Use of aquaporin 4 inhibitor for treating atrial fibrillation

Abstract

The present invention relates to use of an aquaporin 4 inhibitor for treating atrial fibrillation.

Description

Aquaporin 4 inhibitors for the treatment of atrial fibrillation

[0001] The present invention relates to the use of an aquaporin 4 inhibitor for the treatment of atrial fibrillation.

[0002]

[0003] Atrial fibrillation (AF) is a well-known supraventricular arrhythmia. Animal studies have reported that atrial fibrosis plays an important role in the induction and maintenance of AF. Atrial fibrosis causes interatrial heterogeneity in conduction, contributing to the substrate for regional reentry and the progressive nature of AF. The renin-angiotensin system, particularly angiotensin II (Ang II), has been proposed to play a crucial role in the development of cardiac remodeling during AF. Key proteins and mechanisms involved in the remodeling process of AF include changes in the expression of ion channels (resulting in a decrease in action potential duration), Ca 2+ Processing protein (intracellular Ca 2+ (elimination and release disorders) or connexins (intra-atrial conduction disorders). In addition, spontaneous sarcoplasmic reticulum Ca release through altered RyR2 2+ Release can act as a trigger for AF and induce AF by increasing fibrosis, which acts as a substrate to promote re-entry and maintenance of AF. However, the precise downstream molecules crucial for the development of atrial fibrosis induced by AF remain unclear, and a definitive diagnostic method for AF remains lacking.

[0004] Meanwhile, aquaporin 4 is a water channel protein, and 13 types have been identified in mammals. The kidney is the organ where AQP plays the most important role in the human body, and AQP2 is the most dominant. In particular, AQP4 plays the most important role in the brain, and AQP1, 3, 4, and 7 show important protein signals in heart muscle. AQP4 has been shown to play an important role in the development of edema in both brain and heart tissue. Although AQP4 is a single tetramer in the cell membrane, AQP4 differs from other AQPs in that it exists in a square array of tetramers or dimers, and plays the role of having the highest water permeability.

[0005] The role of AQP4 has been studied primarily in ischemic models. AQP4 knockout mice have been observed to exhibit reduced infarct size in ex vivo ischemia-reperfusion models and in vivo ischemia models without reperfusion. In experimental studies using mouse HL-1 cells, AQP4 inhibition has been shown to suppress apoptosis during ischemia and ischemia / reperfusion. Although the role of AQP4 has been studied in cardiovascular diseases such as myocardial infarction, the association between AQP4 and AF or its associated heart failure remains unknown.

[0006]

[0007] One object of the present invention is to provide a pharmaceutical composition for preventing or treating atrial fibrillation (AF)-related diseases, comprising an aquaporin 4 (AQP4) inhibitor as an active ingredient.

[0008] Another object of the present invention is to provide a composition comprising an aquaporin 4 inhibitor as an active ingredient for the prevention or treatment of atrial fibrillation-related diseases.

[0009] Another object of the present invention is to provide a method for preventing or treating a disease related to atrial fibrillation, comprising a step of administering the pharmaceutical composition to a subject in need thereof.

[0010]

[0011] Each description and embodiment disclosed in this invention can also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this invention fall within the scope of this invention. Furthermore, the scope of this invention is not limited by the specific descriptions described below.

[0012] Furthermore, those skilled in the art will recognize or be able to ascertain, using no more than routine experimentation, numerous equivalents to the specific embodiments of the invention described herein. Furthermore, such equivalents are intended to be encompassed by the present invention.

[0013] Additionally, throughout the specification of the present invention, when a part is said to "include" a certain component, this does not mean that other components are excluded, but rather that other components may be further included, unless specifically stated otherwise.

[0014]

[0015] Hereinafter, the present invention will be described in more detail.

[0016]

[0017] As one aspect for achieving the above object, the present invention provides a pharmaceutical composition for preventing or treating atrial fibrillation (AF)-related diseases, comprising an aquaporin 4 (AQP4) inhibitor as an active ingredient.

[0018]

[0019] The term "atrial fibrillation (AF)" of the present invention refers to an irregular and often very fast heart rhythm. This irregular heart rhythm is also called arrhythmia. This atrial fibrillation can cause blood clots in the heart, and this condition can also increase the risk of other heart-related complications, such as heart failure. During atrial fibrillation, the upper chambers of the heart, called atria, beat chaotically and irregularly, out of sync with the lower chambers of the heart, called ventricles. Atrial fibrillation may be asymptomatic in many patients, but it may also cause rapid and pounding heartbeats, shortness of breath, or dizziness. In the present invention, a disease related to atrial fibrillation may include atrial fibrillation or a secondary disease caused by atrial fibrillation, such as heart failure.

[0020] In the present invention, the term "prevention" means any action that inhibits or delays the occurrence, spread, and recurrence of a disease related to atrial fibrillation by administering the composition of the present invention, and "treatment" means any action that improves or beneficially changes the symptoms of the disease by administering the composition of the present invention.

[0021]

[0022] The term "aquaporin 4 inhibitor (AQP4 inhibitor)" of the present invention refers to all agents that reduce the expression or activity of AQP4 mRNA or AQP4 protein, and specifically may include all agents that reduce the expression of AQP4 by interfering with the expression of AQP4 at the transcriptional level. In the present invention, "AQP4" may be interpreted to refer to both AQP4 mRNA and protein unless otherwise specified. For example, the AQP4 inhibitor included in the pharmaceutical composition of the present invention may be a small molecule compound, a polypeptide, or a polynucleotide, but its form is not limited thereto as long as it is a substance that can inhibit the activity or expression of aquaporin 4.

