Immune cell microvesicle profiling for surveillance and treatment of donor transplant rejection

Abstract

The invention relates to methods for assessing conditional status, and for treating rejection, of a donor transplant in a subject. The methods comprise detecting and / or isolating and quantifying immune cell microvesicles and / or at least one immune cell microvesicle biomarker from one or more biological samples obtained from the subject.

Description

[0001]Attorney Docket No.047162-7412WO1(02347) IMMUNE CELL MICROVESICLE PROFILING FOR SURVEILLANCE AND TREATMENT OF DONOR TRANSPLANT REJECTION CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority under 35 U.S.C. § l 19(e) to U.S. Provisional Patent Application No.63 / 593,761, filed October 27, 2023, and to U.S. Provisional Patent Application No.63 / 643,572, filed May 7, 2024, each of which applications is hereby incorporated herein by reference in its entirety. REFERENCE TO AN ELECTRONIC SEQUENCE LISTING The present application contains a Sequence Listing which has been submitted in XML format via Patent Center and is hereby incorporated by reference in its entirety. Said XML file, created on Oct.22, 2024, is named 047162-7412WO1 Sequence Listing.xml and is 73,728 bytes in size. BACKGROUND OF THE INVENTION Allograft surveillance for acute cellular rejection (ACR) and antibody-mediated rejection (AMR) of transplanted organs mediated by recipient immune cells (i.e., T cells and B cells, respectively), remain a critical component of patient care, as acute rejection and immunosuppression related complications remain principal drivers of patient morbidity and mortality. Monitoring transplanted organ rejection is currently achieved using transplant tissue biopsy, an invasive technique that is not practical for frequent repeated testing. EMB is not conducive to serial testing at least because it is prone to variability in interpretation, resource intensive, expensive, and most importantly, may lead to procedural complications such as tricuspid valve injury and hemopericardium. In a recent meta-analysis reviewing literature on efficacy of T cell mediated rejection therapy in kidney transplant patients, the incidence of index subclinical acute rejection by biopsy was 30% and clinical biopsy proven acute rejection was noted in 16% of cases. Importantly, follow-up biopsy performed 2 to 9 months after initial treatment of biopsy-proven ACR showed a pooled proportion of persistent > Banff borderline acute rejection of 0.39 (95% CI 0.26-0.53), with higher proportion in pediatric (0.54) compared to adult (0.32) transplant patients. 1 53258724.1 Attorney Docket No.047162-7412WO1(02347) Furthermore, these assays are not validated in the immediate post-transplant period when highest rates of ACR are seen. In heart transplantation patients, monitoring of cardiac allografts for rejection remains a critical aspect of post-transplant patient care, as medical providers must keep vigilance in maintaining the perfect balance of adequate immunosuppression of T cell alloreactivity to ensure allograft quiescence and yet adjusting immunosuppression to minimize associated complications such as infection and malignancies, especially in the long term. Although the percentage of treated, clinically significant grade >2 ACR episodes has decreased over time from 30% to 15% in heart transplant patients, ACR still remains a major cause of morbidity and mortality during the first-year post-transplant. Endomyocardial biopsy (EMB) has remained the gold standard for allograft monitoring because it enables direct histological analysis of the allograft immune environment. However, EMB grading can be subjective and thus prone to inter-operator differences. Further, EMB is not practical for frequent repeated testing and it is invasive, costly, and associated with risks. Another drawback is that EMB does not enable individualized approach to titration of immunosuppression. As an alternative to transplant tissue biopsy, biomarker platforms such as peripheral blood mononuclear cell gene expression profiling and cell free DNA assays have made some in- roads. But these platforms have not replaced EMB and have limitations. Donor-derived cell free DNA assays are being tested for allograft monitoring in heart, lung, and kidney transplantation. Several such platforms have been reported, with sensitivity in the ~75% range and specificity in 85% range, with positive predictive value ranging from 8% to 20%. A significant drawback is that cell-free DNA assay has no utility during the first 30 days after transplant, when most acute rejection episodes occur. Furthermore, this assay does not enable noninvasive monitoring for efficacy of treatment of acute rejection episodes. Given these drawbacks, transplant tissue biopsy remains the gold standard for monitoring rejection of transplanted organs. There is an urgent and critical need in the art for new time-sensitive, accurate biomarker- based platforms for surveillance and diagnosis of transplant rejection. The present invention addresses this need. SUMMARY OF THE INVENTION In some aspects, the invention provides a method for assessing conditional status of a 2 53258724.1 Attorney Docket No.047162-7412WO1(02347) donor transplant in a subject, the method comprising: (i) obtaining and / or having obtained at least one biological sample from the subject post-transplant; (ii) detecting and / or isolating immune cell microvesicles and / or at least one immune cell microvesicle biomarker from the at least one biological sample; (iii) quantifying the amount and / or relative level of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker; and (iv) comparing the amount and / or relative level of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker in the at least one biological sample to a baseline value of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker; wherein the amount and / or relative level of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker in the at least one biological sample compared to the baseline value indicates the conditional status of the donor transplant. In some embodiments, the immune cell microvesicles are T cell microvesicles and / or B cell microvesicles. In some embodiments, obtaining and / or having obtained at least one biological sample from the subject comprises obtaining and / or having obtained biological samples from the subject at multiple timepoints post-transplant. In some embodiments, the baseline value is determined by quantifying the amount and / or relative level of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker from a reference biological sample obtained from the subject pre-transplant, on transplant day, or within about 1 day to within about 5 days post-transplant. In some embodiments, the quantified amount of the immune cell microvesicle biomarker is normalized to a quantified amount of a control biomarker to obtain the relative level of the immune cell microvesicle biomarker. In some embodiments, the at least one biological sample comprises plasma. In some embodiments, the conditional status indicates rejection of the donor transplant, tolerance of the donor transplant, or recovery from rejection of the donor transplant (e.g., after treatment of a rejection event). In some embodiments: 3 53258724.1 Attorney Docket No.047162-7412WO1(02347) (a) the immune cell is a T cell and the rejection is acute cellular rejection (ACR); or (b) the immune cell is a B cell and the rejection is antibody-mediated rejection (AMR). In some embodiments, the ACR is at least grade 2 ACR. In some embodiments: (a) the immune cell is a T cell and the detecting and / or isolating immune cell microvesicles comprises use of an anti-CD3 antibody; and / or (b) the immune cell is a B cell and the detecting and / or isolating immune cell microvesicles comprises use of an anti-CD19 antibody and / or an anti-CD38 antibody. In some embodiments, the method further comprises: (i) detecting and / or isolating donor cell microvesicles and / or at least one donor cell microvesicle biomarker from the at least one biological sample; (ii) quantifying the amount and / or relative level of the donor cell microvesicles and / or at least one donor cell microvesicle biomarker; and (iii) comparing the amount and / or relative level of the donor cell microvesicles and / or at least one donor cell microvesicle biomarker in the at least one biological sample to a baseline value of the donor cell microvesicles and / or at least one donor cell microvesicle biomarker; wherein the amount and / or relative level of the donor cell microvesicles and / or at least one donor cell microvesicle biomarker in the at least one biological sample compared to the baseline value indicates the conditional status of the donor transplant. In some embodiments, the baseline value is determined by quantifying the amount and / or relative level of the donor cell microvesicles and / or at least one donor cell microvesicle biomarker from a reference biological sample obtained from the subject pre-transplant, on transplant day, or within about 1 day to within about 5 days post-transplant. In some embodiments, the quantified amount of the donor cell biomarker is normalized to a quantified amount of a control biomarker to obtain the relative level of the donor cell biomarker. In some embodiments, the at least one immune cell microvesicle biomarker and / or the at least one donor cell microvesicle biomarker is a protein, a messenger RNA (mRNA), and / or a 4 53258724.1 Attorney Docket No.047162-7412WO1(02347) micro RNA. In some embodiments, the immune cell microvesicles and / or the donor cell microvesicles are characterized by a diameter of about 30 nm to about 400 nm, preferably wherein the diameter is 100 nm or less. In some embodiments, the donor transplant is an organ, tissue, or cells selected from the group consisting of heart, lung(s), kidney(s), liver, pancreas, pancreatic islet tissue(s), and pancreatic beta cells. In some embodiments, the donor transplant is heart or lung(s). In some embodiments, the method comprises quantifying the amount and / or relative level of the immune cell microvesicles and comparing the amount and / or relative level of the immune cell microvesicles to the baseline value, wherein an increase of at least about 40% in the amount and / or relative level of the immune cell microvesicles compared to the baseline value indicates rejection of the donor transplant in the subject. In some embodiments, the at least one immune cell microvesicle biomarker is selected from the group consisting of miR let7i, miR 21a, miR 101b, CD4 protein, CD4 mRNA, CD8 protein, CD8 mRNA, donor-specific T cell receptor (TCR) protein, interferon gamma (IFNγ) mRNA, CD19 mRNA, CD38 mRNA, CD38 protein, HLA-DR mRNA, HLA-DR protein, ICOSL mRNA, CD20 mRNA, IL6-R mRNA, and BAFF-R mRNA, or any combination thereof. In some embodiments: (a) the at least one immune cell microvesicle biomarker is miR let7i, miR 21a, and / or miR 101b, and the control biomarker is hsa miR 26; and / or (b) the at least one immune cell microvesicle biomarker is CD4 protein, CD8 protein, and / or donor-specific TCR protein, and the control biomarker is TSG101 protein. In some embodiments: (a) the at least one immune cell microvesicle biomarker is miR let7i and / or miR 21a, and the conditional status of the donor transplant is rejection when the relative level of the miR let7i and / or the miR 21a is at least about 4-fold greater than the baseline value; (b) the at least one immune cell microvesicle biomarker is miR 101b, and the conditional status of the donor transplant is rejection when the relative level of the miR 101b is at least about 3-fold greater than the baseline value; 5 53258724.1 Attorney Docket No.047162-7412WO1(02347) (c) the at least one immune cell microvesicle biomarker is CD4 protein, and the conditional status of the donor transplant is rejection when the relative level of the CD4 protein is at least about 2.2-fold greater than the baseline value; (d) the at least one immune cell microvesicle biomarker is CD8 protein, and the conditional status of the donor transplant is rejection when the relative level of the CD8 protein is at least about 2.5-fold greater than the baseline value; and / or (e) the at least one immune cell microvesicle biomarker is donor-specific TCR protein, and the conditional status of the donor transplant is rejection when the relative level of the donor-specific TCR protein is at least about 2.2-fold greater than the baseline value. In some embodiments, the donor transplant is heart, and the at least one donor cell microvesicle biomarker is selected from the group consisting of Troponin T protein, Troponin T mRNA, Troponin I protein, and Troponin I mRNA, or any combination thereof. In some embodiments: (a) the at least one donor cell microvesicle biomarker is Troponin T protein and the control biomarker is TSG101 protein; and / or (b) the at least one donor cell microvesicle biomarker is Troponin T mRNA and the control biomarker is GAPDH mRNA. In some embodiments: (a) the at least one donor cell microvesicle biomarker is Troponin T protein, and the conditional status of the donor transplant is rejection when the relative level of the Troponin T protein is at least about 40% less than the baseline value; and / or (b) the at least one donor cell microvesicle biomarker is Troponin T mRNA, and the conditional status of the donor transplant is rejection when the relative level of the Troponin T mRNA is at least about 60% less than the baseline value. In some embodiments, the donor transplant is lung(s), and: (a) the immune cell is a T cell and the at least one immune cell microvesicle biomarker is CD8 mRNA, IFNγ mRNA, HLA-DR mRNA, or any combination thereof; and / or (b) the immune cell is a B cell and the at least one immune cell microvesicle biomarker is CD19 mRNA, CD20 mRNA, CD38 mRNA, IL6-R mRNA, BAFF-R 6 53258724.1 Attorney Docket No.047162-7412WO1(02347) mRNA, IFNγ mRNA, HLA-DR mRNA, ICOSL mRNA, or any combination thereof. In some aspects, the invention provides a method of treating rejection of a donor transplant in a subject, the method comprising: (i) obtaining and / or having obtained at least one biological sample from the subject post-transplant; (ii) detecting and / or isolating immune cell microvesicles and / or at least one immune cell microvesicle biomarker from the at least one biological sample; (iii) quantifying the amount and / or relative level of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker; and (iv) determining the conditional status of the donor transplant, wherein the determining comprises comparing the amount and / or relative level of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker in the at least one biological sample to a baseline value of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker; wherein the amount and / or relative level of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker in the at least one biological sample compared to the baseline value indicates the conditional status of the donor transplant; (v) administering an effective amount of a rejection therapy to the subject when the conditional status indicates rejection of the donor transplant; and / or (vi) stopping administration of the rejection therapy when the conditional status indicates recovery from rejection of the donor transplant. In some embodiments, the immune cell microvesicles are T cell microvesicles and / or B cell microvesicles. In some embodiments, obtaining and / or having obtained at least one biological sample from the subject comprises obtaining and / or having obtained biological samples from the subject at multiple timepoints post-transplant. In some embodiments, the baseline value is determined by quantifying the amount and / or relative level of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker from a reference biological sample obtained from the subject pre-transplant, on 7 53258724.1 Attorney Docket No.047162-7412WO1(02347) transplant day, or within about 1 day to within about 5 days post-transplant. In some embodiments, the quantified amount of the immune cell microvesicle biomarker is normalized to a quantified amount of a control biomarker to obtain the relative level of the immune cell microvesicle biomarker. In some embodiments, the at least one biological sample comprises plasma. In some embodiments: (a) the immune cell is a T cell and the rejection is acute cellular rejection (ACR); and / or (b) the immune cell is a B cell and the rejection is antibody-mediated rejection (AMR). In some embodiments, the ACR is at least grade 2 ACR. In some embodiments: (a) the rejection is ACR and the rejection therapy comprises any one or more of bolus intravenous steroids, mycophenolate mofetil, and thymoglobulin therapy; and / or (b) the rejection is AMR and the rejection therapy comprises an anti-CD20 antibody (e.g., rituximab or ofatumumab). In some embodiments: (a) the immune cell is a T cell and the detecting and / or isolating immune cell microvesicles comprises use of an anti-CD3 antibody; and / or (b) the immune cell is a B cell and the detecting and / or isolating immune cell microvesicles comprises use of an anti-CD19 antibody and / or an anti-CD38 antibody. In some embodiments, the method further comprises: (i) detecting and / or isolating donor cell microvesicles and / or at least one donor cell microvesicle biomarker from the at least one biological sample; (ii) quantifying the amount and / or relative level of the donor cell microvesicles and / or at least one donor cell microvesicle biomarker; and (iii) comparing the amount and / or relative level of the donor cell microvesicles and / or at least one donor cell microvesicle biomarker in the at least one biological sample to a baseline value of the donor cell microvesicles and / or at least one donor cell microvesicle biomarker; wherein the amount and / or relative level of 8 53258724.1 Attorney Docket No.047162-7412WO1(02347) the donor cell microvesicles and / or at least one donor cell microvesicle biomarker in the at least one biological sample compared to the baseline value indicates the conditional status of the donor transplant. In some embodiments, the baseline value is determined by quantifying the amount and / or relative level of the donor cell microvesicles and / or at least one donor cell microvesicle biomarker from a reference biological sample obtained from the subject pre-transplant, on transplant day, or within about 1 day to within about 5 days post-transplant. In some embodiments, the quantified amount of the donor cell biomarker is normalized to a quantified amount of a control biomarker to obtain the relative level of the donor cell biomarker. In some embodiments, the at least one immune cell microvesicle biomarker and / or the at least one donor cell microvesicle biomarker is a protein, a messenger RNA (mRNA), and / or a micro RNA. In some embodiments, the immune cell microvesicles and / or the donor cell microvesicles are characterized by a diameter of about 30 nm to about 400 nm, preferably wherein the diameter is 100 nm or less. In some embodiments, the donor transplant is selected from the group consisting of heart, lung(s), kidney(s), liver, pancreas, pancreatic islet tissue(s), and pancreatic beta cells. In some embodiments, the donor transplant is heart or lung(s). In some embodiments, the method comprises quantifying the amount and / or relative level of the immune cell microvesicles and comparing the amount and / or relative level of the immune cell microvesicles to the baseline value, wherein an increase of at least about 40% in the amount and / or relative level of the immune cell microvesicles compared to the baseline value indicates rejection of the donor transplant in the subject. In some embodiments, the at least one immune cell microvesicle biomarker is selected from the group consisting of miR let7i, miR 21a, miR 101b, CD4 protein, CD4 mRNA, CD8 protein, CD8 mRNA, donor-specific T cell receptor (TCR) protein, interferon gamma (IFNγ) mRNA, CD19 mRNA, CD38 mRNA, CD38 protein, HLA-DR mRNA, HLA-DR protein, ICOSL mRNA, CD20 mRNA, IL6-R mRNA, BAFF-R mRNA, and any combination thereof. In some embodiments: (a) the at least one immune cell microvesicle biomarker is miR let7i, miR 21a, and / or 9 53258724.1 Attorney Docket No.047162-7412WO1(02347) miR 101b, and the control biomarker is hsa miR 26; and / or (b) the at least one immune cell microvesicle biomarker is CD4 protein, CD8 protein, and / or donor-specific TCR protein, and the control biomarker is TSG101 protein. In some embodiments: (a) the at least one immune cell microvesicle biomarker is miR let7i and / or miR 21a, and the conditional status of the donor transplant is rejection when the relative level of the miR let7i and / or the miR 21a is at least about 4-fold greater than the baseline value; (b) the at least one immune cell microvesicle biomarker is miR 101b, and the conditional status of the donor transplant is rejection when the relative level of the miR 101b is at least about 3-fold greater than the baseline value; (c) the at least one immune cell microvesicle biomarker is CD4 protein, and the conditional status of the donor transplant is rejection when the relative level of the CD4 protein is at least about 2.2-fold greater than the baseline value; (d) the at least one immune cell microvesicle biomarker is CD8 protein, and the conditional status of the donor transplant is rejection when the relative level of the CD8 protein is at least about 2.5-fold greater than the baseline value; and / or (e) the at least one immune cell microvesicle biomarker is donor-specific TCR protein, and the conditional status of the donor transplant is rejection when the relative level of the donor-specific TCR protein is at least about 2.2-fold greater than the baseline value. In some embodiments, the donor transplant is heart, and the at least one donor cell microvesicle biomarker is selected from the group consisting of Troponin T protein, Troponin T mRNA, Troponin I protein, and Troponin I mRNA, or any combination thereof. In some embodiments: (a) the at least one donor cell microvesicle biomarker is Troponin T protein and the control biomarker is TSG101 protein; (b) the at least one donor cell microvesicle biomarker is Troponin T mRNA and the control biomarker is GAPDH mRNA. In some embodiments: (a) the at least one donor cell microvesicle biomarker is Troponin T protein, and the 10 53258724.1 Attorney Docket No.047162-7412WO1(02347) conditional status of the donor transplant is rejection when the relative level of the Troponin T protein is at least about 40% less than the baseline value; and / or (b) the at least one donor cell microvesicle biomarker is Troponin T mRNA, and the conditional status of the donor transplant is rejection when the relative level of the Troponin T mRNA is at least about 60% less than the baseline value. In some embodiments, the donor transplant is lung(s), and: (a) the immune cell is a T cell and the at least one immune cell microvesicle biomarker is CD8 mRNA, IFNγ mRNA, HLA-DR mRNA, or any combination thereof; and / or (b) the immune cell is a B cell and the at least one immune cell microvesicle biomarker is CD19 mRNA, CD20 mRNA, CD38 mRNA, IL6-R mRNA, BAFF-R mRNA, IFNγ mRNA, HLA-DR mRNA, ICOSL mRNA, or any combination thereof. BRIEF DESCRIPTION OF THE DRAWINGS The following detailed description of preferred embodiments of the invention will be better understood when read in conjunction with the appended drawings. For the purpose of illustrating the invention, non-limiting illustrative embodiments are shown in the drawings. It should be understood, however, that the invention is not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings. FIG.1 is a schematic of the study design and development of T cell sEV platform. Three study arms were designed to ascertain circulating T cell small extracellular microvesicle (sEV) profiles in heterotopic heart transplantation model. In Maintenance arm, BALB / c heart was transplanted into T cell and B cell immunodeficient C57BL / 6 PrkdcSCIDrecipient to assess for nonspecific CD3 sEV signal and donor passenger T cell sEV signal in recipient blood. In Rejection arm, BALB / c [H2-kd] heart was transplanted into wild type C57BL / 6 [H2-kb] recipient across full MHC mismatch, which reliably leads to ACR mediated allograft asystole by day 12 to 14. In Control arm, syngeneic C57BL / 6 into C57BL / 6 transplant was performed to assess for changes in circulating T cell sEV signal from isograft transplantation. FIGs.2A – 2C illustrate the finding that Jurkat T cells release sEVs expressing exosome markers and T cell markers into culture supernatant. Jurkat T cells were studied to assess 11 53258724.1 Attorney Docket No.047162-7412WO1(02347) whether T cells release sEVs with specific markers. FIG.2A is an NTA plot (scatter mode) of sEVs from Jurkat T cells supernatant is shown, along with mean sEV size, quantity and concentration of particles per μg of protein (n=10). FIG.2B is a wide field electron microscopy image of Jurkat T cell sEVs. FIG.2C is a Western blot of Jurkat sEVs showing expression of exosome markers TSG101, CD63, flotillin-1, and T cell markers CD4, CD8, and TCR. Jurkat sEVs were also checked for absence of expression of calnexin and cytochrome c per MISEV guidelines. FIGs.3A – 3F illustrate the finding that ACR leads to time specific changes in circulating T cell sEVs. FIG.3A: NTA image plots of isolated plasma sEVs from post-transplant time points in all 3 study arms, along with mean sEV size, and quantity (# particles / μg sEV protein). FIG.3B: Electron microscopy of plasma sEVs from day 7 post-transplant in Control, Rejection, and Maintenance arms. FIG.3C: Western blot of plasma sEVs was performed for expression of exosome markers CD63, flotillin-1, and TSG101, with absence of cytochrome c, calnexin, and apolipoprotein E per MISEV guidelines. FIG.3D: CD3-expressing T cell sEV subset signal (red) compared to the total plasma sEV pool (blue) on the NTA fluorescence mode is shown for animal receiving syngeneic transplant (Control arm). Percentage nanoparticles positive for CD3 expression is also shown. FIG.3E: Circulating CD3-expressing T cell sEV subset signal over serial time points in one animal undergoing heart transplantation in the Maintenance arm is shown. Naive wild type C57BL / 6 plasma sEVs and IgG isotype control are also shown. FIG.3F: CD3 sEV signal in total plasma sEV pool from a single recipient animal over serial follow-up after full MHC mismatch heart transplant is shown (Rejection arm); along with naive, wild type control and IgG isotype control. Anti-CD3ε antibody conjugated quantum dot was utilized for T cell sEV subset quantitation on the NTA fluorescence mode. Time specific changes in the T cell sEV signal was seen only in the Rejection arm recipient animal. FIGs.4A – 4F illustrates the finding that circulating T cell sEV signal heralds early ACR. FIG.4A: Scatter plot of circulating T cell sEV quantitative signal in the total plasma sEV pool is shown for the Maintenance (black) and Rejection (red) study arms. Each data point represents a sacrificed animal for the respective postoperative time point. In the Maintenance arm, slight increase in CD3 sEV signal was seen on PODs 1 and 2, after which the signal remained at baseline, pre-heart transplant (pre-HTP) levels. In Control arm, plasma CD3 sEV signal also unchanged, similar to baseline signal (data not shown). Whereas, with ACR in the 12 53258724.1 Attorney Docket No.047162-7412WO1(02347) Rejection arm, time specific increase in the T cell sEV signal was noted that persisted throughout the rejection process and returned to pre-HTP levels upon completion of allograft rejection. By ANOVA, CD3 sEV signal was significantly different in the Rejection arm in a time dependent manner (p<0.001) but was unchanged in the Maintenance arm (p=0.431). FIG.4B: In the Control and Rejection arms, peripheral blood B cells (CD19 + B220+) and CD3+ T cell counts and their subpopulations, CD3+ CD4+ T cells and CD3+ CD8+ T cells, were analyzed by FACS to assess whether the changes in circulating T cell sEV signal in Rejection arm reflected concomitant changes in circulating T cell numbers during ACR. Day 0 versus day 7 samples were analyzed as peak CD3 sEV signal was noted on day 7. Gating strategy for FACS is shown for one of 5 experiments in each study arm. In 3 animals, Sham operation was performed, where the animal’s abdomen was opened and the aorta and inferior vena cava were clamped and then released, and then the abdomen was closed. The animal was then sacrificed to assess for changes in circulating T cell numbers. FIG.4C: Representative FACS results for the Control arm. The numbers of peripheral blood B cell and T cells, and their CD4+ and CD8+ T cell subpopulations were similar in the Control versus Rejection study arms. FIG.4D: Representative FACS results for the Rejection arm. The numbers of peripheral blood B cell and T cells, and their CD4+ and CD8+ T cell subpopulations were similar in the Control versus Rejection study arms. FIG.4E: Representative FACS results for the Sham Operation. FIG.4F: Scatter plot analysis of the results of FACS analysis for peripheral blood B cells and T cells is shown for animals sacrificed on POD 0 (4 hours after transplant) versus POD 7 (n=5 animals in each study arm for each time point). On day 7 when the animal was sacrificed, peripheral blood (n=5) and IVC blood near the heterotopically transplanted heart (n=5) were analyzed by FACS. By two-way repeated measures ANOVA, number of circulating CD3+ T cells and their CD4 and CD8 T cell subpopulations were similar between the Rejection and Control arms on POD 0 and POD 7. FIGs.5A – 5D illustrate the finding that ACR leads to changes in T cell sEV cargoes reflecting an alloreactivity profile. FIG.5A: Schematic for purification of circulating T cell EVs is shown. Given the noted time course of T cell EV signal during ACR, characterization of T cell sEV cargoes from days 4 and 7 after transplantation was performed. FIG.5B: Western blot of anti-CD3 antibody bead unbound sEV fraction was performed for confirmation of absence of CD3, CD4, and CD8 proteins as quality control. Jurkat cell positive control is also shown. Representative one of 3 experiments is shown. FIG.5C: Anti-CD3 antibody bead-bound sEVs 13 53258724.1 Attorney Docket No.047162-7412WO1(02347) were eluted and analyzed on NTA to confirm that intact nanoparticles in the sEV size range were being enriched using this methodology. Typically, when starting with 1x1010sEVs as starting material, the resulting eluted bead-bound sEVs representing the enriched T cell sEV fraction yielded ~ 1-1.5 x108sEVs, suggesting that the T cell sEV signal was being enriched between 66 to 100-fold compared to total plasma sEV analysis. Summary data for 5 independent experiments performed for Rejection arm POD 7 is shown. FIG.5D: Western blot analysis of T cell sEV protein cargoes revealed upregulation of several T cell activation markers including IFNγ, Serca 2, CD4, and TCR. Upregulation of these markers was noted in day 7 versus day 4 samples in Rejection arm but not Control arm. FoxP3 expression was also noted, indicating a regulatory T cell contribution to circulating T cell sEV subpopulation. Plasma sEVs from naive, wild type C57BL / 6 is also shown to confirm that at the baseline, pre-transplant setting, T cell markers are not readily detectable in plasma sEVs. Flotillin-1 is an exosome marker. One of 3 experiments is shown. FIG.5E: RT-PCR of T cell sEV mRNA showed upregulation of T cell activation markers in day 7 versus 4 samples in Rejection arm but not Control arm. CD3ε, TCR, IFNγ, and IL2 expression along with β-actin control is shown (1 of 3 experiments). FIG.5F: T cell sEV cargo expression from syngeneic transplants in Control arm showed low level detection of T cell markers CD4 and TCR, without any changes in expression over serial follow-up. Flotillin-1 is an exosome marker. C57BL / 6 wild type plasma control is shown as control, along with Jurkat cells as positive control. One of 3 experiments is shown. FIGs.6A – 6F illustrate the finding that T cell sEV miRNA cargo profiles reflect alloactivation state. FIG.6A: Principal component analysis plot of Rejection arm day 4 and day 7 CD3 sEV NGS samples showed distinct miRNA cargo populations. FIG.6B: Volcano plot of fold change vs. p-value revealed differentially expressed miRNAs from day 4 to day 7. miRNAs upregulated in day 4 and 7 are highlighted in blue and orange, respectively. FIG.6C: Heatmap of top 31 differentially expressed miRNAs (|fc| > 2, p<0.15) is shown. miRNA expression was normalized (counts per millions), with hierarchical clustering computed using Euclidean distance method. FIG.6D: Pathway analysis of differentially regulated miRNA gene targets in days 4 versus 7 is shown. miRNA gene targets for the top 31 differentially expressed miRNAs were determined using miRTarBase. String-db was used to examine fit of miRNA gene targets to GO biological process pathways. Various immune system processes (blue bars) and apoptotic pathways (red bars) were enriched (FDR < 0.05). FIG.6E: Venn diagrams of enriched apoptosis 14 53258724.1 Attorney Docket No.047162-7412WO1(02347) and immune-specific GO biological processes for day 4 and day 7 upregulated miRNA gene targets is shown. Day 4 showed upregulation miRNAs targeting genes involved in immune response pathways and day 7 showed miRNAs targeting genes associated with apoptosis pathways. FIG.6F: Bar plot of genes targeted by multiple differentially expressed miRNAs. Gene targets of miRNAs upregulated in day 4 and day 7 are shaded in blue and orange, respectively. Only gene targets with >1 miRNA hit are shown. FIGs.7A – 7C show results for T cell EV stem loop RT-qPCR assays for 3 candidate miRNA biomarkers determined by NGS differential expression. Animals from Rejection (n=5) and Control (n=5) arms were sacrificed on POD 7 and RNA from CD3 sEVs was extracted and analyzed for miRNA expression levels by stem loop RT-qPCR. Average relative fold expression with 95% confidence interval in the Control arm compared to Rejection arm is shown. FIG.7A: CD3 sEV stem loop RT-qPCR assay results for let 7i. By t test, let 7i (p=0.03) expression was significantly higher in T cell sEVs with allograft rejection versus syngeneic controls. FIG.7B: CD3 sEV stem loop RT-qPCR assay results for miR 21a. By t test, miR 21a (p=0.046) expression was significantly higher in T cell sEVs with allograft rejection versus syngeneic controls. FIG.7C: CD3 sEV stem loop RT-qPCR assay results for miR 101b. miR 101b showed a higher level of expression but was not significant (p=0.23). FIGs.8A – 8J illustrate the finding that circulating T cell sEVs enriched from Rejection arm animals independently mediate donor cardiomyocyte specific cytotoxicity. FIG.8A: Schematic of plasma components analyzed for potential to mediate donor cardiomyocyte cytotoxicity is shown. Total plasma sEVs from POD 7 in Rejection and Control arms was harvested. From this, T cell sEVs were enriched using anti-CD3 antibody beads. The unbound sEVs with the plasma secretome was then ultracentrifuged to obtain the secretome and unbound sEV fraction. For apoptosis assay, donor BALB / c cardiomyocytes or recipient C57BL / 6 cardiomyocytes were incubated with the following isolated fractions from either the Rejection arm or Control arm: total plasma sEVs (1x1010 sEVs), CD3 sEVs (bound fraction) (1.5x108 sEVs), bead unbound sEVs, and remnant secretome. FIG.8B: Confocal microscopy images of TUNEL assay for BALB / c cells incubated with Control arm total plasma sEVs, CD3 sEVs, unbound sEVs, and secretome failed to show apoptosis. FIG.8C: BALB / c cells incubated with Rejection arm total plasma sEVs and CD3 sEVs showed >45% apoptosis, but minimal (<6%) apoptosis was seen with unbound sEVs and secretome.. FIG.8D: C57BL / 6 cells incubated with 15 53258724.1 Attorney Docket No.047162-7412WO1(02347) Control arm plasma components showed <5% apoptosis. FIG.8E: C57BL / 6 cells incubated with Rejection arm plasma sEVs, CD3 sEVs, unbound sEVs, and secretome failed to show any apoptosis. FIG.8F: BALB / c cells treated with DNase I (positive control) showed near 100% apoptosis. FIG.8G: C57BL / 6 cells treated with DNase I showed >97% apoptosis (positive control). FIG.8H: Summary of apoptosis assay is shown. Results of 2 independent experiments with percentage of apoptosis positive cells is displayed. By Fisher exact test, apoptosis rates were significantly higher in BALB / c cells treated with Rejection arm CD3 sEVs compared to all other tested conditions (p<0.0001), except similar apoptosis rates seen between Rejection arm total plasma sEVs and CD3 sEVs (p=0.28). FIG.8I: CD3 sEVs from C57BL / 6 wild type, BALB / c wild type, Control arm day 7, and Rejection arm day 7 were assessed for expression of pro- apoptotic proteins known to be critical for T cell mediated cytotoxicity. All study groups showed expression of Fas ligand (FasL), perforin-1, granzyme B, TCR, CD38, MHC II, but higher levels of these pro-apoptotic markers and activation markers were seen in the Rejection arm. Flotillin-1 and TSG101 are exosome markers. One of two experiments is shown. FIG.8J: Relative expression of pro-apoptotic markers and activation markers normalized to expression of exosome marker TSG101 is shown. Rejection arm recipients showed higher expression of these markers in their circulating T cell sEVs. FIGs.9A – 9L illustrate the finding that circulating T cell sEVs can be enriched in heart transplant patients. sEVs were isolated from heart transplant patient (n=3) peripheral blood samples (n=14) at different time points post-transplant. Sample collection was time-matched to endomyocardial biopsy, the results of which are shown next to POD time point. FIG.9A: Electron microscopy of plasma sEVs in Subject 2 is shown. FIG.9B: NTA light scatter analysis of sEVs isolated in Subjects 1-3 is shown with mean particle concentration and size. FIG.9C: sEV protein markers were assessed by Western blot for expression of exosome markers TSG101, flotillin-1, CD63, Alix-1, and for absence of cytochrome c, calnexin-1, and ApoE, per MISEV guidelines. Representative Western blot for Subject 2 is shown. FIG.9D: CD3 sEVs were enriched from plasma sEVs using anti-CD3 antibody conjugated beads, and the bead bound fraction was eluted and analyzed on NTA to confirm enrichment of intact sEVs. Representative NTA for 3 time points (PODs 1, 13, and 98) in Subject 2 is shown with particle number and size distribution. Given that the initial amount was 1x1010sEVs for bead isolation and between 0.9 to 1.4x108sEVs were eluted as enriched T cell sEV fraction, it represents potential enrichment of T 16 53258724.1 Attorney Docket No.047162-7412WO1(02347) cell sEV signal by ~ 60 to 100-fold compared to whole plasma sEV analysis. FIG.9E: Western blot analysis of CD3 antibody bead bound sEVs was performed to validate expression of T cell markers. Representative analysis for Subject 2, PODs 1, 13, and 98 is shown along with Jurkat cell positive control for expression of CD8 in the T cell sEV fraction. Flotillin-1, exosome marker expression is also shown. FIG.9F: Western blot analysis of CD3 antibody unbound sEVs was performed to validate absence of T cell markers. Representative analysis for Subject 2 at 3 postoperative time points is shown for expression of CD3 and flotillin-1. CD3 expression was not seen in the unbound sEV fraction, but flotillin-1 (exosome marker) expression was detected. Jurkat EVs and Jurkat cell positive controls are shown. FIG.9G: Western blot analysis of T cell sEVs in Subject 1 for expression of T cell inflammatory and proapoptotic proteins is shown, including perforin-1, granzyme B, IFNγ, Fas L, CD38, and MHC II (HLA-DR). EMB histology data (ACR 0 versus 1 versus 2) is also shown. Grade 2 ACR by EMB correlated with increased expression of these T cell activation marker proteins. Flotillin-1 is an exosome marker protein. FIG.9H: Western blot analysis of T cell sEVs in Subject 2 for expression of T cell inflammatory and proapoptotic proteins is shown, including perforin-1, granzyme B, IFNγ, Fas L, CD38, and MHC II (HLA-DR). EMB histology data (ACR 0 versus 1 versus 2) is also shown. Grade 2 ACR by EMB correlated with increased expression of these T cell activation marker proteins. Flotillin-1 is an exosome marker protein. FIG.9I: Western blot analysis of T cell sEVs in Subject 3 for expression of T cell inflammatory and proapoptotic proteins is shown, including perforin-1, granzyme B, IFNγ, Fas L, CD38, and MHC II (HLA-DR). EMB histology data (ACR 0 versus 1 versus 2) is also shown. Grade 2 ACR by EMB correlated with increased expression of these T cell activation marker proteins. Flotillin-1 is an exosome marker protein. FIG.9J: Stem loop RT-qPCR for miR let 7i, miR 21a, and miR 101b expression in T cell sEVs in Subject 1 at EMB-matched postoperative time points is shown. Relative expression of candidate miRNAs compared to POD 1 baseline (set to 1) is shown. Correlation of miRNA expression with EMB histology data showed increased expression of these miRNAs in T cell sEV fraction at time points of grade 2 ACR. FIG.9K: Stem loop RT-qPCR for miR let 7i, miR 21a, and miR 101b expression in T cell sEVs in Subject 2 at EMB-matched postoperative time points is shown. Relative expression of candidate miRNAs compared to POD 1 baseline (set to 1) is shown. Correlation of miRNA expression with EMB histology data showed increased expression of these miRNAs in T cell sEV fraction at time points of grade 2 ACR. FIG.9L: Stem loop RT- 17 53258724.1 Attorney Docket No.047162-7412WO1(02347) qPCR for miR let 7i, miR 21a, and miR 101b expression in T cell sEVs in Subject 3 at EMB- matched postoperative time points is shown. Relative expression of candidate miRNAs compared to POD 1 baseline (set to 1) is shown. Correlation of miRNA expression with EMB histology data showed increased expression of these miRNAs in T cell sEV fraction at time points of grade 2 ACR. FIG.10 is a schematic of T cell EV mediated targeted suppression of donor heart cardiomyocytes.1) Transplanted heart cardiomyocytes immediately release EVs into the blood stream that localize to secondary lymphoid organs, including regional lymph nodes.2) Donor EVs promote alloantigen recognition and activation of T cell clones via semi-direct pathway, along with direct and indirect pathway-based activation.3) While alloreactive T cell clones proliferate in the regional lymph nodes, they release EVs with TCR specific to the donor cardiomyocytes into the peripheral blood.4) These EVs localize to the allograft cardiomyocytes. 