Multiple antibodies binding to HLA-a24 / prame complex and use thereof

Abstract

Provided are a bispecific antibody comprising a first antigen-binding fragment that binds to an HLA-A24 / PRAME complex and a second antigen-binding fragment that binds to an activated T-cell antigen, a single-domain antibody that binds to an HLA-A24 / PRAME complex, and a pharmaceutical composition comprising the bispecific antibody or the single-domain antibody. Also provided is the use of the bispecific antibody or the single-domain antibody in medicine and biology.

Description

Multiple antibodies that bind to the HLA-A24 / PRAME complex and their uses Cross-reference to related applications This application claims the priority of Chinese Patent Application No. 202311429311.5 filed on October 31, 2023, the entire content of which is incorporated herein by reference in its entirety. Field of the invention The present invention generally relates to the fields of genetic engineering and biomedicine; specifically, the present application relates to bispecific antibodies that bind to the HLA-A24 / PRAME complex, single-domain antibodies that bind to the HLA-A24 / PRAME complex, and their uses. Background of the invention Most proteins in the human proteome are intracellular, and some short peptides generated by the degradation of intracellular proteins in the proteasome can be presented on the cell surface by MHC (major histocompatibility complex) molecules, making them potential targets for cancer immunotherapy. Antibodies against these MHC / peptide complexes are developed to function similar to TCR recognition of MHC / peptide complexes. These antibodies are called T cell receptor mimetic molecules (TCRm) or TCR-like antibodies. Preferentially Expressed Antigen in Melanoma (PRAME) belongs to the cancer / testis antigen (CTA) gene family, which is expressed at very low levels in normal adult tissues except the testis, but at high levels in various cancer cells [1] . The PRAME gene is located on the reverse strand of chromosome 22 (22q11.22), about 12 kilobases in length, and contains a leucine-rich repeat domain [2] . It is reported that the PRAME gene is hypermethylated in normal tissues; however, this gene is hypomethylated in most malignant cells [3] . PRAME is highly expressed in 88% of primary tissues and 95% of metastatic tissues of melanoma [1] . In addition to melanoma, PRAME is also widely expressed in many solid cancers, such as head and neck cancer, breast cancer, renal cell carcinoma, and non-small cell lung cancer [4-7] . PRAME is absent in normal hematopoietic tissues; however, some studies have found high expression levels of PRAME in acute leukemia, chronic leukemia, and Hodgkin lymphoma [8-10] . In addition, the expression level of PRAME is a prognostic biomarker for poor clinical outcomes in breast cancer and neuroblastoma [11,12] . PRAME is degraded into small peptide fragments by the proteasome. Some of these peptides bind to MHC molecules to form complexes, which are presented on the cell surface. LYVDSLFFL corresponds to amino acids 301 - 309 of the full-length PRAME protein and exists as a complex with HLA-A24 on the cell surface.

[0013] This HLA-peptide complex provides a useful target for TCRm-based immunotherapeutic interventions. Bispecific antibodies (BsAbs) are a class of artificial antibodies that contain two different antigen-binding sites. Bispecific antibodies have extensive applications in the biomedical field, especially in cancer immunotherapy. Bispecific antibodies targeting CD3 have one arm that can bind to CD3 in the TCR receptor complex on the surface of T cells, providing the first signal for activating T cells, and the other arm targets tumor antigens. Bispecific antibodies can bring tumor cells and T cells closer together, directly killing tumor cells while activating T cells. TCRm that binds to intracellular proteins of the PRAME class can be used as the part that binds to the target antigen in CD3 bispecific antibodies. Such bispecific antibodies may be more attractive due to the restricted expression of the target antigen. Based on clinical needs, exploring and developing bispecific antibodies targeting PRAME-MHC has important clinical significance. Summary of the Invention In a first aspect, the present application provides a bispecific antibody that comprises a first antigen-binding fragment that binds to the HLA-A24 / PRAME complex and a second antigen-binding fragment that binds to an activating T cell antigen. In some embodiments of the first aspect, the bispecific antibody is capable of mediating the activation of T cells by HLA-A24 + / PRAME + tumor cells, and / or the bispecific antibody is capable of mediating the killing of HLA-A24 + / PRAME + tumor cells by PBMC. In some embodiments of the first aspect, the first antigen-binding fragment comprises HCDR1 as shown in SEQ ID NO:1, HCDR2 as shown in SEQ ID NO:2, and HCDR3 as shown in SEQ ID NO:3; wherein, the amino acid sequences of the HCDRs are defined according to Kabat. In some embodiments of the first aspect, the first antigen-binding fragment is in the form of a single-domain antibody. In some embodiments of the first aspect, the first antigen-binding fragment comprises a monovalent or multivalent single-domain antibody that binds to the HLA-A24 / PRAME complex. In some embodiments of the first aspect, the second antigen-binding fragment comprises an HCDR1 as shown in SEQ ID NO:6, an HCDR2 as shown in SEQ ID NO:7, an HCDR3 as shown in SEQ ID NO:8, and an LCDR1 as shown in SEQ ID NO:9 , an LCDR2 as shown in SEQ ID NO:10, and an LCDR3 as shown in SEQ ID NO:11; wherein the amino acid sequences of the HCDRs are defined according to Kabat. In some embodiments of the first aspect, the second antigen-binding fragment is in the form of a single-chain antibody (scFv) or a Fab fragment. In some embodiments of the first aspect, the first antigen-binding fragment comprises a bivalent single-domain antibody that binds to the HLA-A24 / PRAME complex; optionally, the first antigen-binding fragment comprises the heavy-chain variable regions of two monovalent single-domain antibodies that bind to the HLA-A24 / PRAME complex. In some embodiments of the first aspect, the first antigen-binding fragment comprises the amino acid sequence as shown in SEQ ID NO:4, 5, 14, or 15; and / or the second antigen-binding fragment comprises a heavy-chain variable region having the amino acid sequence as shown in SEQ ID NO:12 and a light-chain variable region having the amino acid sequence as shown in SEQ ID NO:13. In some embodiments of the first aspect, the first antigen-binding fragment comprises the amino acid sequence as shown in SEQ ID NO:4; and the second antigen-binding fragment comprises a heavy-chain variable region having the amino acid sequence as shown in SEQ ID NO:12 and a light-chain variable region having the amino acid sequence as shown in SEQ ID NO:13; the first antigen-binding fragment comprises the amino acid sequence as shown in SEQ ID NO:5; and the second antigen-binding fragment comprises a heavy-chain variable region having the amino acid sequence as shown in SEQ ID NO:12 and a light-chain variable region having the amino acid sequence as shown in SEQ ID NO:13; or the first antigen-binding fragment comprises the amino acid sequence as shown in SEQ ID NO:14; and the second antigen-binding fragment comprises a heavy-chain variable region having the amino acid sequence as shown in SEQ ID NO:12 and a light-chain variable region having the amino acid sequence as shown in SEQ ID NO:13; or the first antigen-binding fragment comprises the amino acid sequence as shown in SEQ ID NO:15; and the second antigen-binding fragment comprises a heavy-chain variable region having the amino acid sequence as shown in SEQ ID NO:12 and a light-chain variable region having the amino acid sequence as shown in SEQ ID NO:13. In some embodiments of the first aspect, the first antigen-binding fragment and the second antigen-binding fragment are linked by an Fc fragment of an antibody heavy chain constant region, and the Fc fragment of the antibody heavy chain constant region includes a first Fc fragment and a second Fc fragment, wherein the amino acids at positions 354 and 366 of the first Fc fragment are C and W, respectively, or the amino acids at positions 349, 366, 368 and 407 of the first Fc fragment are C, S, A and V, respectively; and the amino acids at positions 354 and 366 of the second Fc fragment are C and W, respectively, or the amino acids at positions 349, 366, 368 and 407 of the second Fc fragment are C, S, A and V, respectively; wherein the amino acid positions of the antibody constant region are determined according to EU numbering. In some embodiments of the first aspect, the first antigen-binding fragment and the second antigen-binding fragment are linked by an Fc fragment of an antibody heavy chain constant region, and the Fc fragment of the antibody heavy chain constant region includes a first Fc fragment and a second Fc fragment, wherein the amino acids at positions 234, 235 and 331 of the first Fc fragment and the second Fc fragment are F, E and S, respectively; wherein the amino acid positions of the antibody constant region are determined according to EU numbering. In some embodiments of the first aspect, the first antigen-binding fragment and the second antigen-binding fragment are linked by an Fc fragment of an antibody heavy chain constant region, and the Fc fragment of the antibody heavy chain constant region includes a first Fc fragment and a second Fc fragment, wherein one of the first Fc fragment and the second Fc fragment is linked to the first antigen-binding fragment, and the other of the first Fc fragment and the second Fc fragment is linked to the second antigen-binding fragment. In some embodiments of the first aspect, the bispecific antibody comprises a first arm that binds to the HLA-A24 / PRAME complex and a second arm that binds to an activating T cell antigen, wherein the first arm comprises the amino acid sequence shown in SEQ ID NO: 35 or 36; and the second arm comprises the amino acid sequence shown in SEQ ID NO: 37. In a second aspect, the present application provides a single-domain antibody that binds to the HLA-A24 / PRAME complex, which comprises: HCDR1 as shown in SEQ ID NO: 1, HCDR2 as shown in SEQ ID NO: 2, and HCDR3 as shown in SEQ ID NO: 3; wherein the amino acid sequences of the HCDRs are defined according to Kabat. In some embodiments of the second aspect, the binding epitope of the single-domain antibody to the HLA-A24 / PRAME complex comprises one or more