[0023] For example, the AQP4 inhibitor of the present invention may be a peptide, compound, antibody or binding fragment that specifically binds to AQP4.

[0024] As another example, the AQP4 inhibitor may be polynucleotide-based.

[0025] As another example, the AQP4 inhibitor of the present invention may inhibit AQP4 by inducing RNAi phenomenon specifically on AQP4 mRNA.

[0026] In the present invention, the term "RNA interference (RNAi)" refers to a phenomenon in which expression of a target gene can be suppressed by 80% or more by introducing double-stranded RNA (dsRNA) composed of sense RNA having a sequence homologous to the mRNA of the target gene and antisense RNA having a sequence complementary thereto, thereby inducing destruction of the target gene mRNA after transcription by the dsRNA, and is also called gene silencing.

[0027] For example, the AQP4 inhibitor of the present invention may be at least one selected from siRNA, shRNA, miRNA, antisense oligonucleotide, or aptamer. The inhibitor may specifically bind to a target sequence, and the target sequence may be a gene or mRNA of AQP4.

[0028]

[0029] In the present invention, the terms "siRNA (small interfering RNA)" and "shRNA (small hairpin RNA)" refer to nucleic acid molecules capable of mediating RNA interference (RNAi) or gene silencing, and are used as an efficient gene knockdown method or gene therapy method because they can suppress the expression of target genes.

[0030] The above siRNA refers to a short dsRNA of approximately 21 to 22 bp that induces the RNAi phenomenon.

[0031] In addition, a vector system capable of expressing such siRNA in cells for a long period of time to change the phenotype has been developed in which a sense oligonucleotide of siRNA and a complementary antisense oligonucleotide are expressed with an appropriate number (5-9 nt) of loop sequences in between under an RNA pol III promoter capable of transcribing short RNA transcripts (e.g., U6 promoter, H1 promoter, etc.) to synthesize short hairpin-structured RNA (small hairpin RNA, shRNA). The shRNA synthesized in this way is cleaved by Dicer or RNase III, which are siRNA processing enzymes present in the cell, into siRNA, which is a dsRNA of 8-30 nucleotides in size, and can specifically bind to the mRNA of a target gene having a complementary sequence to induce gene silencing.

[0032] Therefore, which means to use among shRNA and siRNA can be determined by the choice of a person skilled in the art, and if the mRNA sequences they target are the same, a similar expression reduction effect can be expected.

[0033] The method for producing the above siRNA is not particularly limited, and methods known in the art can be used. siRNA can be synthesized chemically or enzymatically. Examples thereof include, but are not limited to, a method for directly chemically synthesizing siRNA, a method for synthesizing siRNA using in vitro transcription, a method for cleaving long double-stranded RNA synthesized by in vitro transcription using an enzyme, an expression method through intracellular delivery of an shRNA expression plasmid or viral vector, and an expression method through intracellular delivery of a PCR (polymerase chain reaction)-induced siRNA expression cassette.

[0034] In another example of the aforementioned embodiments, the AQP4 inhibitor of the present invention may be an shRNA targeting AQP4. The shRNA targeting AQP4 of the present invention may comprise a sense oligonucleotide and a complementary antisense oligonucleotide, and may include a loop sequence between the sense and antisense oligonucleotides.

[0035]

[0036] As used herein, the term "miRNA (micro RNA)" refers to a substance naturally present within cells that induces RNAi (RNAi) and participates in the regulation of specific genes. Any miRNA capable of suppressing the expression or activity of IGFBP3 may be included in the present invention without limitation to its type.

[0037]

[0038] As used herein, the term "antisense oligonucleotide" refers to DNA, RNA, or a derivative thereof that contains a nucleic acid sequence complementary to the sequence of a specific mRNA, and can bind to the complementary sequence in the mRNA and inhibit the translation of the mRNA into a protein. The antisense oligonucleotide sequence may be a DNA or RNA sequence that is complementary to the AQP4 target sequence and can bind to the sequence. The length of the antisense oligonucleotide may be 5 to 100 nt, 8 to 60 nt, 10 to 40 nt, or 10 to 30 nt. The antisense oligonucleotide may be synthesized in vitro by a conventional method and administered in vivo, or may be administered in a form in which the antisense oligonucleotide is synthesized in vivo. The method for synthesizing the antisense oligonucleotide in vitro may be synthesized by a biological / chemical method according to a conventional method in the technical field of the present invention. In addition, the synthesis of antisense oligonucleotides in vivo can be realized using a recombinant vector expressing the antisense oligonucleotide, and such a method can be easily performed according to a method conventional in the technical field of the present invention. Accordingly, the design of the antisense oligonucleotide of the present invention can be easily produced according to a method known in the technical field of the present invention, with reference to the base sequence of SEQ ID NO: 2.