5) T cell EVs also bind to donor cardiomyocyte EVs in peripheral circulation, potentially facilitating their clearance.6) T cell EVs bind to donor cardiomyocytes and initiate targeted injury, including suppression of EV release by the donor heart. Both these processes lead to decrease in donor EV signal in peripheral blood early during ACR.7) T cell EVs carrying pro- inflammatory cytokines and pro-apoptotic markers mediate changes in the local immune environment in the donor heart tissue that contributes to the ACR process, and possibly facilitates migration of alloreactive T cells to the allograft.8) At a later timepoint, proliferated T cell clones egress out of the regional lymph nodes and migrate to the donor heart tissue to potentiate targeted cytotoxicity. FIG.11 is a table of the antibodies used in the experiments disclosed herein. FIG.12 is a table providing clinical information in the 3 heart transplant patients with grade 2 ACR episodes. Grade >2 ACR episodes were treated with additional immunosuppression as detailed in the table. University of Pennsylvania Surveillance EMB Schedule during study period: EMB weeks 1, 2, 4, 6, 8, and every 2 weeks until week 12-16 based on whether patient has any grade > 2 ACR episodes, and then monthly EMB until 1stannual visit. After 1stannual visit, surveillance EMB every 3 months during 2ndyear post-transplant until 2ndannual visit. No surveillance EMB after 2ndannual visit, only for-cause EMB. FIGs.13A – 13C are tables showing stem loop RT-qPCR assay results for quantitation of miRNAs let 7i, miR 101b, and miR 21a in circulating T cell EVs in 3 heart transplant patients. 18 53258724.1 Attorney Docket No.047162-7412WO1(02347) POD: postoperative day, SD: standard deviation. FIG.13A: stem loop RT-qPCR assay results for Patient 1. FIG.13B: stem loop RT-qPCR assay results for Patient 2. FIG.13C: stem loop RT-qPCR assay results for Patient 3. FIG.14 shows data demonstrating time specific down regulation of cardiac troponin T protein and mRNA cargoes in donor heart EVs from recipient circulation in the rodent heart transplant ACR model. FIGs.14A – 14H show results of cargo analysis for all eight candidate biomarkers in Patient 1. Key: green diamond = no ACR, blue + sign = grade 1 ACR, red star = grade 2 ACR, and pink triangle = time point where bolus immunosuppression was given for grade 2 ACR detection by endomyocardial biopsy. POD = postoperative day. FIG.14A: Troponin T protein results from donor heart EVs. FIG.14B: Troponin T mRNA results from donor heart EVs. FIG. 14C: CD4 protein results from recipient T cell EVs. FIG.14D: CD8 protein results from recipient T cell EVs. FIG.14E: TCR protein results from recipient T cell EVs. FIG.14F: miR Let 7i results from recipient T cell EVs. FIG.14G: miR 101b results from recipient T cell EVs. FIG.14H: miR 21a results from recipient T cell EVs. FIGs.15A – 15H show results of cargo analysis for all eight candidate biomarkers in Patient 2. Key: green diamond = no ACR, blue + sign = grade 1 ACR, red star = grade 2 ACR, and pink triangle = time point where bolus immunosuppression was given for grade 2 ACR detection by endomyocardial biopsy. POD = postoperative day. FIG.15A: Troponin T protein results from donor heart EVs. FIG.15B: Troponin T mRNA results from donor heart EVs. FIG. 15C: CD4 protein results from recipient T cell EVs. FIG.15D: CD8 protein results from recipient T cell EVs. FIG.15E: TCR protein results from recipient T cell EVs. FIG.15F: miR Let 7i results from recipient T cell EVs. FIG.15G: miR 101b results from recipient T cell EVs. FIG.15H: miR 21a results from recipient T cell EVs. FIGs.16A – 16H show results of cargo analysis for all eight candidate biomarkers in Patient 3. Key: green diamond = no ACR, blue + sign = grade 1 ACR, red star = grade 2 ACR, and pink triangle = time point where bolus immunosuppression was given for grade 2 ACR detection by endomyocardial biopsy. POD = postoperative day. FIG.16A: Troponin T protein results from donor heart EVs. FIG.16B: Troponin T mRNA results from donor heart EVs. FIG. 16C: CD4 protein results from recipient T cell EVs. FIG.16D: CD8 protein results from recipient T cell EVs. FIG.16E: TCR protein results from recipient T cell EVs. FIG.16F: miR 19 53258724.1 Attorney Docket No.047162-7412WO1(02347) Let 7i results from recipient T cell EVs. FIG.16G: miR 101b results from recipient T cell EVs. FIG.16H: miR 21a results from recipient T cell EVs. FIGs.17A – 17H show results of cargo analysis for all eight candidate biomarkers in Patient 4. Key: green diamond = no ACR, blue + sign = grade 1 ACR, red star = grade 2 ACR, and pink triangle = time point where bolus immunosuppression was given for grade 2 ACR detection by endomyocardial biopsy. POD = postoperative day. FIG.17A: Troponin T protein results from donor heart EVs. FIG.17B: Troponin T mRNA results from donor heart EVs. FIG. 17C: CD4 protein results from recipient T cell EVs. FIG.17D: CD8 protein results from recipient T cell EVs. FIG.17E: TCR protein results from recipient T cell EVs. FIG.17F: miR Let 7i results from recipient T cell EVs. FIG.17G: miR 101b results from recipient T cell EVs. FIG.17H: miR 21a results from recipient T cell EVs. FIGs.18A – 18H show results of cargo analysis for all eight candidate biomarkers in Patient 5. Key: green diamond = no ACR, blue + sign = grade 1 ACR, red star = grade 2 ACR, and pink triangle = time point where bolus immunosuppression was given for grade 2 ACR detection by endomyocardial biopsy. POD = postoperative day. FIG.18A: Troponin T protein results from donor heart EVs. FIG.18B: Troponin T mRNA results from donor heart EVs. FIG. 18C: CD4 protein results from recipient T cell EVs. FIG.18D: CD8 protein results from recipient T cell EVs. FIG.18E: TCR protein results from recipient T cell EVs. FIG.18F: miR Let 7i results from recipient T cell EVs. FIG.18G: miR 101b results from recipient T cell EVs. FIG.18H: miR 21a results from recipient T cell EVs. FIGs.19A – 19H show results of cargo analysis for all eight candidate biomarkers in Patient 6. Key: green diamond = no ACR, blue + sign = grade 1 ACR, red star = grade 2 ACR, and pink triangle = time point where bolus immunosuppression was given for grade 2 ACR detection by endomyocardial biopsy. POD = postoperative day. FIG.19A: Troponin T protein results from donor heart EVs. FIG.19B: Troponin T mRNA results from donor heart EVs. FIG. 19C: CD4 protein results from recipient T cell EVs. FIG.19D: CD8 protein results from recipient T cell EVs. FIG.19E: TCR protein results from recipient T cell EVs. FIG.19F: miR Let 7i results from recipient T cell EVs. FIG.19G: miR 101b results from recipient T cell EVs. FIG.19H: miR 21a results from recipient T cell EVs. FIGs.20A – 20H show results of cargo analysis for all eight candidate biomarkers in Patient 7. Key: green diamond = no ACR, blue + sign = grade 1 ACR, red star = grade 2 ACR, 20 53258724.1 Attorney Docket No.047162-7412WO1(02347) and pink triangle = time point where bolus immunosuppression was given for grade 2 ACR detection by endomyocardial biopsy. POD = postoperative day. FIG.20A: Troponin T protein results from donor heart EVs. FIG.20B: Troponin T mRNA results from donor heart EVs. FIG. 20C: CD4 protein results from recipient T cell EVs. FIG.20D: CD8 protein results from recipient T cell EVs. FIG.20E: TCR protein results from recipient T cell EVs. FIG.20F: miR Let 7i results from recipient T cell EVs. FIG.20G: miR 101b results from recipient T cell EVs. FIG.20H: miR 21a results from recipient T cell EVs. FIGs.21A – 21H show results of cargo analysis for all eight candidate biomarkers in Patient 8. Key: green diamond = no ACR, blue + sign = grade 1 ACR, red star = grade 2 ACR, and pink triangle = time point where bolus immunosuppression was given for grade 2 ACR detection by endomyocardial biopsy. POD = postoperative day. FIG.21A: Troponin T protein results from donor heart EVs. FIG.21B: Troponin T mRNA results from donor heart EVs. FIG. 21C: CD4 protein results from recipient T cell EVs. FIG.21D: CD8 protein results from recipient T cell EVs. FIG.21E: TCR protein results from recipient T cell EVs. FIG.21F: miR Let 7i results from recipient T cell EVs. FIG.21G: miR 101b results from recipient T cell EVs. FIG.21H: miR 21a results from recipient T cell EVs. FIGs.22A – 22H show results of cargo analysis for all eight candidate biomarkers in Patient 9. Key: green diamond = no ACR, blue + sign = grade 1 ACR, red star = grade 2 ACR, and pink triangle = time point where bolus immunosuppression was given for grade 2 ACR detection by endomyocardial biopsy. POD = postoperative day. FIG.22A: Troponin T protein results from donor heart EVs. FIG.22B: Troponin T mRNA results from donor heart EVs. FIG. 22C: CD4 protein results from recipient T cell EVs. FIG.22D: CD8 protein results from recipient T cell EVs. FIG.22E: TCR protein results from recipient T cell EVs. FIG.22F: miR Let 7i results from recipient T cell EVs. FIG.22G: miR 101b results from recipient T cell EVs. FIG.22H: miR 21a results from recipient T cell EVs. FIGs.23A – 23H show results of cargo analysis for all eight candidate biomarkers in Patient 10. Key: green diamond = no ACR, blue + sign = grade 1 ACR, red star = grade 2 ACR, and pink triangle = time point where bolus immunosuppression was given for grade 2 ACR detection by endomyocardial biopsy. POD = postoperative day. FIG.23A: Troponin T protein results from donor heart EVs. FIG.23B: Troponin T mRNA results from donor heart EVs. FIG. 23C: CD4 protein results from recipient T cell EVs. FIG.23D: CD8 protein results from 21 53258724.1 Attorney Docket No.047162-7412WO1(02347) recipient T cell EVs. FIG.23E: TCR protein results from recipient T cell EVs. FIG.23F: miR Let 7i results from recipient T cell EVs. FIG.23G: miR 101b results from recipient T cell EVs. FIG.23H: miR 21a results from recipient T cell EVs. FIGs.24A – 24H show scatter plot results of cargo analysis for the indicated biomarker from all 10 patients. Circles indicate no ACR, triangles indicate grade 1 ACR, and squares indicated grade 2 ACR. FIG.24A is a scatter plot of CD4 levels. FIG.24B is a scatter plot of CD8 levels. FIG.24C is a scatter plot of TCR levels. FIG.24D is a scatter plot of Troponin T protein levels. FIG.24E is a scatter plot of Troponin T mRNA levels. FIG.24F is a scatter plot of miR Let 7i levels. FIG.24G is a scatter plot of miR 101b levels. FIG.24H is a scatter plot of miR 21a levels. FIGs.25A – 25H show box plot results of cargo analysis for the indicated biomarker from all 10 patients. FIG.25A is a box plot of CD4 levels across ACR grades. FIG.25B is a box plot of CD8 levels across ACR grades. FIG.25C is a box plot of TCR levels across ACR grades. FIG.25D is a box plot of Troponin T protein levels across ACR grades. FIG.25E is a box plot of Troponin T mRNA levels across ACR grades. FIG.25F is a box plot of miR Let 7i levels across ACR grades. FIG.25G is a box plot of miR 101b levels across ACR grades. FIG.25H is a box plot of miR 21a levels across ACR grades. FIGs.26A – 26H show Area Under the Receiver Operating Characteristics (AUROC) curves calculated via logistic regression for the indicated biomarker from all 10 patients. FIG. 26A is an AUROC plot for CD4. FIG.26B is an AUROC plot for CD8. FIG.26C is an AUROC plot for TCR. FIG.26D is an AUROC plot for Troponin T protein. FIG.26E is an AUROC plot for Troponin T mRNA. FIG.26F is an AUROC plot for miR Let 7i. FIG.26G is an AUROC plot for miR 101b. FIG.26H is an AUROC plot for miR 21a. FIGs.27A – 27E show Area Under the Receiver Operating Characteristics (AUROC) curves calculated via generalized estimating equations for the indicated biomarker from all 10 patients. FIG.27A is an AUROC plot for CD4. FIG.27B is an AUROC plot for CD8. FIG.27C is an AUROC plot for TCR. FIG.27D is an AUROC plot for Troponin T protein. FIG.27E is an AUROC plot for miR 101b. FIG.28 is a schematic showing changes in circulating tissue / cell specific sEVs associated with AR. In quiescence, a constitutive, baseline signal and cargo profile of donor sEVs, T cell sEVs, and B cell sEVs is present in the peripheral blood. Pathophysiology of ACR 22 53258724.1 Attorney Docket No.047162-7412WO1(02347) associated with T cell activation and allograft injury results in changes in the quantitative output and cargoes of sEVs released by T cells and the allograft into peripheral circulation. Similarly, with AMR, changes in circulating donor sEVs and B cell sEVs occur, along with possible changes in T cell sEVs. Successful treatment of ACR or AMR leads to return of the sEV profiles back to the baseline, constitutive signals seen under quiescence. Thus, characterization of enriched sEV fractions representing contribution from the allograft, T cells, and B cells provide a noninvasive diagnostic window into acute rejection and its effective treatment. FIGs.29A-29B show data from a rodent heterotopic heart transplant model of ACR. In MHC full mismatch model of heart transplantation (BALB / c into C57BL / 6), ACR with T cell infiltration into cardiac allograft occurs by day 5, and fulminant rejection with allograft asystole is complete by days 11-13. In this model, donor heart EVs were purified using anti-H2kd antibody conjugated beads and shown to express cardiomyocyte marker troponin T protein and mRNA. Importantly, troponin T expression in donor heart EV subset decreased early during ACR. Based on these findings, EV methodologies were translated to enrich donor heart sEVs in clinical heart transplantation for cTnT expression. FIG.29A: Western blot for troponin T and TSG101 is shown. FIG.29B: RT-PCR for troponin T mRNA is shown. One of 3 experiments is shown. FIG.30 shows the methodological design for sEV isolation and enrichment of donor heart sEV, T cell sEV, and B cell sEV subpopulations from peripheral blood. Peripheral blood sample is collected in EDTA tube and processed for plasma. Total plasma sEVs are isolated by size exclusion chromatography and ultracentrifugation, after which quality control is performed by NTA, electron microscopy, and Western blot for expression of exosome markers including CD63, TSG101, alix, flotillin 1; along with absence of cytochrome c, calnexin, and apolipoprotein per MISEV guidelines. Cell / tissue specific sEVs are enriched using magnetic beads conjugated to antibodies specific for surface markers expressed on sEV subpopulation of interest. Donor heart sEVs are enriched using anti-donor HLA I specific antibody beads and the bound fraction is eluted and assessed by NTA for intact sEVs. The unbound fraction is checked for absence of cTnT (cardiomyocyte marker). T cell sEVs are enriched using anti-CD3 antibody beads and B cell sEVs are enriched using anti-CD19 antibody beads and the bound fractions are eluted to check for isolation of intact sEVs by NTA. The unbound fraction is correspondingly checked for absence of CD3 (T cell marker) and CD19 (B cell marker) by Western blot. 23 53258724.1 Attorney Docket No.047162-7412WO1(02347) Downstream analysis of sEV protein and RNA cargoes was performed after these quality control steps. Ab: antibody; HLA: human leukocyte antigen. FIG.31 shows the study design and distribution of acute rejection episodes. In 12 patients, plasma samples collected from pre-transplant to POD 112 were collected, including at time points of EMB (n=70 EMB-matched samples). Sample was analyzed for sEVs representing donor heart and T cell sEV subsets. In Patient 7, who had AMR, in addition to donor heart and T cell sEVs, circulating B cell sEVs were also analyzed. None of the samples were excluded. Patients 1-6 had at least one moderate (grade 2) ACR episode, and Patients 8-12 had 3 grade 1 ACR events, without any grade > 2 ACR events. In total, there were 11 grade 2 ACR events and 15 grade 1 ACR events, 3 pAMR 1 / 2 events, and 41 grade 0 ACR events as interpreted on EMB. FIGs.32A-32D show data for total plasma extracellular vesicle characterization. Per MISEV guidelines (Thery, et al., J Extracell Vesicles.2018;7(1)), isolated plasma EVs were quality checked and phenotyped. FIG.32A: Electron microscopy showed isolation of EVs <200 nm in size, consistent with small EVs (sEVs). Representative electron microscopy for POD 1 timepoints in Patient 1-3 is shown. FIG.32B: Nanoparticle tracking analysis (NTA) of total plasma sEVs for all measured postoperative time points for the 12 patients is shown, along with mean size distribution and concentration. In a repeated measures model, no effect over time was noted for sEV quantities (p=0.15). FIG.32C: sEV quantity and size distribution for time points of no ACR versus mild ACR versus moderate ACR is shown with vertical dotted lines showing the mean for each ACR grade. Mean sEV concentrations were: grade 0 ACR: 8.61x108particles / ml, grade 1 ACR: 10.64x108particles / ml, grade 2 ACR: 8.90x108particles / ml. sEV quantities were similar when comparing grade 2 versus grades 0 / 1 ACR (p=0.16). FIG.32D: Western blot analysis of plasma sEVs was performed for expression of exosome markers CD63, TSG101, flotillin 1, and alix. Absence of cytochrome c, calnexin, and apolipoprotein in sEV isolates was also confirmed by Western blot per MISEV guidelines (Thery, et al., J Extracell Vesicles. 2018;7(1)). Representative analysis from Patient 7 is shown. FIGs.33A-33F show assessment of enriched circulating sEV subpopulations. Bound and unbound sEV fractions for enrichment of T cell sEVs, B cell sEVs, and donor heart sEVs were quality checked. For all 3 sEV subpopulations, with starting material of 1x1010sEVs, elution of bead bound sEV fraction resulted in 0.5 to 1.5x108sEVs, potentially representing ~60-to-200- fold enrichment in sEV signal compared to whole plasma sEV analysis. FIG.33A: For T cell 24 53258724.1 Attorney Docket No.047162-7412WO1(02347) sEV enrichment, bead bound sEVs were eluted and studied by NTA to confirm purification of intact sEVs. Representative analysis in Patient 7 is shown. FIG.33B: Anti-CD3 unbound sEVs were studied for absence of CD3 expression by Western blot. Analysis from Patient 7 is shown. Jurkat T cell line positive control is shown, along with expression for TSG101, exosome marker. FIG.33C: For B cell sEVs, eluted fraction from CD19 antibody bead bound sEVs was analyzed by NTA. Analysis from Patient 7 who had AMR is shown. FIG.33D: Anti-CD19 antibody bead unbound sEVs were studied by Western blot for absence of CD19 expression. Analysis from Patient 7 is shown. Human peripheral blood mononuclear cell (PBMC) extract is shown as positive control. FIG.33E: For donor heart sEV enrichment, based on HLA I mismatch, sEVs bound to anti-donor HLA I antibody beads were eluted and assessed by NTA. Data from Patient 7 is shown. FIG.33F: Anti-donor HLA I antibody bead unbound sEVs were checked for absence of cardiomyocyte markers troponin T (cTnT) and I (cTnI) by Western blot. Analysis in Patient 7 is shown. Heart tissue is shown as positive control. FIGs.34A-34D show donor heart sEV and T cell sEV cargo profiles in Patient 1. The relative expression of sEV cargo compared to POD 1 time point (donor heart sEVs) or pretransplant time point (T cell sEVs) is shown. Results of EMB are delineated for each time- matched sample for ACR grades 0, 1, or 2. ACR episodes treated with escalation of immunosuppression are also shown. FIG.34A: Western blot for donor heart sEV cTnT and TSG101 (canonical exosome marker) is shown. Relative expression of cTnT was normalized to TSG101 expression. The normalized expression for POD 1 was set to value of 1, and cTnT expression for all other postoperative time points is shown relative to the POD 1 value. FIG. 34B: RT-qPCR for donor heart sEV cTnT to β-actin mRNA relative expression normalized to POD 1 value set at 1 is shown. FIG.34C: Western blot for T cell sEV CD4, CD8, TCR, and TSG101 is shown. Expression of each T cell marker was normalized to TSG101 expression. Normalized expression for pretransplant sample was set to value of 1, and the T cell marker expression for all other postoperative time points is shown relative to pretransplant value. FIG. 34D: Stem loop RT-qPCR for expression of miR let 7i, miR 101b, and miR 21a in T cell sEVs is shown. Candidate miR biomarker expression was normalized to internal control miR 26 expression. EMB result for each time matched sample is shown, along with time points of escalation of immunosuppression therapy. FIGs.35A-35D show donor heart sEV and T cell sEV cargo profiles in Patient 2. FIG. 25 53258724.1 Attorney Docket No.047162-7412WO1(02347) 35A: Western blot for donor heart sEV cTnT and TSG101 is shown along with its relative expression. FIG.35B: RT-qPCR for donor heart sEV cTnT mRNA to β-actin mRNA relative expression is shown. FIG.35C: Western blot for T cell sEV CD4, CD8, TCR, and TSG101 is shown, along with relative expression of each T cell marker normalized to TSG101. FIG.35D: Stem loop RT-qPCR for expression of miR let 7i, miR 101b, and miR 21a in T cell sEVs is shown. EMB result for each time matched sample is shown, along with time points of escalation of immunosuppression therapy. FIGs.36A-36D show donor heart sEV and T cell sEV cargo profiles in Patient 3. FIG. 36A: Western blot for donor heart sEV cTnT and TSG101 is shown along with its relative expression. FIG.36B: RT-qPCR for donor heart sEV cTnT mRNA to β-actin mRNA relative expression is shown. FIG.36C: Western blot for T cell sEV CD4, CD8, TCR, and TSG101 is shown, along with relative expression of each T cell marker normalized to TSG101. FIG.36D: Stem loop RT-qPCR for expression of miR let 7i, miR 101b, and miR 21a in T cell sEVs is shown. EMB result for each time matched sample is shown, along with time points of escalation of immunosuppression therapy. FIGs.37A-37D show donor heart sEV and T cell sEV cargo profiles in Patient 4. FIG. 37A: Western blot for donor heart sEV cTnT and TSG101 is shown along with its relative expression. FIG.37B: RT-qPCR for donor heart sEV cTnT mRNA to β-actin mRNA relative expression is shown. FIG.37C: Western blot for T cell sEV CD4, CD8, TCR, and TSG101 is shown, along with relative expression of each T cell marker normalized to TSG101. FIG.37D: Stem loop RT-qPCR for expression of miR let 7i, miR 101b, and miR 21a in T cell sEVs is shown. EMB result for each time matched sample is shown, along with time points of escalation of immunosuppression therapy. FIGs.38A-38D show donor heart sEV and T cell sEV cargo profiles in Patient 5. FIG. 38A: Western blot for donor heart sEV cTnT and TSG101 is shown along with its relative expression. FIG.38B: RT-qPCR for donor heart sEV cTnT mRNA to β-actin mRNA relative expression is shown. FIG.38C: Western blot for T cell sEV CD4, CD8, TCR, and TSG101 is shown, along with relative expression of each T cell marker normalized to TSG101. FIG.38D: Stem loop RT-qPCR for expression of miR let 7i, miR 101b, and miR 21a in T cell sEVs is shown. EMB result for each time matched sample is shown, along with time points of escalation of immunosuppression therapy 26 53258724.1 Attorney Docket No.047162-7412WO1(02347) FIGs.39A-39F show donor heart sEV and T cell sEV cargo profiles in Patient 6. Availability of more plasma sample enabled analysis for other potential cell-specific markers in sEV subpopulations. FIG.39A: Western blot for donor heart sEV cTnT, cTnI, and TSG101 is shown along with its relative expression. cTnI, cardiac isoform troponin I, also showed similar expression pattern as cTnT. FIG.39B: RT-PCR for cTnT is shown for the postoperative samples, along with heart tissue as positive control. β-actin mRNA control is shown. FIG.39C: RT-qPCR for donor heart sEV cTnT and cTnI mRNAs to β-actin mRNA relative expression is shown. FIG.39D: Western blot for T cell sEV CD4, CD8, TCR, and TSG101 is shown, along with relative expression of each T cell marker normalized to TSG101. FIG.39E: Stem loop RT- qPCR for expression of miR let 7i, miR 101b, and miR 21a in T cell sEVs is shown. FIG.39F: Given noted expression of CD4, CD8 protein markers in T cell sEVs, mRNA expression of these markers was also assessed. T cell sEV RT-qPCR for CD4, CD8, and IFNγ mRNAs with expression normalized to β-actin mRNA is shown. EMB result for each time matched sample is shown, along with time points of escalation of immunosuppression therapy. FIGs.40A-40D show donor heart sEV and T cell sEV cargo profiles in Patient 8. FIG. 40A: Western blot for donor heart sEV cTnT and TSG101 (canonical exosome marker) is shown along with its relative expression. FIG.40B: RT-qPCR for donor heart sEV cTnT mRNA to β- actin mRNA relative expression is shown. FIG.40C: Western blot for T cell sEV CD4, CD8, TCR, and TSG101 is shown, along with relative expression of each T cell marker normalized to TSG101. FIG.40D: Stem loop RTqPCR for expression of miR let 7i, miR 101b, and miR 21a in T cell sEVs is shown. EMB result for each time matched sample is shown. There were 8 grade 0 ACR events noted by EMB. Expression profiles of the 8 candidate biomarkers remained stable over follow-up. FIGs.41A-41D show donor heart sEV and T cell sEV cargo profiles in Patient 9. FIG. 41A: Western blot for donor heart sEV cTnT and TSG101 (canonical exosome marker) is shown along with its relative expression. FIG.41B: RT-qPCR for donor heart sEV cTnT mRNA to β- actin mRNA relative expression is shown. FIG.41C: Western blot for T cell sEV CD4, CD8, TCR, and TSG101 is shown, along with relative expression of each T cell marker normalized to TSG101. FIG.41D: Stem loop RTqPCR for expression of miR let 7i, miR 101b, and miR 21a in T cell sEVs is shown. EMB result for each time matched sample is shown. There was one grade 1 ACR event and 4 grade 0 ACR events noted by EMB. Expression profiles of the 8 candidate 27 53258724.1 Attorney Docket No.047162-7412WO1(02347) biomarkers remained stable over follow-up. FIGs.42A-42D show donor heart sEV and T cell sEV cargo profiles in Patient 10. FIG. 42A: Western blot for donor heart sEV cTnT and TSG101 (canonical exosome marker) is shown along with its relative expression. FIG.42B: RT-qPCR for donor heart sEV cTnT mRNA to β- actin mRNA relative expression is shown. FIG.42C: Western blot for T cell sEV CD4, CD8, TCR, and TSG101 is shown, along with relative expression of each T cell marker normalized to TSG101. FIG.42D: Stem loop RTqPCR for expression of miR let 7i, miR 101b, and miR 21a in T cell sEVs is shown. EMB result for each time matched sample is shown. There were 7 grade 0 ACR events noted by EMB. Expression profiles of the 8 candidate biomarkers remained stable over follow-up. FIGs.43A-43D show donor heart sEV and T cell sEV cargo profiles in Patient 11. FIG. 43A: Western blot for donor heart sEV cTnT and TSG101 (canonical exosome marker) is shown along with its relative expression. FIG.43B: RT-qPCR for donor heart sEV cTnT mRNA to β- actin mRNA relative expression is shown. FIG.43C: Western blot for T cell sEV CD4, CD8, TCR, and TSG101 is shown, along with relative expression of each T cell marker normalized to TSG101. FIG.43D: Stem loop RTqPCR for expression of miR let 7i, miR 101b, and miR 21a in T cell sEVs is shown. EMB result for each time matched sample is shown. There were 2 grade 1 ACR events and 4 grade 0 ACR events noted by EMB. Expression profiles of the 8 candidate biomarkers remained stable over follow-up. FIGs.44A-44D show donor heart sEV and T cell sEV cargo profiles in Patient 12. FIG. 44A: Western blot for donor heart sEV cTnT and TSG101 (canonical exosome marker) is shown along with its relative expression. FIG.44B: RT-qPCR for donor heart sEV cTnT mRNA to β- actin mRNA relative expression is shown. FIG.44C: Western blot for T cell sEV CD4, CD8, TCR, and TSG101 is shown, along with relative expression of each T cell marker normalized to TSG101. FIG.44D: Stem loop RTqPCR for expression of miR let 7i, miR 101b, and miR 21a in T cell sEVs is shown. EMB result for each time matched sample is shown. There were 5 grade 0 ACR events noted by EMB. Expression profiles of the 8 candidate biomarkers remained stable over follow-up. FIGs.45A-45G show donor heart sEV, T cell sEV, and B cell sEV cargo profiles in Patient 7. This patient developed moderate ACR on POD 7 EMB, with remission on repeat biopsy on POD 15 (mild ACR without myocyte damage) but with development of donor HLA 28 53258724.1 Attorney Docket No.047162-7412WO1(02347) specific antibody. Surveillance EMB on POD 57 showed no ACR, with pAMR1. Repeat surveillance EMB on POD 71 showed no ACR, pAMR2 which was treated with intravenous methylprednisolone. POD 85 EMB showed persistent pAMR2 without ACR, warranting admission with initiation of rituximab therapy on POD 89 and plasmapheresis on POD 90. FIG. 45A: EMB histology from PODs 57 and 85 is shown. Hematoxylin and eosin staining (4X and 40X magnification) and immunohistochemistry for C4d expression is shown. POD 57 biopsy showed pAMR1, without ACR- mild interstitial edema on hematoxylin and eosin staining, with immunohistochemistry C4d 1+ (10% positive with linear staining). POD 85 EMB showed pAMR2 without ACR- diffuse lymphocytes, C4d+ and CD68 positive staining on immunohistochemistry with diffuse interstitial edema and endothelial cell prominence on hematoxylin and eosin staining. FIG.45B: Western blot for donor heart sEV cTnT, cTnI, and TSG101 is shown along with its relative expression. FIG.45C: RT-PCR for cTnT is shown for the postoperative samples, along with heart tissue as positive control. β-actin mRNA control is shown. FIG.45D: RT-qPCR for donor heart sEV cTnT and cTnI mRNAs to β-actin mRNA relative expression is shown. AMR led to decrease in expression of cTnT and cTnI mRNAs in donor heart sEVs for PODs 71 and 85 time points. After initiation of treatment with rituximab and plasmapheresis on PODs 89 and 90, return in cTnT and cTnI mRNA signals was noted for PODs 92 and 93 timepoints. FIG.45E: Western blot for T cell sEV CD4, CD8, TCR, and TSG101 is shown, along with relative expression of each T cell marker normalized to TSG101. Unlike with moderate ACR, CD8 and TCR protein expression in T cell sEVs did not increase with AMR. Increase in CD4 expression was noted for time points of AMR, PODs 57 and 71. FIG.45F: B cells sEVs were enriched using anti-CD19 antibody conjugated beads and their protein cargo was tested for expression of immune cell activation protein markers HLA-DR (HLA II) and CD38 by Western blot. Expression relative to TSG101 expression is shown. FIG. 45G: RT-qPCR for CD38 and CD19 mRNA expression in B cell sEVs demonstrated persistent increase starting POD 15 time point, when development of donor HLA I specific antibody was noted. PODs 57 and 71 showed persistent increase in expression of CD19 and CD38 mRNA in B cell sEV subpopulation. After treatment initiation with rituximab and plasmapheresis on POD 89, B cell sEV analysis from POD 92 showed corresponding decrease in mRNA expression of markers. FIGs.46A-46D show statistical analysis to delineate the diagnostic potential of sEV 29 53258724.1 Attorney Docket No.047162-7412WO1(02347) cargo profiles for detection of grade 2 ACR. Moderate or greater ACR detected on EMB is clinically significant as it mandates escalation in immunosuppression therapy and repeat EMBs until there is resolution of ACR before re-titration of immunosuppression to lower levels. For this reason, the eight candidate biomarkers were analyzed for diagnostic potential to differentiate between grade 2 ACR (moderate) versus grade 0 (none) or grade 1 (mild) ACR episodes – CD4 protein, CD8 protein, TCR protein, cTnT protein, cTnT mRNA, miR let7i, miR 101b, and miR 21a.Wilcoxon rank sum tests were conducted to compare biomarker levels at EMB matched time points of none / mild versus moderate ACR. FIG.46A: Box Whisker plots for the 8 candidate biomarkers demonstrated that all markers were significantly altered at time points of grade 2 ACR compared to grades 0 / 1 ACR. cTnT mRNA showed the highest significance (p=6.87x10-7). FIG.46B: Receiver operating characteristic curves for the candidate biomarkers generated by logistic regression are shown. FIG.46C: Optimal cut-off points for each biomarker using the Youden method are shown, along with sensitivity, specificity, PPV, and NPV at the optimal cut- off is shown. FIG.46D: After treatment initiation for grade > 2 ACR episode, as repeat EMBs are required to assess for resolution of ACR, the extent to which candidate biomarker levels could enable noninvasive detection of resolution of ACR was assessed. Spearman correlations for each biomarker is shown. The results indicate that cTnT mRNA (correlation coefficient - 0.867) and miR 21a (correlation coefficient 0.853) showed the highest correlation. FIGs.47A-47E show receiver operating characteristic curves for the candidate biomarkers generated by generalized estimating equations. FIG.47A: ROC curve for CD4. FIG. 47B: ROC curve for CD8. FIG.47C: ROC curve for TCR. FIG.47D: ROC curve for Troponin T protein. FIG.47E: ROC curve for Troponin T mRNA. ROC curves for cTnT mRNA, miR let 7i, and miR 21a do not have results because the logistic model for probability has fitted value very close to 1 and so the estimates diverge. FIGs.48A–48C show pertinent clinical data for Patients 1 to 3. FIG.48A: Donor specific antibody titers for HLA-DQ, HLA-DP, and HLA-DR in Patients 1 to 3 are shown. Patient 1 showed acute upregulation of donor specific antibodies at the POD 30 time point. FIG. 48B: Computer tomography imaging is shown for Patients 1 and 3. Acute bilateral infiltration was noted in Patient 1 for POD 30 time out. FIG.48C: Pulmonary function tests for Patients 1 to 3 are shown. Compared to pre-transplant lung volumes, all 3 patients demonstrated improved forced vital capacity (FVC) and forced expiratory volume in one second (FEV1) after bilateral 30 53258724.1 Attorney Docket No.047162-7412WO1(02347) lung transplantation, but Patient 1 showed the least improvement. FIGs.49A–49E show characterization of plasma sEVs in Patient 1. FIG.49A: Western blot analysis of plasma sEVs for exosome markers is shown – CD63, flotillin 1, TSG 101, alix 1, and CD81. To assess the plasma sEV isolates for absence of contamination from cellular organelles, Western blot for calnexin (endoplasmic reticulum marker) and cytochrome c (mitochondrial marker) was performed. Human lung tissue protein extract is shown as positive control. To assess for absence of contamination in the sEV isolates from blood lipoproteins, Western blot for apolipoprotein E was performed. Human plasma is shown as positive control. By Western blot, Patient 1 with mixed ACR + AMR also showed increased expression of complement C4d in the sEV isolate from POD 30 compared to PODs 1 and 3 timepoints. PBMC protein isolate is shown as positive control. TSG 101 is an exosome marker. FIG.49B: NTA of plasma sEVs for PODs 1, 3, and 30 timepoints in Patient 1 are shown. This demonstrated that the phenotype of the majority of the isolated sEVs were in the exosome size range, under 150 nm. FIG.49C: Representative NTA screen shot of a video of plasma sEVs for POD 1 in Patient 1. FIG.49D: Representative NTA screen shot of a videos of plasma sEVs for POD 3 in Patient 1. FIG.49E: Representative NTA screen shot of a video of plasma sEVs for POD 30 in Patient 1. FIGs.50A–50I show data related to circulating T cell sEV and B cell sEV cargoes in a lung transplant patient with mixed ACR / AMR. FIG.50A: Workflow for B cell sEV enrichment and downstream analysis is shown. FIG.50B: Anti-CD19 antibody bead-unbound sEVs were analyzed by Western blot for CD19 absence and flotillin-1 (exosome marker) expression. Peripheral blood mononuclear cells (PBMCs) are positive control. FIG.50C: Nanoparticle tracking analysis (NTA) of eluted anti-CD19 antibody bead-bound sEVs is shown. FIG.50D: Western blot for expression of B cell activation markers HLA-DR, CD20, CD38, IFNγ, IL6-R, BAFF-R, and exosome markers TSG101 and flotillin-1 in B cell sEVs is shown. FIG.50E: Western blot of T cell sEVs, enriched from plasma total sEV pool using anti-CD3 antibody beads, is shown for CD3 absence and flotillin-1 expression; along with Jurkat T cell positive control. FIG.50F: NTA of eluted T cell sEVs is shown. FIG.50G: Western blot for expression of T cell markers, CD4 and CD8 in T cell sEVs is shown. FIG.50H: RT-qPCR assays for T cell sEV mRNA cargoes CD8, IFNγ, HLA-DR, and CD4 in Patients 1-3 at POD-1, POD-3, and POD-30 timepoints are shown. Upregulation of T cell activation markers CD8, IFNγ, and HLA- DR, was seen at POD-30 timepoint in Patient-1 only. FIG.50I: RT-qPCR assays for B cell sEV 31 53258724.1 Attorney Docket No.047162-7412WO1(02347) mRNA cargoes, CD19, CD20, IL6-R, BAFF-R, IFNγ, HLA-DR, CD38, and ICOSL, in Patients 1-3 at POD-1, POD-3, and POD-30 timepoints are shown. Upregulation of these markers was observed in Patient-1, POD-30 timepoint of AMR DETAILED DESCRIPTION The present invention relates generally to methods and kits for assessing conditional status, and of treating rejection, of a donor transplant in a subject. In one aspect, the invention includes a method for assessing conditional status of a donor transplant in a subject, the method comprising (i) obtaining and / or having obtained at least one biological sample from the subject post-transplant; (ii) detecting and / or isolating immune cell microvesicles and / or at least one immune cell microvesicle biomarker from the at least one biological sample; (iii) quantifying the amount and / or relative level of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker; and (iv) comparing the amount and / or relative level of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker in the at least one biological sample to a baseline value of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker; wherein the amount and / or relative level of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker in the at least one biological sample compared to the baseline value indicates the conditional status of the donor transplant. In one aspect, the invention includes a method of treating rejection of a donor transplant in a subject, the method comprising: (i) obtaining and / or having obtained at least one biological sample from the subject post-transplant; (ii) detecting and / or isolating immune cell microvesicles and / or at least one immune cell microvesicle biomarker from the at least one biological