residues among positions 301-309 of PRAME as shown in reference to SEQ ID NO:38. In some embodiments of the second aspect, the single-domain antibody is in the form of a monovalent or multivalent single-domain antibody that binds to the HLA-A24 / PRAME complex. In some embodiments of the second aspect, the single-domain antibody is in the form of a bivalent single-domain antibody that binds to the HLA-A24 / PRAME complex. In some embodiments of the second aspect, the single-domain antibody comprises the amino acid sequence as shown in SEQ ID NO:4, 5, 14 or 15. In a third aspect, the present application provides a nucleic acid molecule encoding the bispecific antibody described in the first aspect or the single-domain antibody described in the second aspect. In a fourth aspect, the present application provides a pharmaceutical composition comprising the bispecific antibody described in the first aspect or the single-domain antibody described in the second aspect, and a pharmaceutically acceptable excipient, diluent or carrier. In a fifth aspect, the present application provides the use of the bispecific antibody described in the first aspect, the single-domain antibody described in the second aspect, or the pharmaceutical composition described in the fourth aspect in the preparation of a drug for preventing or treating HLA-A24 / PRAME positive tumors. In a sixth aspect, the present application provides the use of the bispecific antibody described in the first aspect or the single-domain antibody described in the second aspect in the preparation of a product for detecting HLA-A24 / PRAME positive cells. Brief Description of the Drawings Figure 1 shows the antibody against the HLA-A24 / PRAME complex binding to PRAME 301-309 (LYVDSLFFL)-pulsed HT-29 cells. Figure 2 shows the results of the activation of tumor cells on Jurkat-Dual cells mediated by the bispecific antibody 2N83G3×IMCR and the humanized bispecific antibody 2N83G3-h5×IMCR. Figure 3 shows the results of the killing of tumor cells by PBMC mediated by the humanized bispecific antibody 2N83G3-h5×IMCR. Figure 4 shows the activation of Jurkat-Dual cells by alanine-substituted peptide-pulsed HT-29 cells mediated by the humanized bispecific antibody 2N83G3-h5×IMCR. Figure 5 shows the killing results of PBMC mediated by the humanized bispecific antibody 2N83G3-h5×IMCR against HT-29 cells transfected with genes of PRAME or similar peptides 8 / 11 / 12 / 16. Figure 6 shows the killing results of PBMC cells mediated by the humanized bispecific antibody 2N83G3-h5×IMCR against 293T cells transfected with genes of PRAME or similar peptides 8 / 11 / 12 / 16. Figure 7 shows the results of the antitumor activity of the humanized bispecific antibody 2N83G3-h5×IMCR in a mouse model of PBMC immune reconstruction. Sequence description SEQ ID NO:1-3 show the amino acid sequences of HCDR1, HCDR2, and HCDR3 of the heavy chain variable regions of Llama single-domain antibodies N83G3 and N83G3-h5, respectively. SEQ ID NO:4 shows the amino acid sequence of the heavy chain variable region of Llama single-domain antibody N83G3. SEQ ID NO:5 shows the amino acid sequence of the heavy chain variable region of the humanized single-domain antibody N83G3-h5. SEQ ID NO:6-8 show the amino acid sequences of HCDR1, HCDR2, and HCDR3 of the heavy chain variable region of the anti-human CD3 antibody IMCR, respectively. SEQ ID NO:9-11 show the amino acid sequences of LCDR1, LCDR2, and LCDR3 of the light chain variable region of the anti-human CD3 antibody IMCR, respectively. SEQ ID NO:12 shows the amino acid sequence of the heavy chain variable region of the anti-human CD3 antibody IMCR. SEQ ID NO:13 shows the amino acid sequence of the light chain variable region of the anti-human CD3 antibody IMCR. SEQ ID NO:14 shows the amino acid sequence of the tandem heavy chain variable regions of two Llama single-domain antibodies N83G3. SEQ ID NO:15 shows the amino acid sequence of the tandem heavy chain variable regions of two Llama single-domain antibodies N83G3-h5. SEQ ID NO:16 shows the amino acid sequence of the single-chain antibody of the anti-human CD3 antibody IMCR. SEQ ID NO:17 shows the amino acid sequence of the extracellular region of human (homo sapiens) CD3E (hCD3E). SEQ ID NO:18 shows the amino acid sequence of the extracellular region of human (homo sapiens) CD3D (hCD3D). SEQ ID NO:19 shows the amino acid sequence of the antigen peptide PRAME derived from Homo sapiens. 301-309 of the. SEQ ID NO:20 shows the amino acid sequence of the complex (MIP-P3) of the antigen peptide PRAME 301-309 and the disulfide bond-captured single-chain trimer of HLA-A24. SEQ ID NO:21 shows the amino acid sequence of the His tag. SEQ ID NO:22 shows the amino acid sequence of the Fc segment (mFc) of the mouse (Mus musculus) IgG2a antibody. SEQ ID NO:23 shows the amino acid sequence of the heavy chain constant region of the human (Homo sapiens) IgG1 subtype. SEQ ID NO:24 shows the amino acid sequence of the mutant IgG1H of the heavy chain constant region of the human IgG1 subtype antibody. SEQ ID NO:25 shows the amino acid sequence of the mutant IgG1K of the heavy chain constant region of the human IgG1 subtype antibody. SEQ ID NO:26 shows the amino acid sequence of the mutant IgG1m3-H of the heavy chain constant region of the human