Tagmentation methods and kits

Abstract

In an example, a deoxyribonucleic acid (DNA) sample is introduced to a flow cell including depressions and first and second transposome complexes immobilized within the depressions, whereby tagmentation generates respective DNA sample fragments in at least some depressions. The first and second transposome complexes respectively include first and second amplification domains. A pre-grafted particle suspension is introduced into the flow cell, whereby at least some pre-grafted particles respectively attach within a plurality of the at least some depressions. The suspension includes a liquid carrier and pre-grafted particles, which include first and second primers attached to a core. The first and second primers have a same sequence, respectively, as the first and second amplification domains. Amplification is initiated such that, within each of the plurality of the at least some depressions, the respective DNA sample fragments are amplified on a respective one of the at least some pre-grafted particles.

Description

TAGMENTATION METHODS AND KITS CROSS-REFERENCE TO RELATED APPLICATION

[0001] This application claims the benefit of U.S. Provisional Application S.N. 63 / 588,510, filed October 6, 2023, the contents of which is incorporated by reference herein in its entirety. REFERENCE TO SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted electronically in XML file format and is hereby incorporated by reference in its entirety. Said XML copy, created on September 24, 2024 is named ILI271BPCT_IP-2706-PCT_Sequence_Listing.xml and is 14,892 bytes in size. BACKGROUND

[0003] Double-stranded DNA (dsDNA) target molecules can be fragmented and tagged to generate a library of smaller dsDNA that can be further processed to form single-stranded DNA molecules (ssDNA). These smaller, single-stranded DNA molecules may be used as templates in DNA sequencing reactions. The templates may enable short read lengths to be obtained, and then during data analysis, overlapping short sequence reads can be aligned to reconstruct the longer nucleic acid sequences. Some methods for fragmentation and tagging of double-stranded DNA are limited to single samples as they do not involve indexing, generate small fragments, generate excessive waste, involve expensive instruments for fragmentation, and / or are time-consuming. SUMMARY

[0004] Flow cells are disclosed herein that include transposome complexes bound within depressions or a lane of the flow cell. Pre-grafted particles are disclosed herein that have a primer set attached thereto. The flow cells enable on-board tagmentation of a DNA sample to generate fully adapted DNA fragments, and the pre-graftedparticles (which are introduced into the cell either pre- or post-tagmentation) enable amplification of the fully adapted DNA fragments. By physically separating the transposome complexes from the primers, neither the depression surfaces nor the pre- grafted particles are overcrowded, which can be detrimental to tagmentation (e.g., due to steric hindrance), fragment insert size (due to closely spaced transposome complexes), amplification, and cluster generation. In some of the examples disclosed herein, tagmentation occurs on the flow cell surface prior to pre-grafted particle introduction. In other of the examples disclosed herein, the pre-grafted particles are introduced into the flow cell prior to tagmentation. In the latter examples, some of the transposomes at the bottom of the depressions or lane are physically hindered, and thus transposomes at opposed ends of the depressions or lanes may be used for tagmentation. This can lead to increased insert sizes of the resulting DNA fragments. BRIEF DESCRIPTION OF THE DRAWINGS

[0005] Features of examples of the present disclosure will become apparent by reference to the following detailed description and drawings, in which like reference numerals correspond to similar, though perhaps not identical, components. For the sake of brevity, reference numerals or features having a previously described function may or may not be described in connection with other drawings in which they appear.

[0006] Fig.1 is a schematic illustration of an example of a pre-grafted particle disclosed herein;

[0007] Fig.2 is a top view of an example flow cell;

[0008] Fig.3A is an enlarged, cross-sectional view, taken along the 3A-3A line of Fig.2, depicting a patterned and open wafer flow cell architecture;

[0009] Fig.3B is an enlarged, cross-sectional view, taken along the 3B-3B line of Fig.2, depicting one example of a patterned and enclosed flow cell architecture;

[0010] Fig.3C is an enlarged, cross-sectional view, taken along the 3C-3C line of Fig.2, depicting another example of a patterned and enclosed flow cell architecture;

[0011] Fig.3D is an enlarged, cross-sectional view, taken along the 3D-3D line of Fig.2, depicting an example of a non-patterned and enclosed flow cell architecture;

[0012] Fig.4A schematically one example of a dimer including first and second transposome complexes;

[0013] Fig.4B schematically illustrates another example of a transposome complex;

[0014] Fig.5A through Fig.5F are schematic illustrations which together illustrate one example method, where Fig.5A depicts two depressions of a flow cell having transposome complexes attached therein, Fig.5B depicts a DNA sample introduced into the depressions and exposed to tagmentation to generate partially adapted DNA fragments, Fig.5C depicts the generation of fully adapted DNA fragments, Fig.5D depicts the linearization of the fully adapted DNA fragments so that one type of fully adapted DNA fragment remains attached within the depressions, Fig.5E depicts pre- grafted particles introduced into the depressions and the initiation of bridge amplification, and Fig.5F depicts the DNA fragments amplified on the surface of the pre-grafted particles;

[0015] Fig.5A, Fig.5G through Fig.5I, Fig.5E and Fig.5F are schematic illustrations which together illustrate another example method, where Fig.5A depicts two depressions of a flow cell having transposome complexes attached therein, Fig. 5G depicts pre-grafted particles introduced into the depressions, Fig.5H depicts a DNA sample introduced into the depressions and exposed to tagmentation to generate partially adapted DNA fragments, Fig.5I depicts the generation of fully adapted DNA fragments, Fig.5E depicts the initiation of bridge amplification on the pre-grafted particle surface, and Fig.5F depicts the DNA fragments amplified on the surface of the pre-grafted particles;

[0016] Fig.6 is a schematic flow diagram illustrating an example of tagmentation followed by an extension reaction; and

[0017] Fig.7 is a schematic flow diagram illustrating an example of tagmentation followed by ligation. DETAILED DESCRIPTION

[0018] In the examples set forth herein, transposome complexes are attached within depressions or a lane of a flow cell and primers are attached to pre-graftedparticles that are introduced into the or the lane either before or after tagmentation has taken place within the depressions. By incorporating the primers at the surface of the pre-grafted particles instead of within the depressions or the lane with the transposome complexes, the depressions are not or the lane is not overcrowded. Moreover, the primers can be introduced into the depressions or the lane at a desirable time for amplification of fully adapted DNA fragments generated on- board the flow cell via tagmentation and extension or ligation. Thus, the examples disclosed herein enable on-board tagmentation and amplification, without over complicating the surface chemistry of the flow cell.

[0019] Definitions

[0020] Terms used herein will be understood to take on their ordinary meaning in the relevant art unless specified otherwise. Several terms used herein and their meanings are set forth below.

[0021] As used herein, the singular forms “a,” “an,” and “the” refer to both the singular as well as plural, unless the context clearly indicates otherwise. The term “comprising” as used herein is synonymous with “including,” “containing,” or “characterized by,” and is inclusive or open-ended and does not exclude additional, unrecited elements or method steps.

[0022] Reference throughout the specification to “one example,” “another example,” “an example,” and so forth, means that a particular element (e.g., feature, structure, composition, configuration, and / or characteristic) described in connection with the example is included in at least one example described herein, and may or may not be present in other examples. In addition, it is to be understood that the described elements for any example may be combined in any suitable manner in the various examples unless the context clearly dictates otherwise.

[0023] The terms “substantially” and “about” used throughout this disclosure, including the claims, are used to describe and account for small fluctuations, such as those due to variations in processing. For example, these terms can refer to less than or equal to ±5% from a stated value, such as less than or equal to ±2% from a stated value, such as less than or equal to ±1% from a stated value, such as less than orequal to ±0.5% from a stated value, such less than or equal to ±0.2% from a stated value, such as less than or equal to ±0.1% from a stated value, such as less than or equal to ±0.05% from a stated value.

[0024] Adapter: A linear oligonucleotide sequence that can be fused or otherwise added to a nucleic acid molecule, for example, by ligation or tagmentation or an extension reaction. Suitable adapter lengths may range from about 10 nucleotides to about 100 nucleotides, or from about 12 nucleotides to about 60 nucleotides, or from about 15 nucleotides to about 50 nucleotides. The adapter may include any combination of nucleotides and / or nucleic acids. In some examples, the adapter can include an amplification domain, e.g., having a universal nucleotide sequence, such as a P5 or P7 sequence, that can serve as a starting point for template amplification and cluster generation. In other examples, the adapter can include a sequence that is complementary to at least a portion of a surface bound primer (which may be attached to a particle or to a flow cell, and which includes the universal nucleotide sequence). In the latter example, the adapter sequence can hybridize to the complementary surface bound primer during amplification and cluster generation. In some examples, the adapter can also include a sequencing primer sequence (i.e., sequencing binding site). Combinations of different adapters may be incorporated into the nucleic acid molecule, such as the DNA fragments generated via tagmentation.

[0025] Amplification Domain: A portion of an adapter having a universal nucleotide sequence, such as a P5 or P7 sequence or a complement thereof, which can serve as a starting point for template amplification and cluster generation.

[0026] Capture site: A portion of a flow cell substrate having been modified, chemically, magnetically or electrostatically, that allows for anchoring of a pre-grafted particle (whether it has been exposed to tagmentation and amplification or not). In an example, the capture site may include a chemical capture agent, a magnetic capture agent, or an electrostatic capture agent.

[0027] Chemical Capture Agent: A material, molecule or moiety that is capable of anchoring to a functional agent of a pre-grafted particle via a chemical mechanism. One example chemical capture agent includes a capture nucleic acid (e.g., a capture oligonucleotide) that is complementary to at least a portion of a target nucleic acidattached to a pre-grafted particle. Still example chemical capture agent includes a member of a binding pair that is capable of binding to a second member of a binding pair that is attached to the functionalized nanostructure. Example binding pairs include a NiNTA (nickel-nitrilotriacetic acid) ligand and a histidine tag, or streptavidin or avidin and biotin, etc. Yet another example of the chemical capture agent is a chemical reagent that is capable of forming a hydrogen bond, or a covalent bond with the functionalized nanostructure. Covalent bonds may be formed, for example, through thiol-disulfide exchange, click chemistry, Diels-Alder, Michael additions, amine-aldehyde coupling, amine-acid chloride reactions, amine-carboxylic acid reactions, nucleophilic substitution reactions, etc.

[0028] Depositing: Any suitable application technique, which may be manual or automated, and, in some instances, results in modification of the surface properties. Generally, depositing may be performed using vapor deposition techniques, coating techniques, grafting techniques, or the like. Some specific examples include chemical vapor deposition (CVD), spray coating (e.g., ultrasonic spray coating), spin coating, dunk or dip coating, doctor blade coating, puddle dispensing, flow through coating, aerosol printing, screen printing, microcontact printing, inkjet printing, or the like.

[0029] Depression: A discrete concave feature in a substrate or a layer of a substrate (e.g., a patterned resin) having a surface opening that is at least partially surrounded by interstitial region(s) of the substrate or the layer. Depressions can have any of a variety of shapes at their opening in a surface including, as examples, round, elliptical, square, polygonal, star shaped (with any number of vertices), etc. The cross- section of a depression taken orthogonally with the surface can be curved, square, polygonal, hyperbolic, conical, angular, etc. The depression may also have more complex architectures, such as ridges, step features, etc.

[0030] DNA Sample: Multiple stands of a polymeric form of nucleotides of any length that includes deoxyribonucleotides, deoxyribonucleotide analogs, or complementary deoxyribonucleotides derived from an RNA (ribonucleic acid) sample. The DNA sample is double stranded. The DNA sample may include naturally occurring DNA, which includes a nitrogen containing heterocyclic base (a nucleobase such as adenine, thymine, cytosine and / or guanine), a sugar (specifically deoxyribose,i.e., a sugar lacking a hydroxyl group that present at the 2’ position in ribose), and a backbone containing phosphodiester bonds. An analog structure can have an alternate backbone linkage including any of a variety known in the art.

[0031] The DNA sample may be genomic DNA (gDNA) that can be isolated from one or more cells, bodily fluids (e.g., whole blood, blood spots, saliva) or tissues. gDNA can be prepared by lysing a cell that contains the DNA. The cell may be lysed under conditions that substantially preserve the integrity of the cell's gDNA. In one particular example, thermal lysis may be used to lyse a cell. In another particular example, exposure of a cell to alkaline pH can be used to lyse a cell while causing relatively little damage to gDNA. Any of a variety of basic compounds can be used for lysis including, for example, potassium hydroxide, sodium hydroxide, and the like. Additionally, relatively undamaged gDNA can be obtained from a cell lysed by an enzyme that degrades the cell wall. Cells lacking a cell wall either naturally, or due to enzymatic removal, can also be lysed by exposure to osmotic stress. Other conditions that can be used to lyse a cell include exposure to detergents, mechanical disruption, sonication heat, pressure differential such as in a French press device, or Dounce homogenization. Agents that stabilize gDNA can be included in a cell lysate or isolated gDNA sample including, for example, nuclease inhibitors, chelating agents, salts, buffers and the like. A crude cell lysate containing gDNA may be used without further isolation of the gDNA. In one example, a whole blood sample may be lysed using an inorganic salt free lysis buffer, and the crude lysate may be exposed to specific processing steps to generate a complexed crude lysate as defined herein. This complexed crude lysate can also be used as the DNA sample without further isolation or purification.

[0032] Each: When used in reference to a collection of items, each identifies an individual item in the collection, but does not necessarily refer to every item in the collection. Exceptions can occur if explicit disclosure or context clearly dictates otherwise.

[0033] Electrostatic Capture Agent: refers to a charged material that is capable of electrostatically anchoring a charged or reversibly charged pre-grafted particle. The primers of the pre-grafted particles are negatively charged. As such, positivelycharged pads, e.g., made of silanes, with azide functional groups, poly- lysine, polyimines (e.g., polyethyleneimine, polypropylene imine, etc.), and other positively charged materials, may be used as the electrostatic capture agent. Another example of an electrostatic capture agent is an electrode that can attract, when a proper voltage is applied, a reversibly chargeable functional group that is incorporated into the pre-grafted particle. As examples, amines or carboxylic acids can be reversibly switched between a neutral and a charged species in response to a pH change, and the charged species can be attracted to the electrode. The amines or carboxylic acids may be functional groups of a polymeric hydrogel that forms or coats a core material of the pre-grafted particle.

[0034] Flow Cell: A vessel having an enclosed or open flow channel where a reaction can be carried out. A flow cell with an enclosed channel also includes an inlet for delivering reagent(s) to the chamber and an outlet for removing reagent(s) from the chamber. In some examples, the flow cell enables the detection of the reaction that occurs therein. For example, the flow cell can include one or more transparent surfaces allowing for the optical detection of arrays, optically labeled molecules, or the like.