sample; (iii) quantifying the amount and / or relative level of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker; (iv) determining the conditional status of the donor transplant, wherein the determining comprises comparing the amount and / or relative level of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker in the at least one biological sample to a baseline value of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker; wherein the amount and / or relative level of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker in the at least one biological sample compared to the baseline value indicates the conditional status of the donor 32 53258724.1 Attorney Docket No.047162-7412WO1(02347) transplant; (v) administering an effective amount of a rejection therapy to the subject when the conditional status indicates rejection of the donor transplant; and (vi) stopping administration of the rejection therapy when the conditional status indicates recovery from rejection of the donor transplant. Definitions Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although any methods and materials similar or equivalent to those described herein can be used in the practice of and / or for the testing of the present invention, the preferred materials and methods are described herein. In describing and claiming the present invention, the following terminology will be used according to how it is defined, where a definition is provided. It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting. It is also to be understood that the methods described in this disclosure are not limited to particular methods and experimental conditions disclosed herein as such methods and conditions may vary. Furthermore, the experiments described herein, unless otherwise indicated, use conventional molecular and cellular biological and immunological techniques within the skill of the art. Such techniques are well known to the skilled worker, and are explained fully in the literature. See, e.g., Ausubel, et al., ed., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., NY, N.Y. (1987-2008), including all supplements, Molecular Cloning: A Laboratory Manual (Fourth Edition) by MR Green and J. Sambrook, and Harlow et al., Antibodies: A Laboratory Manual, Chapter 14, Cold Spring Harbor Laboratory, Cold Spring Harbor (2013, 2nd edition). Unless otherwise defined, scientific and technical terms used herein have the meanings that are commonly understood by those of ordinary skill in the art. In the event of any latent ambiguity, definitions provided herein take precedent over any dictionary or extrinsic definition. Unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. The use of “or” means “and / or” unless stated otherwise. The use of 33 53258724.1 Attorney Docket No.047162-7412WO1(02347) the term “including,” as well as other forms, such as “includes” and “included,” is not limiting. Generally, nomenclature used in connection with cell and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein is well-known and commonly used in the art. The methods and techniques provided herein are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated. Enzymatic reactions and purification techniques are performed according to manufacturer’s specifications, as commonly accomplished in the art or as described herein. The nomenclatures used in connection with, and the laboratory procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well- known and commonly used in the art. Standard techniques are used for chemical syntheses, chemical analyses, pharmaceutical preparation, formulation, and delivery, and treatment of patients. So that the disclosure may be more readily understood, select terms are defined below. The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element. “About,” as used herein, when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20% or ±10%, in some instances ±5%, in some instances ±1%, and in some instance ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods. As used herein, the term “biological sample” refers to a sample of biological material obtained from a subject, e.g., a human subject, including a biological fluid, e.g., blood, plasma, serum, urine, sputum, spinal fluid, pleural fluid, nipple aspirates, lymph fluid, fluid of the respiratory, intestinal, and genitourinary tracts, tear fluid, saliva, breast milk, fluid from the lymphatic system, semen, cerebrospinal fluid, intra-organ system fluid, ascitic fluid, tumor cyst fluid, amniotic fluid, bronchoalveolar fluid, biliary fluid and combinations thereof. In certain non-limiting embodiments, the presence of one or more biomarkers is determined in a blood sample obtained from a subject. In certain non-limiting embodiments, the presence of one or more biomarkers is determined in a plasma sample obtained from a subject. In certain non- 34 53258724.1 Attorney Docket No.047162-7412WO1(02347) limiting embodiments, the presence of one or more biomarkers is detected in a urine sample obtained from a subject. A “disease” is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal’s health continues to deteriorate. In contrast, a “disorder” in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal’s state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal’s state of health. An “effective amount” as used herein, means an amount which provides a therapeutic or prophylactic benefit. “Encoding” refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an RNA (such as an mRNA), to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA. The terms “extracellular vesicle,” “small extracellular vesicle,” “small extracellular microvesicle,” “extracellular microvesicle”, “EV”, “sEV,” and “microvesicle,” are used interchangeably herein, and refer to vesicles that are released from a cell into bodily fluids. sEVs are lipid bilayer vesicles with a size range of about 30 nm to about 2,000 nm in diameter that are released by several types of cells into the extracellular spaces during physiological and pathological conditions. Their membranes contain surface markers of their parent cell type, and their contents reflect the conditional changes imposed on their cells of origin. EVs are found in body fluids, including but not limited to blood, synovial fluids, breast milk, saliva, plasma, and urine. EVs harbor nucleic acids, proteins, lipids and metabolites that reflect their cellular origin. In certain embodiments, the microvesicle is a vesicle that is released from a cell by exocytosis of intracellular multi vesicular bodies. In certain embodiments, the microvesicles are exosomes. In 35 53258724.1 Attorney Docket No.047162-7412WO1(02347) certain embodiments, the microvesicles have an average diameter less than about 400 nm. In certain embodiments, the microvesicles have an average diameter ranging in size from about 30 nm to about 400 nm. In some embodiments, the microvesicles have an average diameter of 100 nm or less. “Homologous” refers to the sequence similarity or sequence identity between two polypeptides or between two nucleic acid molecules. When a position in both of the two compared sequences is occupied by the same base or amino acid monomer subunit, e.g., if a position in each of two DNA molecules is occupied by adenine, then the molecules are homologous at that position. The percent of homology between two sequences is a function of the number of matching or homologous positions shared by the two sequences divided by the number of positions compared X 100. For example, if 6 of 10 of the positions in two sequences are matched or homologous then the two sequences are 60% homologous. By way of example, the DNA sequences ATTGCC and TATGGC share 50% homology. Generally, a comparison is made when two sequences are aligned to give maximum homology. “Instructional material(s)” as used herein includes a publication, a recording, a diagram, or any other medium of expression that can be used to communicate the usefulness of a composition and / or compound of the invention in a kit. The instructional material may describe a method of using the composition and / or compound of the invention in a method of the invention. The instructional material of the kit may, for example, be affixed to a container that contains the compound and / or composition of the invention or be shipped together with a container that contains the compound and / or composition. Alternatively, the instructional material may be shipped separately from the container with the intention that the recipient uses the instructional material and the compound cooperatively. Delivery of the instructional material may be, for example, by physical delivery of the publication or other medium of expression communicating the usefulness of the kit, or may alternatively be achieved by electronic transmission, for example by means of a computer, such as by electronic mail, or download from a website. “Isolated” means altered or removed from the natural state. For example, a nucleic acid or a peptide naturally present in a living animal is not “isolated,” but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is “isolated.” An isolated nucleic acid or protein can exist in substantially purified form, or can 36 53258724.1 Attorney Docket No.047162-7412WO1(02347) exist in a non-native environment such as, for example, a host cell. In the context of the present invention, the following abbreviations for the commonly occurring nucleosides (nucleobase bound to ribose or deoxyribose sugar via N-glycosidic linkage) are used. “A” refers to adenosine, “C” refers to cytidine, “G” refers to guanosine, “T” refers to thymidine, and “U” refers to uridine. By the term “modulating,” as used herein, is meant mediating a detectable increase or decrease in the level of a response in a subject compared with the level of a response in the subject in the absence of a treatment or compound, and / or compared with the level of a response in an otherwise identical but untreated subject. The term encompasses perturbing and / or affecting a native signal or response thereby mediating a beneficial therapeutic response in a subject, such as, a human. The term “operably linked” refers to functional linkage between a regulatory sequence and a heterologous nucleic acid sequence resulting in expression of the latter. For example, a first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Generally, operably linked DNA or RNA sequences are contiguous and, where necessary to join two protein coding regions, in the same reading frame. The terms “patient,” “subject,” “individual,” and the like are used interchangeably herein, and refer to any animal, or cells thereof whether in vitro or in situ, amenable to the methods described herein. In certain non-limiting embodiments, the patient, subject, or individual is a human. Non-limiting examples of non-human subjects include non-human primates, dogs, cats, mice, rats, guinea pigs, rabbits, fowl, pigs, horses, cows, goats, sheep, etc. The term “polynucleotide” as used herein is defined as a chain of nucleotides. Furthermore, nucleic acids are polymers of nucleotides. Thus, nucleic acids and polynucleotides as used herein are interchangeable. One skilled in the art has the general knowledge that nucleic acids are polynucleotides, which can be hydrolyzed into the monomeric “nucleotides.” The monomeric nucleotides can be hydrolyzed into nucleosides. As used herein polynucleotides include, but are not limited to, all nucleic acid sequences which are obtained by any means available in the art, including, without limitation, recombinant means, i.e., the cloning of nucleic 37 53258724.1 Attorney Docket No.047162-7412WO1(02347) acid sequences from a recombinant library or a cell genome, using ordinary cloning technology and PCR™, and the like, and by synthetic means. As used herein, the terms “peptide,” “polypeptide,” and “protein” are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein’s or peptide’s sequence. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types. “Polypeptides” include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others. The polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof. The term “therapeutic” as used herein means a treatment and / or prophylaxis. A therapeutic effect is obtained by suppression, diminution, remission, or eradication of at least one sign or symptom of a disease or disorder. The term “therapeutically effective amount” refers to the amount of the subject compound that will elicit the biological or medical response of a tissue, system, or subject that is being sought by the researcher, veterinarian, medical doctor or other clinician. The term “therapeutically effective amount” includes that amount of a compound that, when administered, is sufficient to prevent development of, or alleviate to some extent, one or more of the signs or symptoms of the disorder or disease being treated. The therapeutically effective amount will vary depending on the compound, the disease and its severity and the age, weight, etc., of the subject to be treated. To “treat” a disease or disorder as the term is used herein, means to reduce the frequency or severity of at least one sign or symptom of a disease or disorder experienced by a subject. Ranges: throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically 38 53258724.1 Attorney Docket No.047162-7412WO1(02347) disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range. Throughout the description, where compositions are described as having, including, or comprising specific components, or where processes and methods are described as having, including, or comprising specific steps, it is contemplated that, additionally, there are compositions of the present invention that consist essentially of, or consist of, the recited components, and that there are processes and methods according to the present invention that consist essentially of, or consist of, the recited processing steps. Methods The methods of the present invention are useful for assessing conditional status of a donor transplant in a subject, and for treating the rejection of a donor transplant in a subject when the conditional status indicates that a rejection event of the donor transplant is predicted and / or detected in the subject. The methods disclosed herein provide time-sensitive, accurate biomarker-based platforms for surveillance, diagnosis, and treatment of donor transplant rejection in a patient that do not rely on invasive transplant tissue biopsies which are not practical for frequent repeated testing. Accordingly, the methods of the present invention are ideally suitable for ongoing surveillance and frequent / repeated testing of transplant recipients, thereby providing a significant advantage over current biopsy-based techniques. The methods of the present invention are additionally suitable for detecting and diagnosing transplant rejection soon after the patient has received the donor transplant, i.e., within the first 30 days after transplant, when most acute rejection episodes occur. Furthermore, the methods of the present invention enable noninvasive monitoring for efficacy of treatment of transplant rejection episodes, thereby allowing the practitioner to stop treatment once the patient has recovered from the rejection event. As such, the methods disclosed herein reduce and / or prevent immunosuppression-related complications in donor transplant recipients, such as infections and malignancies. In one aspect, the invention includes a method for assessing conditional status of a donor transplant in a subject, the method comprising (i) obtaining and / or having obtained at least one 39 53258724.1 Attorney Docket No.047162-7412WO1(02347) biological sample from the subject post-transplant; (ii) detecting and / or isolating immune cell microvesicles and / or at least one immune cell microvesicle biomarker from the at least one biological sample; (iii) quantifying the amount and / or relative level of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker; and (iv) comparing the amount and / or relative level of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker in the at least one biological sample to a baseline value of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker; wherein the amount and / or relative level of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker in the at least one biological sample compared to the baseline value indicates the conditional status of the donor transplant. In one aspect, the invention includes a method of treating rejection of a donor transplant in a subject, the method comprising: (i) obtaining and / or having obtained at least one biological sample from the subject post-transplant; (ii) detecting and / or isolating immune cell microvesicles and / or at least one immune cell microvesicle biomarker from the at least one biological sample; (iii) quantifying the amount and / or relative level of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker; (iv) determining the conditional status of the donor transplant, wherein the determining comprises comparing the amount and / or relative level of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker in the at least one biological sample to a baseline value of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker; wherein the amount and / or relative level of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker in the at least one biological sample compared to the baseline value indicates the conditional status of the donor transplant; (v) administering an effective amount of a rejection therapy to the subject when the conditional status indicates rejection of the donor transplant; and (vi) stopping administration of the rejection therapy when the conditional status indicates recovery from rejection of the donor transplant. In some embodiments of the methods disclosed herein, the donor transplant is allogeneic in relation to the subject. In some embodiments of the methods disclosed herein, the donor transplant is xenogeneic in relation to the subject. The methods may be repeated to predict and / or detect additional rejection events in the subject and to treat such rejection events appropriately. In this way, the methods of the invention 40 53258724.1 Attorney Docket No.047162-7412WO1(02347) enable rapid, simple, and safe surveillance and treatment of rejection of a donor transplant as needed, as well as monitoring of the efficacy of the rejection treatment, thereby reducing and / or preventing immunosuppression-related complications. In some embodiments of the methods disclosed herein, the conditional status indicates rejection of the donor transplant. In some embodiments, the conditional status indicates tolerance of the donor transplant. In some embodiments, the conditional status indicates recovery from rejection of the donor transplant, for example, after the subject has received treatment for a rejection event. In some embodiments, the method comprises stopping the treatment once the subject has recovered from a rejection event. In certain embodiments of the methods disclosed herein, the immune cell microvesicles are derived from, (e.g., originate from and / or are released from) an immune cell selected from the group consisting of a neutrophil, an eosinophil, a basophil, a mast cell, a monocyte, a macrophage, a dendritic cell, a natural killer cell, a lymphocyte, a T cell, and a B cell. In some embodiments, the immune cell microvesicles are derived from a T cell (i.e., T cell microvesicles). In some embodiments, the immune cell microvesicles are derived from a B cell (i.e., B cell microvesicles). In certain embodiments of the methods disclosed herein, the rejection is acute cellular rejection (ACR). In some embodiments, the ACR is at least grade 2 ACR. It is known in the art that rejection events which are at least grade 2 ACR require immunosuppression therapy. When the rejection is ACR, the immune cell is a T cell. In some embodiments, the immune cell is a T cell and the detecting and / or isolating immune cell microvesicles comprises use of an antibody specific for T cells, such as an anti-CD3 antibody. Any T cell specific marker (e.g., CD3, CD4, and / or CD8) will allow for detection and / or isolation of immune cell microvesicle (i.e., T cell microvesicles). In certain embodiments of the methods disclosed herein, the rejection is antibody- mediated rejection (AMR). When the rejection is AMR, the immune cell is a B cell. In some embodiments, the immune cell is a B cell and the detecting and / or isolating immune cell microvesicles comprises use of an antibody specific for B cells, such as an anti-CD19 antibody and / or an anti-CD38 antibody. Any B cell specific marker (e.g., CD5, CD19, CD20, CD22, CD23, CD24, CD27, and / or CD38) will allow for detection and / or isolation of immune cell microvesicle (i.e., B cell microvesicles). 41 53258724.1 Attorney Docket No.047162-7412WO1(02347) In certain embodiments of the methods disclosed herein, the rejection is ACR and the rejection therapy targets T cells. In certain embodiments of the methods disclosed herein, the rejection is ACR and the rejection therapy comprises any one or more of steroids (e.g., bolus intravenous steroids), mycophenolate mofetil, and thymoglobulin therapy. In certain embodiments of the methods disclosed herein, the rejection is AMR and the rejection therapy targets B cells. In certain embodiments of the methods disclosed herein, the rejection is AMR and the rejection therapy comprises an anti-CD20 antibody. Non-limiting examples of anti-CD20 antibodies include rituximab and ofatumumab. In certain embodiments of the methods disclosed herein, obtaining and / or having obtained at least one biological sample from the subject comprises obtaining and / or having obtained biological samples from the subject at multiple timepoints post-transplant, that is, after the subject has received the donor transplant. In some embodiments, the method comprises obtaining and / or having obtained at least one biological sample from the subject per day post- transplant. In one non-limiting embodiment, the methods comprise obtaining and / or having obtained at least one biological sample from the subject per day post-transplant for at least 30 days. Those skilled in the art will appreciate that the steps of the methods disclosed herein can be performed for each biological sample at the time the biological sample is obtained or shortly thereafter (e.g., on the same day) to enable real-time surveillance, diagnosis, and treatment of donor transplant rejection in a patient. In certain embodiments of the methods disclosed herein, the method further comprises (i) detecting and / or isolating donor cell microvesicles and / or at least one donor cell microvesicle biomarker from the at least one biological sample; (ii) quantifying the amount and / or relative level of the donor cell microvesicles and / or at least one donor cell microvesicle biomarker; (iii) comparing the amount and / or relative level of the donor cell microvesicles and / or at least one donor cell microvesicle biomarker in the at least one biological sample to a baseline value of the donor cell microvesicles and / or at least one donor cell microvesicle biomarker; wherein the amount and / or relative level of the donor cell microvesicles and / or at least one donor cell microvesicle biomarker in the at least one biological sample compared to the baseline value indicates the conditional status of the donor transplant. In some embodiments, the biological sample, or a portion or fraction thereof, is stored, such as stored at a cold temperature and / or frozen, until it is analyzed to quantify the amount 42 53258724.1 Attorney Docket No.047162-7412WO1(02347) and / or relative level of the immune cell and / or donor cell microvesicles and / or the at least one immune cell and / or donor cell microvesicle biomarker. In certain embodiments of the methods disclosed herein, the method comprises obtaining or having obtained at least one reference biological sample. In some embodiments, the reference biological sample is obtained from the subject. In some embodiments, the reference biological sample is obtained from a reference individual, i.e., an individual who has not received a donor transplant, or an individual who has received a donor transplant and the donor transplant is tolerated by the individual (i.e., the conditional status is tolerance of the donor transplant in said individual). In some embodiments, the reference biological sample is obtained from the donor transplant, either before or after the subject has received the donor transplant. In some embodiments, the baseline value of the microvesicles and / or the at least one biomarker (i.e., the immune cell microvesicles / biomarker and / or the donor cell microvesicles / biomarker) is determined by quantifying the amount and / or relative level of the microvesicles and / or at least one microvesicle biomarker from a reference biological sample obtained from the subject or obtained from a reference individual or obtained from the donor transplant, either before or after the subject has received the donor transplant. In some embodiments, the baseline value of the microvesicles and / or the at least one biomarker (i.e., the immune cell microvesicles / biomarker and / or the donor cell microvesicles / biomarker) is determined by quantifying the amount and / or relative level of the microvesicles and / or at least one microvesicle biomarker from a reference biological sample obtained from the subject, e.g., before rejection of the donor transplant occurs. In some embodiments, the reference biological sample is obtained from the subject pre-transplant. As used herein, “pre-transplant” includes any of the days before the subject receives the donor transplant. In non-limiting examples, the reference biological sample can be obtained on day 30 or fewer pre-transplant, on day 25 or fewer pre-transplant, on day 20 or fewer pre-transplant, on day 15 or fewer pre- transplant, on day 10 pretransplant, on day 9 pre-transplant, on day 8 pre-transplant, on day 7 pre-transplant, on day 6 pre-transplant, on day 5 pre-transplant, on day 4 pre-transplant, on day 3 pre-transplant, on day 2 pre-transplant, or on day 1 pre-transplant. The term “pre-transplant” also includes the day of transplant but prior to the subject receiving the donor transplant. In some embodiments, the reference biological sample is obtained from the subject post-transplant, such as on the day of transplant after the subject has received the donor transplant, or within about 1 43 53258724.1 Attorney Docket No.047162-7412WO1(02347) day to within about 5 days post-transplant. In some embodiments, multiple reference biological samples are obtained and analyzed and the results therefrom are averaged to obtain the baseline value of the amount and / or relative level of the immune cell and / or donor cell microvesicles and / or at least one immune cell and / or donor cell microvesicle biomarker. In some embodiments, the at least one reference biological sample is the same type of biological sample as the at least one biological sample used for assessing the conditional status. Non-limiting examples of biological samples include biological material obtained from the subject, including a biological fluid, e.g., blood, plasma, serum, urine, sputum, spinal fluid, pleural fluid, nipple aspirates, lymph fluid, fluid of the respiratory, intestinal, and genitourinary tracts, tear fluid, saliva, breast milk, fluid from the lymphatic system, semen, cerebrospinal fluid, intra-organ system fluid, ascitic fluid, tumor cyst fluid, amniotic fluid, bronchoalveolar fluid, biliary fluid and combinations thereof. In some embodiments, the at least one biological sample comprises plasma. In some embodiments, the at least one reference biological sample comprises plasma. In some embodiments, the at least one biological sample comprises plasma and the at least one reference biological sample comprises plasma. In certain embodiments of the methods disclosed herein, the at least one immune cell microvesicle biomarker and / or the at least one donor cell microvesicle biomarker is a protein and / or a nucleic acid or portion thereof. Non-limiting examples of nucleic acids include DNA, cDNA, mRNA, tRNA, miRNA, snoRNA, scaRNA, lncRNA, and piRNA. The biomarkers of the present invention reside on the surface of or within the immune cell microvesicles and / or the donor cell microvesicles. Methods for detecting and / or isolating protein and / or nucleic acid biomarkers are well known in the art. In certain embodiments of the methods disclosed herein, the at least one immune cell microvesicle biomarker and / or the at least one donor cell microvesicle biomarker is a protein, a messenger RNA (mRNA), and / or a micro RNA (miRNA). In some embodiments, the immune cell microvesicle biomarker is a protein. In some embodiments, the immune cell microvesicle biomarker is an mRNA. In some embodiments, the immune cell microvesicle biomarker is a micro RNA. In some embodiments, the donor cell microvesicle biomarker is a protein. In some embodiments, the donor cell microvesicle biomarker is an mRNA. In some embodiments, the donor cell microvesicle biomarker is a micro RNA. In certain embodiments of the methods disclosed herein, the quantified amount of the 44 53258724.1 Attorney Docket No.047162-7412WO1(02347) immune cell microvesicle biomarker and / or the donor cell microvesicle biomarker is normalized to a quantified amount of a control biomarker to obtain the relative level of the immune cell microvesicle biomarker and / or the donor cell microvesicle biomarker. The control biomarker is generally selected based on the same type of molecule as the immune cell microvesicle biomarker or donor cell microvesicle biomarker that is being analyzed (i.e., a protein, an mRNA, or a micro RNA). The control biomarker has a relatively constant expression level that is not affected by transplant rejection events. Those of skill in the art will be able to select the appropriate control biomarker for use in the methods disclosed herein. Non-limiting examples of an immune cell microvesicle control biomarker include canonical exosome biomarkers such as CD63, flotillin-1, and TSG101, or, e.g., micro RNA hsa miR 26. Techniques for detecting, isolating, and / or analyzing and characterizing microvesicles are known in the art (see, e.g., WO 2017 / 066390). Certain non-limiting examples of such techniques are described in the Working Examples herein, e.g., techniques comprising size exclusion chromatography, antibody-linked magnetic beads, electron microscopy, and / or nanoparticle tracking analysis (NTA). In certain embodiments of the methods disclosed herein, the immune cell and / or donor cell microvesicles are characterized by a diameter of about 30 nm to about 400 nm. In some embodiments, the immune cell microvesicles and / or the donor cell microvesicles are characterized by a diameter of 100 nm or less. In certain embodiments of the methods disclosed herein, the donor transplant comprises one or more organ(s), tissue(s), and / or cells. In certain embodiments of the methods disclosed herein, the donor transplant is selected from the group consisting of heart, lung(s), kidney(s), liver, pancreas, pancreatic islet tissue(s), and pancreatic beta cells. In some embodiments, the donor transplant is heart. In some embodiments, the donor transplant is lung. In certain embodiments, the donor transplant comprises pancreatic islet tissue(s). In certain embodiments, the donor transplant comprises pancreatic beta cells. In some embodiments, the pancreatic beta cells are cultured pancreatic beta cells. In certain embodiments of the methods disclosed herein, the method comprises quantifying the amount and / or relative level of the immune cell microvesicles and comparing the amount and / or relative level of the immune cell microvesicles to the baseline value, wherein an increase of at least about 40% in the amount and / or relative level of the immune cell microvesicles compared to the baseline value indicates rejection of the donor transplant in the 45 53258724.1 Attorney Docket No.047162-7412WO1(02347) subject. In some embodiments, the donor transplant is heart and the method comprises quantifying the amount and / or relative level of the immune cell microvesicles and comparing the amount and / or relative level of the immune cell microvesicles to the baseline value, wherein an increase of at least about 40% in the amount and / or relative level of the immune cell microvesicles compared to the baseline value indicates rejection of the donor transplant in the subject. In certain embodiments of the methods disclosed herein, the at least one immune cell microvesicle biomarker is selected from the group consisting of miR let7i, miR 21a, miR 101b, CD4 protein, CD4 mRNA, CD8 protein, CD8 mRNA, donor-specific T cell receptor (TCR) protein, interferon gamma (IFNγ) mRNA, CD19 mRNA, CD38 mRNA, CD38 protein, HLA-DR mRNA, HLA-DR protein, ICOSL mRNA, CD20 mRNA, IL6-R mRNA, and BAFF-R mRNA, or any combination thereof. In some embodiments, the at least one immune cell microvesicle biomarker is miR let7i. In some embodiments, the at least one immune cell microvesicle biomarker is miR 21a. In some embodiments, the at least one immune cell microvesicle biomarker is miR 101b. In some embodiments, the at least one immune cell microvesicle biomarker is CD4 protein. In some embodiments, the at least one immune cell microvesicle biomarker is CD4 mRNA. In some embodiments, the at least one immune cell microvesicle biomarker is CD8 protein. In some embodiments, the at least one immune cell microvesicle biomarker is CD8 mRNA. In some embodiments, the at least one immune cell microvesicle biomarker is donor-specific TCR protein. In some embodiments, the at least one immune cell microvesicle biomarker is IFNγ mRNA. In some embodiments, the at least one immune cell microvesicle biomarker is CD19 mRNA. In some embodiments, the at least one immune cell microvesicle biomarker is CD38 mRNA. In some embodiments, the at least one immune cell microvesicle biomarker is CD38 protein. In some embodiments, the at least one immune cell microvesicle biomarker is HLA-DR mRNA. In some embodiments, the at least one immune cell microvesicle biomarker is HLA-DR protein. In some embodiments, the at least one immune cell microvesicle biomarker is ICOSL mRNA. In some embodiments, the at least one immune cell microvesicle biomarker is CD20 mRNA. In some embodiments, the at least one immune cell microvesicle biomarker is IL6-R mRNA. In some embodiments, the at least one immune cell microvesicle biomarker is BAFF-R mRNA. In some embodiments of the methods disclosed herein, the at least one immune cell 46 53258724.1 Attorney Docket No.047162-7412WO1(02347) microvesicle biomarker is miR let7i, miR 21a, and / or miR 101b, and the control biomarker is hsa miR 26. In some embodiments of the methods disclosed herein, the at least one immune cell microvesicle biomarker is CD4 protein, CD8 protein, and / or donor-specific TCR protein, and the control biomarker is TSG101 protein. In some embodiments of the methods disclosed herein, the at least one immune cell microvesicle biomarker is miR let7i and / or miR 21a, and the conditional status of the donor transplant is rejection when the relative level of the miR let7i and / or the miR 21a is at least about 4-fold greater than the baseline value. In some embodiments of the methods disclosed herein, the at least one immune cell microvesicle biomarker is miR 101b, and the conditional status of the donor transplant is rejection when the relative level of the miR 101b is at least about 3-fold greater than the baseline value. In some embodiments of the methods disclosed herein, the at least one immune cell microvesicle biomarker is CD4 protein, and the conditional status of the donor transplant is rejection when the relative level of the CD4 protein is at least about 2.2-fold greater than the baseline value. In some embodiments of the methods disclosed herein, the at least one immune cell microvesicle biomarker is CD8 protein, and the conditional status of the donor transplant is rejection when the relative level of the CD8 protein is at least about 2.5-fold greater than the baseline value. In some embodiments of the methods disclosed herein, the at least one immune cell microvesicle biomarker is donor-specific TCR protein, and the conditional status of the donor transplant is rejection when the relative level of the donor-specific TCR protein is at least about 2.2-fold greater than the baseline value. In some embodiments of the methods disclosed herein, the donor transplant is heart, and the at least one donor cell microvesicle biomarker is selected from the group consisting of Troponin T protein, Troponin T mRNA, Troponin I protein, and Troponin I mRNA, or any combination thereof. In some embodiments, the donor transplant is heart, and the at least one donor cell microvesicle biomarker is Troponin T protein. In some embodiments, the donor transplant is heart, and the at least one donor cell microvesicle biomarker is Troponin T mRNA. 47 53258724.1 Attorney Docket No.047162-7412WO1(02347) In some embodiments, the donor transplant is heart, and the at least one donor cell microvesicle biomarker is Troponin I protein. In some embodiments, the donor transplant is heart, and the at least one donor cell microvesicle biomarker is Troponin I mRNA. In some embodiments of the methods disclosed herein, the donor transplant is heart, the at least one donor cell microvesicle biomarker is Troponin T protein, and the control biomarker is TSG101 protein. In some embodiments of the methods disclosed herein, the donor transplant is heart, the at least one donor cell microvesicle biomarker is Troponin T mRNA, and the control biomarker is GAPDH mRNA. In certain embodiments of the methods disclosed herein, the at least one donor cell microvesicle biomarker is Troponin T protein, and the conditional status of the donor transplant is rejection when the relative level of the Troponin T protein is at least about 40% less than the baseline value. In certain embodiments of the methods disclosed herein, the at least one donor cell microvesicle biomarker is Troponin T mRNA, and the conditional status of the donor transplant is rejection when the relative level of the Troponin T mRNA is at least about 60% less than the baseline value. In some embodiments of the methods disclosed herein, the donor transplant is lung(s), the immune cell is a T cell, and the at least one immune cell microvesicle biomarker is CD8 mRNA, IFNγ mRNA, HLA-DR mRNA, or any combination thereof. In some embodiments of the methods disclosed herein, the donor transplant is lung(s), the immune cell is a B cell and the at least one immune cell microvesicle biomarker is CD19 mRNA, CD20 mRNA, CD38 mRNA, IL6-R mRNA, BAFF-R mRNA, IFNγ mRNA, HLA-DR mRNA, ICOSL mRNA, or any combination thereof. Kits In certain non-limiting embodiments, the present disclosure provides for a kit for assessing the conditional status of a donor transplant in a subject, the kit comprising a means (e.g., capturing agent, reagent, technological platform, or combinations thereof) for detecting and / or isolating immune cell microvesicles and / or at least one immune cell microvesicle biomarker from at least one biological sample obtained from the subject. In certain embodiments, the conditional status indicates rejection of the donor transplant, tolerance of the 48 53258724.1 Attorney Docket No.047162-7412WO1(02347) donor transplant, or recovery from rejection of the donor transplant (e.g., after treatment of a rejection event). In certain embodiments, the donor transplant is selected from the group consisting of heart, lung(s), kidney(s), liver, pancreas, pancreatic islet tissue(s), and pancreatic beta cells. In certain embodiments, the donor transplant is heart. In certain embodiments, the donor transplant is lung. In certain embodiments, the donor transplant comprises pancreatic islet tissue(s). In certain embodiments, the donor transplant comprises pancreatic beta cells. In certain embodiments, the pancreatic beta cells are cultured pancreatic beta cells. Types of kits include, but are not limited to, packaged probe and primer sets (e.g. TaqMan probe / primer sets), arrays / microarrays, biomarker-specific antibodies and beads, which further contain one or more probes, primers or other detection reagents for detecting one or more biomarkers of the present disclosure. In certain non-limiting embodiments, a kit can comprise a pair of oligonucleotide primers suitable for polymerase chain reaction (PCR) or nucleic acid sequencing, for detecting one or more biomarker(s) to be identified. A pair of primers can comprise nucleotide sequences complementary to a biomarker, and be of sufficient length to selectively hybridize with said biomarker. Alternatively, the complementary nucleotides can selectively hybridize to a specific region in close enough proximity 5' and / or 3' to the biomarker position to perform PCR and / or sequencing. Multiple biomarker-specific primers can be included in the kit to simultaneously assay a large number of biomarkers. The kit can also comprise one or more polymerases, reverse transcriptase and nucleotide triphosphates (e.g., dNTPs), wherein the nucleotide triphosphates can be further detectably labeled. In certain non-limiting embodiments, a primer can be at least about 10 nucleotides or at least about 15 nucleotides or at least about 20 nucleotides in length and / or up to about 200 nucleotides or up to about 150 nucleotides or up to about 100 nucleotides or up to about 75 nucleotides or up to about 50 nucleotides in length. In certain non-limiting embodiments, the oligonucleotide primers can be immobilized on a solid surface or support, for example, on a nucleic acid microarray, wherein the position of each oligonucleotide primer bound to the solid surface or support is known and identifiable. In certain non-limiting embodiments, a kit can comprise at least one nucleic acid probe, suitable for in situ hybridization or fluorescent in situ hybridization, for detecting the biomarker(s) to be identified. Such kits will generally comprise one or more oligonucleotide probes that have specificity for various biomarkers. 