[0039]

[0040] As used herein, the term "aptamer" refers to a single-stranded oligonucleotide, a nucleic acid molecule having a size of approximately 20 to 60 nucleotides, and having binding activity to a given target. Depending on the sequence, it has various three-dimensional structures and can have high affinity for a specific substance, like an antigen-antibody reaction. An aptamer can inhibit the activity of a given target by binding to the target. The aptamer of the present invention may be RNA, DNA, a modified nucleic acid, or a mixture thereof, and may also be linear or cyclic. Preferably, the aptamer can bind to AQP4 mRNA and inhibit the expression or activity of AQP4.

[0041]

[0042] As another example of the aforementioned embodiments, the AQP4 inhibitor of the present invention may be a vector expressing an shRNA targeting AQP4.

[0043] As used herein, the term "vector" refers to a DNA molecule capable of introducing a desired DNA fragment into a host cell for propagation, also known as a cloning vehicle. The term "expression vector" refers to a recombinant DNA molecule containing a desired coding sequence and an appropriate nucleic acid sequence essential for expressing the coding sequence operably linked to the vector in a specific host organism. In the present invention, the term "vector" may be used interchangeably with the term "expression vector."

[0044] The vector used in the present invention is not particularly limited as long as it is capable of replicating in a host cell, and any vector known in the art can be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, pDZ series, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series can be used as plasmid vectors, and adeno-associated virus (AAV) vectors, adenovirus vectors, herpes virus vectors, retrovirus vectors, lentivirus vectors, vaccinia virus vectors, poxvirus vectors, herpes simplex virus vectors, and the like can be used as viral vectors.

[0045] Insertion of the polynucleotide into a chromosome can be accomplished by any method known in the art, for example, homologous recombination, but is not limited thereto.

[0046] In the present invention, the term "transformation" means introducing a recombinant vector containing a target polynucleotide into a host cell so that the polynucleotide can be expressed in the host cell. As long as the transformed polynucleotide can be expressed in the host cell, it can include both being integrated and located within the chromosome of the host cell or being located extrachromosomally. The transformation method includes any method for introducing a nucleic acid into a cell, and can be performed by selecting an appropriate standard technique known in the art depending on the host cell. Examples thereof include, but are not limited to, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and lithium acetate-DMSO method.

[0047] In addition, the term "operably linked" as described above means that the polynucleotide sequence is functionally linked to a promoter sequence or expression control region that initiates and mediates transcription of the polynucleotide encoding the target protein of the present invention. The operable linkage can be produced using genetic recombination techniques known in the art, and site-specific DNA cleavage and ligation can be produced using cleavage and ligation enzymes known in the art, but is not limited thereto.

[0048] Specifically, the AQP4 inhibitor may be, but is not limited to, N-(1,3,4-thiadiazol-2-yl)nicotinamide, which is a type of small molecule compound.

[0049]

[0050] The pharmaceutical composition of the present invention can prevent or treat the disease by inhibiting the expression of fibrosis-related genes.

[0051] For example, the composition of the present invention can reduce the expression of one or more mRNAs selected from the group consisting of inflammatory factors such as IL-6, TNF-α, IL-1β, HMGB1, HIF-1α, NOX2, and NOX4, and fibrosis-related genes such as TGF-β, MMP9, and MMP2.

[0052] Furthermore, the composition of the present invention can inhibit calcium ion transients or cardiac hypertrophy induced by angiotensin II (Ang II).

[0053]

[0054] Preferably, the pharmaceutical composition according to the present invention may contain an AQP4 inhibitor as an active ingredient in an amount of 0.1 to 75 wt%, more preferably 1 to 50 wt%, based on the total weight of the composition.

[0055] The composition of the present invention may additionally contain a pharmaceutically acceptable carrier, diluent or excipient, and may be formulated and used in various forms, such as oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups and aerosols, and injections of sterile injection solutions, according to conventional methods according to each intended use, and may be administered orally or through various routes, including intravenous, intraperitoneal, subcutaneous, rectal and topical administration. Examples of suitable carriers, excipients or diluents that may be included in such compositions include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. In addition, the compositions of the present invention may further include fillers, anticoagulants, lubricants, wetting agents, fragrances, emulsifiers, preservatives and the like.

[0056] Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations are formulated by mixing at least one excipient, such as starch, calcium carbonate, sucrose, lactose, gelatin, etc., with the above composition. In addition to simple excipients, lubricants such as magnesium stearate and talc may be used.

[0057] Oral liquid preparations include suspensions, solutions, emulsions, and syrups, and may include various excipients, such as wetting agents, sweeteners, flavoring agents, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin.

[0058] Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solutions and suspending agents can include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Suppository bases include withepsol, macrogol, Tween 61, cacao butter, laurin, and glycerogelatin. Meanwhile, injections can include conventional additives such as solubilizers, isotonic agents, suspending agents, emulsifiers, stabilizers, and preservatives.

[0059]

[0060] At this time, the composition of the present invention is administered in a pharmaceutically effective amount. The term "pharmaceutically effective amount" as used herein means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment and not causing side effects. The effective dosage level may be determined based on factors including the patient's health condition, the type and severity of the disease, the activity and sensitivity of the drug, the method of administration, the time of administration, the route and excretion rate, the duration of treatment, drugs used in combination or simultaneously, and other factors well known in the medical field. The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or in multiple doses. It is important to administer an amount that can achieve the maximum effect with the minimum amount without side effects by taking all of the above factors into consideration, and this can be easily determined by those skilled in the art.