[0035] Flow channel: An area i) defined between two bonded or otherwise attached components or ii) defined in an open substrate, which can selectively receive a liquid sample. In some examples, the flow channel may be defined between two patterned or non-patterned sequencing surfaces or a patterned or non-patterned sequencing surface and a lid, and thus may be in fluid communication with one or more components of the sequencing surface(s).

[0036] Fragment: A portion or piece of a strand in a DNA sample. A “partially adapted fragment” is a portion or piece of the strand in the DNA sample that has been tagmented, and thus includes an adapter ligated to the 5’ end of the strand . A “fully adapted fragment” is a portion or piece of the strand in the DNA sample that has adapters incorporated at both the 3’ and 5’ ends of the strand.

[0037] Functional agent: A material, molecule or moiety that is capable of anchoring to a chemical capture site of a flow cell via a chemical mechanism. One example functional agent includes a target nucleic acid that is complementary to acapture nucleic acid (e.g., a capture on the flow cell. Still another example functional agent includes a member of a binding pair that is capable of binding to a second member of a binding pair that is attached to the flow cell.

[0038] Interstitial Region: An area, e.g., of a patterned substrate that separates depressions. For example, an interstitial region can separate one depression of an array from another depression of the array. The two depressions that are separated from each other can be discrete, i.e., lacking physical contact with each other. In many examples, the interstitial region is continuous, whereas the depressions are discrete, for example, as is the case for a plurality of depressions defined in an otherwise continuous surface. The separation provided by an interstitial region can be partial or full separation. Interstitial regions may have a surface material that differs from the surface material of the depressions or posts, or capture sites defined therein or thereon.

[0039] Magnetic Capture Agent: A magnetic material that is capable of magnetically anchoring a pre-grafted particle. Example magnetic capture agents include ferromagnetic materials and ferrimagnetic materials.

[0040] Mechanism: A functional agent, a magnetic material or a reversibly chargeable functional group that is incorporated into the pre-grafted particle in order to render the pre-grafted particles capable of anchoring to a capture site in a flow cell.

[0041] Non-Patterned Structure: A structure of a flow cell that includes a lane that supports a continuous polymeric hydrogel that is not arranged in a pattern.

[0042] Patterned Structure: A structure of a flow cell that includes depressions that are arranged in a pattern. Thus, the polymeric hydrogel within the depression is also in a pattern.

[0043] Primer: A single stranded nucleic acid molecule that can hybridize to a target sequence, such as an adapter attached to a fragment. As one example, a particle surface bound primer can serve as a starting point for fragment amplification and cluster generation. As another example, a primer (e.g., a sequencing primer) may be introduced that can hybridize to fragments or fragment amplicons in order to prime synthesis of a new strand that is complementary to the fragments or fragment amplicons. Any primer can include any combination of nucleotides or analogs thereof.In some examples, the primer is a oligonucleotide or polynucleotide. The primer length can be any number of bases long. In an example, each of the flow cell surface bound primer and the sequencing primer is a short strand, ranging from 10 to 60 bases, or from 20 to 40 bases.

[0044] Surface chemistry: Chemical components, such as a polymeric hydrogel and transposome complexes, that are attached within depressions of a flow cell.

[0045] Tagmentation: A process in which the DNA sample is cleaved / fragmented and tagged (e.g., with adapter(s)) for analysis. Tagmentation is an in vitro transposition reaction.

[0046] Transferred and Non-Transferred Strands: The term “transferred strand” refers to a sequence that includes a transferred portion of a transposon end. Similarly, the term “non-transferred strand” refers to a sequence that includes the non- transferred portion of a transposon end. The 3’-end of a transferred strand is joined or transferred to a double stranded fragment during tagmentation. The non-transferred strand is not joined or transferred to the double stranded fragment during tagmentation. In an example, the transferred and non-transferred strands include at least partially complementary portions that are covalently bound together.

[0047] Transposase: An enzyme that is capable of forming a functional complex with a transposon end-containing composition (e.g., transposons, transposon ends, transposon end compositions) and catalyzing insertion or transposition of the transposon end-containing composition into the double-stranded DNA sample with which it is incubated, for example, in the in vitro transposition reaction (i.e., tagmentation). A transposase as presented herein can also include integrases from retrotransposons and retroviruses. Although many examples described herein refer to Tn5 transposase and / or hyperactive Tn5 transposase, it will be appreciated that any transposase that is capable of inserting a transposon end with sufficient efficiency to 5’-tag and fragment the DNA sample for its intended purpose can be used.

[0048] Transposome or Transposome Complex: A complex formed between a transposase and a double stranded nucleic acid including a transposase integration recognition site. For example, the transposome complex can be a transposase enzyme pre-incubated with double-stranded transposon DNA under conditions thatsupport non-covalent complex stranded transposon DNA can include, for example, Tn5 DNA, a portion of Tn5 DNA, a transposon end composition, a mixture of transposon end compositions or other double-stranded DNAs capable of interacting with a transposase, such as the hyperactive Tn5 transposase.

[0049] Transposon End: A double-stranded nucleic acid strand that exhibits only the nucleotide sequences (the “transposon end sequences”) that are necessary to form the complex with the transposase that is functional in tagmentation. The double- stranded nucleic acid strand of the transposon end can include any nucleic acid or nucleic acid analogue suitable for forming the functional complex with the transposase. For example, the transposon end can include natural DNA or DNA analogs (with modified bases and / or backbones), and can include nicks in one or both strands.

[0050] It is to be understood that the prime (’) designations for any of the reference numeral, e.g., amplification domain 64’, sequencing primer sequence 66’, etc. do not refer to complementary sequences to the corresponding element, e.g., amplification domain 64, etc., but rather, are additional examples of the element. When used to describe a specific primer, e.g., P5’ or P7’, the prime (’) does refer to the complementary sequence.

[0051] Pre-grafted Particles

[0052] Each of the example methods set forth herein involves a pre-grafted particle. An example of the pre-grafted particle 10 is shown in Fig.1. The pre-grafted particle 10 includes a core 12 and a primer set (including primers 14 and 16) attached to the core 12.

[0053] In some examples, the entire core 12 is formed of a polymeric hydrogel. As examples, the polymeric hydrogel material may be poly(N-(5- azidoacetamidylpentyl)acrylamide-co-acrylamide (PAZAM) or another of the acrylamide copolymers disclosed herein, PEG-acrylate, PEG-diacrylate, PEG-amine, PEG-carboxylate, PEG-dithiol, PEG-epoxide, PEG-isocyanate, PEG-maleimide, crosslinked poly(methyl methacrylate) (PMMA), polyvinylpyrrolidone (PVPON), polyvinyl alcohol (PVA), polyethylene oxide-polypropylene oxide block copolymers (PEO-PPO), poly(hydroxyethyl methacrylate) (PHEMA), poly(N-isopropylacrylamide)(PNIPAAm), poly(lactic acid)-poly glycol) block copolymers, poly(ethylene glycol)-poly(lactic-co-glycolic acid) block copolymers, poly(acrylic-co-vinylsulfonic acid), poly(acrylamide-co-vinylsulfonic acid), poly(L-aspartic acid), poly(aspartamide), adipic dihydrazide modified or aldehyde modified poly(L-glutamic acid), bisacrylamide, or hydrogels based on one or more of polylysine, starch, agar, agarose, heparin, alginate, alginate sulfate, dextran sulfate, hyaluronan, pectin, carrageenan, gelatin, chitosan, cellulose, and collagen, or combinations or mixtures thereof.

[0054] In some of the examples disclosed herein, the polymeric hydrogel is a copolymer including at least one acrylamide monomer unit, and is a linear polymeric hydrogel or branched polymeric hydrogel (e.g., a dendrimer).

[0055] The linear or branched polymeric hydrogel may include a first recurring unitof -H, a halogen, an alkyl, an alkoxy, an alkenyl, an alkynyl, a cycloalkyl, an aryl, a heteroaryl, a heterocycle, and optionally substituted variants thereof; R2is selected from the group consisting of an azido, an optionally substituted amino, an optionally substituted alkenyl, an optionally substituted alkyne, a halogen, an optionally substituted hydrazone, an optionally substituted hydrazine, a carboxyl, a hydroxy, an optionally substituted tetrazole, an optionally substituted tetrazine, nitrile oxide, nitrone, sulfate, and thiol; each (CH2)pcan be optionally substituted; and p is an integer from 1 to 50;a second recurring unit of formula (II): , wherein: each of R3, R3’, R4, R4’is independently selected from of -H, R5, -OR5, -C(O)OR5,-C(O)R5, -OC(O)R5, -C(O)NR6R7, and -NR6R7; R5is selected from the group consisting of -H, -OH, an alkyl, a cycloalkyl, a hydroxyalkyl, an aryl, a heteroaryl, a heterocycle, and optionally substituted variants thereof; and each of R6and R7is independently selected from the group consisting of –H and an alkyl.

[0056] In an example of the polymeric hydrogel, R1is –H; R2is an azido; each of R3’, R4, and R4’is –H; R3is -C(O)NR6R7, where each of R6and R7is –H; and p is 5. This polymeric hydrogel is poly(N-(5-azidoacetamidylpentyl)acrylamide-co-acrylamide, or PAZAM. In a variation of PAZAM, R1is –H; R2is an azido; each of R3’, R4, and R4’is –H; R3is -C(O)NR6R7, where each of R6and R7is a C1-C6 alkyl (e.g., –CH3); and p is 5.

[0057] In some examples, R2of some of the recurring units of formula (I) is replaced with tetramethylethylenediamine (TEMED). TEMED is a reaction promoter that may be introduced during copolymerization. As a result of a side reaction, TEMED replaces some of the azide (N3) or other R2groups. While this reaction reduces the azide (or other R2examples) content of the copolymer chains, it also introduces a branching site. The branching sites may provide a location where the copolymer chains can branch to one other.

[0058] In other examples, a third recurring unit of formula (II) may be included, with the caveat that the second and third recurring units are different. For example, in the second recurring unit each of R3’, R4, and R4’is –H; R3is -C(O)NR6R7, where each of R6and R7is –H, and in the third recurring unit, each of R3’, R4, and R4’is –H; R3is - C(O)NR6R7, where each of R6and R7is a C1-C6 alkyl.

[0059] The number of first recurring units (formula (I)) may be an integer ranging from 2 to 50,000, and the number of second recurring units (formula (II)) maybe an integer ranging from 2 to 100,000. the third recurring unit is included, the number of units may be an integer in the range of 1 to 100,000. It is to be understood that the incorporation of the individual units may be statistical, random, or in block, and may depend upon the method used to synthesize the polymeric hydrogel.

[0060] In other examples of the polymeric hydrogel, the first recurring unit of formula (I) may be replaced with a heterocyclic azido group of formula (III): wherein R8is H orincluding a linear chain with 2 to 20 atoms selected from the group consisting of carbon, oxygen, and nitrogen and 10 optional substituents on the carbon and any nitrogen atoms in the chain; E is a linear chain including 1 to 4 atoms selected from the group consisting of carbon, oxygen and nitrogen, and optional substituents on the carbon and any nitrogen atoms in the chain; A is an N substituted amide with an H or a C1-C4 alkyl attached to the N; and Z is a nitrogen containing heterocycle. Examples of Z include 5 to 10 carbon-containing ring members present as a single cyclic structure or a fused structure. Some specific examples of Z include pyrrolidinyl, pyridinyl, or pyrimidinyl.

[0061] In one example of the polymeric hydrogel, formula (III) is the first recurring unit and formula (II) is the second recurring unit. In another example, formula (III) is the first recurring unit, one example of formula (II) is the second recurring unit, and a different example of formula (III) is the third recurring unit.

[0062] It is to be understood that other hydrogel materials may be used for the polymeric hydrogel of the particle core 12, as long as they are functionalized to graft oligonucleotide primers 14, 16 thereto.

[0063] Other examples of other polymeric hydrogels include functionalized polysilanes, such as norbornene silane, azido silane, alkyne functionalized silane, amine functionalized silane, maleimide silane, or any other polysilane having functional groups that can attach the oligonucleotide primers 14, 16. Other examples of suitable polymeric hydrogels include those having a colloidal structure, such as agarose; or a polymer mesh structure, such as gelatin; or a cross- linked polymer structure, such as polyacrylamide polymers and copolymers, silane free acrylamide (SFA), or an azidolyzed version of SFA. Examples of suitable polyacrylamide polymers may be synthesized from acrylamide and an acrylic acid or an acrylic acid containing a vinyl group, or from monomers that form [2+2] photo- cycloaddition reactions. Still other examples of suitable polymeric hydrogel materials include mixed copolymers of acrylamides and acrylates. A variety of polymer architectures containing acrylic monomers (e.g., acrylamides, acrylates etc.) may be utilized in the examples disclosed herein, such as highly branched polymers, including dendrimers. For example, the monomers (e.g., acrylamide, etc.) may be incorporated, either randomly or in block, into the branches (arms) of a dendrimer.

[0064] It is to be understood that functional groups in one or more of the recurring units of the polymeric hydrogel of the core 12 are capable of attaching a plurality of the primers 14, 16. These functional groups (e.g., R2in formula (I), NH2, N3, etc.) may be located in the side chains of the linear or branched polymeric hydrogel material.

[0065] In another example, a binding pair member may be introduced to the core 12, e.g., as part of a monomer used in polymerization, or in a grafting process after core 12 formation, or in a chemical modification reaction. This binding pair member is capable of attaching to another binding pair member that is at the 5’ end of the primers 14, 16. Examples of binding pairs include: those capable of peptide coupling (e.g., spytag and a spycatcher); a NiNTA (nickel- nitrilotriacetic acid) ligand and a histidine tag; or biotin and streptavidin.

[0066] In some examples, the polymeric hydrogel of the core 12 is biotinylated. In these examples, biotin is attached to the surface of the polymeric hydrogel through some of the R2groups (i.e., the azide, tetrazine, or other functional group that canattach to an alkyne). The biotin is to a linker, such as bicyclo[6.1.0]nonyne (BCN), which can covalently attach to some of the R2groups. In other examples, streptavidin and biotin are attached to one another, and the biotin portion is attached to the surface of the polymeric hydrogel through some of the R2groups or the linker.

[0067] In other examples (as shown in Fig.1), the core 12 is a multi-layered particle including a core material 18 coated with any example of the polymeric hydrogel disclosed herein (shown as coating 20). In these examples, the core material 18 is generally rigid and is insoluble in an aqueous liquid. Examples of suitable core materials 18 include magnetic materials (e.g., magnetic FeOx, silica coated FeOx), polymeric materials (e.g., polytetrafluoroethylene (PTFE), some polyacrylics, polypropylene, polyethylene, polybutylene, polyurethanes, polystyrene and other styrene copolymers, nylon (i.e., polyamide), polycaprolactone (PCL), etc.), nitrocellulose, silica (SiO2), silica-based materials (e.g., functionalized SiO2), carbon, or metals. Also in these examples, the polymeric hydrogel forms the coating 20 on the core material 18. The thickness of the polymeric hydrogel coating 20 on the core material 18 ranges from about 10 nm to about 200 nm.