IgG1 subtype antibody. SEQ ID NO:27 shows the amino acid sequence of the mutant IgG1m3-K of the heavy chain constant region of the human IgG1 subtype antibody. SEQ ID NO:28 shows the amino acid sequence of the mutant IgG1m3-H1n1 of the heavy chain constant region of the human IgG1 subtype antibody. SEQ ID NO:29 shows the amino acid sequence of the mutant IgG1m3-Kn1 of the heavy chain constant region of the human IgG1 subtype antibody. SEQ ID NO:30 shows the amino acid sequence of the light chain constant region of the human (Homo sapiens) λ subtype. SEQ ID NO:31 shows the amino acid sequence of the light chain constant region of the human (Homo sapiens) κ subtype SEQ ID NO:32 shows the amino acid sequence of the Fc segment (hFc) of the human (Homo sapiens) IgG1 antibody. SEQ ID NO:33 shows the amino acid sequence of the mutant IgG1m3-FcH1n1 of the Fc segment of the human IgG1 subtype antibody. SEQ ID NO:34 shows the amino acid sequence of the mutant IgG1m3-FcKn1 of the Fc segment of the human IgG1 subtype antibody SEQ ID NO:35 shows the amino acid sequence of 2N83G3-G1m3-FcH1n1 in the bispecific antibody 2N83G3×IMCR. SEQ ID NO:36 shows the amino acid sequence of 2N83G3-h5-G1m3-FcH1n1 in the bispecific antibody 2N83G3-h5×IMCR. SEQ ID NO:37 shows the amino acid sequence of the arm IMCR-scFv-G1m3-FcKn1 in the bispecific antibody 2N83G3×IMCR or 2N83G3-h5×IMCR. SEQ ID NO:38 shows the amino acid sequence of human (homo sapiens) PRAME. SEQ ID NO:39 shows the amino acid sequence of XCR1 derived from human (homo sapiens). SEQ ID NO:40 shows the amino acid sequence of KIFBP derived from human (homo sapiens). SEQ ID NO:41 shows the amino acid sequence of CPVL derived from human (homo sapiens). SEQ ID NO:42 shows the amino acid sequence of PLD1 derived from human (homo sapiens). SEQ ID NO:43 shows the amino acid sequence of HLA-A2402. SEQ ID NO:44 shows the amino acid sequence of PRAME derived from human (homo sapiens) 301-309 The amino acid sequence of similar peptide 1. SEQ ID NO:45 shows the amino acid sequence of PRAME derived from human (homo sapiens) 301-309 The amino acid sequence of similar peptide 2. SEQ ID NO:46 shows the amino acid sequence of PRAME derived from human (homo sapiens) 301-309 The amino acid sequence of similar peptide 3. SEQ ID NO:47 shows the amino acid sequence of PRAME derived from human (homo sapiens) 301-309 The amino acid sequence of similar peptide 4. SEQ ID NO:48 shows the amino acid sequence of PRAME derived from human (homo sapiens) 301-309 The amino acid sequence of similar peptide 5. SEQ ID NO:49 shows the PRAME derived from Homo sapiens 301-309 The amino acid sequence of similar peptide segment 6. SEQ ID NO:50 shows the PRAME derived from Homo sapiens 301-309 The amino acid sequence of similar peptide segment 7. SEQ ID NO:51 shows the PRAME derived from Homo sapiens 301-309 The amino acid sequence of similar peptide segment 8. SEQ ID NO:52 shows the PRAME derived from Homo sapiens 301-309 The amino acid sequence of similar peptide segment 9. SEQ ID NO:53 shows the PRAME derived from Homo sapiens 301-309 The amino acid sequence of similar peptide segment 10. SEQ ID NO:54 shows the PRAME derived from Homo sapiens 301-309 The amino acid sequence of similar peptide segment 11. SEQ ID NO:55 shows the PRAME derived from Homo sapiens 301-309 The amino acid sequence of similar peptide segment 12. SEQ ID NO:56 shows the PRAME derived from Homo sapiens 301-309 The amino acid sequence of similar peptide segment 13. SEQ ID NO:57 shows the PRAME derived from Homo sapiens 301-309 The amino acid sequence of similar peptide segment 14. SEQ ID NO:58 shows the PRAME derived from Homo sapiens 301-309 The amino acid sequence of similar peptide segment 15. SEQ ID NO:59 shows the PRAME derived from Homo sapiens 301-309 The amino acid sequence of similar peptide segment 16 sequence. SEQ ID NO:60 shows the PRAME derived from Homo sapiens 301-309 The amino acid sequence of similar peptide segment 17. SEQ ID NO:61 shows the PRAME derived from Homo sapiens 301-309Amino acid sequence of similar peptide segment 18. SEQ ID NO:62 shows PRAME derived from Homo sapiens 301-309 Amino acid sequence of similar peptide segment 19. SEQ ID NO:63 shows PRAME derived from Homo sapiens 301-309 Amino acid sequence of similar peptide segment 20. SEQ ID NO:64 shows PRAME derived from Homo sapiens 301-309 Amino acid sequence of similar peptide segment 21. SEQ ID NO:65 shows PRAME derived from Homo sapiens 301-309 Amino acid sequence of similar peptide segment 22. SEQ ID NO:66 shows PRAME derived from Homo sapiens 301-309 Amino acid sequence of similar peptide segment 23. SEQ ID NO:67 shows PRAME derived from Homo sapiens 301-309 Amino acid sequence of similar peptide segment 24. SEQ ID NO:68 shows PRAME derived from Homo sapiens 301-309 Amino acid sequence of similar peptide segment 25. SEQ ID NO:69 shows PRAME derived from Homo sapiens 301-309 Amino acid sequence of similar peptide segment 26. SEQ ID NO:70 shows PRAME derived from Homo sapiens 301-309 Amino acid sequence of similar peptide segment 27. SEQ ID NO:71 shows PRAME derived from Homo sapiens 301-309 Amino acid sequence of similar peptide segment 28. SEQ ID NO:72 shows PRAME derived from Homo sapiens 301-309 Amino acid sequence of similar peptide segment 29. SEQ ID NO:73 shows PRAME derived from