[0061] For example, the dosage may increase or decrease depending on the route of administration, severity of disease, gender, weight, age, etc., and thus the dosage does not limit the scope of the present invention in any way.

[0062] Specifically, the effective amount of the AQP4 inhibitor in the composition of the present invention may vary depending on the patient's age, sex, and weight, and is generally 1 to 100 mg per kg of body weight, preferably 5 to 60 mg, administered daily or every other day, or divided into 1 to 3 times a day. However, since the dosage may increase or decrease depending on the route of administration, severity of the disease, sex, body weight, age, etc., the above dosage does not limit the scope of the present invention in any way.

[0063]

[0064] Meanwhile, when the AQP4 inhibitor in the composition of the present invention is in the form of a small molecule compound such as N-(1,3,4-thiadiazol-2-yl)nicotinamide, it may be provided in the form of a pharmaceutically acceptable salt. As a salt, an acid salt formed by a pharmaceutically acceptable free acid is useful. The term "pharmaceutically acceptable salt" of the present invention means any and all organic or inorganic addition salts of the compound at a concentration that is relatively non-toxic and harmless to the patient and has an effective effect, and the side effects caused by the salt do not reduce the beneficial efficacy of the compound.

[0065] Acid addition salts are prepared by conventional methods, for example, by dissolving the compound in an excess of an aqueous acid solution and precipitating the salt using a water-miscible organic solvent such as methanol, ethanol, acetone or acetonitrile. Equimolar amounts of the compound and an acid or alcohol (e.g., glycol monomethyl ether) in water can be heated, and the mixture can then be evaporated to dryness, or the precipitated salt can be filtered off with suction.

[0066] At this time, organic acids and inorganic acids can be used as free acids, and inorganic acids such as hydrochloric acid, phosphoric acid, sulfuric acid, nitric acid, and tartaric acid can be used, and organic acids such as methanesulfonic acid, p-toluenesulfonic acid, acetic acid, trifluoroacetic acid, maleic acid, succinic acid, oxalic acid, benzoic acid, tartaric acid, fumaric acid, mandelic acid, propionic acid, citric acid, lactic acid, glycolic acid, gluconic acid, galacturonic acid, glutamic acid, glutaric acid, glucuronic acid, aspartic acid, ascorbic acid, carbonic acid, vanillic acid, and hydroiodic acid can be used, but are not limited thereto.

[0067] Additionally, pharmaceutically acceptable metal salts can be prepared using bases. Alkali metal salts or alkaline earth metal salts are obtained, for example, by dissolving a compound in an excess alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering out the undissolved compound salt, and evaporating and drying the filtrate. In this case, sodium, potassium, or calcium salts are particularly suitable for pharmaceutical purposes, but are not limited thereto. Furthermore, the corresponding silver salt can be prepared by reacting an alkali metal or alkaline earth metal salt with a suitable silver salt (e.g., silver nitrate).

[0068] For example, the pharmaceutically acceptable salt of the AQP4 inhibitor of the present invention, N-(1,3,4-thiadiazol-2-yl)nicotinamide, includes salts of acidic or basic groups that may be present in N-(1,3,4-thiadiazol-2-yl)nicotinamide, unless otherwise indicated. For example, pharmaceutically acceptable salts may include sodium, calcium, and potassium salts of the hydroxy group, and other pharmaceutically acceptable salts of the amino group include hydrobromide, sulfate, hydrogen sulfate, phosphate, hydrogen phosphate, dihydrogen phosphate, acetate, succinate, citrate, tartrate, lactate, mandelate, methanesulfonate (mesylate), and p-toluenesulfonate (tosylate) salts, and can be prepared through methods for preparing salts known in the art.

[0069]

[0070] Additionally, the AQP4 inhibitor in the form of a small molecule compound such as N-(1,3,4-thiadiazol-2-yl)nicotinamide according to the present invention may include, without limitation, not only pharmaceutically acceptable salts thereof but also solvates such as possible hydrates that can be prepared therefrom and all possible stereoisomers. For example, solvates and stereoisomers of N-(1,3,4-thiadiazol-2-yl)nicotinamide can be prepared from N-(1,3,4-thiadiazol-2-yl)nicotinamide using methods known in the art.

[0071] Furthermore, the AQP4 inhibitor in the form of a small molecule compound, such as N-(1,3,4-thiadiazol-2-yl)nicotinamide according to the present invention, may be prepared in a crystalline or amorphous form, and when prepared in a crystalline form, may be optionally hydrated or solvated. For example, the present invention may include compounds containing various amounts of water as well as stoichiometric hydrates of N-(1,3,4-thiadiazol-2-yl)nicotinamide. The solvates of the AQP4 inhibitor in the form of a small molecule compound, such as N-(1,3,4-thiadiazol-2-yl)nicotinamide according to the present invention, include both stoichiometric solvates and non-stoichiometric solvates.

[0072]

[0073] In another aspect, the present invention provides a composition comprising an aquaporin 4 inhibitor as an active ingredient for the prevention or treatment of atrial fibrillation-related diseases.

[0074] The terms of the present invention, “aquaporin 4 inhibitor”, “atrial fibrillation-related disease”, “prevention” and “treatment” are as described above.

[0075] The term “composition” of the present invention can be defined similarly to “pharmaceutical composition”.