[0068] In an example, the core 12 is a spherical nanoparticle. In another example, the core 12 is a non-spherical nanoparticle, such as a cube, a triangular prism, rod shaped, a platelet, cage-like (e.g., non-spherical, hollow particles having a porous shell), a tube, etc. In still another example, the core 12 is an irregularly shaped nanoparticle.

[0069] The dimensions of the core 12 may vary depending upon its shape. In the examples disclosed herein, the largest dimension (e.g., diameter, length, median, etc.) of the core 12 is on the nanoscale, and thus ranges from about 1 nm to less than 1000 nm. In some examples, the core 12 is a nanoparticle having a diameter of greater than or equal to 1 nm, 2 nm, 3 nm, 4 nm, 5 nm, 6 nm, 7 nm, 8 nm, 9 nm, 10 nm, 20 nm, 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, or greater than or equal to 100 nm.

[0070] The pre-grafted particle 10 also includes the primers 14, 16 attached to the core 12 (either directly or through the coating 20). In one example, the core 12 of the pre-grafted particles 10 is the polymeric hydrogel, and the primers 14, 16 are attacheddirectly to the core 12. In another the core 12 of the pre-grafted particles 10 includes the core material 18 coated with the polymeric hydrogel coating 20, and the primers 14, 16 are attached directly to the polymeric hydrogel coating 20. Together, the primers 14, 16 enable bridge amplification and sequential paired end sequencing. The primers 14, 16 have different sequences from each other, but have the same sequence, respectively, as the first and second amplification domains 64, 64’ of the transposome complexes 46A, 46B (see Fig.4A).

[0071] Examples of suitable sequences for the primers 14, 16 include P5 and P7 primer sequences, P15 and P7 primer sequences, and any combination of the PA primer sequences, PB primer sequences, PC primer sequences, and PD primer sequences set forth herein. Examples of P5 and P7 primer sequences are used on the surface of commercial flow cells sold by Illumina Inc. for sequencing, for example, on HISEQ™, HISEQX™, MISEQ™, MISEQDX™, MINISEQ™, NEXTSEQ™, NEXTSEQDX™, NOVASEQ™, ISEQTM, GENOME ANALYZER™, and other instrument platforms.

[0072] The P5 primer sequence may be any of the following: P5 #1: 5’ → 3’ AATGATACGGCGACCACCGAGAUCTACAC (SEQ. ID. NO.1); or P5 #2: 5’ → 3’ AATGATACGGCGACCACCGAGAnCTACAC (SEQ. ID. NO.2) where “n” is alkene-thymidine (i.e., alkene-dT) in the sequence; or P5 #3: 5’ → 3’ AATGATACGGCGACCACCGAGAnCTACAC (SEQ. ID. NO.3) where “n” is inosine in SEQ. ID. NO.3. The P7 primer sequence may be any of the following:P7 #1: 5’ → 3’ CAAGCAGAAGACGGCATACGAnAT (SEQ. ID. NO.4) P7 #2: 5’ → 3’ CAAGCAGAAGACGGCATACnAGAT (SEQ. ID. NO.5) P7 #3: 5’ → 3’ CAAGCAGAAGACGGCATACnAnAT (SEQ. ID. NO.6) where “n” is 8-oxoguanine in each of the sequences. The P15 primer sequence is: P15: 5’ → 3’ AATGATACGGCGACCACCGAGAnCTACAC (SEQ. ID. NO.7) where “n” is allyl-T (a thymine nucleotide analog having an allyl functionality). The other primer sequences (PA-PD) mentioned above include: PA 5’ → 3’ GCTGGCACGTCCGAACGCTTCGTTAATCCGTTGAG (SEQ. ID. NO.8) PB 5’ → 3’ CGTCGTCTGCCATGGCGCTTCGGTGGATATGAACT (SEQ. ID. NO.9) PC 5’ → 3’ ACGGCCGCTAATATCAACGCGTCGAATCCGCAACT (SEQ. ID. NO.10) PD 5’ → 3’(SEQ. ID. NO.11).

[0073] While not shown in the example sequences for PA-PD, it is to be understood that any of these sequences may include a cleavage site, such as uracil, 8- oxoguanine, allyl-T, diols, etc. at any point in the strand. The sequences for the first amplification domain 64 / primer 14 and for the second amplification domain 64’ / primer 16 may be selected to have orthogonal cleavage sites (i.e., one cleavage site is not susceptible to the cleaving agent used for the other cleavage site), so that after amplification, forward or reverse strands can be cleaved, leaving the other of the reverse or forward strands for sequencing.

[0074] The primers 14, 16 may also include a polyT sequence at the 5’ end of the primer sequence. In some examples, the polyT region includes from 2 T bases to 20 T bases. As specific examples, the polyT region may include 3, 4, 5, 6, 7, or 10 T bases.

[0075] The pre-grafted particles 10 may also include or be functionalized with a mechanism (not shown) that is capable of anchoring to a capture site on a flow cell substrate. The mechanism may be chemical (e.g., a functional agent), electrostatic, or magnetic.

[0076] In some examples, the mechanism is a component of the pre-grafted particle 10 that enables it to be anchored without further functionalization. For example, when the pre-grafted particles 10 include a magnetic material as the core material 21, the pre-grafted particles 10 may be anchored to a magnetic capture agent on a patterned structure 22, 22’ (see Fig.3A through Fig.3C) or on a non-patterned structure 23 (see Fig.3D). For another example, a reversibly chargeable functional group, such as an amine or a carboxylic acid, may be attached (e.g., through a thiol linkage) to the surface of the core 12 along with the primers 14, 16. In this example, the reversibly chargeable functional group (as the mechanism) enables the pre-grafted particles 10 to be anchored to an electrostatic capture agent on the flow cell substrate. For still another example, the mechanism is a functional agent that is added to the pre- grafted particles 10 that enables it to be anchored on the flow cell substrate. As one example, a primer complement may be introduced to DNA sample fragments as aresult of amplification, and the primer is complementary to, and thus capable of hybridizing to, a capture oligonucleotide on the flow cell substrate. As another example, a functional group for covalent attachment (e.g., peptide coupling) or a member of a binding pair may be attached to the pre-grafted particle 10.

[0077] Flow Cells for use with Pre-Grafted Particles

[0078] The pre-grafted particles 10 may be used with a flow cell 30 (Fig.2), which may have an open wafer architecture (Fig.3A) or an enclosed architecture (Fig.3B and Fig.3C). Additionally, some of the flow cells 30 include a patterned structure 22, 22’ (see Fig.3A, Fig.3B, and Fig.3C), while other flow cells 30 include a non- patterned structure 23 (see Fig.3D).

[0079] A top view of an example of the flow cell 30 is shown in Fig.2. Each flow cell 30 includes a patterned structure 22 or a non-patterned structure 23 and at least one flow channel 24, 24’, 24’’. As will be discussed in reference to Fig.3A, some examples of the flow cell 30A include one patterned structure 22 and the flow channel 24 is open to an external environment. As will be discussed in reference to Fig.3B and Fig.3C, other examples of the flow cell 30B and 30C include an enclosed flow channel 24’, 24’’. The flow cell 30B shown in Fig.3B includes one patterned structure 22 and a lid 26 attached to the one patterned structure 22. In these examples, the flow channel 24’ is defined between the patterned structure 22 and the lid 26. The flow cell 30C shown in Fig.3C includes two opposed patterned structures 22, 22’. In these examples, the flow channel 24’’ is defined between the opposed patterned structures 22, 22’. Any of the flow cells 3A-3C could alternatively be formed with non- patterned structure(s) 23 in place of the patterned structure(s) 22, 22’. An example of a flow cell 30D with a non-patterned structure 23 and the open flow channel 24 is shown in Fig.3D.

[0080] Each example of the patterned structure 22 or 22, 22’ and each example of the non-patterned structure 23 includes a substrate, which may be a single layered substrate 28, 28’ or a multi-layered substrate 31, 31’ (which includes a patterned material 34, 34’ over the base support 32, 32’ (shown in phantom)).

[0081] Examples of suitable single substrates 28, 28’ include epoxy siloxane, glass, modified or functionalized glass, polymers (including acrylics, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethanes, polytetrafluoroethylene (such as TEFLON® from Chemours), cyclic olefins / cyclo-olefin polymers (COP) (such as ZEONOR® from Zeon), polyimides, nylon (polyamides), etc.), ceramics / ceramic oxides, silica, fused silica, or silica-based materials, aluminum silicate, silicon and modified silicon (e.g., boron doped p+ silicon), silicon nitride (Si3N4), silicon oxide (SiO2), tantalum pentoxide (Ta2O5) or other tantalum oxide(s) (TaOx), hafnium oxide (HfO2), carbon, metals, inorganic glasses, or the like.

[0082] The multi-layered substrate 31, 31’ include the base support 32, 32’ and the patterned material 34, 34’ over the base support 32, 32’.

[0083] The base support 32, 32’ may be any of the examples set forth herein for the single layered substrate 28, 28’.

[0084] The patterned material 34, 34’ may be any material that is capable of being patterned with depressions 36, 36’.

[0085] In an example, the patterned material 34, 34’ may be an inorganic oxide that is selectively applied to the base support 32, 32’, e.g., via vapor deposition, aerosol printing, or inkjet printing, in the desired pattern. Examples of suitable inorganic oxides include tantalum oxide (e.g., Ta2O5), aluminum oxide (e.g., Al2O3), silicon oxide (e.g., SiO2), hafnium oxide (e.g., HfO2), etc.

[0086] In another example, the patterned material 34, 34’ may be a resin matrix material that is applied to the base support 32, 32’ and then patterned. Suitable deposition techniques include chemical vapor deposition, dip coating, dunk coating, spin coating, spray coating, puddle dispensing, ultrasonic spray coating, doctor blade coating, aerosol printing, screen printing, microcontact printing, etc. Suitable patterning techniques include photolithography, nanoimprint lithography (NIL), stamping techniques, embossing techniques, molding techniques, microetching techniques, printing techniques, etc. Some examples of suitable resins include a polyhedral oligomeric silsesquioxane-based resin, a non-polyhedral oligomeric silsesquioxane epoxy resin, a poly(ethylene glycol) resin, a polyether resin (e.g., ringopened epoxies), an acrylic resin, an resin, a methacrylate resin, an amorphous fluoropolymer resin (e.g., CYTOP® from Bellex), and combinations thereof.

[0087] As used herein, the term “polyhedral oligomeric silsesquioxane” (commercially available under the tradename POSS® from Hybrid Platics) refers to a chemical composition that is a hybrid intermediate (e.g., RSiO1.5) between that of silica (SiO2) and silicone (R2SiO). An example of polyhedral oligomeric silsesquioxane can be that described in Kehagias et al., Microelectronic Engineering 86 (2009), pp.776- 778, which is incorporated by reference in its entirety. In an example, the composition is an organosilicon compound with the chemical formula [RSiO3 / 2]n, where the R groups can be the same or different. Example R groups for polyhedral oligomeric silsesquioxane include epoxy, azide / azido, a thiol, a poly(ethylene glycol), a norbornene, a tetrazine, acrylates, and / or methacrylates, or further, for example, alkyl, aryl, alkoxy, and / or haloalkyl groups. The resin composition disclosed herein may comprise one or more different cage or core structures as monomeric units. The average cage content can be adjusted during the synthesis, and / or controlled by purification methods, and a distribution of cage sizes of the monomeric unit(s) may be used in the examples disclosed herein.

[0088] In an example, the substrates 28, 28’, 31, 31’ (whether single or multi- layered) may be round and have a diameter ranging from about 2 mm to about 300 mm, or may be a rectangular sheet or panel having its largest dimension up to about 10 feet (~ 3 meters). In an example, the substrate 28, 28’, 31, 31’ is a wafer having a diameter ranging from about 200 mm to about 300 mm. Wafers may subsequently be diced to form an individual flow cell substrate. In another example, the substrate 28, 28’, 31, 31’ is a die having a width ranging from about 0.1 mm to about 10 mm. While example dimensions have been provided, it is to be understood that a substrate 28, 28’, 31, 31’ with any suitable dimensions may be used. For another example, a panel may be used that is a rectangular support, which has a greater surface area than a 300 mm round wafer. Panels may subsequently be diced to form individual flow cells 30.

[0089] The flow cell 30 (30A, 30B, 30D) also includes the flow channel 24, 24’, 24’’. While several flow channels 24, 24’, 24’’ are shown in Fig.2, it is to be understood that any number of flow channels 24, 24’, 24’’ may be included in the flow cell 30 (e.g., a single channel 24, four channels 24, etc.). Each flow channel 24, 24’, 24’’ may be isolated from each other flow channel 24, 24’, 24’’ in each example flow cell 30A, 30B, 30C, 30D so that fluid introduced into any particular flow channel 24, 24’, 24’’ does not flow into any adjacent flow channel 24, 24’, 24’’.

[0090] At least a portion of the flow channel 24, 24’, 24’’ may be defined in the substrate 28, 28’, 31, 31’ using any suitable technique that depends, in part, upon the material(s) of the substrate 28, 28’, 31, 31’.

[0091] In the open wafer flow cell 30A, the single layer substrate 28 or the layer 34 of the multi-layer substrate 31 includes a lane 40 defined therein, and the flow channel 24 is defined within the lane 40. In one example, a lane 40 is etched into a single layer glass substrate. In another example, a lane 40 is patterned (e.g., using photolithography, nanoimprint lithography, etc.) into a resin to form the patterned material 34 of the multi-layer substrate 31. The sidewalls and bottom surface of the lane 40 define the flow channel 24.

[0092] In the enclosed flow cell 30B, the substrate 28 or 31 is attached to the lid 26, and the space between these components 28 or 31 and 26 defines the flow channel 24’. The lid 26 may be any material that is transparent to the excitation light that is directed toward the flow cell 30B (e.g., during a sequencing operation, etc.). In optical detection systems, the lid 26 may also be transparent to the emissions generated from reaction(s) taking place in the flow cell 30B. As examples, the lid 26 may include glass (e.g., borosilicate, fused silica, etc.) or a transparent polymer. A commercially available example of a suitable borosilicate glass is D 263®, available from Schott North America, Inc. Commercially available examples of suitable polymer materials, namely cyclo olefin polymers, are the ZEONOR® products available from Zeon Chemicals L.P. In some instances, the lid 26 is shaped to form the top of the flow cell 30B, and in other instances, the lid is shaped to form both the top of the flow cell 30B as well as sidewalls the flow channel 24’.

