scope and spirit of the present application.

[0321] All references cited herein, including but not limited to published and unpublished applications, patents, and literature references, are incorporated herein by reference in their entirety and are hereby made a part of this specification. To the extent publications and patents or patent applications incorporated by reference contradict the disclosure contained in the specification, the specification is intended to supersede and / or take precedence over any such contradictory material.

Claims

NDJP.020WO PATENT WHAT IS CLAIMED IS:

1. A method for treating, inhibiting, or ameliorating KRAS-mutant cancer, comprising: administering a Glutathione S-transferase-p (GST-p) inhibitor and a KRAS inhibitor in therapeutically effective amounts to a subject suffering from the KRAS-mutant cancer in need thereof, wherein the KRAS inhibitor binds to a KRAS-mutant protein.

2. The method of claim 1, wherein the GST-p inhibitor is selected from the group consisting of an RNAi molecule, an antisense nucleic acid, and a vector expressing the RNAi molecule or antisense nucleic acid.

3. The method of claim 1, wherein the GST-p inhibitor is an RNAi molecule.

4. The method of claim 1, wherein the GST-p inhibitor is an RNAi molecule selected from the following Table 1:NDJP.020WO PATENTwherein upper case A, G, C and U refer to ribo-A, ribo-G, ribo-C and ribo-U, respectively; the lower case letters a, u, g, c, t refer to 2' -deoxy-A, 2' -deoxy-U, 2'-deoxy-G, 2'-deoxy-C, and deoxythymidine (dT = T = t) respectively; underlining refers to 2' -OMe-substituted; the lowerNDJP.020WO PATENT case letter f refers to 2' -deoxy-2' -fluoro substitution; the lower case letter s refers to a phosphorothioate linkage; and N is A, C, G, U, U, a, c, g, u, t, or a modified, inverted, or chemically modified nucleotide.

5. The method of claim 1, wherein the GST-p inhibitor is an RNAi molecule having: a sense strand sequence GAAGCCUUUUGAGACCCUAUU (SEQ ID NO: 26); and an antisense strand sequence fUAGgGuCuCAAAAGGCUUCUU (SEQ ID NO.52), wherein A, G, C and U refer to ribo-A, ribo-G, ribo-C and ribo-U, respectively; lower case letters a, u, g, c, t refer to 2’-deoxy-A, 2’-deoxy-U, 2’-deoxy-G, 2’-deoxy-C, and deoxythymidine (dT = T = t) respectively; underlining refers to 2’-OMe-substituted; and the lower case letter f refers to 2’-deoxy-2’-fluoro substitution.

6. The method of claim 1, wherein the GST-p inhibitor is encapsulated into a lipid nanoparticle.

7. The method of claim 1, wherein the GST-p inhibitor is encapsulated into a lipid nanoparticle, and the lipid nanoparticle comprises: a) a compound having the following Formula II:b) a DSPE lipid comprising a poly ethyleneglycol (PEG) region, a multi-branched PEG region, a methoxypoly ethyleneglycol (mPEG) region, a carbonyl- methoxypolyethyleneglycol region, or a polyglycerine region; c) a sterol lipid; and d) one or more neutral lipid(s) other than the DSPE lipid and the sterol lipid.

8. The method of claim 7, wherein the compound having the Formula II is a compound represented by the formula:NDJP.020WO PATENT.

9. The method of claim 7, wherein the sterol lipid is cholesterol.

10. The method of claim 7, wherein the DSPE lipid comprises a mPEG region.

11. The method of claim 7, wherein the DSPE lipid comprises a PEG region having a molecular mass from 200Da to 5000Da.

12. The method of claim 7, wherein the DSPE lipid is DSPE-mPEG-2000.

13. The method of claim 7, wherein the one or more neutral lipid(s) other than the DSPE lipid and the sterol lipid are phosphatidyl ethanolamine compound(s) and / or phosphatidyl choline compound(s).

14. The method of claim 7, wherein the one or more neutral lipid(s) other than the DSPE lipid and the sterol lipid are 1, 2-dioleoyl-sn-Glycero-3-Phosphocholine (DOPC) and / or 1,2- dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE).

15. The method of claim 1, wherein the KRAS inhibitor is a KRAS G12C inhibitor.

16. The method of claim 1, wherein the KRAS inhibitor is a KRAS G12C inhibitor selected from the group consisting of ARS-3248, AMG510 (Sotorasib), MRTX849 (Adagrasib), LY3499446, LY3537982, GDC-6036, D-1553, JDQ443, BI 1823911, FMC-376, and BBO-8520.

17. The method of claim 1, wherein the KRAS inhibitor is Sotorasib or Adagrasib.

18. The method of claim 1, wherein the KRAS-mutant cancer is KRAS-mutant colorectal cancer, KRAS-mutant lung cancer, or KRAS-mutant pancreatic cancer.

19. The method of claim 1, wherein the KRAS-mutant cancer is KRAS-mutant lung cancer.

20. The method of claim 1, wherein the KRAS-mutant cancer is KRAS-mutant non- small cell lung cancer (NSCLC).

21. The method of claim 1, wherein the GST-p inhibitor is administered to the subject before administering the KRAS inhibitor to the subject.

22. The method of claim 1, wherein the GST-p inhibitor is administered to the subject after administering the KRAS inhibitor to the subject.NDJP.020WO PATENT 23. The method of claim 1, wherein the GST-p inhibitor and the KRAS inhibitor are administered to the subject simultaneously.

24. A method for treating, inhibiting, or ameliorating cancer, comprising: administering a GST-p inhibitor and a chemotherapy drug in therapeutically effective amounts to a subject suffering from the cancer, wherein the GST-p inhibitor and the chemotherapy drug are synergistic as evidenced by a Loewe synergistic response score of 20 or more in a cell-based assay for the cancer.

25. The method of claim 24, wherein the chemotherapy drug is selected from the group consisting of paclitaxel, gemcitabine, and cisplatin.

26. The method of claim 24, wherein the chemotherapy drug is paclitaxel.

Images