[0076]

[0077] For example, as described above, the composition of the present invention can reduce the expression of one or more mRNAs selected from the group consisting of inflammatory factors such as IL-6, TNF-α, IL-1β, HMGB1, HIF-1α, NOX2, and NOX4, and fibrosis-related genes such as TGF-β, MMP9, and MMP2, and can suppress calcium ion transients or cardiac hypertrophy induced by angiotensin II (Ang II). Therefore, a composition comprising the aquaporin 4 inhibitor as an active ingredient can be usefully used for the prevention or treatment of atrial fibrillation-related diseases.

[0078]

[0079] In another aspect, the present invention provides a method for preventing or treating atrial fibrillation-related diseases, comprising administering to a subject in need thereof a pharmaceutical composition for preventing or treating atrial fibrillation-related diseases, the pharmaceutical composition comprising an aquaporin 4 inhibitor as an active ingredient.

[0080] The terms of the present invention, “aquaporin 4 inhibitor”, “pharmaceutical composition”, “atrial fibrillation-related disease”, “prevention” and “treatment” are as described above.

[0081]

[0082] The term "subject" of the present invention refers to any animal, including humans, monkeys, cows, horses, sheep, pigs, chickens, turkeys, quails, cats, dogs, mice, rats, rabbits, or guinea pigs, that has developed or may develop a disease related to atrial fibrillation, and the disease can be effectively prevented or treated by administering the pharmaceutical composition of the present invention to the subject. The pharmaceutical composition of the present invention can be administered in combination with existing therapeutic agents.

[0083] The term "administration" in the present invention means providing a predetermined substance to a patient by any suitable method, and the route of administration of the composition of the present invention may be administered through any common route as long as it can reach the target tissue. It may be intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, oral administration, topical administration, intranasal administration, intrapulmonary administration, or rectal administration, but is not limited thereto. In addition, the pharmaceutical composition of the present invention may be administered by any device that allows the active substance to travel to the target cell. Preferred administration methods and formulations include intravenous injection, subcutaneous injection, intradermal injection, intramuscular injection, and drip injection. Injectables can be manufactured using aqueous solvents such as saline solution and Ringer's solution, non-aqueous solvents such as vegetable oils, higher fatty acid esters (e.g., ethyl oleate, etc.), alcohols (e.g., ethanol, benzyl alcohol, propylene glycol, glycerin, etc.), and pharmaceutical carriers such as stabilizers to prevent deterioration (e.g., ascorbic acid, sodium bisulfite, sodium pyrosulfite, BHA, tocopherol, EDTA, etc.), emulsifiers, buffers to adjust pH, and preservatives to inhibit microbial growth (e.g., phenylmercuric nitrate, thimerosal, benzalkonium chloride, phenol, cresol, benzyl alcohol, etc.).

[0084] The term "therapeutically effective amount" used in combination with an active ingredient in the present invention means an amount of an aquaporin 4 inhibitor effective in preventing or treating a target disease.

[0085] The pharmaceutical composition of the present invention may additionally contain, as an active ingredient, a known drug used for the prevention or treatment of each known disease other than an aquaporin 4 inhibitor, depending on the type of disease to be prevented or treated. For example, when used for the prevention or treatment of atrial fibrillation-related diseases, the pharmaceutical composition of the present invention may additionally contain, as an active ingredient, a known drug other than an aquaporin 4 inhibitor, and may be used in combination with other known treatments for the treatment of these diseases.

[0086]

[0087] The pharmaceutical composition comprising an aquaporin 4 (AQP4) inhibitor according to the present invention as an active ingredient can suppress a significant increase in the expression of inflammatory factors and fibrosis-related genes induced by angiotensin II (Ang II) and reduce them to levels equivalent to or similar to normal conditions, and further suppress cardiac hypertrophy in an atrial fibrillation animal model and suppress changes in related variables to maintain them at levels equivalent to or similar to normal individuals, and therefore can be usefully used for the prevention or treatment of diseases related thereto, such as atrial fibrillation or heart failure.

[0088]

[0089] Figure 1 shows changes in cell viability and inflammation-related protein expression following administration of angiotensin II (Ang II) and / or aquaporin 4 (AQP4) inhibitors. The expression levels of IL-6, TNF-α, IL-1β, HMGB1, HIF-1α, NOX2, and NOX4 were confirmed by real-time PCR compared to GAPDH mRNA (*p<0.1, vs. control HL-1 cells).

[0090] Figure 2 shows the expression levels of fibrosis markers TGF-β, MMP9, and MMP2 according to administration of Ang II and / or AQP4 inhibitors as measured by real-time PCR (A to C) and their immunofluorescence confocal microscopy images (D) (*p<0.1 in A to C, vs. control HL-1 cells).

[0091] Figure 3 shows Ang II-induced Ca in HL-1 cells 2+Figure 1. Time-lapse calcium imaging of cells loaded with the intracellular calcium indicator Fluo-4 AM. (A) Representative line scans of time-lapse calcium imaging of cells loaded with the intracellular calcium indicator Fluo-4 AM, representing representative recordings of spontaneous calcium transients in each group. (B) Figure 1. Summary of amplitude and frequency in each group. Amplitude was significantly increased in the group treated with Ang II, and the increase was significantly reduced in the group treated with Ang II and an AQP inhibitor. (C) Figure 1. Calcium sparks between amplitudes. (D) Figure 1. Calcium sparks in each group. Sparks were increased in the group treated with Ang II, and the increase was significantly reduced in the group treated with Ang II and an AQP inhibitor. *P<0.001 vs. the control group by Student's t-test, n=5.