[0093] In the enclosed flow cell 30C, substrate 28 or 31 is attached to the substrate 28’ or 31’, and the space between these components 28 or 31 and 28’ or 31’ defines the flow channel 24’’. The second patterned structure 22’ may include the same components as the patterned structure 22.

[0094] As mentioned, any of the flow cells 30A-30C may be formed with the non- patterned structure 23 rather than the patterned structure 22, 22’. An example of the open wafer flow cell 30D formed with a non-patterned structure 23 is shown in Fig.3D. In this example, the single layer substrate 28 or the layer 34 of the multi-layer substrate 31 includes the lane 40 defined therein, and the flow channel 24 is defined within the lane 40. Unlike the patterned structure 22 that includes the lane 40 (see Fig.3A), the non-patterned structure 23 does not include additional depressions 36 defined in the lane 40.

[0095] In any example of the enclosed flow cell (see as flow cells 30B, 30C), a separate material (e.g., material 38 in Fig.3B and Fig.3C) may be applied to a bonding region of the substrate 28, 30 so that the separate material 38 defines at least a portion of the walls of the flow channel 24’, 24’’. The separate material 38 may be any material that will seal portions of the patterned structure 22 to the lid 26 or second patterned structure 22’. As examples, the separate material 38 may be an adhesive, a radiation-absorbing material that aids in bonding, or the like. In some examples, the separate material 38 is a radiation-absorbing material, e.g., KAPTON® black. The separate material 62 may be positioned at the perimeter of the flow cell 30, and between adjacent channels 24, 24’, 24’’ if multiple channels 24, 24’, 24’’ are included.

[0096] In an example, the flow channel 24, 24’, 24’’ has a substantially rectangular configuration with rounded ends. The length and width of the flow channel 24, 24’, 24’’ may be smaller, respectively, than the length and width of the substrate 28, 28’, 31, 31’ so that a portion of the substrate surface surrounds the flow channel 24, 24’, 24’’. In the flow cells 30A, this portion outlines the perimeter of the lane 40. In the flow cells 30B, 30C, this portion is a bonding region that is available for attachment to another patterned structure 22’ or to the lid 26. In some instances, the width of each flow channel 24, 24’, 24’’ can be at least about 1 mm, at least about 2.5 mm, at least about 5 mm, at least about 7 mm, at least about 10 mm, or more. In some instances, thelength of each flow channel 24, 24’, 24’’ be at least about 10 mm, at least about 25 mm, at least about 50 mm, at least about 100 mm, or more. The width and / or length of each flow channel 24, 24’, 24’’ can be greater than, less than or between the values specified above. In another example, the flow channel 24, 24’, 24’’ is square (e.g., 10 mm x 10 mm).

[0097] In the example of Fig.3A, the depth of the flow channel 24 is approximately equivalent to the depth of the lane 40, although it is deeper in regions where the depressions 36 are formed. In the example of Fig.3D, the depth of the flow channel 24 is approximately equivalent to the depth of the lane 40. In the examples of Fig.3B and Fig.3C, the depth of the flow channel 24’, 24’’ is approximately equivalent to the thickness of the separate material 38, although it is deeper in regions where the depressions 36 or 36, 36’ are formed. In some instances, the depth of each flow channel 24’, 24’’ can be as small as a few monolayers thick, for example, when microcontact, aerosol, or inkjet printing is used to deposit the separate material 38 that defines the flow channel walls. In other examples, the depth of each flow channel 24, 24’, 24’’ can be about 1 μm, about 10 μm, about 50 μm, about 100 μm, or more. In an example, the depth may range from about 10 μm to about 100 μm. In another example, the depth is about 5 μm or less. It is to be understood that the depth of each flow channel 24, 24’, 24’’ can also be greater than, less than or between the values specified above. As noted, the depth of the flow channel 24, 24’, 24’’ may also vary along the length and width of the flow cell 30, e.g., when depressions 36, 36’ are used.

[0098] Each of the patterned structures 22 or 22, 22’ has depressions 36 or 36, 36’ defined therein. Each depression 36, 36’ is a three-dimensional structure that extends inward (downward) from an adjacent surface. The depression 36, 36’ is thus a concave region with respect to interstitial regions 42, 42’ that surround the depressions 36, 36’. Depressions 36, 36’ may be formed in the single layer substrate 28, 28’ or in the patterned material 34, 34’ of the multi-layered substrate 31, 31’.

[0099] The depressions 36, 36’ may be arranged in a particular layout or pattern. Many different patterns for the depressions 36, 36’ may be envisaged, including regular, repeating, and non-regular patterns. In an example, the depressions 36, 36’ are disposed in a hexagonal grid for close packing and improved density. Otherlayouts may include, for example, (rectangular) layouts, triangular layouts, and so forth. In some examples, the layout or pattern can be an x-y format of depressions 36, 36’ that are in rows and columns. Other example patterns may include stripes, swirls, lines, triangles, rectangles, circles, arcs, checks, diagonals, arrows, and / or squares.

[0100] The layout or pattern of the depressions 36, 36’ may be characterized with respect to the density of the depressions 36, 36’ (e.g., number of depressions 36, 36’) in a defined area. For example, the depressions 36, 36’ may be present at a density of approximately 2 million per mm2. The density may be tuned to different densities including, for example, a density of about 100 per mm2, about 1,000 per mm2, about 0.1 million per mm2, about 1 million per mm2, about 2 million per mm2, about 5 million per mm2, about 10 million per mm2, about 50 million per mm2, or more, or less. It is to be further understood that the density of depressions 36, 36’ can be between one of the lower values and one of the upper values selected from the ranges above. As examples, a high density array may be characterized as having depressions 36, 36’ separated by less than about 100 nm, a medium density array may be characterized as having depressions 36, 36’ separated by about 400 nm to about 1 µm, and a low density array may be characterized as having depressions 36, 36’ separated by greater than about 1 µm. While example densities have been provided, it is to be understood that any suitable densities may be used. In some instances, it may be desirable for the spacing between depressions 36, 36’ to be even greater than the examples listed herein.

[0101] The layout or pattern of the depressions 36, 36’ may also or alternatively be characterized in terms of the average pitch, or the spacing from the center of one depressions 36, 36’ to the center of an adjacent depressions 36, 36’ (center-to-center spacing) or from the left edge of one depressions 36, 36’ to the right edge of an adjacent depressions 36, 36’ (edge-to-edge spacing). The pattern can be regular, such that the coefficient of variation around the average pitch is small, or the pattern can be non-regular in which case the coefficient of variation can be relatively large. In either case, the average pitch can be, for example, about 50 nm, about 0.1 μm, about 0.5 μm, about 1 μm, about 5 μm, about 10 μm, about 100 μm, or more or less. Theaverage pitch for a particular pattern of 36, 36’ can be between one of the lower values and one of the upper values selected from the ranges above. In an example, the depressions 36, 36’ have a pitch (center-to-center spacing) of about 1.5 μm. While example average pitch values have been provided, it is to be understood that other average pitch values may be used.

[0102] The depressions 36, 36’ may have any suitable shape, geometry and dimensions, which may depend, at least in part, on the pre-grafted particle 10 that is to be captured within the depression 36, 36’. While any suitable three-dimensional geometry may be used for the depressions 36, 36’, a geometry with an at least substantially flat bottom surface may be desirable so that a polymeric hydrogel layer 44, 44’ may be formed thereon. Example depression geometries include a sphere, a cylinder, a cube, polygonal prisms (e.g., rectangular prisms, hexagonal prisms, etc.), or the like.

[0103] The size of each depression 36, 36’ may be characterized by its volume, opening area, depth, and / or diameter.

[0104] Each depression 36, 36’ can have any volume that is capable of receiving the polymeric hydrogel layer 44, 44’ and transposome complexes (generally designated by reference numerals 46, 46’ and specific examples of which are designated by reference numerals 46A, 46B in Fig 4A and by reference numerals 46C in Fig.4B). For example, the volume can be at least about 1×10−3μm3, at least about 1×10−2μm3, at least about 0.1 μm3, at least about 1 μm3, at least about 10 μm3, at least about 100 μm3, or more. Alternatively or additionally, the volume can be at most about 1×104μm3, at most about 1×103μm3, at most about 100 μm3, at most about 10 μm3, at most about 1 μm3, at most about 0.1 μm3, or less.

[0105] The area occupied by each depression opening can be selected based on the size of the transposome complexes 46, 46’ and the size of the pre-grafted particle 10 that is to be anchored by a capture site 48, 48’ present in the depression 36, 36’. It may be desirable for the pre-grafted particle 10 to enter the depression 36, 36’, and thus the area occupied by the depression opening may be bigger than the size of the pre-grafted particle 10. For example, the area for each depression opening can be at least about 1×10−3μm2, at least about 1×10−2μm2, at least about 0.1 μm2, at leastabout 1 μm2, at least about 10 μm2, at about 100 μm2, or more. Alternatively or additionally, the area can be at most about 1×103μm2, at most about 100 μm2, at most about 10 μm2, at most about 1 μm2, at most about 0.1 μm2, at most about 1×10−2μm2, or less. The area occupied by each depression opening can be greater than, less than or between the values specified above.

[0106] The depth of each depression 36, 36’ is large enough to house at least the polymeric hydrogel layer 44, 44’ and the transposome complexes 46, 46’. In one example, the depression 36, 36’ may be filled with the polymeric hydrogel layer 44, 44’ and the transposome complexes 46, 46’. In this example, the pre-grafted particle 10 becomes anchored to the capture site 48, 48’ but does not enter the depression 36, 36’. In another example, the depression 36, 36’ may be partially filled with the polymeric hydrogel layer 44, 44’ and the transposome complexes 46, 46’. In this example, the pre-grafted particle 10 at least partially enters the depression 36, 36’ and becomes anchored to the capture site 48, 48’ in the depression 36, 36’. In an example, the depth may be at least about 0.1 μm, at least about 0.5 μm, at least about 1 μm, at least about 10 μm, at least about 100 μm, or more. Alternatively or additionally, the depth can be at most about 1×103μm, at most about 100 μm, at most about 10 μm, or less. In some examples, the depth is about 0.4 μm. The depth of each depression 36, 36’ can be greater than, less than or between the values specified above.

[0107] In some instances, the diameter or each of the length and width of each depression 36, 36’ can be at least about 50 nm, at least about 0.1 μm, at least about 0.5 μm, at least about 1 μm, at least about 10 μm, at least about 100 μm, or more. Alternatively or additionally, the diameter or each of the length and width can be at most about 1×103μm, at most about 100 μm, at most about 10 μm, at most about 1 μm, at most about 0.5 μm, at most about 0.1 μm, or less (e.g., about 50 nm). In some examples, the diameter or each of the length and width is about 0.4 μm. The diameter or each of the length and width of each depression 36, 36’ can be greater than, less than or between the values specified above.

[0108] The depressions 36, 36’ provide a designated area for the polymeric hydrogel layer 44, 44’ and the transposome complexes 46, 46’.

[0109] Any example of the polymeric set forth herein for the core 12 may be used for the layer 44, 44’ as long as the layer 44, 44’ includes surface functional groups for attaching the transposome complexes 46, 46’. In some examples, these surface functional groups (e.g., R2in formula (I), NH2, N3, etc.) are located in the side chains of the linear or branched polymeric hydrogel material. In other examples, a binding pair member may be introduced to the polymeric hydrogel layer 44, 44’, e.g., as part of a monomer used in polymerization, or in a grafting process after layer 44, 44’ formation, or in a chemical modification reaction. This binding pair member is capable of attaching to another binding pair member that is at the 5’ end of the transposomes 46, 46’. Examples of binding pairs include: those capable of peptide coupling (e.g., spytag and a spycatcher); a NiNTA (nickel- nitrilotriacetic acid) ligand and a histidine tag; or biotin and streptavidin. In still other examples, the polymeric hydrogel layer 44, 44’ is biotinylated. In these examples, biotin is attached to the surface of the polymeric hydrogel through some of the R2groups (i.e., the azide, tetrazine, or other functional group that can attach to an alkyne). The biotin is attached to a linker, such as bicyclo[6.1.0]nonyne (BCN), which can covalently attach to some of the R2groups. In other examples, streptavidin and biotin are attached to one another, and the biotin portion is attached to the surface of the polymeric hydrogel through some of the R2groups or the linker.

[0110] The polymeric hydrogel layer 44, 44’ may be formed by selectively depositing the polymeric hydrogel material into the depression 36, 36’, or by blanketly depositing the polymeric hydrogel material onto the patterned structure 22, 22’ and removing the material from the interstitial regions 42, 42’ using a polishing technique.

[0111] Fig.3A through Fig.3C depict examples of the patterned structure 22, 22’ because they support depressions 36, 36’ that are arranged in a pattern. Fig.3D depicts an example of the non-patterned structure 23. As shown in Fig.3D, the substrate 28 or 31 includes the lane 40, which has a substantially flat surface 41; and a continuous polymeric hydrogel 44 that is positioned on the substantially flat surface 41.

[0112] The lane 40 is defined in the substrate 28, or it may be defined in the outermost layer 34 of the multi-layered substrate 31. The depth of lane 40 is largeenough to house at least the polymeric 44. In one example, the lane 40 may be filled with the polymeric hydrogel 44. In this example, the pre-grafted particles 10 become anchored to the polymeric hydrogel 44 but do not enter the lane 40. In another example, the lane 40 may be partially filled with the polymeric hydrogel 44 (e.g., may align the bottom or the bottom and sidewalls). In this example, the pre- grafted particles 10 at least partially enter the lane 40 and becomes anchored to the capture site 48, 48’ in the lane 40.

[0113] The polymeric hydrogel layer 44, 44’ may be formed by selectively depositing the polymeric hydrogel material into the lane 40, or by blanketly depositing the polymeric hydrogel material onto the non-patterned structure 23 and removing the material from the bonding regions using a polishing technique.

[0114] In an example, the depth may be at least about 0.1 μm, at least about 0.5 μm, at least about 1 μm, at least about 10 μm, at least about 100 μm, or more. Alternatively or additionally, the depth can be at most about 1×103μm, at most about 100 μm, at most about 10 μm, or less. In some examples, the depth is about 0.4 μm. The depth of the lane 40 can be greater than, less than or between the values specified above.

[0115] Each of the flow cells 30A, 30B, 30C, 30D includes transposome complexes 46, 46’ attached to the polymeric hydrogel layer 44, 44’ within each of the depressions 36, 36’ or within the lane 40. Separate transposome complexes 46 or 46’ are capable of forming dimers in solution, and as shown in Fig.3A through Fig.3D, the dimers attach to the polymeric hydrogel layer 44, 44’. In one example, the transposome complexes 46, 46’ are mixed in solution to form the dimers. Depending upon the complexes (e.g., 46A and 46B shown in Fig.4A) in the solution, homodimers and / or heterodimers may be formed. These pre-formed dimers are then grafted to the polymeric hydrogel 44. Some transposome complexes 46, 46’ may not dimerize, but may become attached to the polymeric hydrogel 44. The monomeric transposome complex(es) 46, 46’ that are attached within the flow cells 30 will not participate in tagmentation.