49 53258724.1 Attorney Docket No.047162-7412WO1(02347) In certain non-limiting embodiments, a kit can comprise at least one antibody for immunodetection of the biomarker(s) to be identified. Antibodies, both polyclonal and monoclonal, specific for a biomarker, can be prepared using conventional immunization techniques, as will be generally known to those of skill in the art. The immunodetection reagents of the kit can include detectable labels that are associated with, or linked to, the given antibody or antigen itself Such detectable labels include, for example, chemiluminescent or fluorescent molecules (rhodamine, fluorescein, green fluorescent protein, luciferase, Cy3, Cy5, or ROX), radiolabels (3H, 35S, 32P, 14C, 131I) or enzymes (alkaline phosphatase, horseradish peroxidase). In certain non-limiting embodiments, the biomarker-specific antibody can be provided bound to a solid support, such as a column matrix, an array, or well of a microtiter plate. Alternatively, the support can be provided as a separate element of the kit. In certain non-limiting embodiments, a kit can comprise one or more primers, probes, microarrays, or antibodies suitable for detecting one or more biomarkers. In certain non-limiting embodiments, where the measurement means in the kit employs an array, the set of biomarkers set forth above can constitute at least 10 percent or at least 20 percent or at least 30 percent or at least 40 percent or at least 50 percent or at least 60 percent or at least 70 percent or at least 80 percent of the species of markers represented on the microarray. In certain non-limiting embodiments, a biomarker detection kit can comprise one or more detection reagents and other components (e.g., a buffer, enzymes such as DNA polymerases or ligases, chain extension nucleotides such as deoxynucleotide triphosphates, and in the case of Sanger type DNA sequencing reactions, chain terminating nucleotides, positive control sequences, negative control sequences, and the like) necessary to carry out an assay or reaction to detect a biomarker. A kit can also include additional components or reagents necessary for the detection of a biomarker, such as secondary antibodies for use in immunohistochemistry. A kit can further include one or more other biomarkers or reagents for evaluating other prognostic factors, e.g., stage of rejection. In certain non-limiting embodiments, a biomarker detection kit can comprise one or more reagents and / or tools for isolating donor organ- or tissue-specific extracellular microvesicles from a biological sample. In certain non-limiting embodiments, a biomarker detection kit can comprise one or more reagents and / or tools for isolating subject T cell-specific, subject B cell- 50 53258724.1 Attorney Docket No.047162-7412WO1(02347) specific, donor organ-specific, or donor tissue-specific extracellular microvesicles from a biological sample. A kit can also include reagents necessary for isolating the protein and / or nucleic acids from the isolated extracellular microvesicles. A kit can further contain means for comparing the biomarker with a reference standard, and can include instructions for using the kit to detect the biomarker of interest. In certain embodiments, the instructions describes that the change in the level and / or presence of a biomarker, set forth herein, is indicative that the donor transplant in a subject is being rejected and / or is injured. In certain embodiments, the instructions describe that the change in the level and / or presence of a biomarker, set forth herein, is indicative that the subject is rejecting the donor transplant. In certain embodiments, the instructions describe that the change in the level and / or presence of a biomarker, set forth herein, is indicative of the level of effectiveness of a therapy, e.g., a therapy for treating rejection of a donor transplant, such as immunosuppressive therapy. Reports, Programmed Computers, and Systems The results of a test (e.g., the conditional state of a transplanted organ, tissue, or cells in a subject), or an individual’s predicted drug responsiveness (e.g., response to immunosuppressive therapy), based on assaying one or more biomarkers, and / or any other information pertaining to a test, can be referred to herein as a "report". A tangible report can optionally be generated as part of a testing process (which can be interchangeably referred to herein as "reporting," or as "providing" a report, "producing" a report, or "generating" a report). Examples of tangible reports can include, but are not limited to, reports in paper (such as computer-generated printouts of test results) or equivalent formats and reports stored on computer readable medium (such as a CD, USB flash drive or other removable storage device, computer hard drive, or computer network server, etc.). Reports, particularly those stored on computer readable medium, can be part of a database, which can optionally be accessible via the internet (such as a database of patient records or genetic information stored on a computer network server, which can be a "secure database" that has security features that limit access to the report, such as to allow only the patient and the patient's medical practitioners to view the report while preventing other unauthorized individuals from viewing the report, for example). In addition to, or as an alternative to, generating a tangible report, reports can also be displayed on a 51 53258724.1 Attorney Docket No.047162-7412WO1(02347) computer screen (or the display of another electronic device or instrument). A report can include, for example, an individual's medical history, or can just include size, presence, absence or levels of one or more biomarkers (for example, a report on computer readable medium such as a network server can include hyperlink(s) to one or more journal publications or websites that describe the medical / biological implications, such as increased or decreased disease risk, for individuals having certain biomarkers or levels of certain biomarkers). Thus, for example, the report can include risk or other medical / biological significance (e.g., drug responsiveness, suggested prophylactic treatment, etc.) as well as optionally also including the biomarker information, or the report can just include biomarker information without including disease risk or other medical / biological significance (such that an individual viewing the report can use the biomarker information to determine the associated disease risk or other medical / biological significance from a source outside of the report itself, such as from a medical practitioner, publication, website, etc., which can optionally be linked to the report such as by a hyperlink). A report can further be "transmitted" or "communicated" (these terms can be used herein interchangeably), such as to the individual who was tested, a medical practitioner ( e.g., a doctor, nurse, clinical laboratory practitioner, genetic counselor, etc.), a healthcare organization, a clinical laboratory, and / or any other party or requester intended to view or possess the report. The act of "transmitting" or "communicating" a report can be by any means known in the art, based on the format of the report. Furthermore, "transmitting" or "communicating" a report can include delivering a report ("pushing") and / or retrieving ("pulling") a report. For example, reports can be transmitted / communicated by various means, including being physically transferred between parties (such as for reports in paper format) such as by being physically delivered from one party to another, or by being transmitted electronically or in signal form (e.g., via e-mail or over the internet, by facsimile, and / or by any wired or wireless communication methods known in the art) such as by being retrieved from a database stored on a computer network server, etc. In certain exemplary embodiments, the disclosed subject matter provides computers (or other apparatus / devices such as biomedical devices or laboratory instrumentation) programmed to carry out the methods described herein. For example, in certain embodiments, the disclosed subject matter provides a computer programmed to receive (i.e., as input) the identity of the one 52 53258724.1 Attorney Docket No.047162-7412WO1(02347) or more biomarkers disclosed herein, alone or in combination with other biomarkers, and provide (i.e., as output) the risk (e.g., risk of organ or tissue rejection) or other result (e.g., organ or tissue rejection diagnosis or prognosis, drug responsiveness, etc.) based on the level or identity of the biomarker(s). Such output (e.g., communication of risk, disease diagnosis or prognosis, drug responsiveness, etc.) can be, for example, in the form of a report on computer readable medium, printed in paper form, and / or displayed on a computer screen or other display. In exemplary embodiments, the system is controlled by the individual and / or their medical practitioner in that the individual and / or their medical practitioner requests the test, receives the test results back, and (optionally) acts on the test results to reduce the individual's disease risk, such as by implementing a disease management system. The contents of the articles, patents, and patent applications, and all other documents and electronically available information mentioned or cited herein, are hereby incorporated by reference in their entirety to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference. Applicants reserve the right to physically incorporate into this application any and all materials and information from any such articles, patents, patent applications, or other physical and electronic documents. While the present invention has been described with reference to the specific embodiments thereof, it should be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the true spirit and scope of the invention. It will be readily apparent to those skilled in the art that other suitable modifications and adaptations of the methods described herein may be made using suitable equivalents without departing from the scope of the embodiments disclosed herein. In addition, many modifications may be made to adapt a particular situation, material, composition of matter, process, process step or steps, to the objective, spirit and scope of the present invention. All such modifications are intended to be within the scope of the claims appended hereto. Having now described certain embodiments in detail, the same will be more clearly understood by reference to the following examples, which are included for purposes of illustration only and are not intended to be limiting. EXPERIMENTAL EXAMPLES The invention is further described in detail by reference to the following experimental 53 53258724.1 Attorney Docket No.047162-7412WO1(02347) examples. These examples are provided for purposes of illustration only, and are not intended to be limiting unless otherwise specified. Thus, the invention should in no way be construed as being limited to the following examples, but rather, should be construed to encompass any and all variations which become evident as a result of the teaching provided herein. Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the compounds of the present invention and practice the claimed methods. The following working examples therefore, specifically point out the preferred embodiments of the present invention, and are not to be construed as limiting in any way the remainder of the disclosure. Example 1: Circulating T cell specific extracellular microvesicle profiles in cardiac allograft acute cellular rejection Materials and Methods Study Design: Schematic of the study design is shown in FIG.1. All animals were purchased from Jackson Laboratory (Bar Harbor, ME). C57BL / 6 (MHC H2-Kb) immunocompetent wild type and C57BL / 6 immunodeficient (MHC H2-Kb Prkdc SCID) mice served as recipients. BALB / c (MHC H2-Kd) and C57BL / 6 (for syngeneic control) mice served as heart donors. The study included Rejection, Maintenance, and Control arms. In the Rejection arm, full MHC mismatch (BALB / c into C57BL / 6) heart transplants were performed, resulting in ACR with allograft asystole by day 12 to 14. Recipients were sacrificed for plasma sEV analysis and allograft histology on days 1, 2, 3, 4, 5, 7, 9, 11, 15, and 30 (n = 58 total). In the Maintenance arm, full MHC mismatch heart transplant was performed into C57BL / 6.SCID immunodeficient recipients, and as these animals lack T and B cells, they accepted the allograft long-term. This was done to assess the noise versus signal in the CD3 (T cell) sEV subpopulation in peripheral blood for 2 reasons: 1) to understand contribution of donor passenger T cells to the recipient plasma CD3 sEV signal, and; 2) to confirm that, outside of T cells, there are no other major contributions from other immune cell types to the plasma CD3 sEV signal. Recipients were sacrificed on days 1, 2, 4, 7, 11, and 30 (n = 30 total), and recipient plasma sEV and donor heart histologic analysis were performed. Control arm comprised of syngeneic transplants (C57BL / 6 into C57BL / 6) to understand the baseline T cell sEV signal and variations in it secondary to the transplant procedure itself, not secondary to allogenicity. Animals were 54 53258724.1 Attorney Docket No.047162-7412WO1(02347) sacrificed on days 1, 2, 4, 7, 9 (n=15 total). For next generation sequencing, sEV cargo analysis, and apoptosis assay additional full MHC mismatch transplants were performed, and animals were sacrificed on days 4 and 7 (n=34), and additional syngeneic transplants were performed, and recipients sacrificed on day 7 for apoptosis assay (n=6). Heterotopic heart transplantation and post-transplant monitoring: The heterotopic heart transplantation procedure was previously described (Ratajczak and Ratajczak, Leukemia. 2020;34(12)). Animals were anesthetized with ketamine and xylazine, and donors received 200 units heparin after which the heart was explanted. Recipient abdominal aorta and inferior vena cava was exposed, and the donor heart pulmonary artery to vena cava and donor aorta to recipient aorta anastomoses were performed to complete the allograft / isograft implantation. Allograft was assessed daily via percutaneous palpation and heart rate monitoring until the animal was sacrificed or until asystole. Mouse plasma sEV isolation: sEVs were isolated from 250 ul to 300 ul of C57BL / 6 mouse and BALB / c mouse plasma samples using size exclusion chromatography along with ultracentrifugation (Vallabhajosyula, et al., J Clin Invest.2017;127(4): 1375-1391; Habertheuer, et al., J Thorac Cardiovasc Surg.2018;155(6); Habertheuer, et al., Transplantation. 2022;106(4)). Based on recommendations per MISEV 2018 position statement,17EVs investigated in this study are categorized as small EVs <200 nm (sEVs). In the manuscript, the distinct subpopulation of CD3-bearing small EVs enriched based on anti-CD3 antibody bead incubation with whole plasma sEVs is referred to as “T cell sEVs”. Plasma was centrifuged at 500g for 10 minutes to eliminate cell debris and the clear supernatant passed through a Sepharose 2B column (Sigma-Aldrich, St. Louis, MO) and the eluent was collected in 100 μl fractions. sEV fractions were pooled after monitoring absorbance at 280 nm. The pooled fractions were filtered through a 100 kilodalton cut-off membrane and then ultracentrifuged at 120,000 g for 2 hours at 4 °C. The pelleted sEV fraction was resuspended in 1X PBS and after quality assessment by nanoparticle detector analysis and Western blot for exosome marker expression, it was utilized for downstream applications. Per the International Society of Extracellular Microvesicles position statement for minimal information for studies of extracellular vesicles 2018 (MISEV2018), sEVs were characterized by protein content (transmembrane proteins CD63, CD81), cytosolic proteins recovered in sEVs (TSG101, flotillin- 1, alix), and sEV purity control assessing for absence of apolipoprotein and cytochrome c 55 53258724.1 Attorney Docket No.047162-7412WO1(02347) (Thery, et al., J Extracell Vesicles.2018;7(1)). sEVs were quantified by total protein amount and by total particle number on the nanoparticle detector. Electron microscopy: Transmission electron microscopy analysis was performed to identify sEVs isolated from mouse plasma, Jurkat cell culture supernatant, and human plasma sEVs containing 250 μg / μl of protein equivalent in 10 μl volume was applied onto 200-mesh copper grids (Quantifoil R1.2 / 1.3). Images were recorded on Falcon III direct electron detector at a magnification of 25,000x. Antibodies: Anti-mouse CD3 antibody (Santa Cruz Biotechnologies Inc., Santa Cruz, CA) was utilized for nanoparticle detector (Nanosight NS300) fluorescence staining. Secondary antibodies and isotype controls (anti-rabbit, anti-mouse, rabbit IgG, and mouse IgG) were also purchased from Santa Cruz Biotechnologies. Anti-rabbit, and anti-mouse conjugated quantum dot (605 nm) were purchased from Life Technologies (Grand Island, NY) and utilized per manufacturer’s protocol for nanoparticle detector fluorescence analysis. Antibodies used in this study for sEV protein analysis were purchased from various manufacturers and used according to the manufacturer suggested dilutions and conditions for Western blot analysis (FIG.11). Enrichment of CD3-expressing small sEVs from mouse and human plasma: Anti-CD3 monoclonal antibody was conjugated to N-hydroxysuccinamide (NHS) magnetic beads (ThermoFisher, MA). Conjugation of Antibody to NHS- beads and separation of specific EVs: 1x109to 1x1010sEVs were used for 10μl to 100μl of NHS-beads according to the experiments performed in this study. NHS beads were washed 3 times with sterile 1x TBS in 1.5ml Eppendorf tube in a volume of 750μl per wash. Dyna Mag 2 (Life Technologies, NY) magnetic stand was used to remove the unwanted NHS beads storage buffer and 3 times prewashed with 1 X TBS buffer. Prewashed beads were equilibrated with 1 X TBS for 10 minutes at room temperature and the 1 X TBS was removed by placing the tube on magnetic stand. Anti-CD3ε antibody (50 μg for 1x1010sEVs) was added to the prewashed beads in 1 X TBS working volume of 500 microliters. Beads were rotated for 2-3 hours at room temperature, and the unbound antibody was separated using magnetic stand. Antibody bound beads were washed one time with 1 X TBS to remove the unbound antibody completely and the bound beads were re-diluted in 1XTBS. Antibody conjugated NHS-beads were added to total sEVs in 1.5 ml Eppendorf tube and rotated for 3 56 53258724.1 Attorney Docket No.047162-7412WO1(02347) hours to overnight at 4oC. Eppendorf tubes were placed on magnetic stand to remove unbound sEVs and saved as unbound sEVs fraction. Specific sEVs bound to beads were washed one more time with 1XTBS and used for downstream protein and RNA cargo analysis. Bead bound EVs elution. sEVs bound to the beads were incubated with elution buffer (2M Glycine-pH 2.5) in 1.5 ml Eppendorf tube for 5 minutes at room temperature and neutralized with 1M Tris (pH 8.0) in a ratio of 1:10. Eppendorf tube placed on the magnetic stand to collect the released sEVs from beads and applied for downstream applications. In the manuscript, this distinct subpopulation of CD3-bearing small EVs enriched based on anti-CD3 antibody bead incubation with whole plasma sEVs is referred to as “T cell sEVs”. Nanoparticle detector tracking analysis (NTA): sEVs were analyzed on the NanoSight NS300 nanoparticle detector on the light scatter mode for quantification and size distribution (Malvern Instruments Inc., Westborough, MA). Experimental sample analysis was performed using NTA3.4 software. T cell specific surface marker detection on EVs was performed using the fluorescence mode. Secondary antibody conjugated to quantum dot with emission at 605 nm was utilized for fluorescence detection against specific surface proteins as described previously [Vallabhajosyula, P., et al., J Clin Invest, 2017.127(4): p.1375-1391; Habertheuer, A., et al., J Thorac Cardiovasc Surg, 2018.155(6): p.2479-2489]. T cell specific EV signal was quantified according to Equation 1: T cell specific EV signal = Equation 1 RNA and protein cargo analysis: RNA was extracted from T cell sEVs using Trizol reagent per manufacturer protocol (Qiagen, Germany). For protein isolation, sEVs were lysed in 1X RIPA buffer with 1X protease inhibitor cocktail (Sigma-Aldrich Co., St. Louis, MO). Protein concentration was measured using bicinchoninic acid assay. For each sample 500 μl of Trizol and 100μl chloroform was added and centrifuged at 12,800g for 10 minutes. After centrifugation, the top clear solution was mixed with 2.5 volumes of isopropanol and stored at -80 °C for 1 hour to overnight. Next, sample was centrifuged at 12,800g for 10 minutes and the RNA pellet was washed with 75% ethanol and dissolved in RNAse free water. RNA concentration was estimated 57 53258724.1 Attorney Docket No.047162-7412WO1(02347) on NanoDrop One (ThermoScientific, Waltham, MA). Western blot analysis: sEVs were lysed and separated on polyacrylamide gel, transferred onto nitrocellulose membrane (Life Technologies). The blot was blocked, incubated with desired antibody as per manufacturer protocol. Horseradish peroxidase coupled secondary antibody (Santa Cruz Biotechnologies) was added for 1 hour and target protein was detected by chemiluminescence using Image quant LAS 400 Phospho-Imager (GE). Quantification of the bands was performed using Image Quant software. Reverse transcription PCR (RT-PCR): Total RNA (25 ng to 50 ng) was reverse transcribed with the SuperScript III one-step RT-PCR system (Life Technologies) for gene expression validation per manufacturer protocol using the following primers shown in Table 1: Table 1: Primer sequences Gene Forward Reverse CD3 ^AAGTCGAGGACAGTGGCTACTACCATCAGCAAGCCCAGAGTGATACA (SEQ ID NO: 1) (SEQ ID NO: 2) IFN- ^TCAAGTGGCATAGATGTGGAAGAATGGCTCTGCAGGATTTTCATG (SEQ ID NO: 3) SEQ ID NO: 4) CXCL10GGATGGCTGTCCTAGCTCTGATAACCCCTTGGGAAGATGG (SEQ ID NO: 5) (SEQ ID NO: 6) Foxp3CAGCTGCCTACAGTGCCCCTAGCATTTGCCAGCAGTGGGTAG (SEQ ID NO: 7) (SEQ ID NO: 8) IL2CCTGAGCAGGATGGAGAATTACATCCAGAACATGCCGCAGAG (SEQ ID NO: 9) (SEQ ID NO: 10) ^-actinGGCTGTATTCCCCTCCATCGCCAGTTGGTAACAATGCCATGT (SEQ ID NO: 11) (SEQ ID NO: 12) TCRGTGGGTGAATGGCAAGGAGGTCCACGGTTTGGGTGAGCCCTCTGGC (SEQ ID NO: 13) (SEQ ID NO: 14) Quantitative reverse transcription PCR (RT-qPCR): Synthesis and amplification of cDNA was performed using TaqMan Advanced miRNA cDNA synthesis kit (A28007) from Applied Biosystems. Ct values were analyzed by the 2-(ddCt) method [Livak and Schmittgen, Methods, 2001.25(4): p.402-8]. Synthesis and amplification of cDNA was performed using TaqMan Advanced miRNA cDNA synthesis kit (A28007) from Applied Biosystems. TaqMan advanced miRNA assays were conducted using 50 ng of RNA for let7i (mmu481511_mir), miR- 21a-5p (mmu482709_mir), and miR-101b-3p (mmu482594_mir). Poly(A) tailing reactions, adaptor ligation reactions, reverse transcription reactions and miR-Amp reactions were performed according to the kit instructions. For TaqMan advanced PCR, the miR-Amp cDNA 58 53258724.1 Attorney Docket No.047162-7412WO1(02347) template product was diluted 10-fold and 5 ul were used for PCR assay using Taqman Fast Advanced Master mix (2X) and Taqman Advanced specific miRNA assay (20X) in 15 ul volume of reaction per well. Reactions were performed in Quant Studio 3 qPCR system (Applied biosystems), using 40 cycles, at the following conditions: 95°C for 1 second and anneal / extend at 60°C for 20 seconds. The Ct values of individual miRNAs in the TaqMan Advanced miRNA were derived using the TaqMan system software. All the RT-qPCR reactions were performed in duplicate. Ct values were analyzed by the 2-(DDCt) method The levels of each miRNA were normalized by the level of has-miR-26b as internal control. Normalized expression in the Rejection arm samples were expressed as fold difference compared to normalized expression in time matched syngeneic controls set at a value of 1. Next generation sequencing (NGS) of T cell sEV miRNA cargoes: RNA extracted from specific sEVs bound to NHS-CD3 was used for NGS at University of Pennsylvania RNA Core Facility. Quality control tests of the total RNA samples were done by using the Agilent Bioanalyzer and Nanodrop spectrophotometry at the RNA Core Facility. Library preparation and sequencing. sEV RNA samples were assayed for quantity and quality with Agilent 2100 Bioanalyzer and the Agilent RNA 6000 Pico Kit (Agilent Technologies, no.5067-1513). Libraries were prepared using the QIAseq miRNA Library Kit (Qiagen, catalogue no.331502) per protocol in the sample preparation guide. Libraries were assayed for overall quality and quantified using the High Sensitivity DNA Kit for the Agilent 2100 Bioanalyzer (Agilent Technologies, no.5067-4626). Samples were multiplexed for sequencing, then 100-base-pair (bp) single-read sequencing of a multiplexed pool of samples was conducted on an Illumina HiSeq 4000 sequencer. Illumina bcl2fastq v.2.20.0.422 software was used to convert bcl to demultiplexed fastq files. Trimming adaptor sequence and unique molecular identifier extraction. The library preparation kit, when sequenced to 100 bp, produces reads with a unique molecular identifier, as well as fixed or nearly fixed sequences. The program ‘cutadapt’ was used to remove the trailing adaptor AGATCGGAAGAGCACACGTCT (SEQ ID NO: 15), with settings ‘-m 36 –max-n 1’. Next, the putative small RNA sequence was extracted using a custom R script. Briefly, those trimmed reads with more than three N or <55 bases in length, or those that did not contain an exact match to the sequence AACTGTAGGCACCATCAAT (SEQ ID NO: 16), were dropped. The last 12 bases of reads were trimmed and recorded as the unique molecular identifier. The 19 59 53258724.1 Attorney Docket No.047162-7412WO1(02347) bases matching the inner adaptor sequence were trimmed, and the leading sequence was retained as the small RNA sequence, appended to the def-line, and the trimmed read and base qualities were saved in FASTQ format. T cell sEV miRNA cargo analysis: miRNA reads were processed and analyzed using the GeneGlobe QIAseq miRNA Library Kit – Primary Quantification (Qiagen). Reads were filtered to remove miRNAs with < 2 counts and normalized by the trimmed mean of M values method. Log CPM values were used for subsequent analysis. Principal component analysis was performed using the built-in prcomp method in R (version 4.0.2). Differential miRNA expression for day 4 and day 7 EVs (n=6) was computed using edgeR (version 3.30.3) to determine the fold change (fc) and p-value. Hierarchical clustering using Euclidean distance and complete-linkage clustering was performed for the 31 up and downregulated microRNAs (|fc| > 2, p < 0.15). Gene targets of the differentially expressed miRNAs were determined by at least 3 validated experiments using miRTarBase (http: / / mirtarbase.mbc.nctu.edu.tw / ). miRNA gene targets were evaluated for fit to Gene Ontology Biological Process (GO: BP) pathways using STRING (https: / / string-db.org / ). Significantly enriched apoptotic or immune-related pathways were then selected by false discovery rates (FDR) <0.05 using REVIGO [Supek, et al., PLoS One, 2011. 6(7): p. e21800]. Fluorescence activated cell sorting (FACS): Blood samples were collected using EDTA tubes and subsequently stained with the following anti-mouse cell-surface markers: CD3 (BioLegend, CA), CD4 (BioLegend), CD8 (BioLegend), CD19 (BD Pharmingen), and B220 (BioLegend). For each sample, 10 μL of whole blood was incubated with a mastermix containing the antibodies for 20 minutes at room temperature in the dark. Samples were analyzed on BD LSR Fortessa flow cytometer (BD Biosciences, NJ), first gated using FSC-A by SSC-A, then single cells using FSC-A by FSC-H. This population was divided into B220+ / CD19+ cells and CD3+ cells divided into CD4+ / CD8+ cells. Percentage of the parent population were analyzed using FlowJo software. Cardiomyocyte isolation and culture: Primary cardiomyocytes were isolated from whole heart preparations according to previously described protocols [Bustamante, et al., Can Med Assoc J, 1982.126(7): p.791-3; Tian, et al., STAR Protoc, 2020.1(2): p.100045]. Apoptosis assay was performed using Click-iT™ Plus TUNEL assay for in situ apoptosis detection, using Alexa Fluor™ 647 dye kit (C10619-ThermoFisher, MA) following the manufacturer suggested 60 53258724.1 Attorney Docket No.047162-7412WO1(02347) protocol. Primary cardiomyocytes were isolated from whole heart preparations. Briefly, specimen was mechanically dissociated using sharp dissection at room temperature into 5 mm2myocardial pieces and further digested using collagenase type II (275 u / mL), protease XXIV (1.2 u / mL) in an oxygenated reaction chamber maintained at 37°C with continuous agitation. The cardiomyocyte containing supernatant was strained through a 250 µM nylon cell strainer and further purified with centrifugation at 30g for 5 minutes at room temperature. Cardiomyocytes were then resuspended in myocyte growth media and plated on a laminin coated culture vessel at a density of 2-6 x 104cells / cm2and incubated at 37 ^C, 5% CO2. Non-cardiomyocyte cell types were selected against by addition of 10 µM cytarabine to culture medium. Apoptosis assay: Apoptosis assay was performed by using Click-iT™ Plus TUNEL assay for in situ apoptosis detection, using Alexa Fluor™ 647 dye kit (C10619-ThermoFisher Scientific) following the manufacturer suggested protocol. Briefly, cardiomyocytes from C57BL / 6 (syngeneic) mouse and BALB / c (allogeneic) mouse were maintained on 20 mm coverslips coated with laminin and incubated with Control (syngeneic) arm T cell specific EVs or Rejection arm T cell specific EVs (250 ng protein equivalent EVs per well) for 24 hours. Plasma from 7 rejection arm animals and 4 control arm animals was used for TUNEL assay experiments.1X PBS was used as background control. Cells were washed and fixed with 3.7% formaldehyde. TUNEL assay was conducted with the in-situ Cell Death Detection Kit, to assess for in-situ DNA fragmentation and quantified by fluorescence microscopy. The cells with TUNEL-labelled nuclei (red color) represented as TUNEL-positive cells, and blue stain DAPI labelled all cell nuclei. The fraction of apoptotic nuclei was then measured for each experimental condition and expressed as the frequency of TUNEL+ nuclei in three, randomly selected and non-overlapping microscope fields. The statistical significance between the rejected mouse EVs treated and syngeneic mouse EVs treated groups was determined by Student’s t test (p<0.05 for significance). Two independent experiments were performed. Human blood plasma collection and sEV characterization: Approval was obtained from University of Pennsylvania Institutional Review Board (Protocol 831237). In 4 patients undergoing heart transplantation, blood samples were collected at time of surveillance endomyocardial biopsy (EMB) for EV characterization. Blood samples were collected up to 100 days postoperatively, along with clinical and EMB information. EV characterization was 61 53258724.1 Attorney Docket No.047162-7412WO1(02347) performed as previously described [Ratajczak and Ratajczak, Leukemia, 2020, 34: 3126-3135; Sedgwick and D’Souza-Schorey, Traffic, 2018.19(5): 319–327]. Isolation and Western blot analysis of T cell sEVs from human plasma: Affinity antibody coupled bead purification method was adopted for T cell specific sEV isolation. Anti-CD3 monoclonal antibody was covalently conjugated to N-hydroxysuccinamide beads (ThermoFisher Scientific, Waltham, MA) and incubated with 75 µg protein equivalent of sEVs overnight at 4°C. The bead bound sEVs were eluted per manufacturer protocol and utilized for Western blot analysis. Equal amounts of sEV protein from different postoperative time points were separated on polyacrylamide gels, transferred onto nitrocellulose membrane (Life Technologies, Carlsbad, CA), blocked overnight, and incubated with specific primary antibodies and secondary antibodies conjugated to horseradish peroxidase. Chemiluminescence was detected by using Image quant LAS 400 Phospho-Imager (GE). Stem loop RT-qPCR of miRNAs in human T cell sEVs: RNA cargo from circulating T cell EVs was enriched using anti-CD3 antibody conjugated bead methodology, and cDNA synthesis was performed using TaqMan miRNA reverse transcription kit (4366596, Applied Biosystem) for (RT specific) hsa-let-7i (ID: 002221), hsa-miR-21a (ID:000397), and hsa-miR-101b (ID:002253) according to the manufacturer suggested conditions. Then, the reverse transcription product was mixed with specific TaqMan miRNA assay TM primers in TaqMan universal PCR master mix, no AmpErase-UNG (4324018) for amplification. The PCR reaction was conducted at 95°C for 5 min, 50 repeated cycles of 95°C for 5 seconds, and then 60°C for 1 minute. All RT- qPCR Ct values were analyzed by the 2-(DDCt) method. The levels of each miRNA were normalized by the expression level of hsa-miR-26b as internal control provided in the TaqMan miRNA assay. Human T cell receptor sequencing from T cell specific sEVs: Circulating T cell EV RNA was extracted using Trizol reagent (Life technologies) followed by phenol-chloroform extraction. After quality control, 500 ng of total RNA was converted to complementary DNA (cDNA) using the protocol described in high-capacity cDNA reverse transcription kit (Applied Biosystems, ref 4368814), and the synthesized cDNA was submitted to Adaptive Biotechnologies for TCR sequencing (immunoSEQ hsTCRB-v4b). In 4 patients with grade 2 ACR episodes as confirmed by endomyocardial biopsy, time points with and without grade 2 62 53258724.1 Attorney Docket No.047162-7412WO1(02347) ACR were chosen for TCR sequencing to assess whether TCR mRNA inside T cell EVs can represent functional clones with intact complementarity determining region 3. Statistical Analysis: First, data were checked for distribution. Statistical significance for parametric data was assessed by independent sample t test (2-tailed) for continuous variables with 2 groups (Control arm versus Rejection arm for miRNA expression) and repeated-measures analysis of variance (ANOVA) for continuous variables with more than 2 groups. Fisher’s exact test was used to assess associations between categorical variables (Control arm and Rejection arm groups for apoptosis assay). General statistics were assessed using StataMP version 14.2 (StataCorp LP, Texas), and scatter plots and NanoSight panels were constructed using Prism version 7.0 (GraphPad, California). All reported tests were 2-tailed and alpha level was set to 0.05. Results Jurkat T cells release sEVs carrying T cell specific surface markers in vitro: Jurkat T cells were cultured in EV-free media, and supernatant was collected for sEV isolation. sEV phenotype was characterized by NTA (FIG.2A), electron microscopy (FIG.2B), and protein marker expression (FIG.2C) per MISEV guidelines. On Western blot, in addition to exosome marker expression (CD63, flotillin-1, and TSG101), T cell markers CD4, CD8, and T cell receptor (TCR) were also detected (FIG.2C). ACR leads to time specific changes in circulating T cell sEV quantities: Plasma EVs were isolated at several time points in the three study arms and quality checked for size distribution on NTA (FIG.3A), electron microscopy (FIG.3B), and protein expression (FIG.3C) per MISEV guidelines. That whole plasma EV profiles are similar in Rejection versus Maintenance arms was previously demonstrated [Habertheuer, A., et al., J Thorac Cardiovasc Surg, 2018.155(6): p. 2479-2489]. T cell sEV subpopulation was quantified within the total plasma sEV pool using anti-CD3 antibody conjugated quantum dots on NTA fluorescence mode. Representative signals for T cell EV subpopulation for the Control, Maintenance, and Rejection arms are shown (FIGs. 3D, 3E, 3F). For each study arm, serial blood samples from single animal were analyzed over several time points to assess if CD3 sEV signal varied with ACR. In the Control (syngeneic C57BL / 6 into C57BL / 6) and Maintenance (BALB / c into C57BL / 6 SCID) arms, CD3 sEV signal remained near baseline levels over follow-up (FIGs.3D, 3E). In the Rejection arm, T cell sEV 63 53258724.1 Attorney Docket No.047162-7412WO1(02347) signal increased by day 4, peaked around day 7-8, and decreased to baseline levels by day 15 post-transplant (FIG.3F) when allograft rejection was complete. Based on these findings, more heart transplants were performed to characterize T cell sEVs during ACR. Scatter plot display of circulating T cell sEV signal for the Maintenance, Control, and Rejection arms is shown in FIG.4A. This demonstrated that T cell sEV quantities were significantly elevated in a time dependent manner in the Rejection arm only (p<0.001) compared to Maintenance (p=0.43) and Control arms. Considering the possibility that this signal change with ACR may be just reflecting concomitant changes in circulating T cell numbers, a FACS analysis was performed of PBMCs in the Control and Rejection arms for quantitative expression of CD3+ T cells and their helper (CD4) and cytotoxic (CD8) subpopulations (FIGs.4B, 4C-4E). CD3+ T cell quantities or the distribution of CD4+ and CD8+ T cell subpopulations were not significantly altered in the peripheral blood in Day 0 versus Day 7 post-transplant time points (FIGs.4C-4E). By two-way repeated measures ANOVA, CD3 T cells (p=0.27), CD4 T cells (p=0.49), and CD8 T cells (p=0.11) were not significantly altered between Rejection and Control arms (FIG.4F). Taken together, this suggests that ACR leads to time specific changes in circulating T cell sEV signal, without significant alterations in the peripheral blood CD3 T cell pool. Circulating T cell sEV cargoes are altered during ACR: Having demonstrated quantitative changes in T cell sEVs with ACR, whether their intra-EV cargoes are also altered during ACR was assessed. Whether T cell sEVs carry immunoregulatory markers typically associated with ACR was analyzed. As T cell sEV levels peaked from baseline values between days 4 to 7, cargo analysis was performed at these 2 time points. From total plasma sEVs, T cell sEVs were purified using antibody conjugated bead technology (FIG.5A). The unbound sEV fraction was analyzed for absence of T cell markers, CD3, CD4, and CD8, by Western blot (FIG.5B). To confirm that intact sEVs were successfully enriched, bead-bound sEVs were eluted and checked on NTA for detection of nanoparticles in the sEV range (FIG.5C). Anti- CD3 antibody bead-bound sEVs showed expression of CD4, TCR, and immunoregulatory markers, including IFNγ, FoxP3, and Serca-2 (FIG.5D). These markers were upregulated in day 7 compared to day 4 samples in Rejection arm but remained unchanged at low levels in Control arm. T cell sEV mRNA cargoes also showed increased expression of CD3ε, TCR, IFN ^, and IL2 by RT-PCR on day 7 time point in Rejection arm but not Control arm (FIGs.5E – 5F). 