[0092] Figure 4 is a diagram showing the effect of an AQP4 inhibitor in a mouse atrial fibrillation model induced by Ang II for 4 weeks. Normal mice were used as the control group, Ang II group was used as the Ang II group, mice treated only with Ang II were used as the experimental group, mice treated with the Ang II-treated mice and the AQP4 inhibitor were used as the experimental group, and mice treated with the Ang II-treated mice and the PBS instead of the AQP4 inhibitor were used as the negative experimental group. (A) shows representative cardiac images obtained from each group, (B) shows M-mode ultrasound images measured for the hearts of mice in each group, and (C) to (F) show the results of echocardiographic parameter analysis measured for mice in each group. *P<0.001 vs. control group, n=5 per group. Data are expressed as mean±SEM.

[0093] Figure 5 is a diagram showing the effect of angiotensin II and / or AQP4 inhibitors on atrial fibrillation induced by programmed electrical stimulation in a mouse model. (A) Representative images induced in each group by programmed electrical stimulation; (B) The percentage of mice in each group induced by the electrical stimulation; (C) The time from the induction of atrial fibrillation to the end measured for the mice in each group. *P<0.001 vs. control group, n=5 per group. Data are expressed as mean±SEM.

[0094]

[0095] Hereinafter, the present invention will be described in more detail through examples. These examples are intended to explain the present invention more specifically, and the scope of the present invention is not limited by these examples.

[0096]

[0097] Example 1: Preparation of angiotensin II-induced atrial fibrillation cell model and evaluation of inflammatory mechanisms.

[0098]

[0099] Angiotensin II (Ang II) was treated in HL-1 atrial cardiomyocytes to create a cell model for inducing atrial fibrillation. For example, Ang II was administered at various concentrations (100, 1000, and 5000 nM), and cell viability was analyzed using the CellTiter 96 non-radioactive cell proliferation assay kit (Promega, Madison, WI, USA), which is based on the reduction of MTT to formazan dye by the action of mitochondrial enzymes. More specifically, HL-1 cells were seeded in 96-well plates at a density of 1 × 10 4Cells were seeded at a density of 10 cells / well and cultured overnight at 37°C and 5% CO2. The cultured cells were treated with Ang II at the indicated concentrations (0, 100, 1000, and 5000 nM) for 24 h, and the absorbance of each well was measured at 570 nm, which is shown in Fig. 1A. Similarly, HL-1 cells were treated with Ang II alone, and Ang II plus the AQP4 inhibitor (1 μM), TGN-020 (10 μM / L for cells, 200 mg / kg for mice), and the cell viability of the samples (denoted as Ang II and Ang II + AQP4 inhibitor, respectively) was measured and compared in Fig. 1B.

[0100] Furthermore, the expression of inflammation-related genes was analyzed using RNA samples isolated from the cultured HL-1 cells. The expression of IL-6, TNF-α, IL-1β, HMGB1, HIF-1α, NOX2, and NOX4 was analyzed using RNA samples isolated from HL-1 cells, a cardiomyocyte cell line treated with Ang II.

[0101] HL-1 cells (ATCC) were cultured in Complete Claycomb medium (SAFC Biosciences, Lenexa, KS, USA) supplemented with 10% fetal bovine serum (FBS), 1% penicillin-streptomycin, 100 μM norepinephrine (Sigma-Aldrich, Merck KGaA, Darmstadt, Germany), and 4 mM L-glutamine (Gibco, Thermo Fisher Scientific, Inc., Waltham, MA, USA) on plates coated with 12.5 μg / mL fibronectin and 0.02% gelatin (Sigma-Aldrich; Merck KGaA) at 37°C in a humidified incubator with 5% CO2 and 21% O2.

[0102] As a result, the expression of inflammation-related genes in HL-1 cells tended to be higher in the Ang II group than in the control group (Fig. 1C), and it was confirmed that the expression in HL-1 cells in the Ang II (1 μM) + AQP4 inhibitor group was significantly reduced in the Ang II group. Table 1 below lists the primer sequences used to confirm the expression of each inflammatory factor.

[0103] Target gene Forward primer Reverse primer IL-6 CGTGGAAATGAGAAAAGAGTTGT (SEQ ID NO: 1) TCCAGTTTGGTAGCATCCATC (SEQ ID NO: 2) TNF-α CCATTCCTGAGTTCTGCAAAG (SEQ ID NO: 3) GCAAAATATAAATAGAGGGGGGC (SEQ ID NO: 4) IL-1β AAACGGTTTGTCTTCAAC (SEQ ID NO: 5) ATGGTGAAGTCAATTATGTC (SEQ ID NO: 6) HNGB1 TGGCAAAGGCTGACAAGGCTC (SEQ ID NO: 7) GGATGCTCGCCTTTGATTTTGG (SEQ ID NO: 8) HIF-1α CTCCCTTTTTCAAGCAGCAG (SEQ ID NO: 9) GCATGCTAAATCGGAGGGTA (SEQ ID NO: 10) NOX2 CCCTTTGGTACAGCCAGTGAAGAT (SEQ ID NO: 11)CAATCCCAGCTCCCACTAACATCA(SEQ ID NO: 12)NOX4GGATCACAGAAGGTCCCTAGCAG(SEQ ID NO: 13)GCAGCTACATGCACACCTGAGAA(SEQ ID NO: 14)GAPDHCCGTGAAAAGATGACCCAG(SEQ ID NO: 15)TAGCCACGCTCGGTCAGG(SEQ ID NO: 16)