[0116] Specific examples of the transposome complexes 46, 46’ are shown in Fig. 4A and Fig.4B.

[0117] Fig.4A depicts the complexes 46A and 46B in the form of a dimer. Fig.4B depicts the transposome complex 46C. Each transposome complex 46A, 46B, 44C includes a transposase enzyme 50, 50’ non-covalently bound to a transposon end 52, 52’. Each transposon end 52, 52’ is a double-stranded nucleic acid strand, one strand 54, 54’ of which is part of a transferred strand 56, 56’ and the other strand 58, 58’ of which is part of a non-transferred strand 60, 60’, 60’’. In other words, the transposon end 52, 52’ includes a portion (strand 54, 54’) of the transferred strand 56, 56’ that is hybridized to at least a portion (e.g., strand 58, 58’) of the non- transferred strand 60, 60’, 60’’.

[0118] The transferred strand 56 includes a 5’ end functional group 62 that is capable of covalently or non-covalently attaching to surface functional groups of the polymeric hydrogel layer 44, 44’, a first amplification domain 64, and a sequencing primer sequence 66 that is attached to the strand 54 of the transposon end 52. The strand 54 of the transposon end 52 is positioned at the 3’ end of the transferred strand 56. Similar to the transferred strand 56, the transferred strand 56’ includes a 5’ end functional group 62’ that is capable of covalently or non-covalently attaching to surface functional groups of the polymeric hydrogel layer 44, 44’, a second amplification domain 64’, and a sequencing primer sequence 66’ that is attached to the strand 58’ of the transposon end 52’. The strand 54’ of the transposon end 52’ is positioned at the 3’ end of the transferred strand 56’.

[0119] The 5’ end functional groups 62, 62’ may be any functional group that is capable of covalently or non-covalently attaching to surface functional groups of the polymeric hydrogel layer 44, 44’ and thus will depend upon these surface functional groups. In one example, the polymeric hydrogel layer 44, 44’ includes azide or tetrazine surface groups, and the 5’ end functional groups 62, 62’ include a terminal alkyne (e.g., hexynyl) or an internal alkyne, where the alkyne is part of a cyclic compound (e.g., bicyclo[6.1.0]nonyne (BCN) or dibenzocyclooctyne (DBCO)). In another example, the polymeric hydrogel layer 44, 44’ is functionalized with biotin surface groups, and the 5’ end functional groups 62, 62’ also include biotin. In these examples, additional streptavidin or avidin is added to indirectly attach the biotin groups to one another. In still another example, the polymeric hydrogel 44, 44’ isfunctionalized with one member of a pair, and the second member of the binding pair is the 5’ end functional group 62, 62’.

[0120] The first and second amplification domains 64, 64’ have different sequences from each other, but have the same sequence, respectively, as first and second primers 14, 16 attached to the core 12. The first amplification domain 64, its complement, and the primer 14 together with the second amplification domain 64’, its complement, and the primer 16 enable the amplification of the DNA sample fragments that are generated during tagmentation.

[0121] The sequencing primer sequences 66, 66’ have different sequences from each other that respectively bind to sequencing primers that are introduced, e.g., to a flow cell surface that binds the pre-grafted particles 10. As examples, the sequencing primer sequence 66 may bind a sequencing primer that primes synthesis of a new strand that is complementary to forward strand fragments / fragment amplicons and the sequencing primer sequence 66’ may bind a sequencing primer that primes synthesis of a new strand that is complementary to reverse strand fragments / fragment amplicons.

[0122] The transposon ends 52, 52’ of each transposome complex 46A, 46B, 44C, include the strands 54, 54’ respectively hybridized to the strands 58, 58’. As such, the strands 54 and 58 are complementary and the strands 54’ and 58’ are complementary. The double stranded transposon ends 52, 52’ are respectively capable of complexing with the transposases 50, 50’. As examples, the strands 54, 58 and 54’, 58’ of the transposon ends 52, 52’ may be the related, but non-identical, 19-base pair (bp) outer end (e.g., strands 54, 54’) and inner end (e.g., strands 58, 58’) sequences that serve as the substrate for the activity of the Tn5 transposase, or the mosaic ends recognized by a wild-type or mutant Tn5 transposase, or the R1 end (e.g., strands 54, 54’) and the R2 end (strands 58, 58’) recognized by the MuA transposase.

[0123] As shown in Fig.4A, the non-transferred strands 60, 60’ of the transposome complexes 46A, 46B are completely made up of the strands 58, 58’.

[0124] As shown in Fig.4B, the non-transferred strands 60’’ of the transposome complexes 46C are made up of the strands 58 and adapter segments 68 that create a forked adapter when hybridized to the transferred strands 56. When the non-transferred strand 60’’ includes the segments 68 and creates a forked adapter, it is to be understood that one type of transposome complex 46C is grafted to the polymeric hydrogel layer 44. This is because the individual complex 46C includes the adapters to create fully adapted DNA fragments, and thus complexes 46C with the respective amplification domains 64, 64’ are not needed. As one example, the transposome complex 46C includes the transferred strand 56 as described herein with the first amplification domain 64, and the non-transferred strand 60’’ includes the strand 58, a complement of the sequencing primer sequence 66’ (shown as 66’C in Fig.4B), and a complement of the second amplification domain 64’ (shown as 64’C in Fig.4B).

[0125] As mentioned, the separate transposome complexes 46A and 46B are capable of forming dimers in solution, either as homodimers or heterodimers. In one example, the transposome complexes 46A and 46B are mixed in solution to form the dimers. These preformed dimers are then grafted to the polymeric hydrogel layer 44, 44’ within the depressions 36, 36’ or the lane 40. In another example, the individual transposome complexes 46A and 46B and the polymeric hydrogel 44, 44’ are mixed together in solution where the dimers will form and graft to the polymeric hydrogel 44, 44’. This pre-grafted polymeric hydrogel can be applied to the patterned structure 22, 22’ or the non-patterned structure 23 as described herein. It is to be understood that some transposome complexes 46A and 46B may not dimerize and these individual transposome complexes 46A and 46B can attach to the polymeric hydrogel layer 44, 44’. The monomeric transposome complex(es) 46A and 46B attached to the polymeric hydrogel layer 44, 44’ will not participate in tagmentation. The transposome complexes 46C can be grafted after the polymeric hydrogel layer 44, 44’ is attached within the depressions 36, 36’ or may be pre-grafted to the polymeric hydrogel before the layer 44, 44’ is formed. These transposome complexes 46C may also form dimers.

[0126] Each of the flow cells 30A, 30B, 30C, 30D also includes the capture site 48, 48’ for attaching the pre-grafted particles 10 during the methods described herein. While shown as an individual entity within the depression 36, 36’ or within the lane 40,it is to be understood that the capture 48’ may be attached to, deposited on, or integrated into the polymeric hydrogel layer 44, 44’.

[0127] The capture sites 48, 48’ may be chemical capture sites, electrostatic captures sites, or magnetic capture sites.

[0128] Chemical capture sites include any example of the chemical capture agent set forth herein that can be deposited on or otherwise attached to predefined locations of the polymeric hydrogel layer 44, 44’. In one example, the chemical capture agent may be deposited, e.g., using microcontact printing, aerosol printing, etc., in a desirable location on the polymeric hydrogel layer 44, 44’ to form the capture sites 48, 48’. In another example, a mask (e.g., a photoresist) may be used to define the space / location where the chemical capture agent will be deposited. The chemical capture agent may then be deposited, and the mask removed (e.g., via lift-off, dissolution, or another suitable technique). In this example, the chemical capture agent may form a monolayer or thin layer of the chemical capture agent. In still another example, a capture nucleic acid may be selectively attached to the polymeric hydrogel layer 44, 44’ (e.g., at R2groups) to form the chemical captures sites.

[0129] Electrostatic captures sites include any example of the electrostatic capture agents set forth herein that can be deposited in the depressions 36, 36’ or the lane 40 before the polymeric hydrogel layer 44, 44’. For example, electrode materials may be deposited using chemical vapor deposition, masking and deposition, or another suitable technique to form the capture sites 48, 48’. When electrostatic capture sites are used, the patterned structure 22, 22’ or non-patterned structure 23 may include additional circuitry to address the individual capture sites 48, 48’. As an example, the patterned structure 22, 22’ or non-patterned structure 23 can be integrated with a complementary metal oxide semi-conductor (CMOS) chip such that the depressions 36, 36’ or lane 40, respectively, are aligned with transparent electrodes and optical components of the CMOS.

[0130] Magnetic capture sites include any example of the magnetic capture agent set forth herein that can be deposited over or under predefined locations of the polymeric hydrogel layer 44, 44’. For example, magnetic materials may be deposited using chemical vapor deposition, masking and deposition, or another suitabletechnique to form the capture sites 48, It may be desirable to couple magnetic capture sites with other capture sites, such as chemical or electrostatic, to ensure that the pre-grafted particles 10 are locked into position within the depressions 36, 36’ or the lane 40 after being initially magnetically drawn to the depressions 36, 36’.

[0131] Kits

[0132] The pre-grafted particle 10 and flow cell 30 may be included in a kit.

[0133] One example kit includes the first and second transposome complexes 46A, 46B shown in Fig.4A. In one example, this kit includes i) a flow cell 30 (e.g., 30A, 30B, or 30C) including depressions 36, 36’ separated by interstitial regions 42, 42’ and first and second transposome complexes 46A, 46B immobilized within each of the depressions 36, 36’, the first transposome complexes 46A including a first amplification domain 64 and the second transposome complexes 46B including a second amplification domain 64’; and ii) a pre-grafted particle suspension, including a liquid carrier and pre-grafted particles 10 including a core 12 and a primer 14 attached to the core 12, the primer 14 having a same sequence as the first or second amplification domain 64, 64’. In another example, this kit includes i) a flow cell 30 (e.g., 30D) including a lane 40 and first and second transposome complexes 46A, 46B immobilized within the lane 40, the first transposome complexes 46A including a first amplification domain 64 and the second transposome complexes 46B including a second amplification domain 64’; and ii) a pre-grafted particle suspension, including a liquid carrier and pre-grafted particles 10 including a core 12 and a primer 14 attached to the core 12, the primer 14 having a same sequence as the first or second amplification domain 64, 64’.

[0134] As mentioned, the pre-grafted particle suspension includes the liquid carrier. The liquid carrier may be any suitable liquid in which an extension reaction, strand invasion, and amplification can take place. In an example, the liquid carrier may include water and an ionic salt buffer fluid, e.g., saline citrate, sodium citrate, sodium chloride, potassium chloride, phosphate buffered saline, etc., and other buffers, such as tris(hydroxymethyl)aminomethane (TRIS) or (4-(2-hydroxyethyl)-1- piperazineethanesulfonic acid) (HEPES). Any of the ionic salt buffers may be presentat milli-molar concentrations, e.g., about 350 mM to about 800 mM. The liquid carrier may also include non-ionic surfactant(s), such as TWEEN™ polysorbates.

[0135] The pre-grafted particles 10 described herein are suspended within the liquid carrier. In an example, the concentration of the pre-grafted particles 10 in the pre-grafted particle suspension ranges from about 0.05 mg / mL to about 1 mg / mL. In one specific example, the concentration of the pre-grafted particles 10 ranges from about 0.1 mg / mL to about 0.2 mg / mL.

[0136] This example kit may also include an extension mix. An example of the extension mix may include nucleotides, a polymerase, and accessory proteins. The nucleotides include the following bases: adenine, cytosine, guanine and thymine, and may also include any cleavable nucleobases or other cleavage sites. Any polymerase that can accept the nucleotide, and that can successfully incorporate the base of the nucleotide at the 3’ end of each of the tagmented DNA fragments. Example polymerases include those polymerases from family A, such as Bsu Polymerase, Bst Polymerase, Taq Polymerase, T7 Polymerase, and many others; polymerases from families B and B2, such as Phi29 polymerase and other highly processive polymerases (family B2), Pfu Polymerase (family B), KOD Polymerase (family B), 9oN (family B), and many others; polymerases from family C, such as Escherichia coli DNA Pol III, and many others, polymerases from family D, such as Pyrococcus furiosus DNA Pol II, and many others; polymerases from family X, such as DNA Pol µ, DNA Pol β, DNA Pol σ, and many others. The extension mix may also include a liquid carrier, such as water and / or an ionic salt buffer fluid, e.g., saline citrate at milli-molar to molar concentrations, sodium chloride, potassium chloride, phosphate buffered saline, etc., and other buffers, such as tris(hydroxymethyl)aminomethane (TRIS) or (4-(2- hydroxyethyl)-1-piperazineethanesulfonic acid) (HEPES). The liquid carrier may also include catalytic metal(s) intended for the extension reaction, such as Mg2+, Mn2+, etc. A single catalytic metal or a combination of catalytic metals may be used, and the total amount may range from about 0.01 mM to about 100 mM. The extension mix may also include a buffer agent (e.g., Tris), enzymes, stabilizers, a surfactant (e.g., TWEEN polysorbates), and / or a co-solvent (e.g., glycerol, dimethylformamide, etc.).

[0137] This example kit may further an amplification mix. One example of the amplification mix is used for bridge amplification, and the other amplification mix is used to initiate strand invasion amplification. An example of the amplification mix for bridge amplification may include a liquid carrier, nucleotides, a polymerase, and accessory proteins. The liquid carrier, polymerase, and the nucleotides may be any of the examples set forth herein for the extension mix. An example of the amplification mix for strand invasion amplification may include a liquid carrier, a strand-displacing polymerase, a recombinase, nucleotides, and a single stranded binding protein. The liquid carrier and the nucleotides may be an of the examples set forth herein for the extension mix. Examples of suitable strand-displacing polymerases include the large fragment of Bacillus subtilis Pol 1 (Bsu), Phi29 DNA polymerase, or the large fragment (exo-) of Geobacillus stearothermophilus pol I (Bst LF). Examples of suitable recombinases include UvsX, Cre, Hin, FLP, and tyrosine recombinases (e.g., XerC). Examples of suitable single stranded binding proteins include gp32, Human RPA, and E. Coli SSB. Any example of the amplification mix may also include a buffer agent (e.g., Tris), enzymes, stabilizers, a metal co-factor, a surfactant (e.g., TWEEN polysorbates), and / or a co-solvent (e.g., glycerol, dimethylformamide, etc.).