Homo sapiens 301-309 Amino acid sequence of similar peptide segment 30. SEQ ID NO:74 shows PRAME derived from Homo sapiens301-309 Amino acid sequence of similar peptide segment 31. SEQ ID NO:75 shows PRAME derived from Homo sapiens 301-309 Amino acid sequence of similar peptide segment 32. SEQ ID NO:76 shows PRAME derived from Homo sapiens 301-309 Amino acid sequence of similar peptide segment 33. SEQ ID NO:77 shows PRAME derived from Homo sapiens 301-309 Amino acid sequence of similar peptide segment 34. SEQ ID NO:78 shows PRAME derived from Homo sapiens 301-309 Amino acid sequence of similar peptide segment 35. SEQ ID NO:79 shows PRAME derived from Homo sapiens 301-309 Amino acid sequence of similar peptide segment 36. SEQ ID NO:80 shows PRAME derived from Homo sapiens 301-309 Amino acid sequence of similar peptide segment 37. SEQ ID NO:81 shows PRAME derived from Homo sapiens 301-309 Amino acid sequence of similar peptide segment 38. SEQ ID NO:82 shows PRAME derived from Homo sapiens 301-309 Amino acid sequence of similar peptide segment 39. SEQ ID NO:83 shows PRAME derived from Homo sapiens 301-309 Amino acid sequence of similar peptide segment 40. SEQ ID NO:84 shows PRAME derived from Homo sapiens 301-309 Amino acid sequence of similar peptide segment 41. SEQ ID NO:85 shows PRAME derived from Homo sapiens 301-309 Amino acid sequence of similar peptide segment 42 sequence. SEQ ID NO:86 shows PRAME derived from Homo sapiens 301-309 Amino acid sequence of similar peptide segment 43. SEQ ID NO:87 shows the amino acid sequence of the PRAME-derived similar peptide 44 from Homo sapiens. 301-309 from Homo sapiens. SEQ ID NO:88 shows the amino acid sequence of the PRAME-derived similar peptide 45 from Homo sapiens. 301-309 from Homo sapiens. SEQ ID NO:89 shows the amino acid sequence of the PRAME-derived similar peptide 46 from Homo sapiens. 301-309 from Homo sapiens. SEQ ID NO:90 shows the amino acid sequence of the PRAME-derived similar peptide 47 from Homo sapiens. 301-309 from Homo sapiens. SEQ ID NO:91 shows the amino acid sequence of the PRAME-derived similar peptide 48 from Homo sapiens. 301-309 from Homo sapiens. SEQ ID NO:92 shows the amino acid sequence of the PRAME-derived similar peptide 49 from Homo sapiens. 301-309 from Homo sapiens. SEQ ID NO:93 shows the amino acid sequence of the PRAME-derived similar peptide 50 from Homo sapiens. 301-309 from Homo sapiens. SEQ ID NO:94 shows the amino acid sequence of the linker. SEQ ID NO:95 shows the nucleotide sequence of the primer Pcal-CH2R. SEQ ID NO:96 shows the amino acid sequence of the negative control antibody DP47VH. SEQ ID NO:97 shows the amino acid sequence of the negative control antibody DP47VK. SEQ ID NO:98 shows the amino acid sequence of the irrelevant peptide. DETAILED DESCRIPTION OF THE INVENTION The inventors of the present application prepared a bispecific antibody (such as a TCRm bispecific antibody) by genetic engineering means, which combines a first antigen-binding fragment that binds to the HLA-A24 / PRAME complex and a second antigen-binding fragment that binds to an activating T cell antigen (such as the CD3 molecule). The first antigen-binding fragment that binds to the HLA-A24 / PRAME complex binds to the PRAME presented on the surface of target cells (tumor cells). 301-309(LYVDSLFFL) complex with HLA - A24, while the second antigen - binding fragment binds to an activating T - cell antigen (such as the CD3 molecule), thereby establishing an interaction between the target cell and the T cell, inducing the activation of cytotoxic T cells, and lysing the target cell (such as a tumor cell) in a major histocompatibility complex (MHC) - dependent manner to achieve the purpose of treating diseases (such as tumors). In various aspects of the present application, novel bispecific antibodies comprising a first antigen - binding fragment that binds to the HLA - A24 / PRAME complex and a second antigen - binding fragment that binds to an activating T - cell antigen (such as the CD3 molecule), single - domain antibodies that bind to the HLA - A24 / PRAME complex, nucleic acid molecules encoding the bispecific antibody or the single - domain antibody, vectors comprising the nucleic acid molecule, host cells comprising the nucleic acid molecule or the vector, methods for preparing and purifying the bispecific antibody or the single - domain antibody, and medical and biological applications of the bispecific antibody or the single - domain antibody are provided. According to the sequences of the bispecific antibodies or single - domain antibodies provided by the present application, bispecific antibodies or single - domain antibodies that bind to the HLA - A24 / PRAME complex can be constructed as drugs for clinical use in preventing or treating tumors. Unless otherwise specified, the practice of the present application employs conventional techniques of molecular biology, microbiology, cell biology, biochemistry, and immunology in the art. Unless otherwise specified, the terms used in the present application have the meanings commonly understood by those skilled in the art. Definitions As used herein, the term "HLA - A24 / PRAME complex" refers to the complex of HLA - A24 molecule and PRAME. In a specific embodiment of the present application, the "HLA - A24 / PRAME