[0104] Example 2: Effect of AQP4 inhibitors on cardiac fibrosis

[0105]

[0106] Similarly to Example 1, in order to confirm the expression of fibrosis-related genes, TGF-β, MMP9, and MMP2, in an atrial fibrillation-induced cell model prepared by treating HL-1 cells with Ang II, RNA samples isolated from the HL-1 cells were analyzed, and the results are shown in Figs. 2A to 2C. As shown in Figs. 2A to 2C, the expression of all fibrosis-related genes, TGF-β, MMP9, and MMP2, tended to be higher in the Ang II group than in the control group, and was significantly decreased in the Ang II (1000 nM) + AQP4 inhibitor group compared to the Ang II group.

[0107] HL-1 cells from the control, Ang II, and Ang II + AQP4 inhibitor groups were cultured on regular cell culture dishes and a flexible energy harvester, respectively. The cultured cells were fixed with 4% ice-cold formaldehyde (pH 7.2–7.3) for 1 h at room temperature, washed, and then permeabilized with 0.3% Triton X-100 for 30 min. The cells were washed and blocked with 5% bovine serum albumin (BSA) and 0.3% Triton X-100 in phosphate-buffered saline (PBS) for 30 min. The cells were washed and stained with primary antibodies against TGF-β, MMP9, and MMP2 in PBS containing 0.3% Triton X-100 and 1% BSA overnight at 4°C. Cells were washed and stained with Alexa Fluor 488 and Alexa 555 secondary antibodies in PBS containing 0.3% Triton X-100 and 1% BSA for 3 hours at room temperature. Cells were then washed three times for 5 minutes and stained with DAPI (4',6-diamidino-2-phenylindole) during the final wash. Fluorescence images were captured using a confocal microscope, and the results are shown in Fig. 2D.

[0108] As shown in Figure 2D, in the Ang II group, TGF-β, MMP9, and MMP2 were all increased 2-3 times compared to the control group, but the Ang II + AQP4 inhibitor group effectively suppressed the increase in the above fibrosis-related genes (p<0.001). Table 2 below lists the primer sequences used to confirm the expression of each fibrosis-related factor.

[0109] Target gene Forward primer Reverse primer TGF-β CCACCTGCAAGACCATCGAC (SEQ ID NO: 17) CTGGCGAGCCTTAGTTTGGAC (SEQ ID NO: 18) MMP9 GGACCCGAAGCGGACATTG (SEQ ID NO: 19) CGTCGTCGAAATGGGCATCT (SEQ ID NO: 20) MMP2 CCTGGACCCTGAAACCGTG (SEQ ID NO: 21) TCCCCATCATGGATTCGAGAA (SEQ ID NO: 22) GAPDHCCTGAAAAGATGACCCAG (SEQ ID NO: 15) TAGCCACGCTCGGTCAGG (SEQ ID NO: 16)

[0110] Example 3: Effect of AQP4 inhibitors on calcium transients in cardiac cells.

[0111]

[0112] Next, spontaneous Ca 2+ To investigate the effect of AQP4 inhibitors on transient phenomena, HL-1 cells were seeded in 1 mL of Claycomb medium in 35 mm dishes, and the AQP4 inhibitors were administered to the HL-1 cells, incubated at 37°C for 24 h, and the cells were fused. The cells were observed using a confocal microscope to confirm whether the miRNAs were properly delivered and effective within the HL-1 cells, and the results were evaluated as in Figures 3B to 3D.

[0113] At this time, dynamic Ca 2+Images were obtained using a confocal microscope (LSM700; Carl Zeiss, Germany). HL-1 cells from the control, Ang II, and Ang II + AQP4 inhibitor groups were washed three times with live cell imaging solution (140 mM NaCl, 2.5 mM KCl, 1.8 mM CaCl2, 1 mM MgCl2, 20 mM HEPES-Na, 5.6 mM glucose, pH 7.4) and loaded with 5 μM fluo-4AM. The coverslips were mounted in a 1 mL volume chamber at 37°C for 20 min and placed on the microscope for fluorescence measurement after excitation with a 488 nm wavelength argon laser beam or a filter system. Fluo-4 was excited with the 488 nm line of the argon laser, and emission signals above 505 nm were collected. The line scan images were collected along the longitudinal axis of the cells, and each line consisted of 512 pixels with a spacing of 0.14 μm. After sequential scanning, two-dimensional images of 512 × 10,000 lines or 512 × 20,000 lines were generated and stored for offline analysis. Image sequences were analyzed using NIH open access software ImageJ, and intracellular Ca 2+ Levels were expressed as a percentage of fluorescence intensity relative to baseline fluorescence intensity.

[0114] As shown in Fig. 3A, spontaneous Ca obtained from HL-1 cells in the control, Ang II, and Ang II + AQP4 inhibitor groups 2+ Representative line scan images of the transient phenomenon were obtained.