[0138] Another example kit includes the transposome complexes 46C shown in Fig. 4B. In one example, this kit includes i) a flow cell 30 (e.g., 30A, 30B, 30C) including depressions 36, 36’ separated by interstitial regions 42, 42’ and forked transposome complexes 46C immobilized within each of the depressions 36, 36’, the forked transposome complexes 46C including a transposon end 52 with a portion 54 of a transferred strand 56 hybridized to a portion 58 of a non-transferred strand 60’’(wherein the transferred strand 56 includes a first amplification domain 64, and wherein the non-transferred strand 60’’ includes a sequencing primer sequence 66’C, and a second amplification domain 64’C) and a transposase enzyme 50 non- covalently bound to the transposon end 52; and ii) a pre-grafted particle suspension, including a liquid carrier and pre-grafted particles 10 including the core 12 and the primer 14 attached to the core 12, the primer 14 having a same sequence as the first amplification domain 64 or having a complementary sequence to the second amplification domain 64’C. In another example, this kit includes i) a flow cell 30 (e.g.,30D) including a lane 40 and forked complexes 46C immobilized within the lane 40, the forked transposome complexes 46C including a transposon end 52 with a portion 54 of a transferred strand 56 hybridized to a portion 58 of a non- transferred strand 60’’(wherein the transferred strand 56 includes a first amplification domain 64, and wherein the non-transferred strand 60’’ includes a sequencing primer sequence 66’C, and a second amplification domain 64’C) and a transposase enzyme 50 non-covalently bound to the transposon end 52; and ii) a pre-grafted particle suspension, including a liquid carrier and pre-grafted particles 10 including the core 12 and the primer 14 attached to the core 12, the primer 14 having a same sequence as the first amplification domain 64 or having a complementary sequence to the second amplification domain 64’C.

[0139] The pre-grafted particle solution described herein may be used in these examples of the kit.

[0140] These example kits may further include a ligation mix, which includes a liquid carrier, a gap fill ligation enzyme, and a DNA ligase. The liquid carrier may be any of the examples set forth herein for the extension mix. Examples of the gap fill ligation enzyme include tTaq608 polymerase, T7 exo minus polymerase, etc. Examples of the DNA ligase include EColi DNA ligase, T4 DNA ligase, etc. The ligation mix also includes any of the nucleotides described herein for the extension mix.

[0141] These example kits may also include any example of the amplification mix described herein.

[0142] In any of the kits, the flow cell 30 may further include any example of the particle capture site 48, 48’ within each of the depressions 36, 36’ or the lane 40.

[0143] Any of the kits described herein may also include a tagmentation buffer, an example of which is described herein with reference to the methods.

[0144] Methods

[0145] Some examples of the method utilizing both the pre-grafted particle 10 and the flow cell 30 are schematically depicted in Fig.5A through Fig.5I. One example method is shown in Fig.5A through Fig.5F and the other example method is shown inFig.5A, Fig.5G through Fig.5I, Fig.5E, Fig.5F. Each of the methods described in reference to Fig.5A through Fig.5I involves the open wafer form of the flow cell 30A, but it is to be understood that any of the flow cells 30B, 30C, 30D may be used. Each of the methods described in reference to Fig.5A through Fig.5I also involves the transposome complexes 46A, 46B. Either substrate 28, 28’ or 31, 31’ may be used in the methods; and the base support 32 is shown in phantom in Fig.5A and is not shown in remainder of the figures for ease of illustration.

[0146] The examples shown in Fig.5A through Fig.5I and also discussed in reference to Fig.6 generally include introducing a deoxyribonucleic acid (DNA) sample 70 to an example of the flow cell 30A including the depressions 36 separated by interstitial regions 42 and the first and second transposome complexes 46A, 46B immobilized within each of the depressions 36, whereby tagmentation generates respective partially adapted DNA sample fragments 72, 74 in at least some of the depressions 36; introducing the pre-grafted particle suspension to the flow cell 30, whereby at least some of the pre-grafted particles 10 respectively attach within a plurality of the at least some of the depressions 36; generating respective fully adapted DNA sample fragments 72’, 74’ from the respective partially adapted DNA sample fragments 72, 74; and initiating amplification such that, within each of the plurality of the at least some of the depressions 36, some of the respective fully adapted DNA sample fragments 72’, 74’ are amplified on a respective one of the at least some of the pre-grafted particles 10. When the flow cell 30D is used, the method generally includes introducing a deoxyribonucleic acid (DNA) sample 70 to an example of the flow cell 30D including the lane 40 and the first and second transposome complexes 46A, 46B immobilized within the lane 40, whereby tagmentation generates respective partially adapted DNA sample fragments 72, 74 in at least some of the lane 40; introducing the pre-grafted particle suspension to the flow cell 30D, whereby at least some of the pre-grafted particles 10 respectively attach within the lane 40; generating respective fully adapted DNA sample fragments 72’, 74’ from the respective partially adapted DNA sample fragments 72, 74; and initiating amplification such that, within the lane 40, some of the respective fully adapted DNA sample fragments 72’, 74’ are amplified on a respective one of the at least some of the pre-grafted particles 10. Inthe example shown in Fig.5A through the DNA sample 70 is introduced into the flow cell 30 before the pre-grafted particle solution. In the example shown in Fig. 5A, Fig.5G through Fig.5I, Fig.5E, and Fig.5F, the pre-grafted particle solution is introduced into the flow cell 30 before the DNA sample 70.

[0147] The method depicted in Fig.5A through Fig.5F will now be described. Fig. 5A depicts a portion of the open wafer flow cell 30A at the outset of the method. In particular, Fig.5A depicts two depressions 36 of the open wafer flow cell 30A having the transposome complexes 46A, 46B attached, as dimers, to the polymeric hydrogel layer 44.

[0148] As shown in Fig.5B, this example method involves introducing the DNA sample 70 into the flow cell 30A. While a single piece of the DNA sample 70 is shown, it is to be understood that the DNA sample 70 includes several copies of a longer piece of DNA or a piece of complementary DNA (cDNA) generated from RNA.

[0149] The introduction of the DNA sample 70 into the flow cell 30A may be performed manually (e.g., using a pipette), or using an automated sample preparation instrument. When one of the enclosed flow cells 30B or 30C is used, the introduction may take place via the inlet.

[0150] The DNA sample fragment 70 may be introduced with a tagmentation buffer, which may include water, an optional co-solvent (e.g., dimethylformamide), a metal co- factor for the transposase (e.g., magnesium acetate), and a buffer salt (e.g., Tris acetate salt, pH 7.6). In an example, the optional co-solvent may be present in an amount up to about 11%, the metal co-factor may be present in a concentration ranging from about 3 mM to about 5.5 mM, and the buffer salt may be present in a concentration ranging from about 7 mM to about 12 mM.

[0151] Within the depressions 36, the DNA sample 70 is tagmented. At the outset of tagmentation, the longer DNA sample 70 is fragmented by the transposome complexes 46A, 46B. As depicted in Fig.5B, and more specifically in Fig.6 (to the left side of the arrow), the 5’ ends of both strands of the duplex sample 70 are ligated to respective 3’ ends of the transferred strands 56, 56’ of at least some of the transposome complexes 46A and 46B. This generates partially adapted DNA fragments 72A, 74A, 72B, 74B, 72C, 74C, 72D, 74D. As shown in Fig.5B, the DNAsample 70 is fragmented multiple times, may take place across the depressions 36. The number of tagmentation events that take place on a single DNA sample 70 will depend upon the length of the sample 70 and the distance between neighboring dimers of the transposome complexes 46A, 46B. At a minimum, the transposome complexes 46A, 46B can tagment the DNA sample at least every 30 base pairs, although longer insert sizes may be desirable. The opposite ends of the DNA sample 70 may be loose (i.e., not tagmented at one end), as shown in Fig.5B. These loose ends will not be fitted with adapters at both ends, and thus will not participate in amplification.

[0152] Fragmentation and ligation may take place at a temperature at or above 30°C. In one example, the temperature may range from 30°C to about 55°C. In another example, the temperature may range from 35°C to about 45°C. The 3’ ends of the generated strands 72A, 74A, 72B, 74B, 72C, 74C, 72D, 74D are not ligated to the 5’ ends of the non-transferred strands 60, 60’ (which in this example are made up of the strands 58, 58’ alone). As such, a gap G1 exists between the 3’ end of the DNA fragment strand 74A, 74B, 74C, 74D and the 5’ end of the non-transferred strand 60’, and a gap G2 exists between the 3’ end of the DNA fragment strand 72A, 72B, 72C, 72D and the 5’ end of the non-transferred strand 60. In one example, each gap G1, G2 is nine (9) base pairs long. The gaps G1, G2are labeled in Fig.6.

[0153] In this example method, prior to the introduction of the pre-grafted particle solution, the generation of the respective fully adapted DNA sample fragments 72A’, 74A’, 72B’, 74B’, 72C’, 74C’, 72D’, 74D’ (see Fig.5C, also shown as 72’, 74’ in Fig.6) from the respective partially adapted DNA sample fragments 72A, 74A, 72B, 74B, 72C, 74C, 72D, 74D involves removing the transposase enzyme 50, 50’ from each of the first and second transposome complexes 46A, 46B, and performing an extension reaction.

[0154] The transposases 50, 50’ are removed from the complexes 46A, 46B, which are now attached to the fragments 72A, 74A, 72B, 74B, 72C, 74C, 72D, 74D via the transferred strands 56, 56’ (see Fig.5B and the left side of the arrow in Fig.6). Transposase 50, 50’ removal may be accomplished, for example, using sodium dodecyl sulfate (SDS) or proteinase, or by heating the flow cell 30A to about 60°C.When heat is used, some example involve introducing a washing solution into the flow channel 24, and heating the flow cell 30A, containing the washing solution, to about 60°C. An example washing solution is an aqueous solution including a buffer agent (e.g., Tris), a salt (e.g., sodium chloride, sodium citrate, etc.), a surfactant (e.g., TWEEN polysorbates), and / or a chelating agent (e.g., EDTA). In one example, the washing solution includes water, the salt at a concentration ranging from about 25 mM to about 50 mM, the surfactant in an amount ranging from about 0.01 wt% to about 0.1 wt%, and optionally the chelating agent. The washing solution may have a relatively high pH, e.g., ranging from about 7 to about 10.

[0155] The washing solution is removed, and then an extension mix is introduced into the flow channel 24 that contains the now tagmented partially adapted DNA fragments 72A, 74A, 72B, 74B, 72C, 74C, 72D, 74D. Prior to the introduction of the extension mix, the temperature of the flow cell 30A may be lowered to about 38°C. Any example of the extension mix for bridge amplification described herein may be used.

[0156] Fig.6 illustrates the extension reaction at one set of partially adapted DNA fragments 72, 74. A similar reaction takes place at each of the partially adapted DNA fragments 72A, 74A, 72B, 74B, 72C, 74C, 72D, 74D generated during the method of Fig.5A through Fig.5F. At the outset, the non-transferred strands 60, 60’ are dehybridized and additional sequences (adapters) are added to the 3’ ends of the partially adapted fragments 72, 74 (e.g., 72A, 74A, 72B, 74B, 72C, 74C, 72D, 74D) by the extension reaction. The extension reaction involves the addition of nucleotides in a template dependent fashion from the 3’ ends of the partially adapted DNA fragments 72, 74 using the respective transferred strands 56, 56’ as the template. The DNA fragment 74 is extended along the transferred strand 56’ (now attached to the DNA fragment 72) to generate complementary sections 64’C, 66’C, 54’C of the second amplification domain 64’, the sequencing primer sequence 66’, and the portion 54’; and the DNA fragment 72 is extended along the transferred strand 56 (now attached to the DNA fragment 74) to generate complementary sections 64C, 66C, 54C of the first amplification domain 64, the sequencing primer sequence 66, and the portion 54. The sequences resulting from the extension reaction render the partially adaptedfragments 72, 74 (i.e., the tagmented that have not been extended) fully adapted and ready for further amplification and cluster generation. The fully adapted DNA fragments 72’, 74’ are shown to the right of the arrow in Fig.6. The fully adapted DNA fragments 72A’, 74A’, 72B’, 74B’, 72C’, 74C’, 72D’, 74D’ are also shown in Fig. 5C.

[0157] After their generation, the fully adapted DNA fragments 72A’, 74A’, 72B’, 74B’, 72C’, 74C’, 72D’, 74D’ are then dehybridized to generate single stranded fragments, as shown in Fig.5D.

[0158] This example method then involves introducing the pre-grafted particle suspension to the flow cell 30A, whereby at least some of the pre-grafted particles 10 respectively attach at least some of the depressions 36 where tagmentation and linearization has taken place. Any example of the pre-grafted particle suspension described herein may be used. The introduction of the pre-grafted particle suspension into the flow cell 30A may be performed manually (e.g., using a pipette), or using an automated sample preparation instrument. When one of the enclosed flow cells 30B or 30C is used, the introduction may take place via the inlet.

[0159] Within the flow cell 30A, at least some of the pre-grafted particles 10 attach to respective capture sites 48 within the depressions 36. As described herein, the pre- grafted particles 10 include a functional agent, a reversibly chargeable functional group, and / or magnetic material that specifically binds, attaches, or is otherwise attracted (e.g., electrostatically, magnetically, etc.) to the capture site 48. The pre- grafted particle suspension may be allowed to incubate in the flow cell 30A for a predetermined time to allow the pre-grafted particles 10 to become anchored. When electrostatic capture sites 48 are used, the individual sites 48 may be electrically addressed to move the pre-grafted particles 10 toward individual capture sites 48. In this example, the pre-grafted particles 10 may include a reversibly chargeable functional group that can be converted from a neutral species to a charged species at a suitable pH. The charged species can be generated by adjusting the pH, and then attracted to the electrostatic capture sites 48 that are individually or globally addressed. A rinse may be performed to remove any non-immobilized pre-graftedparticles 10, and then amplification may performed on-board the flow cell 30A as described herein. The attached pre-grafted particles 10 are shown in Fig.5E.

[0160] To initiate bridge amplification, any example of the amplification mix (for bridge amplification) described here may be introduced into the flow cell 30A containing the attached pre-grafted particles 10.

[0161] In one example of amplification, at least some of the fully adapted fragments, e.g., 72A’, 74B’, and 74C’ in Fig.5E, hybridize to a complementary primer 14 or 16 on the surface of the respective pre-grafted particles 10. While not shown in Fig.5E, it is to be understood that the other fully adapted fragments, e.g., 72B’, 74A’, 72C’, 72D’, and 74D’, may be inhibited from hybridizing due to the overlying pre- grafted particle 10; or the other fully adapted fragments, e.g., 72B’, 74A’, 72C’, 72D’, and 74D’, may hybridize to another complementary primer 14 or 16 on the respective pre-grafted particles 10 and undergo amplification (which leads to the formation of a polyclonal cluster). A polymerase respectively copies the hybridized fragments 72A’, 74B’ and 74C’ to form double stranded bridges (the initial formation of which is illustrated by the dashed arrow in Fig.5E), which are denatured to form two single stranded strands. The first round of amplification in each depression 36 generates an amplicon 76A, 76B, 76C that is attached to the respective pre-grafted particle 10 through the primer 14 or 16. Both the depression bound fully adapted fragments 72A’, 74B’ and 74C’ and the newly generated particle surface bound amplicons 76A, 76B, 76C loop over and hybridize to an adjacent or nearby complementary primers 14 or 16 and are extended again to form new double stranded loops. The process is repeated on each template copy (amplicon) by cycles of isothermal denaturation and amplification to create dense clonal clusters on the surface of the pre-grafted particle. Each cluster of double stranded bridges is denatured.