complex" refers to the complex of HLA - A24 molecule and the 301 - 309 positions of PRAME shown in SEQ ID NO:38 (PRAME 301-309 ) of the HLA - A24 / PRAME 301-309 complex. As used herein, the term "activating T - cell antigen" refers to an antigenic determinant expressed on the surface of T lymphocytes, especially cytotoxic T lymphocytes, which can induce T - cell activation when interacting with an antigen - binding molecule. Specifically, the interaction between the antigen - binding molecule and the activating T - cell antigen can induce T - cell activation by triggering the signal transduction cascade of the T - cell receptor complex. In a particular aspect, the activating T - cell antigen is the CD3 molecule. As used herein, the term "antibody" refers to an immunoglobulin molecule that can specifically bind to a target via at least one antigen - recognition site located in the variable region of the immunoglobulin molecule. Targets include, but are not limited to, carbohydrates, polynucleosides Acids, lipids, polypeptides, etc. As used herein, "antibody" includes not only intact (i.e., full-length) antibodies, but also binding fragments thereof (e.g., Fab, Fab’, F(ab’)2, Fv), variants thereof, fusion proteins containing antibody portions, humanized antibodies, chimeric antibodies, bispecific antibodies, linear antibodies, single-chain antibodies, single-domain antibodies, multispecific antibodies (e.g., bispecific antibodies), and any other modified configurations of immunoglobulin molecules containing antigen recognition sites of the desired specificity, including glycosylation variants of antibodies, amino acid sequence variants of antibodies, and covalently modified antibodies. Typically, an intact or full-length antibody comprises two heavy chains and two light chains. Each heavy chain contains a heavy chain variable region (VH) and first, second, and third constant regions (CH1, CH2, and CH3). Each light chain contains a light chain variable region (VL) and a constant region (CL). The full-length antibody can be any class of antibody, such as IgD, IgE, IgG, IgA, or IgM (or subclasses thereof), but the antibody need not belong to any particular class. Immunoglobulins can be designated into different classes based on the amino acid sequence of the constant region of the heavy chain. Typically, there are five main classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, and several of these classes can be further differentiated into subclasses (isotypes), such as IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2. The heavy chain constant regions corresponding to the different immunoglobulin classes are designated α, δ, ε, γ, and μ, respectively. The subunit structures and three-dimensional structures of the different classes of immunoglobulins are well known. As used herein, the term "bispecific antibody" refers to an antibody that has the ability to bind to two antigen epitopes at the same time. The two antigen epitopes can be on different antigens or on the same antigen. Bispecific antibodies can have a variety of structural configurations. For example, a bispecific antibody can be composed of two Fc fragments and two binding parts fused thereto respectively (similar to natural antibodies, the difference is that the two arms bind to different antigen targets or epitopes), and the antigen binding part can be a single domain antibody, a single chain antibody (scFv) or a Fab fragment. When targeting the epitopes of two given antigens, the two different binding parts of the bispecific antibody each bind to the N-terminus of an Fc fragment, and the antigen binding part configuration of the two arms can have four combinations: single domain antibody + Fab fragment, single domain antibody + scFv, scFv + single domain antibody and Fab fragment + single domain antibody. The Fc fragment can contain mutations that can ensure heavy chain heteropolymerization, and the KIH technology (knob-in-hole, KIH) is a strategy to solve heavy chain heteropolymerization. Generally, KIH technology refers to the formation of a structure that is conducive to the pairing of heterologous half antibodies by modifying the amino acid sequence of the CH3 region, which can form a bispecific antibody while maintaining the structure of a normal antibody as much as possible. For guidance on KIH technology, see, for example, "An efficient route to human bispecific IgG", A. Margaret Merchant et al., Nature Biotechnology, Volume 16, 1998

[0014] , which is incorporated herein by reference in its entirety. As used herein, the terms "binding portion" or "binding fragment" are used interchangeably and refer to a portion or region of a complete antibody molecule that is responsible for binding to an antigen. The antigen binding domain may comprise a heavy chain variable region (VH), a light chain variable region (VL), or both. Each of VH and VL typically contains three complementary determining regions, CDR1, CDR2, and CDR3. It is well known to those skilled in the art that the complementarity determining region (CDR, usually CDR1, CDR2 and CDR3) is the region in the variable region that has the greatest impact on the affinity and specificity of the antibody. There are two common definitions of the CDR sequence of VH or VL, namely the Kabat definition and the Chothia definition. (See, for example, Kabat, "Sequences of Proteins of Immunological Interest", National Institutes of Health, Bethesda, Md. (1991)