64 53258724.1 Attorney Docket No.047162-7412WO1(02347) Collectively, this suggests that T cell sEVs carry immunoregulatory protein and mRNA markers and ACR leads to changes in the expression of these markers. T cell sEV miRNA cargo profiles. NGS of miRNA cargoes of circulating T cell sEVs was performed to: (i) assess for candidate biomarkers of ACR, and (ii) provide mechanistic insights into potential functional roles of T cell sEVs. T cell sEV RNA cargo from 5 animals in Rejection arm was pooled for single NGS analysis, with 3 such separate experiments performed for days 4 (n=15) and 7 (n=15). Principal component analysis showed clear distinction between days 4 versus 7, with one pooled outlier (FIG.6A). Differential expression analysis of T cell sEV cargo was performed (FIG.6B) and identified top 31 differentially expressed miRNAs in days 4 versus 7 (FIG.6C). To determine their biological significance, experimentally validated miRNA gene targets were identified with miRTarBase and pathway analysis was performed which showed changes in immune regulatory processes in accordance with the temporal flow of the ACR process (FIG.6D). Day 4 miRNA cargoes, representing early stages of ACR, showed selective targeting of immune pathways involved in regulation of B cell activation, T cell differentiation, adaptive immune response, lymphoid organ development, and lymphocyte activation (FIGs.6D, 6E). Selective upregulation of apoptotic pathways was noted for day 7: regulation of programmed cell death, cytochrome c release from mitochondria, apoptotic process, and positive regulation of cell death (FIGs.6D, 6E), consistent with donor cytotoxicity associated with ACR. Next, the major miRNA targets implicated in these processes were assessed. Gene targets with > 2 miRNA hits from the 31 differentially expressed miRNAs (FIG. 6C) are shown (FIG.6F). Several of these gene targets are implicated in apoptosis pathways, especially HDAC4, PTEN, BCL2, IL-6, MEF2c, and SMAD7. Taken together, miRNA cargo pathway analysis indicated that T cell sEVs likely play a pathophysiologic role in facilitating ACR. Specific T cell sEV miRNAs serve as candidate biomarkers of ACR. To understand the diagnostic potential of T cell EV cargoes as candidate biomarkers of ACR, based on differential expression and principal component analyses of NGS data, stem loop RT-qPCR assays were developed for 3 candidate miRNAs that were detected by principal component analysis (i.e. let7i, miR 21a, and miR 101b). Syngeneic (n=5) and full MHC mismatch (BALB / c into C57BL / 6) (n=5) transplants were performed, T cell EV RNA cargoes were harvested, and RT-qPCR was performed for the 3 candidate miRNAs. Expression patterns in Rejection (n=5) versus Control 65 53258724.1 Attorney Docket No.047162-7412WO1(02347) (n=5) arms showed significant upregulation of all 3 tested candidate biomarkers with ACR (FIGs.7A-7C). T cell sEVs released secondary to alloactivation independently mediate donor tissue specific apoptosis. Given findings suggesting upregulation of alloreactivity and apoptosis pathways in T cell sEVs with ACR, whether T cell sEVs can independently mediate allogeneic donor specific cytotoxicity was tested. BALB / c (donor) or C57BL / 6 (recipient) cardiomyocytes were incubated with either total plasma sEVs, T cell sEVs, CD3 antibody unbound sEVs, or plasma secretome in sEV preparations of day 7 samples from Rejection or Control arms (FIG. 8A). Cytotoxicity was assessed by TUNEL assay. Control arm sEV samples and secretome did not mediate apoptosis of either BALB / c (allogeneic) or C57BL / 6 (syngeneic) cells (FIGs.8B, 8E) compared to DNase I treated positive controls (FIGs.8D, 8G). C57BL / 6 cells treated with sEV fractions and secretome from Rejection arm also did not show any apoptosis (FIG.8F). But BALB / c cells treated with Rejection arm total plasma sEVs and CD3+ sEVs showed positivity by TUNEL assay (FIG.8C). Apoptosis rates were significantly higher for BALB / c cells treated with Rejection arm CD3+ sEVs compared to any other study group (p<0.0001, FIG.8H), except for Rejection arm total plasma sEVs (p=0.28). Cytotoxic T cell mediated apoptosis occurs via granule (containing granzymes and perforin) dependent exocytosis pathway and Fas-FasL pathway. Therefore, whether T cell sEVs express these markers was assessed. On Western blot, expression of Fas ligand, granzyme B, and perforin were seen in the enriched plasma T cell sEV subpopulations in the naive, syngeneic recipient, and allogeneic recipient animals, but higher expression levels were seen in the Rejection arm (FIGs.8I, 8J). CD38 and MHC II, markers of T cell activation status, were also upregulated in Rejection arm T cell sEV subset. Collectively, this suggests that a subset of circulating T cell sEVs during ACR carry functional capabilities to mediate donor specific cytotoxicity in vitro, and express pro-apoptotic and activation markers like their cytotoxic T cell counterparts. Circulating T cell sEVs can be detected in clinical heart transplantation. To understand whether similar ACR-specific changes occur in circulating T cell sEV physiology in the clinical setting, this platform was investigated in heart transplant patients. In 3 patients with ACR episodes as diagnosed by endomyocardial biopsy, time-matched blood samples were obtained for T cell sEV profiling (FIG.12). Grade >2 ACR is clinically significant, mandating treatment with additional immunosuppression and repeating endomyocardial biopsy to confirm reversal of grade 66 53258724.1 Attorney Docket No.047162-7412WO1(02347) >2 ACR to grade 0 or 1 ACR. Plasma sEVs were characterized by electron microscopy (FIG. 9A), NTA (FIG.9B), and Western blot for EV markers (FIG.9C) per MISEV guidelines. Methodology for enrichment of CD3-expressing sEVs in mouse model was translated to clinical setting. Anti-CD3 antibody bead-bound sEVs were eluted and analyzed by NTA to confirm enrichment of intact sEVs (FIG.9D). This fraction was studied by Western blot for confirmation of expression of T cell markers, with their absence in the unbound fraction (FIGs.9E, 9F). In all 3 patients, T cell intra-sEV cargoes showed upregulation of IFNγ, granzyme B, perforin, Fas ligand, human leukocyte antigen class II, and CD38 by Western blot at time points of grade 2 ACR (FIGs.9G-9I). Resolution of grade 2 ACR led to corresponding decrease in expression of these activation markers in the T cell sEV subset. Next, whether the three tested candidate T cell sEV miRNAs in the rodent ACR model may also be differentially regulated in clinical heart transplantation was assessed. By stem loop RT-qPCR, miR let7i, miR 101-b, and miR 21a expression in circulating T cell EVs demonstrated upregulation of the candidate miRNAs with grade 2 ACR episodes in all 3 patients (FIGs.9J-9L, FIGs.13A-13C). Grade 0 ACR by EMB correlated with the baseline signal assessed on postoperative day (POD) 1. Taken together, these findings suggest that the circulating T cell sEV physiology of ACR detailed in the rodent model may also occur during ACR in the clinical setting. Collectively, these findings support the idea that targeted cytotoxicity of T cell EVs is mediated through intact, donor antigen specific TCRs on T cell EVs. Given the detection of intra-EV TCR mRNA and protein, whether T cell clones with intact complementarity determining region 3 sequences can be sequenced from the circulating T cell EV subset in the clinical setting was assessed. In 4 heart transplant patients during time points of grade 0 or grade 2 ACR, productive TCR sequences were successfully identified, with 38 unique functional clones (Table 2). Clustering analysis of these 38 sequences against a large reference dataset containing 20 million TCRs demonstrated that only one TCR sequence clustered, indicating that the other 37 TCRs were unique to this cohort (Table 3). This suggested that T cell EVs may carry clone-specific TCRs, potentially facilitating targeted injury to the donor cardiomyocytes via functional TCR expressed as part of their cargo. Table 2: Past-filter TCR sequences with intact complementarity determining region 3 in 4 heart transplant patients with moderate grade 2 ACR events for 11 studied time points is shown. TCR 67 53258724.1 Attorney Docket No.047162-7412WO1(02347) sequences with non-productive CDR3, failed TRBV calls or missing conserved motifs were removed. TRB Clonal CDR3 Sequence Variable- FrequenRank Sample NamegenecyCASSQSRPIIHHNSPLHF TRBV3- 0.2222222222 1 Patient 2_POD- (SEQ ID NO: 17) 1*01 22222 0_NO_REJ_TCRB.tsv CASRSILQHARNTIYF TRBV21- 0.0769230769 1 Patient (SEQ ID NO: 18) 1*01 230769 2_POD13_MOD_REJ_TCRB. tsv CASSLCHPILHHQPQHF TRBV3- 0.125 1 Patient (SEQ ID NO: 19) 1*01 2_POD_98_NO_REJ_TCRB.t sv CASSYLYPISETQYF TRBV3- 0.0625 0.5 Patient (SEQ ID NO: 20) 1*01 2_POD_98_NO_REJ_TCRB.t sv CTREQSRANVLTF TRBVA- 0.0625 0.5 Patient (SEQ ID NO: 21) 1*01 2_POD_98_NO_REJ_TCRB.t sv CASSRFGPVMQDTQYF TRBV3- 0.0714285714 1 Patient (SEQ ID NO: 22) 1*01 285714 4_POD30_MOD_ACR_TCR B.tsv CASSRFGPVMQDTQYF TRBV3- 0.0357142857 0. Patient 4_POD_ (SEQ ID NO: 23) 1*01 142857 30MOD_ACR_TCRB.tsv CASRDRREQFF TRBV21- 0.0357142857 0.5 Patient (SEQ ID NO: 24) 1*01 142857 4_POD30_MOD_ACR_TCR B.tsv CASSPRAPHSDNEQFF TRBV3- 0.0357142857 0.5 Patient (SEQ ID NO: 25) 1*01 142857 4_POD30_MOD_ACR_TCR B.tsv CASSEDLGGKTYGYTF TRBV6- 0.0357142857 0.5 Patient (SEQ ID NO: 26) 1*01 142857 4_POD30_MOD_ACR_TCR B.tsv CASSCITKCRTYGYTF TRBV7- 0.0357142857 0.5 Patient (SEQ ID NO: 27) 7*01 142857 4_POD30_MOD_ACR_TCR B.tsv CASSSPEELESRANVLT TRBV25- 0.0357142857 0.5 Patient F 1*01 142857 4_POD30_MOD_ACR_TCR (SEQ ID NO: 28) B.tsv CAQQRHHSWHHQPQH TRBV3- 0.125 1 Patient F 1*01 4_POD65_NO_ACR_1_TCR (SEQ ID NO: 29) B.tsv CASTLIVSHKVGHVLT TRBV5- 0.0625 0.5 Patient F 5*01 4_POD65_NO_ACR_1_TCR (SEQ ID NO: 30) B.tsv 68 53258724.1 Attorney Docket No.047162-7412WO1(02347) CLTECICFLCLTYRVVH TRBV15* 0.0625 0.5 Patient F 01 4_POD65_NO_ACR_1_TCR (SEQ ID NO: 31) B.tsv CASSLRAKCQSRANVL TRBV7- 0.125 0.9 Patient T 7*01 4_POD65_NO_ACR_2_TCR (SEQ ID NO: 32) B.tsv CASSSTYPIFGHQPQHF TRBV3- 0.125 0.9 Patient (SEQ ID NO: 33) 1*01 4_POD65_NO_ACR_2_TCR B.tsv CASSEIGYHDKVGHVL TRBV7- 0.0625 0.4 Patient TF 9*01 4_POD65_NO_ACR_2_TCR (SEQ ID NO: 34) B.tsv CASSTQVSGLTGELFF TRBV3- 0.0625 0.4 Patient (SEQ ID NO: 35) 1*01 4_POD65_NO_ACR_2_TCR B.tsv CASSGKGPILHHQPQH TRBV3- 0.0625 0.4 Patient F 1*01 4_POD65_NO_ACR_2_TCR (SEQ ID NO: 36) B.tsv CASSQRGPIHNSPLHF TRBV3- 0.0833333333 0.625 Patient 3_POD- (SEQ ID NO: 37) 1*01 333333 0_NO_REJ_TCRB.tsv CASSLAAPIIHHNSPLH TRBV3- 0.0833333333 0.625 Patient 3_POD- F 1*01 333333 0_NO_REJ_TCRB.tsv (SEQ ID NO: 38) CASSYNLATVHNEKLF TRBV21- 0.0833333333 0.625 Patient 3_POD- F 1*01 333333 0_NO_REJ_TCRB.tsv (SEQ ID NO: 39) CASSVWHHQPQHF TRBV3- 0.0833333333 0.625 Patient 3_POD- (SEQ ID NO: 40) 1*01 333333 0_NO_REJ_TCRB.tsv CASSQFFIHHNSPLHF TRBV3- 0.1666666666 0.666 Patient 3_POD (SEQ ID NO: 41) 1*01 66667 16_MOD_REJ_TCRB.tsv CSVSKKLAYSRANVLT TRBV29- 0.1666666666 0.666 Patient 3_POD- F 1*01 66667 16_MOD_REJ_TCRB.tsv (SEQ ID NO: 42) CASVKRVRKTYGYTF TRBV5- 0.1666666666 0.666 Patient 3_POD- (SEQ ID NO: 43) 5*01 66667 16_MOD_REJ_TCRB.tsv CASSVKYPIHNSPLHF TRBV3- 0.125 0.75 Patient 3_POD- (SEQ ID NO: 44) 1*01 74_NO_REJ_TCRB.tsv CASSSLSPIFGHQPQHF TRBV3- 0.125 0.75 Patient 3_POD- (SEQ ID NO: 45) 1*01 74_NO_REJ_TCRB.tsv CASSELCPICKKNIQYF TRBV3- 0.0909090909 1 Patient (SEQ ID NO: 46) 1*01 090909 3_POD9_MOD_REJ_TCRB.t sv CATSMAKRCDKVGNV TRBV15* 0.0526315789 0.583 Patient LTF 01 473684 1_POD38_MOD_ACR_TCR (SEQ ID NO: 47) B.tsv 69 53258724.1 Attorney Docket No.047162-7412WO1(02347) CASSCRVKGTKSGQRP TRBV4- 0.0526315789 0.58 Patient DF 2*01 473684 1_POD38_MOD_ACR_TCR (SEQ ID NO: 48) B.tsv CSVLHHIQSRANVLTF TRBV29- 0.0526315789 0.58 Patient (SEQ ID NO: 49) 1*01 473684 1_POD38_MOD_ACR_TCR B.tsv CASRRPLATRNEKLFF TRBV21- 0.0526315789 0.583 Patient (SEQ ID NO: 50) 1*01 473684 1_POD38_MOD_ACR_TCR B.tsv CASKMYWDTQSRANV TRBV5- 0.0526315789 0.583 Patient LT 2*01 473684 1_POD38_MOD_ACR_TCR (SEQ ID NO: 51) B.tsv CASSRIYPIYHADTQYF TRBV3- 0.0526315789 0.583 Patient (SEQ ID NO: 52) 1*01 473684 1_POD38_MOD_ACR_TCR B.tsv CASSPPNPVMQDTQYF TRBV3- 0.0833333333 0.75 Patient (SEQ ID NO: 53) 1*01 333333 1_POD65_NO_ACR_1_TCR B.tsv CASSPTTPILHHQPQHF TRBV3- 0.0833333333 0.75 Patient (SEQ ID NO: 54) 1*01 333333 1_POD65_NO_ACR_1_TCR B.tsv Table 3: GIANA query of T cell EV-derived TCRs against large reference human TCR database. CDR3 Cluster TRBV Clonal Sample ID Query ID gene Frequency status CASRDRREQFF 2 TRBV21- 0.0001245 COVID19:BS-EQ-0006-T2- ref (SEQ ID NO: 24) 1*01 replacement_TCRB.tsv CASRDRREQFF 2 TRBV21- 4.77E-05 COVID19:BS-EQ-0009-T2- ref (SEQ ID NO: 24) 1*01 replacement_TCRB.tsv CASRDRREQFF 2 TRBV21- 3.77E-05 COVID19:BS-EQ-44-T0_BS- ref (SEQ ID NO: 24) 1*01 GIGI_11-replacement_TCRB.tsv CASRDRREQFF 2 TRBV21- 2.32E-05 COVID19:BS-GIGI_46- ref (SEQ ID NO: 24) 1*01 replacement_TCRB.tsv CASRDRREQFF 2 TRBV21- 5.95E-05 COVID19:BS-HS-18_TCRB.tsv ref (SEQ ID NO: 24) 1*01 CASRDRREQFF 2 TRBV21- 1.72E-05 COVID19:KHBR20-00193_TCRB.tsv ref (SEQ ID NO: 24) 1*01 CASRDRREQFF 2 TRBV21- 3.74E-05 LungCancer_MDanderson2019:MDA- ref (SEQ ID NO: 24) 1*01 1636-C.tsv CASRDRREQFF 2 TRBV21- 1.92E-05 LungCancer_MDanderson2019:MDA- ref (SEQ ID NO: 24) 1*01 1908-C.tsv CASRDRREQFF 2 TRBV21- 1.89E-05 LungCancer_MDanderson2019:MDA- ref (SEQ ID NO: 24) 1*01 1963-C.tsv 70 53258724.1 Attorney Docket No.047162-7412WO1(02347) CASRDRREQFF 2 TRBV21- 3.79E-05 LungCancer_MDanderson2019:MDA- ref (SEQ ID NO: 24) 1*01 2025-C.tsv CASRDRREQFF 2 TRBV21- 3.49E-05 LungCancer_MDanderson2019:MDA- ref (SEQ ID NO: 24) 1*01 2175-C.tsv CASRDRREQFF 2 TRBV21- 2.92E-05 LungCancer_MDanderson2019:MDA- ref (SEQ ID NO: 24) 1*01 2244-C.tsv CASRDRREQFF 2 TRBV21- 2.19E-05 LungCancer_MDanderson2019:MDA- ref (SEQ ID NO: 24) 1*01 2325-C.tsv CASRDRREQFF 2 TRBV21- 2.62E-05 LungCancer_MDanderson2019:MDA- ref (SEQ ID NO: 24) 1*01 3203-C.tsv CASRDRREQFF 2 TRBV21- 1.48E-05 LungCancer_MDanderson2019:MDA- ref (SEQ ID NO: 24) 1*01 3212-C.tsv CASRDRREQFF 2 TRBV21- 0.00012317 LungCancer_MDanderson2019:MDA- ref (SEQ ID NO: 24) 1*01 4378-C.tsv CASRDRREQFF 2 TRBV21- 0.03571429 JAT_MOD_ACR_TCRB.tsv query (SEQ ID NO: 24) 1*01 Interestingly, even though it is well known that peripheral blood T cell counts do not increase with ACR, there is a distinct surge in T cell EVs, suggesting that EV profiles reflect functional status of their cellular counterparts rather than the viable or circulating cellular mass. Accordingly, as demonstrated herein, resolution of ACR led to time specific return of T cell EV quantities back to baseline levels, with corresponding decrease in expression of alloreactive markers. As such, it is contemplated herein that the T cell EV platform will also enable noninvasive monitoring of efficacy of treatment of clinically significant grade >2 ACR episodes that require additional immunosuppressive therapy, thereby replacing repeat EMB as the standard of care method to confirm successful treatment of ACR. The following results demonstrated herein indicate that T cell EVs play a role in the pathophysiology associated with ACR: (a) time specific changes in circulating T cell EV profiles are seen in Rejection arm only; (b) increased expression of proinflammatory / allo-stimulatory markers inside T cell EVs (IL2, CXCL10, IFNγ, CD38, MHC II, TCR); (c) pathway analysis of T cell EV miRNA cargoes showed sequential upregulation of immune regulatory pathways and apoptotic pathways on days 4 and 7 post-transplant; (d) miR target analysis showed regulation of genes involved in apoptosis pathways, including HDAC4 [Paroni, et al., Mol Biol Cell, 2004. 15(6): p.2804-18], PTEN [Zhu, et al., Apoptosis, 2006.11(2): p.197-207], BCL2, MEF2c [Paroni, et al., Mol Biol Cell, 2004.15(6): p.2804-18; Hayashi, et al., J Clin Invest, 2004. 113(8): p.1138-48], SMAD7 [Lallemand, et al., Oncogene, 2001.20(7): p.879-84], and CAB39 71 53258724.1 Attorney Docket No.047162-7412WO1(02347) [Xu, et al., Cancer Lett, 2019.449: p.226-236]; (e) T cell EVs express proteins important in mediating targeted apoptosis by cytotoxic T cells, including TCR, Fas L, granzyme B, and perforin; (f) only T cell EVs from Rejection arm mediated apoptosis of donor specific BALB / c cardiomyocytes on TUNEL assay, and; (g) expression of T cell clones with functional TCRs was noted in circulating T cell EVs. Taken together, these findings implicate that in addition to cell- cell contact mediated apoptosis of donor tissue, alloreactive T cell clones may potentiate donor tissue inhibition / injury and cell death even before they migrate to the allograft via their EVs carrying donor alloreactive clone specific TCRs. The concept of targeted cytotoxicity mediated via T cell EVs contemplated herein is consistent with an interesting observation noted in previous studies of donor tissue EV profiles during ACR. In animal ACR models of islet, heart, and lung transplantation [Vallabhajosyula, et al., J Clin Invest, 2017.127(4): p.1375-1391; Habertheuer, et al., J Thorac Cardiovasc Surg, 2018.155(6): p.2479-2489; Habertheuer, et al., 2022.106(4): p.754-766; Hu, et al., Transplant Direct, 2020.6(11): p. e615], it was consistently observed that circulating donor specific EV levels significantly decreased days before infiltration and subsequent injury of the graft by T cells on histology. The following model is proposed herein to explain these findings (FIG.10). In the peri-transplant period, donor tissue specific EVs collect in secondary lymphoid organs such as regional lymph node and promote alloreactive T cell activation via semi-direct, indirect, and direct pathways [DeWolf and Sykes, J Clin Invest, 2017.127(7): p.2473-2481; Barry and Bleackley, Nat Rev Immunol, 2002.2(6): p.401-9; Chavez-Galan, et al., Cell Mol Immunol, 2009.6(1): p.15-25]. While specific alloreactive T cell clones proliferate before migration to the allograft, their activation leads to release of T cell EVs expressing TCR specific to donor tissue into peripheral circulation. Donor specific T cell EVs migrate to allograft and initiate targeted injury / apoptosis of donor cells, which leads to inhibition of donor EV release. They also directly bind donor EVs in circulation leading to a decrease in the donor EV signal. This is reflected as a decrease in circulating donor EVs early during ACR, before graft infiltration by T cells. This enables the adaptive immune arm to mediate injury / inhibition of donor tissue even before alloreactive T cells can infiltrate into the allograft. T cell EVs also carry cytokines such as IFNγ, and CXCL10 which facilitate creation of a proinflammatory microenvironment in the donor tissue and may promote donor specific T cell migration to the allograft and potentiate the alloreactive response. 72 53258724.1 Attorney Docket No.047162-7412WO1(02347) It is further contemplated herein that the target specificity of T cell EVs is mediated via the expressed TCR, like their cellular counterparts. Accordingly, specific T cell EV TCR clonal subpopulations activated during ACR are studied and characterized. Although such studies have been previously performed directly from allograft biopsies or from recipient peripheral blood mononuclear cell samples after in vitro stimulation using irradiated donor cells [Aschauer, et al., Front Immunol, 2021.12: p.750005; Tian, et al., Front Immunol, 2021.12: p.778559], they have not previously been studied in EVs. As demonstrated herein, both TCR protein and mRNA were detected in T cell EVs, and sequencing of functional TCR clones utilizing the EV mRNA cargo was performed. As EVs reflect functional and activation states of their cellular counterparts, detection and characterization of patient-specific TCR clones that may play dominant roles during ACR episodes is useful for surveillance, diagnosis, and treatment of ACR. Example 2: Circulating Tissue Specific Extracellular Microvesicles for Noninvasive Diagnosis of Grade 2 Acute Cellular Rejection in Clinical Heart Transplantation Materials and Methods In 10 consenting patients undergoing orthotopic heart transplantation at a single institution, plasma samples were collected in perioperative period, and at endomyocardial biopsy (EMB) time points over a follow-up of the first 100 days post-transplant. Five patients had at least one grade 2 ACR episode and the other five were without any grade > 2 ACR episodes. Circulating donor heart EVs and recipient T cell EVs were profiled and compared to EMB. Donor heart EVs were enriched using anti-donor HLA I specific antibody and its cargo was analyzed for cardiac specific troponin T protein and mRNA expression by Western blot and quantitative reverse transcriptase PCR (RT-qPCR). Recipient T cell EVs were purified using anti-CD3 antibody, and its cargo for CD4, CD8, and T cell receptor (TCR) proteins were quantified by Western blot. T cell EV specific miRNA (miR) cargoes let7i, miR 101b, and miR 21a were quantified by stem loop RT-qPCR. There were 61 EMB episodes in total, with 10 grade 2 AR (16.4%) events, 14 grade 1 AR (22.9%) events, and 37 grade 0 AR events (60.7%). There were no exclusion criteria. Relative expression of candidate biomarker for each EMB- matched time point was expressed relative to internal control and normalized to post-transplant day 1 or pre-transplant signal. The study was approved by the institutional review boards from University of 73 53258724.1 Attorney Docket No.047162-7412WO1(02347) Pennsylvania and Yale University. Venous peripheral blood samples were obtained prospectively from consenting patients up to 100 days post-transplant. In the perioperative period during in-hospital stay, samples were collected at pretransplant, post operative days (POD) 1, 2, or 3, and weekly thereafter until time of discharge. Sample collection was coordinated with times of routine blood draw for clinical monitoring to minimize patient discomfort, with single EDTA tube containing 5 ml of patient blood drawn for plasma isolation. At time points of in-patient and out-patient EMB, single EDTA tube was drawn from the venous access site (internal jugular vein or common femoral vein) placed to obtain endovascular access to perform allograft biopsy. In all cases, EDTA tube was transported at room temperature to the investigator’s laboratory for plasma isolation and downstream EV analysis. Sample collection was performed in 14 consenting consecutive heart transplant patients without any exclusion criteria; of these 5 patients (15.7%) had 10 grade 2 ACR episodes. The 5 patients with grade 2 ACR episodes were matched with 5 patients with similar EMB time points without grade 2 ACR to serve as comparative controls (Patients 1-10). EV analysis was completed in these 10 patients. In total, 61 EMBs were performed over the follow-up period in the 10 patients, with 10 grade 2 ACR episodes, 14 grade 1 ACR episodes, and 37 grade 0 ACR events. All grade 2 ACR episodes occurred within the first 51 days post-transplant, and 8 out of 10 events occurred in the first 30 days post-transplant. There were no exclusion criteria for this study and all the performed EMB time points were included. To understand the potential broader biomarker scope of the EV platform, in one other patient with grade 2 ACR (Patient 11) circulating donor heart EVs and T cell EVs were purified to validate whether other tissue specific intra-EV cargoes may be altered during grade 2 ACR episodes. Candidate biomarkers tested in EV cargoes. Eight potential candidate biomarkers from cargoes of circulating donor heart EVs and recipient T cell EVs were selected and tested. As cardiac troponin T is a known bona fide cardiomyocyte specific marker, its specific protein and mRNA expression was assessed in donor heart EVs. In rodent heart transplant ACR model (see Example 1), time specific down regulation of cardiac troponin T protein and mRNA cargoes was observed in donor heart EVs from recipient circulation. In the same rodent model, markers of helper T cell and cytotoxic T cell alloactivation, CD4, CD8, and TCR were upregulated in T cell EVs during ACR (FIG.2C). Next generation sequencing and RT-qPCR of circulating T cell EV 74 53258724.1 Attorney Docket No.047162-7412WO1(02347) small RNA cargoes demonstrated upregulation of specific miRNAs during ACR, including miR let 7i, miR 101b, and miR 21a (FIGs.7A – 7C). EV methodologies established in the mouse model were modified and validated for translation to the clinical setting, as described in Example 1. Sensitivity, specificity, and diagnostic accuracy for each candidate biomarker to distinguish > grade 2 ACR was calculated, setting EMB result as the gold standard. In Patient 11, other potential tissue specific markers were tested to assess whether the EV platform may be investigated for other candidate biomarkers to further improve diagnostic accuracy – cardiac specific troponin I protein and mRNA in donor heart EVs, and CD4, CD8, and IFNγ mRNA in T cell EVs. EV cargo signal quantitation and established threshold cut-off for distinguishing > grade 2 ACR. Because the clinical consequence of failing to diagnose grade > 2 ACR can impart marked morbidity to patient, threshold cut-off was optimized to maximize sensitivity for all candidate biomarkers. In all cases, candidate biomarker signal expression was normalized to internal control marker expression. For EV protein and mRNA cargo analysis in donor heart EVs, cardiac troponin T expression was normalized to expression of canonical exosome marker TSG101 by Western blot. As EV profiles are dynamic and based on studies in animal model of heart transplantation which showed a constitutive baseline expression of troponin T by POD 1, the signal for POD 1 time point (POD 1 troponin T / TSG101 ratio) was set to a value of 1, and relative expression of troponin T signal for other POD time points were calculated to assess for differences in expression. Reduction in relative expression of troponin T protein by > 40% from POD 1 baseline was set as threshold cut-off for > grade 2 ACR. Troponin T mRNA expression in donor heart EVs was analyzed along with expression of GAPDH mRNA as internal control by RT-qPCR. The normalized expression of troponin T (troponin T / GAPHDH mRNA expression) on POD 1 was set at value of 1, and relative expression compared to POD 1 value was quantified, with > 60% reduction in signal as cut-off for distinguishing > grade 2 ACR. For T cell EV protein cargo analysis, CD4, CD8, and TCR marker expression was normalized internally to expression of canonical exosome marker TSG101. Relative expression for the POD time points was quantified compared to the normalized pretransplant expression of the specific marker set at value of 1. For CD4 and TCR markers, relative expression > 2.2-fold compared to pretransplant value was set as threshold cut-off for distinguishing > grade 2 ACR, and for CD8 the cut-off was set at > 2.5-fold increase from pretransplant baseline. For T cell EV 75 53258724.1 Attorney Docket No.047162-7412WO1(02347) miRNA cargoes, candidate biomarker level was normalized to internal control, hsa miR 26, and relative expression for each EMB matched POD time point compared to POD 1 normalized value was analyzed. For let 7i and miR 21a, > 4-fold increase in relative expression compared to POD 1 normalized value was set as threshold cut-off for diagnosing > grade 2 ACR; and for miR 101b the threshold cut-off was set at > 3-fold increase. EV isolation. Plasma was processed from peripheral blood sample as previously described. Sample was spun at 2000 RPM x 20 minutes at 4°C and the supernatant representing plasma was collected and stored at -80°C for EV isolation. EV isolation was performed as previously reported. Tissue specific EV purification. Donor heart EVs were enriched from whole plasma EV pool using magnetic beads coupled to anti-donor human leukocyte antigen (HLA) I specific antibodies, with the bead bound EVs representing allograft EV subset. T cell EVs were purified using anti-CD3 antibody conjugated beads. RT-qPCR of EV mRNA cargoes. Biomarkers tested cardiac troponin T, CD4, CD8, and IFNγ. Stem loop RT-qPCR of EV miRNA cargoes. The expression pattern of these three T cell EV miRNAs (let 7i, miR 101b, and miR 21a) was analyzed by stem loop quantitative RT-PCR assay, with normalization to internal miRNA control, hsa miR 26. Statistical Analysis. Statistical analysis was performed to assess whether biomarker levels can differentiate between Acute Cellular Rejection (ACR) and no ACR. Eight biomarkers were analyzed: CD4, CD8, TCR, Troponin T protein, Troponin T mRNA, miRNA Let 7i, miRNA 101b, and miRNA 21a. The level of each biomarker on a specific day was considered as the ratio of the measurement on that day to the pre-transplant measurement or the first post-transplant measurement when the pre-transplant measurement was absent. Wilcoxon rank sum tests were conducted to compare biomarker levels at time points with ACR and without ACR. Generalized estimating equations were used to assess the biomarker effects on the ACR event, accounting for the correlations among biomarker levels on different days within the same patient. ROC curves were constructed for each biomarker using both logistic regression and generalized estimating equations. Optimal cutoff points for each biomarker were determined using the Youden method. Sensitivity, specificity, negative predictive value (NPV), and positive predictive value (PPV) were calculated at the optimal cutoff points. To evaluate whether biomarker levels can detect the 76 53258724.1 Attorney Docket No.047162-7412WO1(02347) relief of rejection, the Spearman correlations between biomarker levels and grades of ACR were calculated for measures after the first observation of an ACR event for each patient. Results As demonstrated herein, grade > 2 ACR leads to dynamic changes in cargoes of circulating donor heart EVs and T cell EVs - marked suppression of donor heart EV signal secondary to ACR mediated allograft injury and marked increase in T cell EV signal due to activation of alloreactivity during ACR. Clinical Data. Overall, none of the patients developed decrease in heart function before or after grade 2 ACR episodes, as confirmed by echocardiography. Maintenance immunosuppression comprised of tacrolimus therapy in all patients. Grade 2 ACR episodes were primarily treated with bolus intravenous steroids, along with selective addition of mycophenolate mofetil and thymoglobulin therapy. There were zero antibody mediated rejection (AMR) episodes or grade > 2 ACR episodes. Whole plasma EV analysis and quality control. In addition to measurement of protein concentration, plasma EV sample concentration and size distribution was assessed by nanoparticle tracking analysis. Size distribution of EVs was consistent with nanoparticles in the exosome size range (median particle size 100 nm). Plasma EV size distribution and concentration were similar at time points of grade 2 ACR versus grade 0 ACR. In all samples, plasma EVs protein fraction was analyzed for expression of canonical exosome markers CD63 and TSG101, and for absence of cytochrome c (mitochondrial and apoptotic body marker) as part of quality control. Electron microscopy of plasma EVs also showed nanoparticles in the exosome size range. Quality control of tissue specific EV purification was also performed to validate optimal capture. Based on HLA class I mismatch, anti-donor HLA I specific antibody conjugated beads were prepared, quality tested for specificity and utilized for purification of donor heart EVs. The unbound fraction representing recipient specific EVs was assessed for absence of expression of donor specific HLA I and cardiac troponin T. For T cell EV purification experiments performed using anti-CD3 antibody conjugated beads, the unbound EV fraction was tested for absence of CD3 by Western blot. Tissue specific EV cargo analysis. The results of cargo analysis for all eight candidate biomarkers (Troponin T protein and Troponin T mRNA from donor heart EVs, and CD4 protein, 77 53258724.1 Attorney Docket No.047162-7412WO1(02347) CD8 protein, TCR protein, miR Let 7i, miR 101b, and miR 21a from recipient T cell EVs) in each of the 10 patients, respectively, are detailed in FIGs.14A--14H, 15A-15H, 16A-16H, 17A- 17H, 18A-18H, 19A-19H, 20A-20H, 21A-21H, 22A-22H, and 23A-23H. Western blot data, based on densitometry analysis for candidate protein biomarker expression was performed for cardiac troponin T, CD4, CD8, TCR, and TSG101 (canonical exosome marker). Relative expression of each marker is shown. Donor heart EV cardiac troponin T cargo analysis. Overall, in the 5 patients without any grade 2 ACR episodes and 3 grade 1 ACR episodes (Patients 2, 4, 6, 8, 10), cardiac troponin T protein signal was steady without any significant decrease. In the 5 subjects with 10 grade 2 ACR episodes, there were also 11 grade 1 ACR events. Patient 1 had 4 grade 2 ACR and 2 grade 1 ACR episodes, requiring treatment with additional immunosuppression 4 times, including intravenous thymoglobulin therapy. Patient 7 EMBs only showed grade 1 (n=4) or grade 2 (n=2) ACR events. For cardiac troponin T protein, grade 2 ACR resulted in >40% reduction in relative expression of protein in 8 out of 10 episodes. There were 2 false positive events that were grade 1 ACR by EMB, one in Patient 1 and the other in Patient 7; repeat EMB 7-8 days later in both patients showed grade 2 ACR (FIG.40C, FIG.46C). Grade 1 ACR events showed variable reduction in cardiac troponin T protein expression compared to POD 1 baseline, suggesting the dynamic nature of circulating tissue specific EVs. Importantly, effective treatment of grade 2 ACR as confirmed by repeat EMB showing grade < 1 ACR resulted in concomitant increase in troponin T protein cargo in donor heart EVs above the threshold cut-off. Circulating donor EV cardiac troponin T mRNA cargo analysis by RT-qPCR showed stable or increased signal in the 5 patients without grade 2 ACR events, compared to POD 1 baseline. Importantly, in all 5 patients with 10 grade 2 ACR episodes, troponin T mRNA levels were markedly decreased by >60% in all cases, and >70% in 9 out of 10 cases. There was a single false positive event, POD 7 time point in Patient 7 which showed grade 1 ACR by EMB. Repeat surveillance EMB on POD 15 in Patient 7 showed grade 2 ACR, with troponin T mRNA signal decreasing >80% from baseline in the time matched plasma sample. As seen with troponin T protein levels, effective treatment of grade 2 ACR as confirmed by repeat EMB demonstrated corresponding increase in the donor heart EV troponin T mRNA signal in all instances. T cell EV protein cargo analysis. Western blots were conducted for CD4, CD8, TCR, and TSG101 protein expression in T cell EV subset. In patients without grade 2 ACR events, 78 53258724.1 Attorney Docket No.047162-7412WO1(02347) expression of all 3 T cell protein markers remained stable at all EMB time points, including 3 grade 1 ACR events. At pre-transplant times, CD4, CD8, and TCR signals were detected in all patients suggesting that a constitutive circulating T cell EV pool exists in peripheral blood, and upon initiation of immunosuppression at time of heart transplantation, the signal does not change in post-transplant period if there is no > moderate acute cellular rejection episode. In patients with grade 2 ACR episodes, persistent elevation above threshold was observed for CD4, CD8, and TCR protein signals. For CD4, 2 grade 0 ACR events were falsely positive, both occurring at time points of repeat EMB after treatment of grade 2 ACR episodes.50% of mild ACR episodes (7 out of 14) also showed CD4 expression levels higher than threshold cut-off. CD8 protein expression was also markedly elevated at all time points of moderate acute rejection (10 out of 10). Three out of 37 episodes of grade 0 ACR showed >2.5-fold elevation in CD8 relative expression, occurring in Patients 3 and 9. Five out of 14 mild ACR episodes also showed increased CD8 levels. All these false positive events occurred at EMB time points before or after grade 2 ACR episodes, with none noted in the patients without any grade 2 ACR events. Overall, compared to CD4 protein expression in the T cell EV subpopulation, higher elevation in CD8 expression was noted at grade 2 ACR episodes. T cell receptor protein expression was also assessed in circulating T cell EVs, with threshold cut-off of > 2.2-fold increase from baseline signal as positive for grade 2 ACR. In the 5 subjects without any grade 2 ACR events, TCR expression remained stable over follow-up, at levels similar to baseline signal on pre-transplant time point. In correspondence with CD4 and CD8 expression changes, moderate ACR in the 5 subjects also led to time-specific increase in TCR expression. There were 2 grade 0 ACR time points in Patients 1 and 9 that showed > 2.2- fold increase in TCR expression, both occurring at time points right after grade 2 ACR events. There were also 4 grade 1 ACR episodes that were falsely positive by TCR expression analysis; all of which were also positive by either CD4 expression or CD8 expression or both. Collectively, analysis of the 3 T cell specific protein markers demonstrated that the conditionally increased stimulatory and alloreactivity states during grade 2 ACR is reflected in time specific changes in the circulating T cell EV protein cargoes. Successful treatment of grade 2 ACR, as confirmed by repeat EMB demonstrating < grade 1 ACR, led to corresponding decrease in the T cell EV marker signal, attesting to the dynamic nature of T cell EV profiles. T cell EV miRNA cargo analysis. In the 5 patients without any grade 2 ACR episodes, 79 53258724.1 Attorney Docket No.047162-7412WO1(02347) miR let 7i, miR 101b, and miR 21a expression remained stable at all time points, including grade 1 ACR events by EMB. In the 5 subjects with moderate rejection, T cell EV miRNA cargoes were analyzed for 8 EMB-matched time points with grade 2 ACR – all 3 miRNAs showed time specific elevation in signal at the 8 time points. Compared to T cell protein marker analysis, miRNAs showed much higher fold increase in signal with grade 2 ACR, along with more rapid decrease back to baseline upon resolution of grade 2 ACR by EMB. There was high level of consistency in signal changes for each candidate miRNA biomarker in correlation with grade 2 ACR episodes. For miR let 7i, there were no false negative results, and a single false positive result – in Patient 3, repeat EMB on POD 44 (grade 0 ACR) after treatment of grade 2 ACR episode on POD 30 showed signal higher than threshold, although the signal had decreased over 5-fold at this time point compared to POD 30. For miR101b as well, there were no false negative results, but a single false positive result that occurred at a repeat EMB time point (POD 25) showing grade 1 ACR after treatment of grade 2 ACR (PODs 9 and 16). Though above threshold, the miR 101b signal was down-trending compared to grade 2 ACR time points. There were 3 false positive results with miR 21a RT-qPCR assay, all 3 noted at EMB time points preceding grade 2 ACR time points. Interestingly, in Patient 1 as well, there was elevation in miR 21a on POD 15 (EMB grade 1 ACR), with repeat surveillance biopsy on POD 22 showing grade 2 ACR. Therefore, miR 21a elevation was consistently observed before onset of grade 2 ACR by EMB, suggesting it may be an early marker heralding moderate rejection. Overall, T cell EV miRNA markers were highly sensitive for grade 2 ACR. Grade 2 ACR may lead to alterations in other tissue specific markers. Given the promising observations with respect to the eight candidate biomarkers tested, whether other cell specific markers are also expressed in tissue specific EVs was also tested, and if so, whether they would also be altered secondary to ACR. In routine clinical practice, cardiac troponin T and I proteins are measured in peripheral blood as highly sensitive and specific markers of myocardial infarction. Given the findings noted with cardiac troponin T analysis, methodology for cardiac specific troponin I protein and mRNA quantitation in donor heart EVs was developed. Grade 2 ACR led to time-specific drop in troponin I signal; with return of the signal back to baseline upon resolution to grade 0 ACR in EMB-matched time points. Next, other