[0162] In an example, the reverse strands are removed by a cleaving agent suitable for the cleavage site of the primers 14 or 16 to which the reverse strands are attached (e.g., specific base cleavage), leaving forward template strands / amplicons attached to the other of the primers 16 or 14. In another example, the forward strands are removed by a cleaving agent suitable for the cleavage site of the primers 14 or 16 to which the forward strands are attached (e.g., specific base cleavage), leavingreverse template strands / amplicons to the other of the primers 16 or 14. Clustering results in the formation of several template strands attached to the core 12. In this example, amplification generates the clustered particles 82, 82’ shown in Fig. 5F. The process may result in polyclonal clusters (particle 82’) or monoclonal clusters (particle 82) depending upon how many of the fully adapted fragments, e.g., 72A’, 74B’, and 74C’ amplify on the individual particle surface.

[0163] The method depicted in Fig.5A, Fig.5G through Fig.5I, Fig.5E and Fig.5F will now be described. As described herein, Fig.5A depicts a portion of the open wafer flow cell 30A at the outset of the method.

[0164] As shown in Fig.5G, this example method involves introducing the pre- grafted particle suspension to the flow cell 30A, whereby at least some of the pre- grafted particles 10 respectively attach to at least some of the depressions 36 where tagmentation has not yet taken place. Any example of the pre-grafted particle suspension described herein may be used, and the introduction may take place as described in reference to Fig.5E.

[0165] Within the flow cell 30A, at least some of the pre-grafted particles 10 attach to respective capture sites 48 within the depressions 36 via the functional agent, the reversibly chargeable functional group, and / or the magnetic material that specifically binds, attaches, or is otherwise attracted (e.g., electrostatically, magnetically, etc.) to the capture site 48. The pre-grafted particle suspension may be allowed to incubate in the flow cell 30A for a predetermined time to allow the pre-grafted particles 10 to become anchored. In this example, the attached pre-grafted particles 10 may block underlying transposome complexes 46A, 46B from being used in tagmentation. This may increase the size of the partially adapted DNA fragments 72, 74 because the available transposome complexes 46A, 46B may be at opposed ends of the depression 36.

[0166] This example method then includes introducing the DNA sample 70, into the flow cell 30A. The DNA sample 70 includes several copies of a longer piece of DNA or CDNA, and may be introduced as described herein in reference to Fig.5B.

[0167] The DNA sample 70 may be introduced with a tagmentation buffer, and tagmentation and ligation may be performed as described herein in reference to Fig.5B and Fig.6 to generate the partially DNA fragments 72E, 74E, 72F, 74F, 72G, 74G in the respective depressions 36, as shown in Fig.5H.

[0168] The removal of the transposase enzymes 50, 50’ and the extension reaction may then be performed as described in reference to Fig.6 in order to generate fully adapted DNA fragments 72E’, 74E’, 72F’, 74F’, 72G’, 74G’ in the respective depressions 36, as shown in Fig.5I. The fully adapted fragments 72E’, 74E’, 72F’, 74F’, 72G’, 74G’ that are generated in this example method are similar to fragments 72’, 74’ that are shown and described in reference to Fig.6.

[0169] After their generation, the fully adapted DNA fragments 72E’, 74E’, 72F’, 74F’, 72G’, 74G’ are then dehybridized to generate single stranded fragments.

[0170] Bridge amplification is then initiated and performed as described in reference to Fig.5E and Fig.5F. The process generates particle-bound amplicons 76E1, 76E2, 76F that are attached to the respective cores 12. The example shown in Fig.5F depicts two clustered particles 82, 82’ with particle-bound amplicons 76E1, 76E2, 76F. The process may result in polyclonal clusters (particle 82’) or monoclonal clusters (particle 82) depending upon how many of the fully adapted fragments, e.g., 72E’, 74E’, and 74F’ amplify on the individual particle surface.

[0171] It is to be understood that strand invasion amplification may be used to initiate amplification on the pre-grafted particles 10. To initiate strand invasion amplification, an example of the amplification mix described herein for strand invasion may be introduced into the flow cell 30A containing the fully adapted DNA fragments 72’, 74’ and the attached pre-grafted particles 10. Within the flow cell 30A, the recombinase binds to primers 14 on the pre-grafted particle surface in the presence of adenosine triphosphate (ATP). In some instances, a crowding agent, such as poly(ethylene glycol) may be included as well. This forms a recombinase-primer complex. The complex then interrogates double stranded DNA, in this example, the hybridized fully adapted fragments 72’, 74’, seeking a homologous sequence and promotes strand invasion by the primer 14 or 16 at the cognate site. In order to prevent the ejection of the inserted primer 14 by branch migration, the displaced fully adapted DNA fragment 74’ or 72’ is stabilized by the single-stranded binding proteins. Finally, the recombinase disassembles and the strand displacing DNA polymerasebinds to the 3’ end of the primer 14 or elongate it in the presence of the nucleotides to generate particle-bound amplicons that are attached to the respective cores 12. The particle-bound amplicons can then undergo bridge amplification to form clustered particles 82, 82’.

[0172] In still another example method which is not shown in Fig.5A through Fig. 5I, the DNA sample 70 is introduced into the flow cell 30A simultaneously with the pre- grafted particle solution at a temperature suitable for the tagmentation and for the strand invasion amplification. Between the end of tagmentation and the beginning of amplification, the temperature of the flow cell 30A may be raised and exposed to a wash solution to remove the transposase enzymes 52, 52’, and then the temperature may then be lowered again for amplification.

[0173] The methods described in reference to Fig.5A through Fig.5I may alternatively be performed using the forked transposome complexes 46C. In some of these examples, the methods generally involve introducing a deoxyribonucleic acid (DNA) sample 70 to a flow cell 30 (e.g., 30A, 30B, 30C) including depressions 36, 36’ separated by interstitial regions 42, 42’; and forked transposome complexes 46C immobilized within each of the depressions 36, 36’, the forked transposome complexes 46C including i) a transposon end 52 with a portion 54 of a transferred strand 56 hybridized to a portion 58 of a non-transferred strand 60’’, wherein the transferred strand 56 includes a first amplification domain 64, and wherein the non- transferred strand 60’’ further includes a sequencing primer sequence 66, and a second amplification domain 64 and ii) a transposase enzyme 50 non-covalently bound to the transposon end 52, whereby tagmentation generates respective partially adapted DNA sample fragments 84, 86 (see Fig.7) in at least some of the depressions 36, 36’; generating respective fully adapted DNA sample fragments 84’, 86’ (see Fig. 7) from the respective partially adapted DNA sample fragments 84, 86; introducing a pre-grafted particle suspension to the flow cell 30, wherein the pre-grafted particle suspension includes the liquid carrier and the pre-grafted particles 10, whereby at least some of the pre-grafted particles 10 respectively attach within a plurality of the at least some of the depressions 26, 26’; and initiating strand invasion amplification such that, within each of the plurality of the at least some of the depressions 36, 36’, someof the fully adapted DNA sample 84’, 86’ are amplified on a respective one of the at least some of the pre-grafted particles 10. In other examples, the methods generally involve introducing a deoxyribonucleic acid (DNA) sample 70 to a flow cell 30 (e.g., 30D) including a lane 40; and forked transposome complexes 46C immobilized within each of the depressions 36, 36’, the forked transposome complexes 46C including i) a transposon end 52 with a portion 54 of a transferred strand 56 hybridized to a portion 58 of a non-transferred strand 60’’, wherein the transferred strand 56 includes a first amplification domain 64, and wherein the non- transferred strand 60’’ further includes a sequencing primer sequence 66, and a second amplification domain 64 and ii) a transposase enzyme 50 non-covalently bound to the transposon end 52, whereby tagmentation generates respective partially adapted DNA sample fragments 84, 86 (see Fig.7) in at least some of the lane 40; generating respective fully adapted DNA sample fragments 84’, 86’ (see Fig.7) from the respective partially adapted DNA sample fragments 84, 86; introducing a pre- grafted particle suspension to the flow cell 30, wherein the pre-grafted particle suspension includes the liquid carrier and the pre-grafted particles 10, whereby at least some of the pre-grafted particles 10 respectively attach within the lane 40; and initiating strand invasion amplification such that, within the lane 40, some of the fully adapted DNA sample fragments 84’, 86’ are amplified on a respective one of the at least some of the pre-grafted particles 10.

[0174] When the forked transposome complexes 46C are used in the method described in Fig.5A through Fig.5F or the method of Fig.5A, Fig.5G through Fig.5I, Fig.5E, and Fig.5F the processes are the same except for tagmentation and the formation of the fully adapted DNA fragments 84’, 86’. These processes will now be described.

[0175] As depicted in Fig.7, the 5’ ends of the tagmented portions of the duplex sample 70 are ligated to respective 3’ ends of the transferred strands 56 of the transposome complexes 46C. Fragmentation and ligation may take place as described in reference to Fig.6.

[0176] In the example shown Fig.7, the method further includes removing the transposase 50. More specifically, the transposases 50 are removed from thecomplexes 46C, which are now attached the fragments 84, 86 (similar to fragments 72, 74) via the transferred strands 56. Transposase 50 removal may be accomplished, as described herein. Washing may then take place.

[0177] In the example shown in Fig.7, the washing solution is removed, and then gap fill ligation is then performed to attach the DNA sample fragments 84, 86 to the non-transferred strands 60’’, which include the adapter components 68. Gap fill ligation may be performed with any suitable gap fill ligation enzyme (e.g., tTaq608 polymerase, T7 exo minus polymerase, etc.) and any suitable ligase (e.g., EColi DNA ligase, T4 DNA ligase, etc.), in combination with a solution of nucleotides. Gap fill ligation may take place at a temperature ranging from about 37°C to about 50°C for about 5 minutes. As a result of gap fill ligation, fully adapted DNA fragments 84’, 86’ are attached to the flow cell depressions 36, 36’. In this example, the fully adapted DNA fragments 84’, 86’ have one amplification domain 64 at one end and the complement 64’C of the other amplification domain 64’ at the other end.

[0178] The fully adapted fragments 84’, 86’ may be used as described in the methods of Fig.5A through Fig.5F and of Fig.5A, Fig.5G through Fig.5I, Fig.5E and Fig.5F to generate particle-bound amplicons 76A, 76B, 76C, etc. on the cores 12.

[0179] In any of the methods disclosed herein, the particle-bound amplicons 76A, 76B, 76C, etc. may be sequenced, e.g., using sequencing-by-synthesis.

[0180] To initiate sequencing, sequencing primers may then be introduced to the flow cell 30. The sequencing primers hybridize to a complementary portion of the sequence (e.g., 66C, 66’C) of the amplicons 76A, 76B or 76E1, 76E2 and 76C or 76F that are attached to the clustered particles 82’ or 82. These sequencing primers render the amplicons 76A, 76B or 76E1, 76E2 and 76C or 76F ready for sequencing.

[0181] An incorporation mix including labeled nucleotides may then be introduced into the flow cell 30. In addition to the labeled nucleotides, the incorporation mix may include water and / or an ionic salt buffer fluid, such as saline citrate at milli-molar to molar concentrations, sodium chloride, potassium chloride, phosphate buffered saline, etc., and / or other buffers, such as tris(hydroxymethyl)aminomethane (TRIS) or (4-(2- hydroxyethyl)-1-piperazineethanesulfonic acid) (HEPES). The liquid carrier may also include catalytic metal(s) intended for the incorporation reaction, such as Mg2+, Mn2+,Ca2+, etc. A single catalytic metal or a of catalytic metals may be used, and the total concentration may range from about 0.01 mM to about 100 mM. The incorporation mix also includes a polymerase that can accept the labeled nucleotides, and that can successfully incorporate the nucleotide base into a nascent strand along an amplicon. Examples polymerases include those polymerases from family A, such as Bsu Polymerase, Bst Polymerase, Taq Polymerase, T7 Polymerase, and many others; polymerases from families B and B2, such as Phi29 polymerase and other highly processive polymerases (family B2), Pfu Polymerase (family B), KOD Polymerase (family B), 9oN (family B), and many others; polymerases from family C, such as Escherichia coli DNA Pol III, and many others, polymerases from family D, such as Pyrococcus furiosus DNA Pol II, and many others; polymerases from family X, such as DNA Pol µ, DNA Pol β, DNA Pol σ, and many others.

[0182] When the incorporation mix is introduced into the flow cell 30, the mix enters the flow channel 24, and contacts the amplicons 76A, 76B or 76E1, 76E2 and 76C or 76F. The incorporation mix is allowed to incubate in the flow cell 30, and labeled nucleotides (including optical labels) are incorporated by respective polymerases into the nascent strands along the amplicons on the clustered particles 82, 82’.

[0183] During incorporation, one of the labeled nucleotides is incorporated, by a respective polymerase, into one nascent strand that extends one sequencing primer and that is complementary to one of the template strands / amplicons. Incorporation is performed in a template strand dependent fashion, and thus detection of the order and type of labeled nucleotides added to the nascent strand can be used to determine the sequence of the amplicon and thus the original DNA sample stands. Incorporation occurs in at least some of the amplicons across the clustered particles 82, 82’ during a single sequencing cycle.

[0184] The incorporated labeled nucleotides may include a reversible termination property due to the presence of a 3’ OH blocking group, which terminates further sequencing primer extension once the labeled nucleotide has been added. After a desired time for incubation and incorporation, the incorporation mix, including non- incorporated labeled nucleotides, may be removed from the flow cell 30 during a wash cycle. The wash cycle may involve a flow-through technique, where a washingsolution (e.g., buffer) is directed into, and then out of flow channel 24, e.g., by a pump or other suitable mechanism.

[0185] Without further incorporation taking place, the most recently incorporated labeled nucleotides can be detected through an imaging event or a data collection event.

[0186] During the imaging event, an illumination system may provide excitation light to the flow cell 30. The optical labels of the incorporated labeled nucleotides emit optical signals in response to the excitation light. An optical imager captures images of the optical signals.