[0115] Ca 2+Amplitude and wave frequency increased in the Ang II group (P<0.001, 1.0±0.0 F / F0 to 3.5±0.2 F / F0) compared to the control group, and recovered in the Ang II + AQP4 inhibitor group (P<0.001, 3.5±0.2 F / F0 to 1.2±0.1 F / F0) compared to the Ang II group (Fig. 3B). Similarly, Ca 2+ In Spark, the Ang II + AQP4 inhibitor group (2.8±0.2 F / F0 to 1.2±0.1 F / F0) showed a tendency to recover to a level similar to that of the control group compared to the Ang II group.

[0116]

[0117] Example 4: Effect of AQP4 inhibitors in a mouse atrial fibrillation animal model.

[0118]

[0119] Mice were randomly assigned to the control group, Ang II, Ang II + AQP4, and Ang II + PBS groups, with 5 mice each. The Ang II group was administered Ang II at a concentration of 1500 ng for 4 weeks using an osmotic pump (Alzet 2004). The Ang II + AQP4 inhibitor group was administered Ang II through an osmotic pump inserted into the dorsal region similarly to the Ang II group, and the AQP4 inhibitor was injected intraperitoneally twice a week for a total of 8 times to prepare experimental animals. The Ang II + PBS group was prepared similarly to the Ang II + AQP4 inhibitor group, except that PBS was administered instead of the AQP4 inhibitor as a negative control. The experimental animals in each group prepared as described above were sacrificed, and the hearts were removed for observation and analysis, and the results are shown in Fig. 4.

[0120] As shown in Fig. 4A, the recovered hearts were visually observed, and significant cardiac hypertrophy was confirmed in the Ang II and Ang II + PBS groups compared to the control group, and it was confirmed that the cardiac hypertrophy was significantly reduced in the Ang II + AQP4 inhibitor group. For more accurate confirmation, an echocardiographic experiment was performed, and the results are shown in Fig. 4B to E. Specifically, before killing the mice in each group, they were anesthetized with IFRAN, and the hair on the chest was removed. The shape and beat of the heart were checked using a cardiac ultrasound machine, and based on this, ventricular function-related variables such as left ventricular end-diastolic diameter (LVEDD), left ventricular end-systolic dimension (LVEDD), fractional shortening (FS), and ejection fraction (EF) were calculated.

[0121]

[0122] Example 5: Effect of AQP4 inhibitors on atrial fibrillation progression in an in vivo model.

[0123]

[0124] Finally, we analyzed the inducibility of atrial fibrillation (AF) in mice using a burst pacing protocol. A pacing catheter was placed through the jugular vein into the right atrium and right ventricle, and an electrode catheter capable of pacing and data acquisition was used. All pacing studies used a protocol with an initial cycle length of 100 ms, which was reduced by 10 ms every 2 seconds before terminating. A 30-second recovery period was provided between burst pacing sessions. An irregular atrial response lasting longer than 1 second was considered to be AF. The experiment was terminated when AF-induced responses persisted for 10 minutes, and the AF incidence and total duration were defined as the sum of all AF episodes.

[0125] Figure 5A shows the electrocardiograms inducing atrial fibrillation using a burst pacing protocol. In the control and Ang II + AQP4 inhibitor groups, atrial fibrillation was not observed at short pacing cycle lengths, whereas in the Ang II and Ang II + PBS groups, atrial fibrillation was easily induced at long cycle lengths (Figure 5B), and atrial fibrillation persisted significantly longer (Figure 5C).

[0126]

[0127] From the above description, those skilled in the art will understand that the present invention can be implemented in other specific forms without altering its technical spirit or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention should be interpreted as encompassing all changes or modifications derived from the meaning and scope of the following claims and their equivalent concepts, rather than the detailed description above.

Claims

1. A pharmaceutical composition for preventing or treating atrial fibrillation (AF)-related diseases, comprising an aquaporin 4 (AQP4) inhibitor as an active ingredient.

2. In paragraph 1, A pharmaceutical composition, wherein the above atrial fibrillation-related disease is atrial fibrillation or atrial fibrillation-induced heart failure.

3. In paragraph 1, A pharmaceutical composition, wherein the composition reduces the expression of one or more mRNAs selected from the group consisting of IL-6, TNF-α, IL-1β, HMGB1, HIF-1α, NOX2, NOX4, TGF-β, MMP9, and MMP2.

4. In paragraph 1, A pharmaceutical composition, wherein the composition inhibits calcium ion transients or cardiac hypertrophy induced by angiotensin II (Ang II).

5. In paragraph 1, A pharmaceutical composition wherein the AQP4 inhibitor is a compound, peptide, antibody, binding fragment, siRNA, shRNA, miRNA, antisense oligonucleotide or aptamer.

6. In paragraph 1, A pharmaceutical composition wherein the above AQP4 inhibitor is N-(1,3,4-thiadiazol-2-yl)nicotinamide.

7. Use of a composition containing an aquaporin 4 inhibitor as an active ingredient for the prevention or treatment of atrial fibrillation-related diseases.

8. A method for preventing or treating atrial fibrillation-related diseases, comprising administering to a subject in need thereof a pharmaceutical composition for preventing or treating atrial fibrillation-related diseases containing an aquaporin 4 inhibitor as an active ingredient.

Images