potential markers in T cell EVs were assessed. Given the findings with CD4 and CD8 protein expression, mRNA expression of CD4 and CD8 in T cell EVs was also 80 53258724.1 Attorney Docket No.047162-7412WO1(02347) assessed. Selective expression of IFNγ and MHC II was assessed, as IFNγ is an important mediator of effector T cell phenotype, and T cell activation is associated with upregulation of MHC II expression. CD4, CD8, and IFNγ mRNAs were upregulated in T cell EVs at the time point of grade 2 ACR specifically, correlating in expression pattern to the other T cell EV markers detailed above. Diagnostic accuracy of the candidate biomarkers. Sensitivity, specificity, and diagnostic accuracy for candidate biomarkers from donor heart EVs and T cell EVs were assessed. For cardiac troponin T protein in donor heart EVs, sensitivity and specificity were 80% and 95.1% respectively, with diagnostic accuracy of 92.2%. There were 2 false negative results, both in Patient 1, and 2 false positive results (Patients 1 POD 7 and Patient 7 POD 7) occurring at times points of grade 1 ACR, where repeat EMB 7-8 days later showed grade 2 ACR. Cardiac troponin T mRNA RT-qPCR assay showed 100% sensitivity, 97.2% specificity, and accuracy of 97.8%. There was one false positive result in Patient 7 at POD 7 time point, where EMB showed grade 1 ACR; troponin T protein and miR 21a markers also met threshold cut-offs for grade 2 ACR at this time point (FIGs.46B, 46F). Surveillance EMB on POD 15 was positive for grade 2 ACR in this patient. CD4, CD8, and TCR protein expression in T cell EVs showed 100% sensitivity for grade 2 ACR detection, with specificity ranging from 82.4% to 88.2% (FIGs.37C – 37E). Diagnostic accuracy for the 3 proteins was 85.2%, 86.95, and 90.2% respectively, with 100% negative predictive value for all 3 marker proteins. Of note, all false positive results occurred in subjects with grade 2 ACR episodes. T cell miRNA markers also showed high diagnostic accuracy, with 100% sensitivity for grade 2 ACR. For miR let 7i and miR 101b, diagnostic accuracy was 97.6% with one false positive result. In Patient 3, miR let 7i was >55-fold higher than POD 1 baseline on POD 30 time point, with EMB showing moderate ACR. Repeat EMB 14 days later on POD 44 showed grade 0 ACR, but miR let 7i levels trended down to 8.7-fold higher than baseline, still above the threshold. In Patient 5, miR 101b was >36-fold higher than baseline on POD 16 time point, which showed grade 2 ACR. Repeat EMB on POD 25 showed grade 1 ACR, but miR 101b levels, though trending on, were 7.4-fold higher than baseline. This was the single false positive result with miR 101b cargo analysis. Sensitivity and specificity for miR 21a expression was 100% and 90.9%. There were 3 false positive results in Patients 3, 7, and 9, and all 3 of these events occurred at EMB time points preceding grade 2 ACR episodes (diagnostic accuracy 81 53258724.1 Attorney Docket No.047162-7412WO1(02347) 92.7%). Overall, T cell EV miRNA cargo profiles showed improved diagnostic accuracy compared to T cell protein markers, and much higher fold changes in expression at grade 2 ACR time points were observed with miRNAs. Statistical Analysis. Statistical analysis was performed to assess whether biomarker levels can differentiate between Acute Cellular Rejection (ACR) and no ACR. The eight biomarkers (CD4, CD8, TCR, Troponin T protein, Troponin T mRNA, miRNA Let 7i, miRNA 101b, and miRNA 21a) were analyzed as described in the methods. Scatter plots of the biomarker levels are shown in FIGs.24A – 24H. Box plots of the biomarker levels across ACR grades are shown in FIGs.25A – 25H. The level of each biomarker on a specific day was considered as the ratio of the measurement on that day to the pre-transplant measurement or the first post-transplant measurement when the pre-transplant measurement was absent. Wilcoxon rank sum tests were conducted to compare biomarker levels at time points with ACR and without ACR. Generalized estimating equations were used to assess the biomarker effects on the ACR event, accounting for the correlations among biomarker levels on different days within the same patient. ROC curves were constructed for each biomarker using both logistic regression (FIGs.26A – 26H) and generalized estimating equations (FIGs.27A – 27E). Troponin T mRNA, miR Let 7i, and miR 21a have no ROC curve from generalized estimating equations because logistic model for probability has fitted value very close to 1, so estimates diverge. Optimal cutoff points for each biomarker were determined using the Youden method (see Table 4). Sensitivity, specificity, negative predictive value (NPV), and positive predictive value (PPV) were calculated at the optimal cutoff points. To evaluate whether biomarker levels can detect the relief of rejection, the Spearman correlations (see Table 5) between biomarker levels and grades of ACR were calculated for measures after the first observation of an ACR event for each patient. Table 4: Optimal cutoff points (Youden) Biomarker Optimal cutoff Sensitivity Specificity (%) NPV (%) PPV (%) points (%) CD4 2.059 90.9 78.2 97.7 45.5 CD8 2.506 100 83.6 100 55.0 TCR 2.198 90.9 87.3 98.0 58.8 Troponin T 0.572 72.7 95.6 93.5 80.0 protein Troponin T 0.412 100 97.4 100 91.7 mRNA 82 53258724.1 Attorney Docket No.047162-7412WO1(02347) miR Let 7i 3.574 100 94.7 100 81.8 miR 101b 3.009 100 97.3 100 87.5 miR 21a 3.865 100 91.9 100 75.0 Table 5: Spearman correlation between biomarker level and ACR grade for observation after ACR grade 2 Biomarker Correlation CD4 0.412 CD8 0.627 TCR 0.571 Troponin T protein -0.616 Troponin T mRNA -0.867 miR Let 7i 0.752 miR 101b 0.700 miR 21a 0.853 Example 3: B cell EVs biomarkers for prediction and / or diagnosis of B cell-mediated transplant rejection Materials and Methods Antibody-mediated rejection (AMR). A single heart transplant recipient patient presented with an antibody-mediated rejection episode. EVs were purified from the patient’s plasma as described in Examples 1 and 2, and B-cell specific EVs were isolated using anti-CD19 and anti- CD38 antibody coated beads. Results B cell EV biomarkers predict antibody-mediated transplant rejection. B cell EVs were analyzed by qPCR for mRNA levels of biomarkers CD19 and CD38 to assess for their ability to detect and / or predict antibody-mediated rejection events. Increases in CD19 and CD38 mRNA levels above baseline were observed on POD 11 and POD 57, prior to AMR detection by biopsy on POD 71, and returned to baseline levels after the patient was treated with rituximab. Thus, B cell EV biomarkers are able to predict AMR events, allowing for treatment before the donor heart is damaged. 83 53258724.1 Attorney Docket No.047162-7412WO1(02347) Example 4: Circulating Tissue Specific Extracellular Vesicles as Biomarkers of Acute Cellular Rejection in Clinical Heart Transplantation Materials and Methods Abbreviations. The abbreviations used herein include the following: ACR: acute cellular rejection; AMR: antibody mediated rejection; AR: acute rejection; cTnI: cardiac isoform Troponin I; cTnT: cardiac isoform Troponin T; EMB: endomyocardial biopsy; EVs: extracellular vesicles; HLA: Human leukocyte antigen; miRNA / miR: microRNA; NPV: negative predictive value; NTA: nanoparticle tracking analysis; PPV: positive predictive value; POD: postoperative day; RT-PCR: reverse transcription polymerase chain reaction; RT-qPCR: reverse transcription- quantitative polymerase chain reaction; and TCR: T cell receptor. Study design and sample collection. Institutional review boards from University of Pennsylvania (#831237) and Yale University (#2000030522) approved the study (adults >18 years age). There were no exclusion criteria. Venous blood (5-6 ml EDTA tube) was obtained from 12 patients to post-operative day (POD) 112 at timepoints - pretransplant, PODs 0, 1, 2, or 3, and time points of EMBs. In total, 70 EMB-matched samples were analyzed (average 5.83 biopsies per patient). Characterization from plasma sEVs. Institutional Review Board (IRB) approvals from University of Pennsylvania, Yale University school of Medicine, were obtained along with the consents from patients undergoing heart transplantation. Blood samples were collected on pretransplant, postoperative days 1 or 3, and at the time of endomyocardial biopsy surveillance, up to 112 days of postoperative follow-up blood sample, along with the patient clinical and endomyocardial biopsy (EMB) information. sEV isolation and characterization was carried out using previously published methodologies (Example 1 herein and Korutla, et al., Am J Transplant.2024 Mar;24(3):419-435). In brief, total EVs were isolated from 1 ml of plasma sample by size exclusion chromatography along with ultracentrifugation and analyzed on the nanoparticle detector (NS300) on the light scatter mode for quantification and size distribution using NTA3.4 software according to manufacturer’s protocol (Malvern Instruments Inc., MA). Histology. Endomyocardial biopsy tissue sections were processed in the histopathology laboratory at Yale University for POD 57 and POD 85 timepoints. EMB tissue was fixed in 10% neutral buffered formalin. Paraffin-embedded sections (5 μm) were stained for the presence of C4d protein by immunohistochemistry, along with hematoxylin and eosin staining using standard 84 53258724.1 Attorney Docket No.047162-7412WO1(02347) protocols. Images were captured using Leica microscope. Horse radish peroxidase conjugated anti-rabbit secondary antibody was used, and immunoreactivity was observed with the diaminobenzidine chromogen reaction. Antibodies. Antibodies were purchased from different vendors and followed their data sheet suggested dilutions and conditions for Western blot analysis. Antibodies utilized for Western blot and sEV analysis are shown in Table 6. In this study, human specific anti-CD3 (Santa Cruz Biotechnologies Inc., Santa Cruz, CA) and donor HLA I specific antibodies (One Lambda Inc., Canoga Park, CA) were used for NHS-magnetic bead conjugation. Secondary antibodies conjugated to HRP (anti-rabbit, anti-mouse, anti-goat) were purchased from Santa Cruz Biotechnologies Inc, and used for Western blot analysis. Table 6: Antibodies utilized for Western blot and sEV analysis Antibody Vendor Catalogue Dilution Number CD4 (MT310) mouse monoclonal Santa Cruz Sc-19641 1:500 Biotechnology CD8 (UCH-T4) mouse monoclonal Santa Cruz Sc-1181 1:500 Biotechnology CD38 (H11) mouse monoclonal Santa Cruz Sc-374650 1:500 Biotechnology CD3 (17A2) mouse monoclonal Santa Cruz Sc-18843 1:500 Biotechnology Cardiac troponin I (E-9) mouse Santa Cruz Sc-365446 1:500 monoclonal Biotechnology T cell receptor (KJ1-26) mouse Santa Cruz Sc-65737 1:500 monoclonal Biotechnology CD9 (E8L5J) rabbit monoclonal Cell Signaling 98327S 1:1000 Technology CD19 (PDR134) mouse monoclonal Santa Cruz Sc-53191 1:500 Biotechnology Interferon gamma rabbit polyclonal Proteintech 15365-I-AP 1:1000 Cardiac troponin T (13-11) mouse Invitrogen MA5-12960 1:1000 monoclonal Human HLA-DR (LN-3) mouse Novus 45310 1:1000 monoclonal Biologicals H2Kdmouse monoclonal Santa Cruz Sc-53852 1:500 Biotechnology 85 53258724.1 Attorney Docket No.047162-7412WO1(02347) Cytochrome C (A-8) mouse monoclonal Santa Cruz Sc-13156 1:500 Biotechnology Flotillin 1 mouse monoclonal Proteintech 67968-1-Ig 1:1000 CD63 rabbit polyclonal Proteintech 25682-I-AP 1:1000 TSG101 mouse monoclonal Proteintech 67381-I-Ig 1:1000 Anti-mouse IgG horseradish peroxidase- Cell Signaling 7076S 1:5000 linked antibody Technology Anti-rabbit IgG horseradish peroxidase- Cell Signaling 7074S 1:5000 linked antibody Technology Cardiac troponin I goat polyclonal Abcam Ab56357 1:1000 ApoE (E7X2A) rabbit monoclonal Cell signaling 49285S 1:1000 technology Calnexin rabbit Polyclonal Proteintech 10427-2-AP 1:1000 Alix rabbit polyclonal Proteintech 12422-1-AP 1:1000 Donor HLA I specific antibodies used Vendor Catalogue Concentration for N-hydroxysuccinamide (NHS) Number NHS- bead conjugation Beads / Ab Bulk monoclonal A1,36 IgM One Lambda 0289HA 50λ / 10μg Bulk monoclonal A3 IgM One Lambda 0170HA 50λ / 10μg Bulk monoclonal A2 IgG One Lambda 0791HA 50λ / 10μg Bulk monoclonal B27,44,47+ IgG One Lambda 0792AHA 50λ / 10μg Bulk monoclonal B13,62,15 IgG One Lambda 0044HA 50λ / 10μg HLA B8 IgG2b biotin conjugated One Lambda BIH0536A 50λ / 10μg monoclonal Affinity antibody coupled purification of sEV subpopulations. Donor HLA–specific antibodies, T cell specific (anti-CD3) antibody, and B cell specific (anti-CD19) antibody was covalently conjugated to N-hydroxysuccinamide (NHS) magnetic beads (ThermoFisher, MA) using manufacturer’s protocol, and detailed previously (Example 1 herein and Korutla, et al., Am J Transplant.2024 Mar;24(3):419-435).1-2x1010nanoparticles of sEVs were incubated with 86 53258724.1 Attorney Docket No.047162-7412WO1(02347) antibody–magnetic beads complex overnight at 4°C. The bead bound and unbound sEV fractions were separated on magnetic stand. Specific sEVs bound to the beads were washed with 1XPBS and eluted by the protocol described in the manual. The bound fraction representing the T cell sEVs, B cell sEVs, and donor tissue sEVs were used for the downstream applications. Electron microscopy. Cryo-electron microscopy analysis was performed to identify EVs size from 5 ug / ul of protein equivalent in 10 ul volume onto 200-mesh copper grids (Quantifoil R1.2 / 1.3). Images were recorded on Falcon III direct electron detector at a magnification of 25,000x. Candidate biomarkers evaluated in sEV cargoes. In rodent heart transplant ACR model, it was previously demonstrated that donor heart sEVs profiles are altered with ACR (Habertheuer, et al., J Thorac Cardiovasc Surg.2018;155(6)). Donor heart sEV enrichment methodologies were developed in this model and cardiac isoform troponin T (cTnT) expression was noted herein (FIGs.29A-29B). It was also demonstrated that T cell sEV profiles are altered with ACR (Example 1 herein and Korutla, et al., Am J Transplant.2024 Mar;24(3):419-435). Therefore, these EV methodologies were translated to heart transplant patients (Example 1 herein and Korutla, et al., Am J Transplant.2024 Mar;24(3):419-435; Hu, et al., Transplant Direct, 2020.6(11): p. e615). Two candidate biomarkers in donor heart sEVs (cTnT protein and mRNA), and 6 biomarkers in T cell sEVs (CD4, CD8, TCR proteins, miRNAs (miRs) let7i, 101b, 21a) were assessed. Other potential cell-specific markers were also assessed in Patients 6 and 7 (enrolled at Yale University) due to availability of more plasma sample: mRNAs for CD4, CD8, IFNγ in T cell sEVs, cardiac troponin I (cTnI) in donor heart sEVs in Patients 6 and 7, and CD38, HLA-DR proteins and CD19, CD38 mRNAs in B cell sEVs in Patient 7. Human plasma sEV isolation. sEVs were isolated from 1 ml plasma using size exclusion chromatography and ultracentrifugation (Habertheuer, et al., J Thorac Cardiovasc Surg. 2018;155(6); Habertheuer, et al., Transplantation.2022;106(4); Hu, et al., Transplant Direct, 2020.6(11): p. e615; Vallabhajosyula, et al., J Clin Invest.2017;127(4): 1375-1391). Per Minimal Information for Studies of Extracellular Vesicles (MISEV) position statement guidelines in 201831, the phenotype of EVs analyzed in this study are labeled as small EVs (sEVs). Enrichment of circulating tissue / cell-specific sEVs. Methodological design for the study is shown in FIG.30. sEV subpopulations were purified using beads conjugated to the following 87 53258724.1 Attorney Docket No.047162-7412WO1(02347) antibodies: anti-donor human leukocyte antigen (HLA) I specific antibody (donor heart sEVs), anti-CD3 antibody (T cell sEVs), and anti-CD19 antibody (B cell sEVs). RNA and protein cargo analysis. Total RNA was extracted from sEVs by using Trizol reagent. sEVs were lysed with 500 ul of Trizol, extracted with 100 ul chloroform and centrifuged at 12,800g for 15 minutes. After centrifugation, the top clear solution was mixed with 2.5 volumes of isopropanol and stored at -80 °C for 1 hour to overnight to precipitate the RNA. After RNA precipitation samples were centrifuged at 12,800g for 15 minutes to pellet down the RNA, washed with 75% ethanol twice and dissolved in RNAse free water. RNA quality and concentration was measured on NanoDrop One (ThermoScientific, MA). For protein analysis, bound sEVs were lysed in 1X RIPA buffer containing 1X protease inhibitor cocktail (Sigma-Aldrich Co., MO), followed by the calorimetric assay (BCA) to estimate the protein concentration. Protein was separated on NuPAGE 4-12% Bis-Tris gel and transferred onto iBlot 2 nitrocellulose membrane. The blot was blocked with 5% milk, incubated with desired antibody as per the vendor suggested protocol. HRP conjugated secondary antibody (Santa Cruz Biotechnologies) in 1:5000 dilution was added for 1 hour and target protein was detected by chemiluminescence using Image quant LAS 400 Phospho-Imager (GE). Image Quant software was used to quantify the protein signals. Reverse transcription PCR (RT-PCR) and quantitative RT-PCR (RT-qPCR). sEV RNA (25-50 ng) was reverse transcribed using SuperScript III system (Life Technologies, CA) per manufacturer protocol. cDNA amplification was performed using TaqMan Advanced cDNA synthesis kit (Applied Biosystems, MA). Ct values were analyzed by delta-delta Ct method (Livak and Schmittgen, Methods, 2001.25(4): p.402-8). Primers used are shown in Table 7. Table 7: Primers used for RT-qPCR mRNA signatures in sEV subpopulations Gene Primer Sequences Forward: 5′- CATGGAGAAGGACCTGAATGA- 3′ cTNNT (SEQ ID NO: 55) Reverse: 5′- CGTCTCTCGATCCTGTCTTTG- 3′ (SEQ ID NO: 56) Forward; 5’-CCAACTACCGCGCTTATGC-3’ cTNNI (SEQ ID NO: 57) Reverse: 5’-CTCGCTCCAGCTCTTGCTTT-3’ (SEQ ID NO: 58) 88 53258724.1 Attorney Docket No.047162-7412WO1(02347) Forward: 5′-CTGTACGCCAACACAGTGCT-3′ β-actin (SEQ ID NO: 59) Reverse: 5′- GCTCAGGAGGAGCAATGATC-3′ (SEQ ID NO: 60) Forward: 5’-TGCTGATGACCTCACATGGT-3’ CD38 (SEQ ID NO: 61) Reverse: 5’- CCATTGAGCATCACATGGAC-3’ (SEQ ID NO: 62) Forward: 5’- TGCCCCGTCTTATGGAAACC-3’ CD19 (SEQ ID NO: 63) Reverse: 5’- CTCTTCTTCTGGGCCCACTC-3’ (SEQ ID NO: 64) Forward: 5’-TTTTGAAGAATTGGAAAGAGGA-3’ IFN- ^ (SEQ ID NO: 65) Reverse: 5’- CACTTGGATGAGTTCATGTATTG-3’ (SEQ ID NO: 66) Forward: 5’- TCCTTCCCACTCGCCTTTACA-3’ CD4 (SEQ ID NO: 67) Reverse: 5’-AGCACCCACACCGCCTTCTCC-3’ (SEQ ID NO: 68) Forward: 5’- CCCACTTTGTAGCCCCATCAC-3’ CD8 (SEQ ID NO: 69) Reverse: 5’- TCAGTCCTCCAGCACACTCTG-3’ (SEQ ID NO: 70) Gene expression analysis using RT-qPCR. RNA (50-100 ng) from each sample was utilized for cDNA synthesis and amplification using a High-capacity cDNA reverse transcription kit (4368814) according to the supplier instructions (Applied Biosystems, Foster, CA). To perform the RT-qPCR reaction, 2 ul of synthesized cDNA along with forward and reverse primers was mixed with PowerUp SYBR Green master mix (Applied Biosystems) in each reaction. The RT-qPCR was performed on the QuantStudio 3 real time PCR system (Applied Biosystems) using reaction conditions; 95°C for 2 min, 40 cycles of 95°C for 15 seconds and 60°C for 30 seconds. Expression values were calculated using the 2-ddctmethod (Livak and Schmittgen, Methods, 2001.25(4): p.402-8). Stem loop RT-qPCR of sEV miRNA cargoes. cDNA synthesis of T cell sEV miRNA cargo was performed using TaqMan miRNA kit (4366596) for the 3 candidate miRNAs and RT- qPCR product was quantified by delta-delta Ct method (Livak and Schmittgen, Methods, 2001. 25(4): p.402-8). Stem loop RT-qPCR analysis of sEV miRNAs. cDNA was synthesized from sEV RNA 89 53258724.1 Attorney Docket No.047162-7412WO1(02347) using TaqMan miRNA reverse transcription kit (4366596, Applied Biosystem) for (RT specific) hsa-let-7i (ID: 002221), hsa-miR-21a (ID:000397), and hsa-miR-101b (ID:002253). Then, the reverse transcription product was mixed with specific TaqMan miRNA assay TM primers in TaqMan universal PCR master mix, no AmpErase-UNG (4324018) for amplification. The PCR reaction was carried out at 95°C for 5 min, 50 repeated cycles of 95°C for 5 seconds, and then 60°C for 1 minute. All RT-qPCR Ct values were analyzed by the 2-ddCtmethod (Livak and Schmittgen, Methods, 2001.25(4): p.402-8). The levels of each miRNA were normalized by the expression level of hsa-miR-26b as internal control provided in the TaqMan miRNA assay. sEV cargo signal quantitation. In all cases, candidate biomarker signal was normalized to internal control. For proteins, quantitation was performed by densitometry on Western blot, and biomarker expression was normalized to TSG101 (canonical exosome marker) expression. RNA was quantified by RT-qPCR and normalized to β-actin for mRNA and hsa miR 26 internal control for miRNA biomarker expression. Pre-transplant (for T cell sEV cargoes) or POD 1 (for donor heart sEVs) time point was set to a value of 1, and relative expression of biomarker signal for other POD time points were calculated. AR events in the 12 patients are shown (FIG.31). Statistical Analysis. Wilcoxon rank sum tests were conducted to compare biomarker levels at time points with ACR grade 2 versus 0 / 1. Generalized estimating equations were used to assess biomarker effects on ACR event, accounting for the correlations among biomarker levels on different days within the same patient. Receiver operating characteristic (ROC) curves were constructed using both logistic regression and generalized estimating equations. Optimal cutoff points for each biomarker were determined using Youden method. Sensitivity, specificity, negative predictive value (NPV), and positive predictive value (PPV) were calculated at the optimal cutoff points. To evaluate whether biomarker levels could detect effective treatment of moderate ACR, Spearman correlations between biomarker levels and grades of ACR were calculated for measures after the first observation of moderate ACR event for each patient. Results Clinical Data. Donor-recipient demographics, immunosuppressive regimen, and pertinent echocardiographic data are shown in Tables 8-10. Donor recipient HLA profiles are shown in Table 11. Twelve patients (1-12) underwent 70 EMBs over first 112 days follow-up: 6 (50%) subjects had 11 (15.7%) moderate ACR (grade 2) episodes and 5 (41.6%) patients had mild or no 90 53258724.1 Attorney Docket No.047162-7412WO1(02347) ACR episodes. There were 15 mild ACR (grade 1) (21.4%), and 41 (58.6%) events with no ACR (grade 0). Ten out of 11 (90.9%) moderate ACR episodes occurred within POD 38. Patient 7 developed antibody mediated rejection (AMR). Table 8 Acute cellular Patient rejection (ACR) Acute rejection Transthoracic Transthoracic Donor / recipient # grade 2, treatment echo- echoc- Demographics Antibody additional cardiography ardiography medicated Immuno- before after treatment rejection suppression treatment (AMR) pAMR1, pAMR2 timepoints #1 Postoperative POD11: LVEF Donor: 35-year-old ACR2 POD8 day (POD) 8: 70%, RV normal male, Caucasian, no Solumedrol POD3: Left size & function smoking, no chest 500mg ventricle (LV) trauma, head intravenous (IV) ejection fraction trauma, BMI 39.16 daily x 3 (EF) 60%, right Recipient: 37-year- POD23: ventricle (RV) & POD30: LVEF old male, Caucasian, ACR2 POD22 Prednisone LV normal 70%, mild LV history of smoking, 100mg daily x 5 function hypertrophy, RV body mass index normal size & (BMI) 31.13, non- function ischemic POD39: POD46: top cardiomyopathy ACR2 POD38 Solumedrol normal LV wall (possibly familial), 500mg IV daily thickness, LVEF no ventricular-assist x 3 and MMF 60%, RV mildly device, UNOS status increased to dilated with 4 1250mg every borderline normal (Q) 12H function POD80: top ACR2 POD51 POD51: normal LV wall Thymoglobulin x thickness, LVEF 7 days 60%, RV mildly dilated with borderline normal function 91 53258724.1 Attorney Docket No.047162-7412WO1(02347) #2 Donor: 26-year-old ACR2 POD30 Solumedrol POD35: LVEF male, Caucasian, 500mg IV daily POD29: mild 55%, RV & LV smoker, no chest x 3 days LVH, LVEF normal size & trauma, anoxia (drug 55%, RV normal function overdose), BMI size & function 27.52 Recipient: 22-year- old male, Caucasian, nonsmoker, BMI 23.93, cardiac allograft vasculopathy (this was his 2nd orthotopic heart transplant), no ventricular assist device, UNOS status 3 #3 POD9: Donor: 35-year-old ACR2 POD9 solumedrol POD26: mild LV female, Caucasian, 500mg IV daily POD2: LVEF hypertrophy, no history of x 3 65%, RV normal LVEF 70%, RV smoking, chest POD16: function normal function trauma, anoxia, BMI ACR2 POD16 solumedrol 32.12 500mg IV daily Recipient: 34-year- x 3, old female, mycophenolate Caucasian, history mofetil (MMF) of smoking, BMI increased to 18.58, dilated 1500mg Q12H nonischemic cardiomyopathy, left ventricular assist device, UNOS status 3 #4 POD 23: LVEF Donor: 21-year-old solumedrol POD14: mild 70%, RV normal male, Caucasian, no ACR2 POD15 500mg IV daily LVH, LVEF size with smoker, no chest x 3 days then 70%, RV normal moderate trauma, head trauma solumedrol 1gm size & function dysfunction (acute subarachnoid IV daily x 3 POD32: mild hemorrhage), BMI ACR2 POD22 LVH, LVEF 65%, 24.75 RV normal size & Recipient: 39-year- function old female, Caucasian, no history of smoking, BMI 20.65, nonischemic cardiomyopathy (Adriamycin induced), no ventricular assist device, UNOS status 2 #5 Donor: 23-year-old ACR2 POD13 female, Caucasian, no smoking, no 92 53258724.1 Attorney Docket No.047162-7412WO1(02347) solumedrol POD8: LV with POD22: mild chest trauma, natural 500mg IV daily mild LVH, EF LVH, EF 61%, (ruptured colloid x 3 days 58%, RV normal RV normal size & cyst with size with function herniation), BMI borderline 30.3 normal function Recipient: 30-year- old female, non- Hispanic, nonsmoker, BMI 17.5, nonischemic cardiomyopathy (dilated, familial), no ventricular assist device, UNOS status 2 #6 POD35: 1g IV POD36: LVEF Donor: Non high ACR2 POD34 Solumedrol x 3 POD22: LVEF 57%. normal left risk, brain death days tapered 68%. Normal cavity size. The donor with home RV & LV size apical inferior and Recipient: 56-year- prednisone and function apical septum old male, ischemic segments are cardiomyopathy, hypokinetic. former smoker, BMI Normal right 30.18, UNOS status ventricular size. 3 Mildly decreased right ventricle systolic function #7 POD60: POD73: LVEF Donor: Non high pAMR1 POD57 Prednisone 25mg 67%. Normal RV risk, brain death daily POD60: Normal & LV size and donor. Azathioprine left cavity size. function Recipient: 34-year- 100mg daily Mild concentric old, transgender Tacrolimus 9mg left ventricular female, with non- bid, (tac goal 8- hypertrophy. ischemic advanced 10 ng / ml) LVEF 69% dilated POD 72: Pulse POD92: LVEF cardiomyopathy. pAMR2 POD71 dose IV 55%-60%. BMI 40.92. Former Solumedrol 1g Normal RV & LV smoker, UNOS x3, Increase size and function status 4 Tacrolimus to 9.5 mg BID (tac goal 10-12 ng / ml), Increase Azathioprine 150mg daily POD90: Pulse POD138: normal pAMR2 POD85 dose IV left ventricle size Solumedrol 1g and function x3 LVEF 67% Plasmapheresis x5 (1-1.5 plasma volume exchange) IVIG 100 mg / kg x5 #8 No rejection Donor: 21-year-old male, Caucasian, 93 53258724.1 Attorney Docket No.047162-7412WO1(02347) nonsmoker, no chest trauma, head injury (MVA, SAH & SDH), BMI 27.49 Recipient: 65-year- old male, Caucasian, history of smoking, BMI 19.5, Ischemic cardiomyopathy, no ventricular assist device, UNOS status 2 #9 No rejection Donor: 32-year-old female Caucasian, nonsmoker, no chest trauma, anoxia, BMI 36 Recipient: 51-year- old male, Hispanic, nonsmoker, BMI 28.79, familial cardiomyopathy / atri oventricular nodal reentry tachycardia, no ventricular assist device, UNOS status 2 #10 No rejection Donor: 41-year-old male, African American, unknown history of smoking, no chest trauma, anoxic brain injury. cardiovascular unknown cause of death, BMI 32.4 Recipient: 52-year-old male, Caucasian, history of smoking, BMI 32.5, nonischemic cardiomyopathy, ventricular assist device, UNOS status 4 #11 No rejection Donor: 39-year-old male, Caucasian, nonsmoker, no chest trauma, anoxic brain injury secondary to drug overdose, BMI 34.7 Recipient: 62-year- old male, Caucasian, history of smoking, BMI 26.1, 94 53258724.1 Attorney Docket No.047162-7412WO1(02347) hypertrophic cardiomyopathy, no ventricular assist device, UNOS status 2 #12 No rejection Donor: 34-year-old male, Caucasian, nonsmoker, no chest trauma, anoxic brain injury. cardiovascular, BMI 24.6 Recipient: 36-year- old male, non- Hispanic, nonsmoker, BMI 24.7, dilated / familial cardiomyopathy, no ventricular assist device, UNSO status 2 Table 9 Immunosuppression treatment for Patients 1-5, 8-12 (University of Pennsylvania) Standard Protocol 1gm mycophenolate mofetil INTRA-OPERATIVE 1gm methylprednisolone 1gm mycophenolate mofetil Q12H POST-OPERATIVE 125mg IV methylprednisolone Q8H x 3 doses followed by weight based steroid taper tacrolimus started POD#0 Calcineurin Inhibitor Sparing Protocol 1gm mycophenolate mofetil INTRA-OPERATIVE 500 mg methylprednisolone Basiliximab POD #0 & #4 POST-OPERATIVE 1gm mycophenolate mofetil Q12H 125mg IV methylprednisolone Q8H x 3 doses followed by weight based steroid taper tacrolimus started POD#3 Immunosuppression treatment for Patients 5, 6 (Yale University) INTRA-OPERATIVE POST-OPERATIVE Methylprednisolone 1 gram prior to POD# 0 to 1 125 mg IV PUSH every 8 hours x3 doses (Solu-Medrol) reperfusion starting 2 hours after patient arrives in CTICU POD #2-3 50 mg by mouth every 12 hours POD #4-5 45 mg by mouth every 12 hours 95 53258724.1 Attorney Docket No.047162-7412WO1(02347) Prednisone POD #6-7 40 mg by mouth every 12 hours POD #8-9 35 mg by mouth every 12 hours POD #10-11 30 mg by mouth every 12 hours POD #12-13 25 mg by mouth every 12 hours POD #14-15 20 mg by mouth every 12 hours POD #16-23 30 mg by mouth daily Mycophenolate Mofetil POD #1 1000 mg every 12 hours (CellCept) *May start IV or oral suspension with bowel function and convert to tablets / capsules when extubated Basiliximab 20 mg IV PUSH prior POD #4 20 mg IV once (Simulect) to reperfusion Table 10 Calcineurin Inhibitor (CNI) Tacrolimus If < 2 ng / mL, increase does to 4 mg every 12 hours then titrate to goal First dose: 2 mg then check 12-hour Start oral or sublingual POD# 1- level 3 based on clinical indications If >2 ng / mL, gradually titrate dose to such as renal and graft function goal CNI: Target Trough Levels Tacrolimus Cyclosporine Months 0-6 8-10 ng / mL Months 0-3 150-300 ng / mL After 6 months 5-8 ng / mL After 3 months 100-200 ng / mL Donor-recipient pair demographics, induction and maintenance immunosuppression regimen for all 12 patients is shown. Escalation immunosuppression treatment for moderate ACR episodes along with pertinent echocardiographic findings at time points of moderate ACR is shown. Escalation immunosuppression in Patient 7 at time points of pAMR2 is also shown, along with echocardiographic data. In any of the 11 moderate ACR episodes and the 3 pAMR episodes, there were no clinical signs of acute rejection, as echocardiography showed normal heart function in all instances where surveillance EMB showed grade 2 ACR or pAMR. Table 11: Recipient and respective donor HLA profiles Recipient-Donor Human Leukocyte Antigen (HLA) profiles are shown. Anti-donor HLA I specific antibody utilized for enrichment of donor heart sEVs is shown in bold and underlined. Patient 1 Recipient HLA A 24 32 Donor HLA A 2 3 HLA B 61 55 HLA B 49 57 HLA C W2 W9 HLA C 04 07 HLA BW 6 HLA BW 4 Positive 6 Negative 96 53258724.1 Attorney Docket No.047162-7412WO1(02347) HLA DQ 03:01 05 HLA DQ 01 02 HLA DR 4 11 HLA DR 7 13 Patient 2 Recipient HLA A 1 2 Donor HLA A 3 31 HLA B 62 49 HLA B 60 60 HLA C W4 W7 HLA C 10 10 HLA BW 6 4 HLA BW 4 Negative 6 Positive HLA DQ 01 02:01 HLA DQ 01 03 HLA DR 1 7 HLA DR 4 13 Patient 3 Recipient HLA A 24 Donor HLA A 1 3 HLA B 44 58 HLA B 8 35 HLA C W10 W5 HLA C 07 12 HLA BW 4 HLA BW 4 Negative 6 Positive HLA DQ 5 HLA DQ 02 03 HLA DR 11 12 HLA DR 4 7 Patient 4 Recipient HLA A 1 Donor HLA A 3 24 HLA B 8 57 HLA B 35 51 HLA C W6 W7 HLA C 04 15 HLA BW 6 4 HLA BW 4 Positive 6 Positive HLA DQ 02:01 05:01 HLA DQ 01 01 HLA DR 17 7 HLA DR 13 15 Patient 5 Recipient HLA A 11 23 Donor HLA A 1 24 HLA B 41 51 HLA B 8 44 HLA C W4 17 HLA C 02 07 HLA BW 6 4 HLA BW 4 Positive 6 Positive HLA DQ 02:01 03 HLA DQ 01 05:01 HLA DR 4 7 HLA DR 1 17 Patient 6 Recipient HLA A 23 32 Donor HLA A 03 01 HLA B 81 42 HLA B 07 27 HLA C 08 17 HLA C 07 02 HLA BW 6 6 HLA BW 6 4 HLA DQ 01:02 01:05 HLA DQ 02:01 01:02 HLA DR 13 12 HLA DR 07 16 Patient 7 Recipient HLA A 68 33 Donor HLA A 02 32 HLA B 15 58 HLA B 13 40 HLA C 03 03 HLA C 18 15 HLA DQ 05:05 04:01 HLA BW 4 6 HLA DR 13 03 HLA DQ 01:02 03:01 HLA DR 15 04 97 53258724.1 Attorney Docket No.047162-7412WO1(02347) Patient 8 Recipient HLA A 11 26 Donor HLA A 2 11 HLA B 35 45 HLA B 7 44 HLA C W4 W6 HLA C 05 07 HLA BW 6 HLA BW 4 Positive 6 Positive HLA DQ 1 HLA DQ 01 No 2nd antigen detected HLA DR 103 15 HLA DR 15 No 2nd antigen detected Patient 9 Recipient HLA A 11 24 Donor HLA A 2 26 HLA B 8 60 HLA B 37 38 HLA C W10 W7 HLA C 06 12 HLA BW 6 HLA BW 4 Positive 6 Negative HLA DQ 03:01 05:01 HLA DQ 01 01 HLA DR 17 4 HLA DR 13 15 Patient 10 Recipient HLA A 1 2 Donor HLA A 30 33 HLA B 8 13 HLA B 44 71 HLA C W6 W7 HLA C 07 10 HLA BW 6 4 HLA BW 4 Positive 6 Positive HLA DQ 02:01 05:01 HLA DQ 01:02 05:01 HLA DR 7 HLA DR 15 17 Patient 11 Recipient HLA A 30 60 Donor HLA A 2 29 HLA B 13 53 HLA B 51 60 HLA C W4 W6 HLA C 10 14 HLA BW 4 HLA BW 4 Positive 6 Positive HLA DQ 02:01 05 HLA DQ 01 No 2nd antigen detected HLA DR 7 13 HLA DR 13 No 2nd antigen detected Patient 12 Recipient HLA A 2 11 Donor HLA A 2 32 HLA B 35 51 HLA B 13 37 HLA C W4 14 HLA C 02 06 HLA BW 6 4 HLA BW 4 Positive 6 Negative HLA DQ 01:03 05:05 HLA DQ 01 02 HLA DR 11 HLA DR 7 15 Whole plasma sEV analysis and quality control. Plasma sEVs were characterized per MISEV guidelines (Thery, et al., J Extracell Vesicles.2018;7(1)). By electron microscopy, small EVs were detected (FIG.32A), confirmed by nanoparticle tracking analysis (NTA) (FIG.32B). Overall, sEV size distribution and concentration were similar at different time points (FIG.32B). sEV size distribution or concentration when comparing by ACR grade were similar (FIG.32C). 98 53258724.1 Attorney Docket No.047162-7412WO1(02347) By Western blot, sEVs expressed exosome markers CD63, CD9, TSG101, flotillin-1, and alix; with absence of cytochrome c, calnexin, and apolipoprotein E (FIG.32D). Collectively, sEV quantitative profiles between patients or between different ACR grades were similar. Tissue / cell-specific sEVs were enriched from plasma sEVs using antibody conjugated magnetic beads (FIG.30). To validate that intact sEVs were enriched using this methodology, the bead-bound and unbound sEV fractions were analyzed. For T cell sEVs, CD3 antibody bead- bound fraction was eluted and analyzed by NTA to validate enrichment of intact sEVs (FIG. 33A), and the unbound sEVs were studied for CD3 absence by Western blot (FIG.33B). For B cell sEVs, CD19 antibody bead-bound fraction was eluted for sEV characterization by NTA (FIG.33C) and the unbound sEVs were assessed for CD19 absence by Western blot (FIG.33D) Similarly, donor heart sEVs were eluted and confirmed by NTA for enrichment of intact sEVs (FIG.33E) and the unbound sEVs were analyzed for absence of troponins by Western blot (FIG.33F). Donor heart and T cell sEV cargo analysis. Expression of the 8 candidate biomarkers for EMB-matched time points is shown. Representative data for Patients 1-6 in whom there were moderate ACR episodes are shown in FIGs.34A-34D, FIGs.35A-35D, FIGs.36A-36D, FIGs. 37A-37D, FIGs.38A-38D, and FIGs.39A-39F, respectively. sEV profiles in Patient 7 with AMR are shown in FIGs.45A-45G. sEV cargo profiles for Patients 8-12 in whom there were no moderate ACR or AMR episodes are shown in FIGs.40A-40D, FIGs.41A-41D, FIGs.42A- 42D, FIGs.43A-43D, and FIGs.44A-44D, respectively. For each patient, donor heart sEV cTnT protein expression by Western blot is shown, along with cTnT mRNA expression by RT- qPCR. For T cell sEVs, CD4, CD8, and TCR protein expression by Western blot is shown, along with quantitation of miRs let 7i, 101b, and 21a by stem loop RT-qPCR. Donor heart sEV analysis. Overall, in 5 patients without moderate ACR episodes, there were 3 mild ACR episodes and other EMBs showed zero ACR (FIGs.40A-40D, FIGs.41A- 41D, FIGs.42A-42D, FIGs.43A-43D, and FIGs.44A-44D, respectively). cTnT protein signal remained steady or above POD 1 baseline at all time points (FIG.40A, FIG.41A, FIG.42A, FIG.43A, and FIG.44A, respectively). In the 6 subjects with 11 moderate ACR episodes (Patients 1-6), there were also 11 mild ACR events (FIG.34A, FIG.35A, FIG.36A, FIG.37A, FIG.38A, and FIG.39A, respectively). Patient 1 had 4 moderate ACR and 2 mild ACR episodes, requiring escalation of immunosuppression 4 times (FIGs.34A-34D). Patient 3 had 4 99 53258724.1 Attorney Docket No.047162-7412WO1(02347) mild and 2 moderate ACR events (FIGs.36A-36D). For cTnT protein, moderate ACR resulted in reduction in cTnT expression in 8 out of 11 episodes. There were 2 false positive events that were mild ACR by EMB, one in Patient 1 (FIG.34A) and the other in Patient 4 (FIG.37A); repeat EMB 7-8 days later in both patients showed moderate ACR. cTnT mRNA cargo analysis by RT-qPCR showed stable signal in the 5 patients without moderate ACR events (FIG.40B, FIG.41B, FIG.42B, FIG.43B, and FIG.44B, respectively). In Patients 1-6 with moderate ACR episodes, cTnT mRNA levels were consistently decreased with grade 2 ACR (FIG.34B, FIG.35B, FIG.36B, FIG.37B, FIG.38B, and FIGs.39B, 39C, respectively). Reversal of moderate ACR episodes demonstrated corresponding increase in cTnT mRNA signal back toward baseline signal (FIG.34B, FIG.35B, FIG.36B, FIG.37B, FIG. 38B, and FIGs.39B, 39C, respectively). T cell sEV protein cargo analysis. Western blots for CD4, CD8, TCR, and TSG101 proteins and their relative expression in T cell sEVs are shown (FIG.34C, FIG.35C, FIG.36C, FIG.37C, FIG.38C, FIG.39D, FIG.45E, FIG.40C, FIG.41C, FIG.42C, FIG.43C, and FIG.44C). In 5 patients without moderate ACR, T cell protein markers remained stable (FIG. 40C, FIG.41C, FIG.42C, FIG.43C, and FIG.44C, respectively). CD4, CD8, and TCR protein signals increased with moderate ACR episodes, and reversal of ACR led to decrease in the signals back towards baseline (FIG.34C, FIG.35C, FIG.36C, FIG.37C, FIG.38C, and FIG.39D, respectively). Especially, CD8 expression was elevated at all time points of moderate ACR (11 out of 11). T cell sEV miRNA cargo analysis. In 5 patients without moderate ACR episodes, let 7i, miR 101b, and miR 21a expression remained stable (FIG.40D, FIG.41D, FIG.42D, FIG.43D, and FIG.44D, respectively). In Patients 1-6, all 3 miRNAs showed elevation in miRNA signals with moderate ACR episodes (FIG.34D, FIG.35D, FIG.36D, FIG.37D, FIG.38D, and FIG. 39E, respectively). Interestingly, in Patients 1, 2, 4 and 5, miR 21a was elevated at EMB time points preceding the moderate ACR episode (FIG.34D, FIG.35D, FIG.37D, and FIG.38D). Overall, T cell EV miRs showed strong correlation with increase in expression levels with moderate ACR episodes. Moderate ACR may lead to changes in other cell specific markers. Whether other cell- specific markers may also be altered secondary to ACR was analyzed. First, cardiac troponin I (cTnI) protein and mRNA expression were assessed in donor heart sEVs. In Patient 6, moderate 100 53258724.1 Attorney Docket No.047162-7412WO1(02347) ACR led to decrease in cTnI protein and mRNA signals (FIGs.39A, 39C, respectively). Similarly, in Patient 7, pAMR2 led to decrease in cTnI signal (FIG.45C). Second, mRNA markers of T cell activation were assessed in T cell sEVs. Accordingly, CD4, CD8, and IFNγ mRNAs were upregulated in Patient 6 with moderate ACR (FIG.39F). This suggests that other cell-specific protein and RNA signatures may be dynamically altered with ACR. sEV profiling may enable noninvasive window into AMR. An ideal biomarker platform would enable distinction of ACR versus AMR, as treatment modalities for these two types of AR are different. It is contemplated herein that AMR would lead to dynamic changes in circulating B cell sEV cargoes (FIG.28). In Patient 7, surveillance EMB on POD 57 demonstrated pAMR1, with repeat biopsy on POD 71 showing pAMR2 (FIG.45A), treated with escalation in tacrolimus + azathioprine, and intravenous methylprednisolone. Repeat EMB on POD 85 showed persistent pAMR2 requiring further escalation to rituximab and plasmapheresis therapy started on POD 90. cTnT and cTnI protein and mRNA cargoes were downregulated in donor sEVs at time points of pAMR2 (FIGs.45B-45D). T cell sEV markers