[0187] After imaging is performed, a cleavage mix may then be introduced into the flow cell 30. In an example, the cleavage mix is capable of i) removing the 3’ OH blocking group from the incorporated nucleotides, and ii) cleaving the optical label from the incorporated nucleotide. Examples of 3’ OH blocking groups and suitable de- blocking agents / components in the cleavage mix may include: ester moieties that can be removed by base hydrolysis; allyl-moieties that can be removed with Nal, chlorotrimethylsilane and Na2S2O3or with Hg(II) in acetone / water; azidomethyl which can be cleaved with phosphines, such as tris(2-carboxyethyl)phosphine (TCEP) or tri(hydroxypropyl)phosphine (THP); acetals, such as tert-butoxy-ethoxy which can be cleaved with acidic conditions; MOM (—CH2OCH3) moieties that can be cleaved with LiBF4and CH3CN / H2O; 2,4-dinitrobenzene sulfenyl which can be cleaved with nucleophiles such as thiophenol and thiosulfate; tetrahydrofuranyl ether which can be cleaved with Ag(I) or Hg(II); and 3’ phosphate which can be cleaved by phosphatase enzymes (e.g., polynucleotide kinase). Examples of suitable optical label cleaving agents / components in the cleavage mix may include: sodium periodate, which can cleave a vicinal diol; phosphines, such as tris(2-carboxyethyl)phosphine (TCEP) or tris(hydroxypropyl)phosphine (THP), which can cleave azidomethyl linkages; palladium and THP, which can cleave an allyl; bases, which can cleave ester moieties; or any other suitable cleaving agent.

[0188] Additional sequencing cycles may then be performed until the amplicons are sequenced.

[0189] Additional Notes

[0190] Any of the flow cells 30 (e.g., 30A, 30B, 30C, 30D) disclosed herein having the transposome complexes 46A, 46B, 46C attached via biotin-streptavidin interactions (e.g., through a biotinylated polymeric hydrogel layer 44, 44’) may be used again in the methods disclosed herein. In these examples, the sequenced particles can be removed, e.g., by cleaving or reversing the interaction between the capture site 48 and the mechanism.

[0191] The spent transposome complexes 46A, 46B, 46C may also be removed. This may be accomplished using a biotin streptavidin cleavage composition that is introduced into the flow cell 30. Examples of the biotin streptavidin cleavage composition include about 95% formamide and about 10mM ethylenediaminetetraacetic acid (EDTA), or from about 10% by volume to about 50% by volume of a formamide reagent and a balance of a salt buffer. At suitable reaction temperatures, these cleavage compositions disrupt the biotin-streptavidin interactions, thus releasing whatever is attached (e.g., the transposome complexes 46A, 46b, 46C) to the biotin of the biotinylated polymeric hydrogel layer 44. Alternatively, a hot wash with biotin and / or desthiobiotin causes the newly added biotin and / or desthiobiotin to compete with the already bound biotin. By disrupting the biotin-streptavidin interactions, the streptavidin and the transposome complexes 46A, 46B, 46C (having a biotin at their 5’ end) are removed, leaving the biotinylated polymeric hydrogel layer 44, 44’ intact for attaching fresh biotinylated transposome complexes 46A, 46B, 46C. The fresh biotinylated transposome complexes 46A, 46B, 46C may then be introduced, rendering the flow cell 30 ready for reuse using any of the methods disclosed herein.

[0192] In other examples, if any unused transposome complexes 46A, 46B, 46C remain after tagmentation, amplification, and sequencing, the flow cell 30 may be reused. In these examples, the sequenced particles can be removed, e.g., by cleaving or reversing the interaction between the capture site 48, 48’ and the mechanism. A new DNA sample 70 may be introduced to initiate tagmentation at the unused transposome complexes 46A, 46B, 46C.

[0193] It should be appreciated that of the foregoing concepts and additional concepts discussed in greater detail below (provided such concepts are not mutually inconsistent) are contemplated as being part of the inventive subject matter disclosed herein. In particular, all combinations of claimed subject matter appearing at the end of this disclosure are contemplated as being part of the inventive subject matter disclosed herein. It should also be appreciated that terminology explicitly employed herein that also may appear in any disclosure incorporated by reference should be accorded a meaning most consistent with the particular concepts disclosed herein.

[0194] Reference throughout the specification to “one example”, “another example”, “an example”, and so forth, means that a particular element (e.g., feature, structure, and / or characteristic) described in connection with the example is included in at least one example described herein, and may or may not be present in other examples. In addition, it is to be understood that the described elements for any example may be combined in any suitable manner in the various examples unless the context clearly dictates otherwise.

[0195] While several examples have been described in detail, it is to be understood that the disclosed examples may be modified. Therefore, the foregoing description is to be considered non-limiting.

Claims

What is claimed is:

1. A method, comprising: introducing a deoxyribonucleic acid (DNA) sample to a flow cell including: depressions separated by interstitial regions; and first and second transposome complexes immobilized within each of the depressions, the first transposome complexes including a first amplification domain and the second transposome complexes including a second amplification domain, whereby tagmentation generates respective partially adapted DNA sample fragments in at least some of the depressions; generating respective fully adapted DNA sample fragments from the respective partially adapted DNA sample fragments; introducing a pre-grafted particle suspension to the flow cell, wherein the pre- grafted particle suspension includes: a liquid carrier; and pre-grafted particles including: a core; and first and second primers attached to the core, the first and second primers having a same sequence, respectively, as the first and second amplification domains, whereby at least some of the pre-grafted particles respectively attach within a plurality of the at least some of the depressions; and initiating amplification such that, within each of the plurality of the at least some of the depressions, some of the respective fully adapted DNA sample fragments are amplified on a respective one of the at least some of the pre-grafted particles.

2. The method as defined in claim 1, wherein the DNA sample is introduced into the flow cell before the pre-grafted particle solution.

3. The method as defined in claim 2, wherein prior to the introduction of the pre-grafted particle solution, the generation of the respective fully adapted DNAsample fragments from the respective adapted DNA sample fragments involves: removing a transposase enzyme from each of the first and second transposome complexes; and performing an extension reaction.

4. The method as defined in claim 1, wherein the DNA sample is introduced into the flow cell simultaneously with the pre-grafted particle solution at a temperature suitable for the tagmentation and for the amplification.

5. The method as defined in claim 1, wherein the pre-grafted particle solution is introduced into the flow cell before the DNA sample.

6. The method as defined in claim 5, wherein after the introduction of the DNA sample, the generation of the respective fully adapted DNA sample fragments from the respective partially adapted DNA sample fragments involves: removing a transposase enzyme from each of the first and second transposome complexes; and performing an extension reaction.

7. The method as defined in any of claims 1-6, wherein the amplification generates a plurality of amplicons on the respective one of the at least some of the pre-grafted particles, and the method further comprises initiating a sequencing operation of the plurality of amplicons.

8. The method as defined in claim 7, further comprising removing the pre- grafted particles from the depressions after the sequencing operation.

9. The method as defined in any of claim 7 or claim 8, further comprising removing the first and second transposome complexes from each of the depressions.

10. The method as defined in 9, further comprising: immobilizing fresh first and second transposome complexes within first and second transposome complexes immobilized within each of the depressions; and repeating the method with a fresh DNA sample.

11. A kit, comprising: a flow cell including: depressions separated by interstitial regions; and first and second transposome complexes immobilized within each of the depressions, the first transposome complexes including a first amplification domain and the second transposome complexes including a second amplification domain; and a pre-grafted particle suspension, including: a liquid carrier; and pre-grafted particles including: a core; and first and second primers attached to the core, the first and second primers having a same sequence, respectively, as the first and second amplification domains.

12. The kit as defined in claim 11, further comprising an amplification mix including a second liquid carrier, a strand-displacing polymerase, a recombinase, nucleotides, and a single stranded binding protein.

13. The kit as defined in any of claim 11 or claim 12, wherein the flow cell further comprises a particle capture site within each of the depressions.

14. The kit as defined in any of claims 11-13, wherein the core of the pre- grafted particles is a polymeric hydrogel, and wherein the first and second primers are attached directly to the core.

15. The kit as defined in any of 11-13, wherein the core of the pre- grafted particles is a core material coated with a polymeric hydrogel coating, and wherein the first and second primers are attached directly to the polymeric hydrogel coating.

16. The kit as defined in any of claims 11-15, wherein: each of the first transposome complexes includes: a first transposon end with a portion of a first transferred strand hybridized to a first non-transferred strand, wherein the first transferred strand includes the first amplification domain and a first sequencing primer sequence; and a first transposase enzyme non-covalently bound to the first transposon end; and each of the second transposome complexes includes: a second transposon end with a portion of a second transferred strand hybridized to a second non-transferred strand, wherein the second transferred strand includes the second amplification domain and a second sequencing primer sequence; and a second transposase enzyme non-covalently bound to the second transposon end.

17. The kit as defined in claim 16, further comprising an extension mix including a second liquid carrier, a polymerase, and nucleotides.

18. A method, comprising: introducing a deoxyribonucleic acid (DNA) sample to a flow cell including: depressions separated by interstitial regions; and forked transposome complexes immobilized within each of the depressions, the forked transposome complexes including: a transposon end with a portion of a transferred strand hybridized to a portion of a non-transferred strand, wherein the transferred strandincludes a first and wherein the non-transferred strand further includes a sequencing primer sequence and a second amplification domain; and a transposase enzyme non-covalently bound to the transposon end; whereby tagmentation generates respective partially adapted DNA sample fragments in at least some of the depressions; generating respective fully adapted DNA sample fragments from the respective partially adapted DNA sample fragments; introducing a pre-grafted particle suspension to the flow cell, wherein the pre- grafted particle suspension includes: a liquid carrier; and pre-grafted particles including: a core; and first and second primers attached to the core, the first primer having a same sequence as the first amplification domain and the second amplification domain being complementary to the second primer, whereby at least some of the pre-grafted particles respectively attach within a plurality of the at least some of the depressions; and initiating amplification such that, within each of the plurality of the at least some of the depressions, some of the respective fully adapted DNA sample fragments are amplified on a respective one of the at least some of the pre-grafted particles.

19. The method as defined in claim 18, wherein the DNA sample is introduced into the flow cell before the pre-grafted particle solution.

20. The method as defined in claim 19, wherein prior to the introduction of the pre-grafted particle solution, the generation of the respective fully adapted DNA sample fragments from the respective partially adapted DNA sample fragments involves:removing a transposase enzyme each of the forked transposome complexes; and ligating 3’ ends of the respective partially adapted DNA sample fragments to respective non-transferred strands.

21. The method as defined in claim 18, wherein the DNA sample is introduced into the flow cell simultaneously with the pre-grafted particle solution at a temperature suitable for the tagmentation and for the amplification.

22. The method as defined in claim 18, wherein the pre-grafted particle solution is introduced into the flow cell before the DNA sample.

23. The method as defined in claim 22, wherein after the introduction of the DNA sample, the generation of the respective fully adapted DNA sample fragments from the respective partially adapted DNA sample fragments comprises: removing a transposase enzyme from each of the forked transposome complexes; and ligating 3’ ends the respective partially adapted DNA sample fragments to respective non-transferred strands.

24. The method as defined in any of claims 18-23, wherein the amplification generates a plurality of amplicons on the respective one of the at least some of the pre-grafted particles, and the method further comprises initiating a sequencing operation of the plurality of amplicons.

25. The method as defined in claim 24, further comprising removing the pre- grafted particles from the depressions after the sequencing operation.

26. The method as defined in any of claim 24 or claim 25, further comprising removing the first and second transposome complexes from each of the depressions.

27. The method as defined in 26, further comprising: immobilizing fresh first and second transposome complexes within first and second transposome complexes immobilized within each of the depressions; and repeating the method with a fresh DNA sample.

28. A kit, comprising: a flow cell including: depressions separated by interstitial regions; and forked transposome complexes immobilized within each of the depressions, the forked transposome complexes including: a transposon end with a portion of a transferred strand hybridized to a portion of a non-transferred strand, wherein the transferred strand includes a first amplification domain, and wherein the non-transferred strand includes a sequencing primer sequence, and a second amplification domain; and a transposase enzyme non-covalently bound to the transposon end; and a pre-grafted particle suspension, including: a liquid carrier; and pre-grafted particles including: a core; and first and second primers attached to the core, the first primer having a same sequence as the first amplification domain and the second primer having a complementary sequence to the second amplification domain.

29. The kit as defined in claim 28, wherein the flow cell further comprises a particle capture site within each of the depressions.

30. The kit as defined in any of 28 or claim 29, wherein the core of the pre-grafted particles is a polymeric hydrogel, and wherein the first and second primers are attached directly to the core.

31. The kit as defined in any of claim 28 or claim 29, wherein the core of the pre-grafted particles is a core material coated with a polymeric hydrogel coating, and wherein the first and second primers are attached directly to the polymeric hydrogel coating.

32. The kit as defined in any of claim 28-31, further comprising an amplification mix including a second liquid carrier, a strand-displacing polymerase, a recombinase, nucleotides, and a single stranded binding protein.

33. The kit as defined in any of claim 28-31, further comprising a ligation mix including a second liquid carrier, a gap fill ligation enzyme, and a DNA ligase.

34. A method, comprising: introducing a deoxyribonucleic acid (DNA) sample to a flow cell including: a lane; and first and second transposome complexes immobilized within the lane, the first transposome complexes including a first amplification domain and the second transposome complexes including a second amplification domain, whereby tagmentation generates respective partially adapted DNA sample fragments in the lane; generating respective fully adapted DNA sample fragments from the respective partially adapted DNA sample fragments; introducing a pre-grafted particle suspension to the flow cell, wherein the pre- grafted particle suspension includes: a liquid carrier; and pre-grafted particles including: a core; andfirst and second attached to the core, the first and second primers having a same sequence, respectively, as the first and second amplification domains, whereby at least some of the pre-grafted particles respectively attach within the lane; and initiating amplification such that, within the lane, some of the respective fully adapted DNA sample fragments are amplified on a respective one of the at least some of the pre-grafted particles.

35. A method, comprising: introducing a deoxyribonucleic acid (DNA) sample to a flow cell including: a lane; and forked transposome complexes immobilized within the lane, the forked transposome complexes including: a transposon end with a portion of a transferred strand hybridized to a portion of a non-transferred strand, wherein the transferred strand includes a first amplification domain, and wherein the non-transferred strand further includes a sequencing primer sequence and a second amplification domain; and a transposase enzyme non-covalently bound to the transposon end; whereby tagmentation generates respective partially adapted DNA sample fragments in the lane; generating respective fully adapted DNA sample fragments from the respective partially adapted DNA sample fragments; introducing a pre-grafted particle suspension to the flow cell, wherein the pre- grafted particle suspension includes: a liquid carrier; and pre-grafted particles including: a core; andfirst and second attached to the core, the first primer having a same sequence as the first amplification domain and the second amplification domain being complementary to the second primer, whereby at least some of the pre-grafted particles respectively attach within the lane; and initiating amplification such that, within the lane, some of the respective fully adapted DNA sample fragments are amplified on a respective one of the at least some of the pre-grafted particles.

Images