CD8 and TCR were unchanged, but CD4 was upregulated (FIG.45E). Importantly, in B cell sEVs upregulation of lymphocyte activation markers HLA-DR (major histocompatibility complex II) and CD38 proteins were noted at time points of pAMR (FIG.45F). CD38 mRNA and CD19 mRNA expression was also upregulated (FIG.45G). AMR treatment correspondingly led to decrease of CD19, CD38, and HLA-DR expression in B cell sEV fractions (POD 92, 93 timepoints (FIG. 45F, FIG.45G). Diagnostic accuracy of the candidate biomarkers. Expression of all 8 sEV candidate biomarkers categorized by ACR grade are shown in Box-Whisker format (FIG.46A). By Wilcoxon rank sum test analysis, the biomarkers were significantly altered during moderate ACR episodes (FIG.46A), with RNA signatures showing greater statistical significance. cTnT mRNA signal was the most statistically significant (p=6.87x10-7). ROC curves were constructed for each biomarker using logistic regression (FIG.46B) and generalized estimating equations (FIGs.47A-47E). Area under curve values were highest for cTnT mRNA (0.99) and for T cell sEV miRNAs (> 0.97) (FIG.46B). Optimal threshold cut-offs for each biomarker along with sensitivity, specificity, PPV, and NPV are shown (FIG.46C). cTnT mRNA demonstrated highest diagnostic accuracy, with sensitivity of 100%, specificity of 97.4%, NPV of 100%, and PPV of 91.7%. Overall, sEV RNA signatures showed higher diagnostic accuracy compared to 101 53258724.1 Attorney Docket No.047162-7412WO1(02347) protein markers. Spearman correlations between biomarker signals and ACR grades were calculated after observation of moderate ACR event to assess if sEV biomarkers may enable noninvasive monitoring of ACR treatment efficacy. This demonstrated good to strong correlation of changes in RNA signatures in donor heart sEVs and T cell sEVs with reversal of moderate ACR, especially with cTnT mRNA (FIG.46D). The present study indicates that ACR imparts alterations in donor heart and T cell sEV quantitative and cargo profiles; with successful treatment resulting in dynamic reversal of the sEV profiles back to the baseline constitutive state. In all 6 subjects with moderate ACR episodes, and in one patient with AMR, this dynamic trend in sEV profiles was observed. Spearman coefficients were calculated to understand how well the changes in sEV biomarkers correlated with repeat EMB data demonstrating successful treatment of moderate ACR (FIG. 46D). Candidate RNA biomarkers showed strong correlation, especially troponin T mRNA (0.867) and miR 21a (0.853). Other tested candidate markers such as cTnI, CD4 mRNA, CD8 mRNA, CD38, HLA-DR, and IFNγ also showed changes with AR (FIGs.39A-39F, FIGs.45A- 45G). As the underlying pathophysiology of ACR remains very similar across many transplant tissue types, it contemplated herein that this platform may have universal application in the field of transplantation diagnostics and surveillance. It is further contemplated herein that analogous to the changes noted in T cell sEV cargoes secondary to ACR, AMR would lead to concomitant changes in circulating B cell sEV profiles; thus, potentially enabling distinction of ACR versus AMR versus mixed ACR / AMR. In the patient with AMR, plasma sEV analysis showed upregulation of B cell activation markers, including HLA-DR, CD38, CD19 in B cell sEVs along with decrease in donor heart sEV cTnT and cTnI signals (FIGs.45A-45G). Interestingly, pAMR2 treatment with rituximab + plasmapheresis led to reversal of these changes in the sEV profiles, analogous to the findings seen with successful treatment of moderate ACR. These results support that a composite panel of donor heart sEV, T cell sEV, and B cell sEV cargo signatures would enable AR diagnosis, distinguishing between ACR versus AMR versus mixed ACR / AMR. A recent study of platelet-free whole plasma analysis of EVs showed 69.2% sensitivity (9 / 13) for ACR detection in a validation cohort (Castellani, et al., J Heart Lung Transplant. Oct 2020;39(10):1136-1148). EV size was also different for moderate ACR timepoints. In the present study, differences in size or quantity of plasma sEVs was not observed possibly because of 102 53258724.1 Attorney Docket No.047162-7412WO1(02347) differences in isolation methods and the EV phenotypes studied. Unlike whole plasma EV analysis, it is contemplated herein that cell / tissue specific sEVs have greater diagnostic potential as they represent the direct secretory output of the tissue of interest. Enrichment of sEV subpopulations improves the signal to noise ratio of biomarker signature compared to peripheral blood sample that represents sEV contribution from all cell types in the body (FIGs.33A-33F). The results of the present study support this hypothesis. Another important aspect of sEV platform may be its utility for ACR diagnosis in the peri-transplant period (first 30 to 45 days). The present study had no exclusion criteria other than patient age. Ten out of 11 moderate ACR episodes in the present study occurred during the first 38 days post-transplant. As observed in the animal transplant models (Habertheuer, et al., J Thorac Cardiovasc Surg.2018;155(6); Habertheuer, et al., Transplantation.2022;106(4); Vallabhajosyula, et al., J Clin Invest.2017;127(4): 1375-1391), donor sEVs are constitutively released into peripheral blood immediately after transplantation, reaching steady state under conditions of allograft quiescence. Similar trend was noted with circulating T cell sEVs (Example 1 herein and Korutla, et al., Am J Transplant.2024 Mar;24(3):419-435). At present, it is unclear whether sEV profiles change over long-term follow-up. As ddcfDNA levels may not be stable and increase >24 months post-transplant (Kim, et al, J Heart Lung Transplant. Jul 2022;41(7):919-927), it will be important to understand if the cell-specific sEV profiles remain stable over long-term follow-up. Example 5: B cell extracellular vesicle biomarkers for detection of antibody mediated rejection in lung transplantation Materials and Methods Sex as a biological variable: Sex was not considered as a biological variable for this study. Antibodies: Antibodies were purchased and recommended dilutions in the manufacturer’s data sheets for Western blot analysis (ST1) were followed. Monoclonal anti-CD3 (SC-1179), and anti-CD19 (SC-18896) antibodies (Santa Cruz Biotechnologies Inc., Santa Cruz, CA) were used to conjugate with the N-hydroxysuccinamide (NHS) magnetic beads (88827) from Pierce Inc (Waltham, MA). Horse radish peroxidase-conjugated secondary anti-rabbit and anti-mouse antibodies for western blot analysis were purchased from Santa Cruz Biotechnologies Inc. 103 53258724.1 Attorney Docket No.047162-7412WO1(02347) Table 12: Antibodies utilized for Western Blot analysis and for antibody bead conjugation Antibody Biotech Company Catalog Number Dilution CD3-E (UCH-Tl) Santa Cruz SC-1179 Antibody-conjugated Mouse monoclonal Biotechnology beads CD19 (SJ25-Cl) Santa Cruz SC-18896 Antibody-conjugated Mouse monoclonal Biotechnology beads HLA-DR(LN-3) Novus Biologicals NBP2-45310 1:1000 Mouse monoclonal Inc CD20(AT80) Santa Cruz Sc-58982 1:500 Mouse monoclonal Biotechnology CD38 (Hll) Santa Cruz Sc-374650 1:500 Mouse monoclonal Biotechnology IFNy Proteintech 15365-1-AP 1:1000 Rabbit polyclonal IL6R Proteintech 66855-1-Ig 1:1000 Mouse monoclonal BAFF-R (F-3) Santa Cruz SC-365610 1:500 Mouse monoclonal Biotechnology TSG 101 Proteintech 67381-1-Ig 1:1000 Mouse monoclonal Flotillin 1 Proteintech 67968-1-Ig 1:1000 Mouse monoclonal CD4 (MT310) Santa Cruz Sc-19641 1:500 Mouse monoclonal Biotechnology CDS (UCH-T4) Santa Cruz Sc-1181 1:500 Mouse monoclonal Biotechnology Small extracellular vesicles (sEVs) isolation from plasma and characterization: Institutional Review Board (IRB) approval was obtained from Washington University, Saint Louis (IRB 201705135), along with a material transfer agreement in place with Yale University for shipment of plasma samples. Patients’ blood samples were collected on POD 1, day 3 and day 30 along with the patient clinical and transbronchial lung allograft biopsy information. Peripheral blood samples (5 ml) were collected in EDTA tube and centrifuged at 2000 x g for 20 minutes. The supernatant representing the plasma was collected and frozen at -80 °C. Samples were then shipped to Yale University for sEV isolation and downstream analysis. Isolation and 104 53258724.1 Attorney Docket No.047162-7412WO1(02347) characterization of small EVs was performed with modification of previously published methodologies (Habertheuer, et al., Transplantation.2022;106(4):754-766; Habertheuer, et al., Am J Transplant.2022;22(7):1909-1918; Example 1 herein and Korutla, et al., Am J Transplant. 2024;24(3):419-435). With the aim of translating the sEV methodologies to the clinical setting, the isolation protocol was modified to performing ultracentrifugation as the primary modality, excluding size exclusion chromatography techniques which are very time consuming and resource intensive, and more difficult to achieve wide application. The goal was to simplify the sEV isolation technique without compromising quality control so that the technique can be more easily and widely adopted. In making this change, extensive quality testing was performed to ensure that the sEV cargo analysis experiments were not compromised. Plasma sample ultracentrifugation methodologies were adopted to isolate small EVs by spinning the plasma at 130,000 x g twice for 2 hours and the sEV pellet was resuspended in phosphate buffered saline. Protein concentration was obtained using absorbance spectrometry and 5 ug of sEV protein equivalent was run by nanoparticle tracking analysis (NS300, Malvern Instruments, Westborough, MA) to obtain nanoparticle size distribution and concentration. The mean particle size distribution was <100 nm, and in any preparations that the mean size was over 100 nm, the sample was not utilized for further downstream sEV applications. To confirm enrichment of exosomes in the sEV preparation, Western blot was performed to assess for expression of exosome markers, CD63, CD81, TSG101, flotillin-1, and alix-1. To make sure that the sEV preparation was not contaminated with intracellular organelles, Western blot was performed to check for absence of calnexin (endoplasmic reticulum marker) and cytochrome c (mitochondria marker), along with appropriate positive control. As the size of apolipoproteins in plasma can be in the same size range as sEVs, Western blot for absence of apolipoprotein in the sEV preparation was also performed along with total human plasma protein as positive control. Enrichment of T cell and B cell specific small extracellular vesicles using affinity antibody coupled methodology: Specific antibodies for T cell (anti-CD3) and B cell (anti-CD19) were covalently conjugated to NHS magnetic beads per manufacturer’s protocol. sEVs (1.5 to 2.0 x 1010particles based on sample availability) were incubated with antibody–magnetic beads complex overnight at 4°C. Using the magnetic stand, bead bound sEVs and unbound EVs were separated. The bound fraction representing the T cell EV subsets, or B cell subsets were washed with phosphate buffered saline and used for the downstream applications (RNA and protein 105 53258724.1 Attorney Docket No.047162-7412WO1(02347) cargo). As quality control, the bound sEV fraction was tested by Western blot for expression of cell-specific markers (T cell or B cell based on the antibody used) and the unbound sEV fraction was assessed for absence of cell-specific markers and presence of exosome marker, flotillin-1; along with appropriate positive control. Small EVs RNA and protein cargo analysis: Total RNA was extracted from T cell specific and B cell specific small EVs by using Trizol reagent (Ambien, life technologies) followed by phenol chloroform extraction methodology (Example 1 herein and Korutla, et al., Am J Transplant.2024;24(3):419-435). RNA quality and concentration (ng / µl) was measured on NanoDrop One (ThermoScientific, Waltham, MA). Bound sEVs were lysed using radioimmunoprecipitation assay buffer and separated on NuPAGE 4-12% Bis-Tris gel and transferred onto iBlot 2 nitrocellulose membrane (Invitrogen). The blot was blocked with 5% milk, incubated with specific primary antibody, followed by horse radish peroxidase-conjugated secondary antibody. Target protein expression was detected by chemiluminescence using Image quant LAS Amersham ImageQuant™ 800 (Cytivia Lifesciences, Marlborough, MA) (Example 1 herein and Korutla, et al., Am J Transplant.2024;24(3):419-435). mRNAs expression analysis using RT-qPCR: RNA enriched from anti-CD3 bound sEVs or from anti-CD19 bound sEVs was used for amplification of cDNA using Vilo cDNA reverse transcription kit (11754050) (Thermo Fisher Scientific). RT-qPCR reactions were performed using synthesized cDNA along with forward and reverse primers (Table 13) mixed with PowerUp SYBR Green master mix (Thermo Fisher Scientific) in each reaction. The RT-qPCR reactions were carried out on the QuantStudio 3 real time qPCR system (Thermo Fisher Scientific). For each mRNA candidate biomarker, expression levels were normalized to internal control b-actin mRNA expression. Obtained relative quantitative values from cycle threshold (Ct) were normalized to β-actin expression for that sample and quantified using the 2−ΔΔCT method (Livak, et al., Methods.2001; 25(4):402-408). For AMR detection, quantification of B cell sEV mRNA cargoes via RT-qPCR was performed for 8 markers of B cell activation (i.e., CD19, CD20, IL6-R, BAFF-R, IFNγ, HLA-DR, CD38, ICOS ligand (ICOSL) (Heeger, et al., Nature Rev Nephrology.2024;20:218-232). 106 53258724.1 Attorney Docket No.047162-7412WO1(02347) Table 13: Primers used for RT-qPCR of mRNA cargoes of T cell and B cell sEVs Gene Primer Sequences Forward: 5’-TGCTGATGACCTCACATGGT-3’ CD38 (SEQ ID NO: 61) Reverse: 5’- CCATTGAGCATCACATGGAC-3’ (SEQ ID NO: 62) Forward: 5’- TGCCCCGTCTTATGGAAACC-3’ CD19 (SEQ ID NO: 63) Reverse: 5’- CTCTTCTTCTGGGCCCACTC-3’ (SEQ ID NO: 64) Forward: 5’-TTTTGAAGAATTGGAAAGAGGA-3’ IFN- ^ (SEQ ID NO: 65) Reverse: 5’- CACTTGGATGAGTTCATGTATTG-3’ (SEQ ID NO: 66) Forward: 5’- TCCTTCCCACTCGCCTTTACA-3’ CD4 (SEQ ID NO: 67) Reverse: 5’-AGCACCCACACCGCCTTCTCC-3’ (SEQ ID NO: 68) Forward: 5’- CCCACTTTGTAGCCCCATCAC-3’ CD8 (SEQ ID NO: 69) Reverse: 5’- TCAGTCCTCCAGCACACTCTG-3’ (SEQ ID NO: 70) Forward: 5’- TGGGACCATCTTCATCATCAAGG-3’ HLA-DR (SEQ ID NO: 71) Reverse: 5’- GGGCATTCCATAGCAGAGACAGAC-3’ (SEQ ID NO: 72) Forward: 5’- CTCTCTGGGGAGGCATTATGTA-3’ CD20 (SEQ ID NO: 73) Reverse: 5’- GTAACAGTATTGGGTAGATGGGGAG-3’ (SEQ ID NO: 74) Forward: 5’- TGGTGGATGTTCCCCCCGAG -3’ IL6R (SEQ ID NO: 75) Reverse: 5’- TCCTGGGAATACTGGCACGG-3’ (SEQ ID NO: 76) Forward: 5’- GTGGGTCTGGTGAGCTGGAG-3’ BAFF-R (SEQ ID NO: 77) Reverse: 5’- GGTGGTTCCTGGTCTTCCC-3’ (SEQ ID NO: 78) Forward: 5’- TGGAAGAGGTGGTCAGGC-3’ ICOSL (SEQ ID NO: 79) Reverse: 5’- TTAGGCTATTGTCCGTTG-3’ (SEQ ID NO: 80) 107 53258724.1 Attorney Docket No.047162-7412WO1(02347) Results Lifelong surveillance for allograft rejection is a major cornerstone of lung transplant patient care. Antibody-mediated rejection (AMR) significantly contributes to allograft dysfunction, yet its noninvasive diagnosis and treatment monitoring remain challenging (Berry, et al., Ann Transl Med.2020;8(6):411). Building on the novel biomarker platform for acute cellular rejection (ACR) monitoring based on T cell sEV cargo profiling disclosed herein, it is contemplated herein that, as ACR leads to changes in circulating T cell sEVs, AMR would induce changes in circulating B cell sEV cargoes, enabling its noninvasive diagnosis. As such, the development of a B cell-specific sEV platform that demonstrates distinct cargo changes in a lung transplant patient with AMR compared to two patients without AMR / ACR is disclosed herein. Three bilateral lung transplant recipients (Patients 1-3) were studied. Patient-1 developed mixed AMR and ACR; Patients-2 and -3 did not have ACR or AMR. Peripheral blood was collected on postoperative days (PODs) 1, 3, and 30, with surveillance transbronchial lung biopsies performed on POD-30. Unlike Patients-2 and -3, Patient-1 developed de novo donor- specific antibodies (DSAs) on POD-30 and presented with dyspnea and pulmonary infiltration on computer tomography (FIG.48A, FIG.48B). Pulmonary function tests were performed for functional vital capacity (FVC) and forced expiratory volume in one second (FEV1) measurements (FIG.48C). This demonstrated improvement in FVC and FEV1 compared to pre- transplant measurements in all 3 patients, but the least improvement was seen in Patient-1 (FIG. 48C). This patient received treatment for mixed ACR / AMR with thymoglobulin, high dose steroids, carfilzomib, tocilizumab, and intravenous immunoglobulin therapy. Patients 2 and 3 had uneventful postoperative courses without development of DSAs and biopsies demonstrating no ACR or AMR. Plasma sEVs enriched with exosomes were isolated using serial ultracentrifugation, and sEVs were characterized per the Society of Extracellular Vesicles guidelines (Welsh, et al., J Extracell Vesicles.2024;13(5):e12451), including expression of exosome markers CD63, flotillin-1, TSG101, alix-1, CD81 on Western blot, along with absence of calnexin (endoplasmic reticulum marker), cytochrome c (mitochondria marker), and apolipoprotein E (plasma lipoprotein marker) (FIG.49A, Table 12). By nanoparticle tracking analysis (NTA), the isolated nanoparticles phenotyped as small EVs (FIGs.49B-49E). B cell-specific sEVs were enriched 108 53258724.1 Attorney Docket No.047162-7412WO1(02347) from the plasma sEV pool using anti-CD19 antibody-conjugated beads (FIG.50A). As quality control, the bead unbound sEVs were analyzed for the absence of CD19 but presence of flotillin- 1 (FIG.50B). The bead-bound sEVs representing B cell sEVs were analyzed by NTA (FIG. 50C) and Western blot for expression of B cell activation protein markers, including CD20, class II human leukocyte antigen (HLA)-DR, CD38, IFNγ, IL6 receptor (IL6-R), BAFF receptor (BAFF-R) (FIG.50D). Furthermore, several of these markers were more highly expressed at the POD-30 time point of AMR diagnosis in Patient-1. Similarly, T cell sEVs were enriched using anti-CD3 antibody-conjugated beads and both bound and unbound fractions were analyzed (FIGs.50E-50G). Collectively, the results disclosed herein indicate that AMR leads to changes in protein cargoes of circulating B cell sEVs. Next, methodologies were developed for characterization of mRNA cargoes of sEVs by RT-qPCR. For ACR, T cell sEV mRNA cargoes were quantified for markers of T cell alloreactivity (CD8, IFNγ, HLA-DR, CD4) (Table 13). Relative expression at POD-3 and POD- 30 was compared to POD-1 baseline. Patient-1 with mixed ACR / AMR showed upregulation of T cell markers CD8, IFNγ, and HLA-DR on POD-30 (FIG.50H), while Patients-2 and -3 exhibited marker expression levels similar to baseline across all timepoints (FIG.50H). For AMR detection, B cell sEV mRNA cargoes were quantified for 8 markers of B cell activation: CD19, CD20, IL6-R, BAFF-R, IFNγ, HLA-DR, CD38, ICOS ligand (ICOSL). RT-qPCR assays were established for these sEV RNA markers. In Patient-1, these markers of B cell activation were upregulated at POD-30 timepoint compared to POD-1 and POD-3 timepoints, coinciding with AMR / ACR diagnosis and treatment (FIG.50I). Patients-2 and -3 showed unchanged B cell sEV marker expression across all timepoints (FIG.50I). These results demonstrate that B cell sEV cargoes reflecting increased B cell alloreactivity were selectively upregulated only in the patient who developed AMR. In conclusion, a novel circulating B cell sEV platform that reveals time-specific, distinct cargo changes in a lung transplant patient diagnosed with mixed ACR / AMR, compared to a matched analysis in two lung transplant patients without rejection, was developed and disclosed herein. This platform serves as a useful tool for noninvasive diagnosis of AMR in lung transplantation. 109 53258724.1 Attorney Docket No.047162-7412WO1(02347) Enumerated Embodiments The following exemplary embodiments are provided, the numbering of which is not to be construed as designating levels of importance: Embodiment 1: A method for assessing conditional status of a donor transplant in a subject, the method comprising: (i) obtaining and / or having obtained at least one biological sample from the subject post-transplant; (ii) detecting and / or isolating immune cell microvesicles and / or at least one immune cell microvesicle biomarker from the at least one biological sample; (iii) quantifying the amount and / or relative level of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker; and (iv) comparing the amount and / or relative level of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker in the at least one biological sample to a baseline value of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker; wherein the amount and / or relative level of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker in the at least one biological sample compared to the baseline value indicates the conditional status of the donor transplant. Embodiment 2: The method of embodiment 1, wherein the immune cell microvesicles are T cell microvesicles and / or B cell microvesicles. Embodiment 3: The method of embodiment 1 or embodiment 2, wherein obtaining and / or having obtained at least one biological sample from the subject comprises obtaining and / or having obtained biological samples from the subject at multiple timepoints post-transplant. Embodiment 4: The method of any one of embodiments 1-3, wherein the baseline value is determined by quantifying the amount and / or relative level of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker from a reference biological sample obtained from the subject pre-transplant, on transplant day, or within about 1 day to within about 5 days post-transplant. 110 53258724.1 Attorney Docket No.047162-7412WO1(02347) Embodiment 5: The method of any one of embodiments 1-4, wherein the quantified amount of the immune cell microvesicle biomarker is normalized to a quantified amount of a control biomarker to obtain the relative level of the immune cell microvesicle biomarker. Embodiment 6: The method of any one of embodiments 1-5, wherein the at least one biological sample comprises plasma. Embodiment 7: The method of any one of embodiments 1-6, wherein the conditional status indicates rejection of the donor transplant, tolerance of the donor transplant, or recovery from rejection of the donor transplant (e.g., after treatment of a rejection event). Embodiment 8: The method of embodiment 7, wherein: (a) the immune cell is a T cell and the rejection is acute cellular rejection (ACR); or (b) the immune cell is a B cell and the rejection is antibody-mediated rejection (AMR). Embodiment 9: The method of embodiment 8, wherein the ACR is at least grade 2 ACR. Embodiment 10: The method of any one of embodiments 1-9, wherein: (a) the immune cell is a T cell and the detecting and / or isolating immune cell microvesicles comprises use of an anti-CD3 antibody; and / or (b) the immune cell is a B cell and the detecting and / or isolating immune cell microvesicles comprises use of an anti-CD19 antibody and / or an anti-CD38 antibody. Embodiment 11: The method of any one of embodiments 1-10, wherein the method further comprises: (i) detecting and / or isolating donor cell microvesicles and / or at least one donor cell microvesicle biomarker from the at least one biological sample; (ii) quantifying the amount and / or relative level of the donor cell microvesicles and / or 111 53258724.1 Attorney Docket No.047162-7412WO1(02347) at least one donor cell microvesicle biomarker; and (iii) comparing the amount and / or relative level of the donor cell microvesicles and / or at least one donor cell microvesicle biomarker in the at least one biological sample to a baseline value of the donor cell microvesicles and / or at least one donor cell microvesicle biomarker; wherein the amount and / or relative level of the donor cell microvesicles and / or at least one donor cell microvesicle biomarker in the at least one biological sample compared to the baseline value indicates the conditional status of the donor transplant. Embodiment 12: The method of embodiment 11, wherein the baseline value is determined by quantifying the amount and / or relative level of the donor cell microvesicles and / or at least one donor cell microvesicle biomarker from a reference biological sample obtained from the subject pre-transplant, on transplant day, or within about 1 day to within about 5 days post-transplant. Embodiment 13: The method of embodiment 11 or embodiment 12, wherein the quantified amount of the donor cell biomarker is normalized to a quantified amount of a control biomarker to obtain the relative level of the donor cell biomarker. Embodiment 14: The method of any one of embodiments 1-13, wherein the at least one immune cell microvesicle biomarker and / or the at least one donor cell microvesicle biomarker is a protein, a messenger RNA (mRNA), and / or a micro RNA. Embodiment 15: The method of any one of embodiments 1-14, wherein the immune cell microvesicles and / or the donor cell microvesicles are characterized by a diameter of about 30 nm to about 400 nm, preferably wherein the diameter is 100 nm or less. Embodiment 16: The method of any one of embodiments 1-15, wherein the donor transplant is an organ, tissue, or cells selected from the group consisting of heart, lung(s), kidney(s), liver, pancreas, pancreatic islet tissue(s), and pancreatic beta cells. Embodiment 17: The method of embodiment 16, wherein the donor transplant is heart or lung(s). 112 53258724.1 Attorney Docket No.047162-7412WO1(02347) Embodiment 18: The method of any one of embodiments 1-17, wherein the method comprises quantifying the amount and / or relative level of the immune cell microvesicles and comparing the amount and / or relative level of the immune cell microvesicles to the baseline value, wherein an increase of at least about 40% in the amount and / or relative level of the immune cell microvesicles compared to the baseline value indicates rejection of the donor transplant in the subject. Embodiment 19: The method of any one of embodiments 1-18, wherein the at least one immune cell microvesicle biomarker is selected from the group consisting of miR let7i, miR 21a, miR 101b, CD4 protein, CD4 mRNA, CD8 protein, CD8 mRNA, donor-specific T cell receptor (TCR) protein, interferon gamma (IFNγ) mRNA, CD19 mRNA, CD38 mRNA, CD38 protein, HLA-DR mRNA, HLA-DR protein, ICOSL mRNA, CD20 mRNA, IL6-R mRNA, and BAFF-R mRNA, or any combination thereof. Embodiment 20: The method of embodiment 19, wherein: (a) the at least one immune cell microvesicle biomarker is miR let7i, miR 21a, and / or miR 101b, and the control biomarker is hsa miR 26; and / or (b) the at least one immune cell microvesicle biomarker is CD4 protein, CD8 protein, and / or donor-specific TCR protein, and the control biomarker is TSG101 protein. Embodiment 21: The method of embodiment 19 or embodiment 20, wherein: (a) the at least one immune cell microvesicle biomarker is miR let7i and / or miR 21a, and wherein the conditional status of the donor transplant is rejection when the relative level of the miR let7i and / or the miR 21a is at least about 4-fold greater than the baseline value; (b) the at least one immune cell microvesicle biomarker is miR 101b, and wherein the conditional status of the donor transplant is rejection when the relative level of the miR 101b is at least about 3-fold greater than the baseline value; (c) the at least one immune cell microvesicle biomarker is CD4 protein, and wherein the conditional status of the donor transplant is rejection when the relative level of 113 53258724.1 Attorney Docket No.047162-7412WO1(02347) the CD4 protein is at least about 2.2-fold greater than the baseline value; (d) the at least one immune cell microvesicle biomarker is CD8 protein, and wherein the conditional status of the donor transplant is rejection when the relative level of the CD8 protein is at least about 2.5-fold greater than the baseline value; and / or (e) the at least one immune cell microvesicle biomarker is donor-specific TCR protein, and wherein the conditional status of the donor transplant is rejection when the relative level of the donor-specific TCR protein is at least about 2.2-fold greater than the baseline value. Embodiment 22: The method of any one of embodiments 11-21, wherein the donor transplant is heart, and wherein the at least one donor cell microvesicle biomarker is selected from the group consisting of Troponin T protein, Troponin T mRNA, Troponin I protein, and Troponin I mRNA, or any combination thereof. Embodiment 23: The method of embodiment 22, wherein: (a) the at least one donor cell microvesicle biomarker is Troponin T protein and the control biomarker is TSG101 protein; (b) the at least one donor cell microvesicle biomarker is Troponin T mRNA and the control biomarker is GAPDH mRNA. Embodiment 24: The method of embodiment 22 or embodiment 23, wherein: (a) the at least one donor cell microvesicle biomarker is Troponin T protein, and wherein the conditional status of the donor transplant is rejection when the relative level of the Troponin T protein is at least about 40% less than the baseline value; and / or (b) the at least one donor cell microvesicle biomarker is Troponin T mRNA, and wherein the conditional status of the donor transplant is rejection when the relative level of the Troponin T mRNA is at least about 60% less than the baseline value. Embodiment 25: A method of treating rejection of a donor transplant in a subject, the method 114 53258724.1 Attorney Docket No.047162-7412WO1(02347) comprising: (i) obtaining and / or having obtained at least one biological sample from the subject post-transplant; (ii) detecting and / or isolating immune cell microvesicles and / or at least one immune cell microvesicle biomarker from the at least one biological sample; (iii) quantifying the amount and / or relative level of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker; and (iv) determining the conditional status of the donor transplant, wherein the determining comprises comparing the amount and / or relative level of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker in the at least one biological sample to a baseline value of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker; wherein the amount and / or relative level of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker in the at least one biological sample compared to the baseline value indicates the conditional status of the donor transplant; (v) administering an effective amount of a rejection therapy to the subject when the conditional status indicates rejection of the donor transplant; and (vi) stopping administration of the rejection therapy when the conditional status indicates recovery from rejection of the donor transplant. Embodiment 26: The method of embodiment 25, wherein the immune cell microvesicles are T cell microvesicles and / or B cell microvesicles. Embodiment 27: The method of embodiment 25 or embodiment 26, wherein obtaining and / or having obtained at least one biological sample from the subject comprises obtaining and / or having obtained biological samples from the subject at multiple timepoints post-transplant. Embodiment 28: The method of any one of embodiments 25-27, wherein the baseline value is determined by quantifying the amount and / or relative level of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker from a reference biological sample 115 53258724.1 Attorney Docket No.047162-7412WO1(02347) obtained from the subject pre-transplant, on transplant day, or within about 1 day to within about 5 days post-transplant. Embodiment 29: The method of any one of embodiments 25-28, wherein the quantified amount of the immune cell microvesicle biomarker is normalized to a quantified amount of a control biomarker to obtain the relative level of the immune cell microvesicle biomarker. Embodiment 30: The method of any one of embodiments 25-29, wherein the at least one biological sample comprises plasma. Embodiment 31: The method of any one of embodiments 25-30, wherein: (a) the immune cell is a T cell and the rejection is acute cellular rejection (ACR); or (b) the immune cell is a B cell and the rejection is antibody-mediated rejection (AMR). Embodiment 32: The method of embodiment 31, wherein the ACR is at least grade 2 ACR. Embodiment 33: The method of embodiment 31 or embodiment 32, wherein: (a) the rejection is ACR and the rejection therapy comprises any one or more of bolus intravenous steroids, mycophenolate mofetil, and thymoglobulin therapy; or (b) the rejection is AMR and the rejection therapy comprises an anti-CD20 antibody (e.g., rituximab or ofatumumab). Embodiment 34: The method of any one of embodiments 25-33, wherein: (a) the immune cell is a T cell and the detecting and / or isolating immune cell microvesicles comprises use of an anti-CD3 antibody; and / or (b) the immune cell is a B cell and the detecting and / or isolating immune cell microvesicles comprises use of an anti-CD19 antibody and / or an anti-CD38 antibody. Embodiment 35: The method of any one of embodiments 25-34, wherein the method further 116 53258724.1 Attorney Docket No.047162-7412WO1(02347) comprises: (i) detecting and / or isolating donor cell microvesicles and / or at least one donor cell microvesicle biomarker from the at least one biological sample; (ii) quantifying the amount and / or relative level of the donor cell microvesicles and / or at least one donor cell microvesicle biomarker; and (iii) comparing the amount and / or relative level of the donor cell microvesicles and / or at least one donor cell microvesicle biomarker in the at least one biological sample to a baseline value of the donor cell microvesicles and / or at least one donor cell microvesicle biomarker; wherein the amount and / or relative level of the donor cell microvesicles and / or at least one donor cell microvesicle biomarker in the at least one biological sample compared to the baseline value indicates the conditional status of the donor transplant. Embodiment 36: The method of embodiment 35, wherein the baseline value is determined by quantifying the amount and / or relative level of the donor cell microvesicles and / or at least one donor cell microvesicle biomarker from a reference biological sample obtained from the subject pre-transplant, on transplant day, or within about 1 day to within about 5 days post-transplant. Embodiment 37: The method of embodiment 35 or embodiment 36, wherein the quantified amount of the donor cell biomarker is normalized to a quantified amount of a control biomarker to obtain the relative level of the donor cell biomarker. Embodiment 38: The method of any one of embodiments 25-37, wherein the at least one immune cell microvesicle biomarker and / or the at least one donor cell microvesicle biomarker is a protein, a messenger RNA (mRNA), and / or a micro RNA. Embodiment 39: The method of any one of embodiments 25-38, wherein the immune cell microvesicles and / or the donor cell microvesicles are characterized by a diameter of about 30 nm to about 400 nm, preferably wherein the diameter is 100 nm or less. Embodiment 40: The method of any one of embodiments 25-39, wherein the donor transplant is 117 53258724.1 Attorney Docket No.047162-7412WO1(02347) selected from the group consisting of heart, lung(s), kidney(s), liver, pancreas, pancreatic islet tissue(s), and pancreatic beta cells. Embodiment 41: The method of embodiment 40, wherein the donor transplant is heart or lung(s). Embodiment 42: The method of any one of embodiments 25-41, wherein the method comprises quantifying the amount and / or relative level of the immune cell microvesicles and comparing the amount and / or relative level of the immune cell microvesicles to the baseline value, wherein an increase of at least about 40% in the amount and / or relative level of the immune cell microvesicles compared to the baseline value indicates rejection of the donor transplant in the subject. Embodiment 43: The method of any one of embodiments 25-42, wherein the at least one immune cell microvesicle biomarker is selected from the group consisting of miR let7i, miR 21a, miR 101b, CD4 protein, CD4 mRNA, CD8 protein, CD8 mRNA, donor-specific T cell receptor (TCR) protein, interferon gamma (IFNγ) mRNA, CD19 mRNA, CD38 mRNA, CD38 protein, HLA-DR mRNA, HLA-DR protein, ICOSL mRNA, CD20 mRNA, IL6-R mRNA, and BAFF-R mRNA, or any combination thereof. Embodiment 44: The method of embodiment 43, wherein: (a) the at least one immune cell microvesicle biomarker is miR let7i, miR 21a, and / or miR 101b, and the control biomarker is hsa miR 26; and / or (b) the at least one immune cell microvesicle biomarker is CD4 protein, CD8 protein, and / or donor-specific TCR protein, and the control biomarker is TSG101 protein. Embodiment 45: The method of embodiment 43 or embodiment 44, wherein: (a) the at least one immune cell microvesicle biomarker is miR let7i and / or miR 21a, and wherein the conditional status of the donor transplant is rejection when the relative level of the miR let7i and / or the miR 21a is at least about 4-fold greater than the baseline value; (b) the at least one immune cell microvesicle biomarker is miR 101b, and wherein the 118 53258724.1 Attorney Docket No.047162-7412WO1(02347) conditional status of the donor transplant is rejection when the relative level of the miR 101b is at least about 3-fold greater than the baseline value; (c) the at least one immune cell microvesicle biomarker is CD4 protein, and wherein the conditional status of the donor transplant is rejection when the relative level of the CD4 protein is at least about 2.2-fold greater than the baseline value; (d) the at least one immune cell microvesicle biomarker is CD8 protein, and wherein the conditional status of the donor transplant is rejection when the relative level of the CD8 protein is at least about 2.5-fold greater than the baseline value; and / or (e) the at least one immune cell microvesicle biomarker is donor-specific TCR protein, and wherein the conditional status of the donor transplant is rejection when the relative level of the donor-specific TCR protein is at least about 2.2-fold greater than the baseline value. Embodiment 46: The method of any one of embodiments 35-45, wherein the donor transplant is heart, and wherein the at least one donor cell microvesicle biomarker is selected from the group consisting of Troponin T protein, Troponin T mRNA, Troponin I protein, and Troponin I mRNA, or any combination thereof. Embodiment 47: The method of embodiment 46, wherein: (a) the at least one donor cell microvesicle biomarker is Troponin T protein and the control biomarker is TSG101 protein; (b) the at least one donor cell microvesicle biomarker is Troponin T mRNA and the control biomarker is GAPDH mRNA. Embodiment 48: The method of embodiment 46 or embodiment 47, wherein: (a) the at least one donor cell microvesicle biomarker is Troponin T protein, and wherein the conditional status of the donor transplant is rejection when the relative level of the Troponin T protein is at least about 40% less than the baseline value; and / or (b) the at least one donor cell microvesicle biomarker is Troponin T mRNA, and wherein the conditional status of the donor transplant is rejection when the 119 53258724.1 Attorney Docket No.047162-7412WO1(02347) relative level of the Troponin T mRNA is at least about 60% less than the baseline value. Embodiment 49: The method of any one of embodiments 1-48, wherein the donor transplant is lung(s), further wherein: (a) the immune cell is a T cell and the at least one immune cell microvesicle biomarker is CD8 mRNA, IFNγ mRNA, HLA-DR mRNA, or any combination thereof; and / or (b) the immune cell is a B cell and the at least one immune cell microvesicle biomarker is CD19 mRNA, CD20 mRNA, CD38 mRNA, IL6-R mRNA, BAFF-R mRNA, IFNγ mRNA, HLA-DR mRNA, ICOSL mRNA, or any combination thereof. The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entirety. While this invention has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of this invention may be devised by others skilled in the art without departing from the true spirit and scope of the invention. The appended claims are intended to be construed to include all such embodiments and equivalent variations. 120 53258724.1

Claims

Attorney Docket No.047162-7412WO1(02347) CLAIMS What is claimed:

1. A method for assessing conditional status of a donor transplant in a subject, the method comprising: (i) obtaining and / or having obtained at least one biological sample from the subject post-transplant; (ii) detecting and / or isolating immune cell microvesicles and / or at least one immune cell microvesicle biomarker from the at least one biological sample; (iii) quantifying the amount and / or relative level of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker; and (iv) comparing the amount and / or relative level of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker in the at least one biological sample to a baseline value of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker; wherein the amount and / or relative level of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker in the at least one biological sample compared to the baseline value indicates the conditional status of the donor transplant.

2. The method of claim 1, wherein the immune cell microvesicles are T cell microvesicles and / or B cell microvesicles.

3. The method of claim 1 or claim 2, wherein obtaining and / or having obtained at least one biological sample from the subject comprises obtaining and / or having obtained biological samples from the subject at multiple timepoints post-transplant.

4. The method of any one of claims 1-3, wherein the baseline value is determined by quantifying the amount and / or relative level of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker from a reference biological sample obtained from the subject pre-transplant, on transplant day, or within about 1 day to within about 5 days post-transplant. 121 53258724.1Attorney Docket No.047162-7412WO1(02347) 5. The method of any one of claims 1-4, wherein the quantified amount of the immune cell microvesicle biomarker is normalized to a quantified amount of a control biomarker to obtain the relative level of the immune cell microvesicle biomarker.

6. The method of any one of claims 1-5, wherein the at least one biological sample comprises plasma.

7. The method of any one of claims 1-6, wherein the conditional status indicates rejection of the donor transplant, tolerance of the donor transplant, or recovery from rejection of the donor transplant (e.g., after treatment of a rejection event).

8. The method of claim 7, wherein: (a) the immune cell is a T cell and the rejection is acute cellular rejection (ACR); or (b) the immune cell is a B cell and the rejection is antibody-mediated rejection (AMR).

9. The method of claim 8, wherein the ACR is at least grade 2 ACR.

10. The method of any one of claims 1-9, wherein: (a) the immune cell is a T cell and the detecting and / or isolating immune cell microvesicles comprises use of an anti-CD3 antibody; and / or (b) the immune cell is a B cell and the detecting and / or isolating immune cell microvesicles comprises use of an anti-CD19 antibody and / or an anti-CD38 antibody.

11. The method of any one of claims 1-10, wherein the method further comprises: (i) detecting and / or isolating donor cell microvesicles and / or at least one donor cell microvesicle biomarker from the at least one biological sample; (ii) quantifying the amount and / or relative level of the donor cell microvesicles and / or at least one donor cell microvesicle biomarker; and 122 53258724.1Attorney Docket No.047162-7412WO1(02347) (iii) comparing the amount and / or relative level of the donor cell microvesicles and / or at least one donor cell microvesicle biomarker in the at least one biological sample to a baseline value of the donor cell microvesicles and / or at least one donor cell microvesicle biomarker; wherein the amount and / or relative level of the donor cell microvesicles and / or at least one donor cell microvesicle biomarker in the at least one biological sample compared to the baseline value indicates the conditional status of the donor transplant.

12. The method of claim 11, wherein the baseline value is determined by quantifying the amount and / or relative level of the donor cell microvesicles and / or at least one donor cell microvesicle biomarker from a reference biological sample obtained from the subject pre- transplant, on transplant day, or within about 1 day to within about 5 days post-transplant.

13. The method of claim 11 or claim 12, wherein the quantified amount of the donor cell biomarker is normalized to a quantified amount of a control biomarker to obtain the relative level of the donor cell biomarker.

14. The method of any one of claims 1-13, wherein the at least one immune cell microvesicle biomarker and / or the at least one donor cell microvesicle biomarker is a protein, a messenger RNA (mRNA), and / or a micro RNA.

15. The method of any one of claims 1-14, wherein the immune cell microvesicles and / or the donor cell microvesicles are characterized by a diameter of about 30 nm to about 400 nm, preferably wherein the diameter is 100 nm or less.

16. The method of any one of claims 1-15, wherein the donor transplant is an organ, tissue, or cells selected from the group consisting of heart, lung(s), kidney(s), liver, pancreas, pancreatic islet tissue(s), and pancreatic beta cells.

17. The method of claim 16, wherein the donor transplant is heart or lung(s). 123 53258724.1Attorney Docket No.047162-7412WO1(02347) 18. The method of any one of claims 1-17, wherein the method comprises quantifying the amount and / or relative level of the immune cell microvesicles and comparing the amount and / or relative level of the immune cell microvesicles to the baseline value, wherein an increase of at least about 40% in the amount and / or relative level of the immune cell microvesicles compared to the baseline value indicates rejection of the donor transplant in the subject.

19. The method of any one of claims 1-18, wherein the at least one immune cell microvesicle biomarker is selected from the group consisting of miR let7i, miR 21a, miR 101b, CD4 protein, CD4 mRNA, CD8 protein, CD8 mRNA, donor-specific T cell receptor (TCR) protein, interferon gamma (IFNγ) mRNA, CD19 mRNA, CD38 mRNA, CD38 protein, HLA-DR mRNA, HLA-DR protein, ICOSL mRNA, CD20 mRNA, IL6-R mRNA, and BAFF-R mRNA, or any combination thereof.

20. The method of claim 19, wherein: (a) the at least one immune cell microvesicle biomarker is miR let7i, miR 21a, and / or miR 101b, and the control biomarker is hsa miR 26; and / or (b) the at least one immune cell microvesicle biomarker is CD4 protein, CD8 protein, and / or donor-specific TCR protein, and the control biomarker is TSG101 protein.

21. The method of claim 19 or claim 20, wherein: (a) the at least one immune cell microvesicle biomarker is miR let7i and / or miR 21a, and wherein the conditional status of the donor transplant is rejection when the relative level of the miR let7i and / or the miR 21a is at least about 4-fold greater than the baseline value; (b) the at least one immune cell microvesicle biomarker is miR 101b, and wherein the conditional status of the donor transplant is rejection when the relative level of the miR 101b is at least about 3-fold greater than the baseline value; (c) the at least one immune cell microvesicle biomarker is CD4 protein, and wherein the conditional status of the donor transplant is rejection when the relative level of the CD4 protein is at least about 2.2-fold greater than the baseline value; 124 53258724.1Attorney Docket No.047162-7412WO1(02347) (d) the at least one immune cell microvesicle biomarker is CD8 protein, and wherein the conditional status of the donor transplant is rejection when the relative level of the CD8 protein is at least about 2.5-fold greater than the baseline value; and / or (e) the at least one immune cell microvesicle biomarker is donor-specific TCR protein, and wherein the conditional status of the donor transplant is rejection when the relative level of the donor-specific TCR protein is at least about 2.2-fold greater than the baseline value.

22. The method of any one of claims 11-21, wherein the donor transplant is heart, and wherein the at least one donor cell microvesicle biomarker is selected from the group consisting of Troponin T protein, Troponin T mRNA, Troponin I protein, and Troponin I mRNA, or any combination thereof.

23. The method of claim 22, wherein: (a) the at least one donor cell microvesicle biomarker is Troponin T protein and the control biomarker is TSG101 protein; (b) the at least one donor cell microvesicle biomarker is Troponin T mRNA and the control biomarker is GAPDH mRNA.

24. The method of claim 22 or claim 23, wherein: (a) the at least one donor cell microvesicle biomarker is Troponin T protein, and wherein the conditional status of the donor transplant is rejection when the relative level of the Troponin T protein is at least about 40% less than the baseline value; and / or (b) the at least one donor cell microvesicle biomarker is Troponin T mRNA, and wherein the conditional status of the donor transplant is rejection when the relative level of the Troponin T mRNA is at least about 60% less than the baseline value.

25. A method of treating rejection of a donor transplant in a subject, the method comprising: (i) obtaining and / or having obtained at least one biological sample from the subject 125 53258724.1Attorney Docket No.047162-7412WO1(02347) post-transplant; (ii) detecting and / or isolating immune cell microvesicles and / or at least one immune cell microvesicle biomarker from the at least one biological sample; (iii) quantifying the amount and / or relative level of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker; and (iv) determining the conditional status of the donor transplant, wherein the determining comprises comparing the amount and / or relative level of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker in the at least one biological sample to a baseline value of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker; wherein the amount and / or relative level of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker in the at least one biological sample compared to the baseline value indicates the conditional status of the donor transplant; (v) administering an effective amount of a rejection therapy to the subject when the conditional status indicates rejection of the donor transplant; and (vi) stopping administration of the rejection therapy when the conditional status indicates recovery from rejection of the donor transplant.

26. The method of claim 25, wherein the immune cell microvesicles are T cell microvesicles and / or B cell microvesicles.

27. The method of claim 25 or claim 26, wherein obtaining and / or having obtained at least one biological sample from the subject comprises obtaining and / or having obtained biological samples from the subject at multiple timepoints post-transplant.

28. The method of any one of claims 25-27, wherein the baseline value is determined by quantifying the amount and / or relative level of the immune cell microvesicles and / or at least one immune cell microvesicle biomarker from a reference biological sample obtained from the subject pre-transplant, on transplant day, or within about 1 day to within about 5 days post-transplant. 126 53258724.1Attorney Docket No.047162-7412WO1(02347) 29. The method of any one of claims 25-28, wherein the quantified amount of the immune cell microvesicle biomarker is normalized to a quantified amount of a control biomarker to obtain the relative level of the immune cell microvesicle biomarker.

30. The method of any one of claims 25-29, wherein the at least one biological sample comprises plasma.

31. The method of any one of claims 25-30, wherein: (a) the immune cell is a T cell and the rejection is acute cellular rejection (ACR); or (b) the immune cell is a B cell and the rejection is antibody-mediated rejection (AMR).

32. The method of claim 31, wherein the ACR is at least grade 2 ACR.

33. The method of claim 31 or claim 32, wherein: (a) the rejection is ACR and the rejection therapy comprises any one or more of bolus intravenous steroids, mycophenolate mofetil, and thymoglobulin therapy; or (b) the rejection is AMR and the rejection therapy comprises an anti-CD20 antibody (e.g., rituximab or ofatumumab).

34. The method of any one of claims 25-33, wherein: (a) the immune cell is a T cell and the detecting and / or isolating immune cell microvesicles comprises use of an anti-CD3 antibody; and / or (b) the immune cell is a B cell and the detecting and / or isolating immune cell microvesicles comprises use of an anti-CD19 antibody and / or an anti-CD38 antibody.

35. The method of any one of claims 25-34, wherein the method further comprises: (i) detecting and / or isolating donor cell microvesicles and / or at least one donor cell microvesicle biomarker from the at least one biological sample; 127 53258724.1Attorney Docket No.047162-7412WO1(02347) (ii) quantifying the amount and / or relative level of the donor cell microvesicles and / or at least one donor cell microvesicle biomarker; and (iii) comparing the amount and / or relative level of the donor cell microvesicles and / or at least one donor cell microvesicle biomarker in the at least one biological sample to a baseline value of the donor cell microvesicles and / or at least one donor cell microvesicle biomarker; wherein the amount and / or relative level of the donor cell microvesicles and / or at least one donor cell microvesicle biomarker in the at least one biological sample compared to the baseline value indicates the conditional status of the donor transplant.

36. The method of claim 35, wherein the baseline value is determined by quantifying the amount and / or relative level of the donor cell microvesicles and / or at least one donor cell microvesicle biomarker from a reference biological sample obtained from the subject pre- transplant, on transplant day, or within about 1 day to within about 5 days post-transplant.

37. The method of claim 35 or claim 36, wherein the quantified amount of the donor cell biomarker is normalized to a quantified amount of a control biomarker to obtain the relative level of the donor cell biomarker.

38. The method of any one of claims 25-37, wherein the at least one immune cell microvesicle biomarker and / or the at least one donor cell microvesicle biomarker is a protein, a messenger RNA (mRNA), and / or a micro RNA.

39. The method of any one of claims 25-38, wherein the immune cell microvesicles and / or the donor cell microvesicles are characterized by a diameter of about 30 nm to about 400 nm, preferably wherein the diameter is 100 nm or less.

40. The method of any one of claims 25-39, wherein the donor transplant is selected from the group consisting of heart, lung(s), kidney(s), liver, pancreas, pancreatic islet tissue(s), and pancreatic beta cells. 128 53258724.1Attorney Docket No.047162-7412WO1(02347) 41. The method of claim 40, wherein the donor transplant is heart or lung(s).

42. The method of any one of claims 25-41, wherein the method comprises quantifying the amount and / or relative level of the immune cell microvesicles and comparing the amount and / or relative level of the immune cell microvesicles to the baseline value, wherein an increase of at least about 40% in the amount and / or relative level of the immune cell microvesicles compared to the baseline value indicates rejection of the donor transplant in the subject.

43. The method of any one of claims 25-42, wherein the at least one immune cell microvesicle biomarker is selected from the group consisting of miR let7i, miR 21a, miR 101b, CD4 protein, CD4 mRNA, CD8 protein, CD8 mRNA, donor-specific T cell receptor (TCR) protein, interferon gamma (IFNγ) mRNA, CD19 mRNA, CD38 mRNA, CD38 protein, HLA-DR mRNA, HLA-DR protein, ICOSL mRNA, CD20 mRNA, IL6-R mRNA, and BAFF-R mRNA, or any combination thereof.

44. The method of claim 43, wherein: (a) the at least one immune cell microvesicle biomarker is miR let7i, miR 21a, and / or miR 101b, and the control biomarker is hsa miR 26; and / or (b) the at least one immune cell microvesicle biomarker is CD4 protein, CD8 protein, and / or donor-specific TCR protein, and the control biomarker is TSG101 protein.

45. The method of claim 43 or claim 44, wherein: (a) the at least one immune cell microvesicle biomarker is miR let7i and / or miR 21a, and wherein the conditional status of the donor transplant is rejection when the relative level of the miR let7i and / or the miR 21a is at least about 4-fold greater than the baseline value; (b) the at least one immune cell microvesicle biomarker is miR 101b, and wherein the conditional status of the donor transplant is rejection when the relative level of the miR 101b is at least about 3-fold greater than the baseline value; (c) the at least one immune cell microvesicle biomarker is CD4 protein, and wherein 129 53258724.1Attorney Docket No.047162-7412WO1(02347) the conditional status of the donor transplant is rejection when the relative level of the CD4 protein is at least about 2.2-fold greater than the baseline value; (d) the at least one immune cell microvesicle biomarker is CD8 protein, and wherein the conditional status of the donor transplant is rejection when the relative level of the CD8 protein is at least about 2.5-fold greater than the baseline value; and / or (e) the at least one immune cell microvesicle biomarker is donor-specific TCR protein, and wherein the conditional status of the donor transplant is rejection when the relative level of the donor-specific TCR protein is at least about 2.2-fold greater than the baseline value.

46. The method of any one of claims 35-45, wherein the donor transplant is heart, and wherein the at least one donor cell microvesicle biomarker is selected from the group consisting of Troponin T protein, Troponin T mRNA, Troponin I protein, and Troponin I mRNA, / or any combination thereof.

47. The method of claim 46, wherein: (a) the at least one donor cell microvesicle biomarker is Troponin T protein and the control biomarker is TSG101 protein; (b) the at least one donor cell microvesicle biomarker is Troponin T mRNA and the control biomarker is GAPDH mRNA.

48. The method of claim 46 or claim 47, wherein: (a) the at least one donor cell microvesicle biomarker is Troponin T protein, and wherein the conditional status of the donor transplant is rejection when the relative level of the Troponin T protein is at least about 40% less than the baseline value; and / or (b) the at least one donor cell microvesicle biomarker is Troponin T mRNA, and wherein the conditional status of the donor transplant is rejection when the relative level of the Troponin T mRNA is at least about 60% less than the baseline value. 130 53258724.1Attorney Docket No.047162-7412WO1(02347) 49. The method of any one of claims 1-48, wherein the donor transplant is lung(s), further wherein: (a) the immune cell is a T cell and the at least one immune cell microvesicle biomarker is CD8 mRNA, IFNγ mRNA, HLA-DR mRNA, or any combination thereof; and / or (b) the immune cell is a B cell and the at least one immune cell microvesicle biomarker is CD19 mRNA, CD20 mRNA, CD38 mRNA, IL6-R mRNA, BAFF-R mRNA, IFNγ mRNA, HLA-DR mRNA, ICOSL mRNA, or any combination thereof. 131 53258724.1

Images