[0015] ;A1-Lazikani et al., J. Mol. Biol. 273:927-948 (1997)

[0016] ; and Martin et al., Proc. Natl. Acad. Sci. USA 86:9268-9272 (1989))

[0017] For the variable region sequences of a given antibody, the CDR region sequences in the VH and VL sequences can be determined according to the Kabat definition or the Chothia definition. In the embodiments of the present application, the Kabat definition is used to define the CDR sequences. For the variable region sequences of a given antibody, the CDR region sequences in the variable region sequences can be analyzed in a variety of ways. For example, the online software Abysis can be used for determination (http: / / www.abysis.org / ). For a general antibody, examples of antigen-binding fragments include, but are not limited to: (1) Fab fragment, which can be a monovalent fragment having a VL-CL chain and a VH-CH1 chain; (2) F(ab’)2 fragment, which can be a divalent fragment having two Fab’ fragments, and the two Fab’ fragments are connected by a disulfide bridge in the hinge region (i.e., a dimer of Fab’); (3) Fv fragment having the VL and VH domains of a single arm of the antibody; (4) single-chain Fv (scFv), which can be a single polypeptide chain composed of a VH domain and a VL domain via a peptide linker; (5) (scFv)2, which can contain two VH domains and two VL domains connected by a peptide linker, and the two VL domains are combined with the two VH domains via a disulfide bridge; and (6) single-domain antibody form. In the construction of bispecific antibodies, the "binding portion" includes, but is not limited to, single-domain antibody form, Fab fragment form, and / or single-chain antibody (scFv) form. As used herein, the term "single-chain antibody (scFv, single chain fragment variable)" refers to an antibody in a single-chain structure generally constructed by genetic engineering techniques, which comprises a polypeptide chain with a heavy-chain variable region (VH) and a light-chain variable region (VL). A flexible linker peptide is usually designed between the heavy-chain variable region and the light-chain variable region so that the heavy-chain variable region and the light-chain variable region can fold into a correct conformation capable of binding an antigen. As used herein, the term "Fab (fragment antigen binding) fragment", "Fab portion", or similar terms refer to an antibody fragment capable of binding an antigen produced by treating a complete antibody with papain, including a complete light chain (VL-CL), a heavy-chain variable region, and a CH1 fragment (VH-CH1). As used herein, the term "single-domain antibody" refers to a heavy-chain single variable domain antibody that is naturally lacking a light chain, such antibodies comprising a heavy-chain variable region (VHH) and conventional CH2 and CH3 regions (e.g., one or two sets (heavy-chain variable region (VHH) and conventional CH2 and CH3 regions)). The VHH structure, cloned and expressed alone, has structural stability comparable to that of the original heavy-chain antibody and binding activity to an antigen, and is the smallest unit known to be capable of binding to a target antigen. Single-domain antibodies are also referred to as Nanobodies (Nb). As used herein, the terms "Fc fragment", "Fc domain", and "Fc portion" are used interchangeably and refer to a part of the constant region of an antibody heavy chain, including the hinge region, the CH2 fragment, and the CH3 fragment of the heavy-chain constant region, and are determined with reference to the EU numbering of human IgG1 antibody. As used herein, the term "specifically binds" refers to a non-random binding reaction between two molecules, such as the binding of an antibody to an antigen epitope. As used herein, the term "tumor" refers to a neoplasm or solid lesion formed by abnormal cell growth. Tumors can be benign, pre-malignant, or malignant. As used herein, the term "malignant tumor" refers to or describes a physiological condition in a mammal that is typically characterized by unregulated cell growth. Exemplary malignant tumors include: carcinoma, solid tumor, melanoma, sarcoma, hematological tumor, germ cell tumor, and embryonal cell tumor. More specific examples of malignant tumors include: melanoma, non-small cell lung cancer, small cell lung cancer, breast cancer (e.g., triple-negative breast cancer), renal cell carcinoma, esophageal cancer, head and neck cancer (e.g., head and neck squamous cell carcinoma), cervical cancer, bladder cancer, hepatocellular carcinoma, gastric cancer, Hodgkin lymphoma, neuroblastoma, endometrial or uterine cancer, salivary gland cancer, vulvar cancer, thyroid cancer, anal cancer, penile cancer, multiple myeloma, and B-cell lymphoma, brain cancer, and related metastases. As used herein, the term "hematologic malignancy" refers to a condition caused by the uncontrolled growth and proliferation of abnormal cells, which in most cases originate in the bone marrow, the site of blood cell production. Exemplary hematologic malignancies include various leukemias, multiple myeloma, and malignant lymphomas. More specific examples of hematologic malignancies include: acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL), acute myeloid leukemia (AML), chronic myeloid leukemia (CML), acute granulocytic leukemia, chronic granulocytic leukemia, hairy cell leukemia (HCL), T-cell prolymphocytic leukemia, large granular lymphocyte leukemia, juvenile myelomonocytic leukemia, B-cell prolymphocytic leukemia, Burkitt leukemia, and adult T-cell leukemia, non-Hodgkin lymphoma, B-cell lymphoma, small lymphocytic lymphoma, lymphoplasmacytic lymphoma, primary macroglobulinemia ( macroglobulinemia), splenic marginal zone lymphoma, plasmacytoma, extranodal marginal zone B-cell lymphoma, MALT lymphoma, nodal marginal zone B-cell lymphoma (NMZL), follicular lymphoma, mantle cell lymphoma, diffuse large B-cell lymphoma, mediastinal (thymic) large B-cell lymphoma, intravascular large B-cell lymphoma, primary effusion lymphoma, Burkitt lymphoma, B-cell chronic lymphocytic lymphoma, classical Hodgkin lymphoma, nodular lymphocyte-predominant Hodgkin lymphoma, adult T-cell lymphoma, extranodal nasal type NK / T-cell lymphoma, enteropathy-type T-cell lymphoma, hepatosplenic T-cell lymphoma, blastic NK-cell lymphoma, mycosis fungoides, Sézary syndrome, primary cutaneous CD30-positive T-cell lymphoproliferative disorder, primary cutaneous anaplastic large cell lymphoma, lymphomatoid papulosis, angioimmunoblastic T-cell lymphoma, peripheral T-cell lymphoma, unspecified, and anaplastic large cell lymphoma. As used herein, the term "solid tumor" refers to a palpable mass that can be detected by clinical examinations such as radiography, CT scan, B-ultrasound, or palpation. Clinically diagnosed solid tumors are divided into two types: malignant and benign. Malignant solid tumors include: melanoma (metastatic melanoma), head and neck cancer (such as head and neck squamous cell carcinoma), esophageal cancer (such as esophageal squamous cell carcinoma), urothelial carcinoma, oral cancer (such as oral squamous cell carcinoma), sarcoma (such as synovial sarcoma), liver cancer, lung cancer, bladder cancer, ovarian cancer, colorectal cancer, breast cancer, childhood Hodgkin lymphoma: lymphocyte-predominant type, nodular sclerosis type, mixed cell type, lymphocyte depletion type; childhood non-Hodgkin lymphoma: prelymphoblastic lymphoma, small non-cleaved cell lymphoma (Burkitt / non-Burkitt lymphoma), diffuse large B-cell lymphoma, anaplastic large cell lymphoma, etc.; childhood kidney tumors: Wilms tumor, renal clear cell carcinoma, renal rhabdoid tumor, renal clear cell sarcoma, primitive neuroectodermal tumor of the kidney, etc.; childhood neuroblastoma: neuroblastoma, ganglioneuroblastoma, ganglioneuroma; childhood extracranial germ cell tumors: mature teratoma, immature teratoma, endodermal sinus tumor (yolk sac tumor), seminoma, dysgerminoma, choriocarcinoma, embryonal carcinoma, etc.; osteosarcoma and chondrosarcoma; childhood rhabdomyosarcoma: embryonal type, alveolar type, pleomorphic type, etc.; soft tissue sarcoma: fibrosarcoma, malignant fibrous histiocytoma, liposarcoma, leiomyosarcoma, angiosarcoma, lymphangiosarcoma, malignant schwannoma, alveolar soft part sarcoma, epithelioid sarcoma, clear cell sarcoma, malignant melanoma, synovial sarcoma, desmoplastic small round cell tumor, etc.; Ewing family sarcoma: Ewing sarcoma, primitive neuroectodermal tumor; childhood liver tumors: hepatoblastoma (embryonal type, fetal type, undifferentiated type), hepatocellular carcinoma; retinoblastoma; other tumors: posterior fossa medulloblastoma, nasopharyngeal carcinoma, papillary thyroid carcinoma, thymoma, pulmonary blastoma, pancreaticoblastoma, islet cell tumor, ileocecal carcinoid, mesothelioma, etc. Benign solid tumors include: lymphangioma, hemangioma, thyroglossal duct cyst, etc. In a first aspect, the present application provides a bispecific antibody comprising a first antigen-binding fragment that binds to the HLA-A24 / PRAME complex and a second antigen-binding fragment that binds to an activating T cell antigen. In some embodiments of the first aspect, the bispecific antibody is capable of mediating the activation of T cells by HLA-A24 + / PRAME + tumor cells, and / or the bispecific antibody is capable of mediating the killing of HLA-A24 + / PRAME + tumor cells by PBMCs. In some embodiments of the first aspect, the bispecific antibody is capable of mediating HLA-A24 + / PRAME+ Tumor cells activate Jurkat-Dual cells. In some embodiments of the first aspect, the binding epitope of the first antigen-binding fragment to the HLA-A24 / PRAME complex comprises one or more residues among positions 301-309 of PRAME as shown in reference to SEQ ID NO:38. In some embodiments, the amino acid sequence of positions 301-309 of PRAME as shown in reference to SEQ ID NO:38 is LYVDSLFFL (SEQ ID NO:19). In some embodiments of the first aspect, the binding epitope of the first antigen-binding fragment to the HLA-A24 / PRAME complex comprises at least one of the residues at positions 304, 305, 306, 307, 308, and 309 of PRAME as shown in reference to SEQ ID NO:38. In some specific embodiments of the first aspect, the binding epitope of the first antigen-binding fragment to the HLA-A24 / PRAME complex comprises the residues at positions 304, 305, 306, 307, 308, and 309 of PRAME as shown in reference to SEQ ID NO:38. In some embodiments, the residues at positions 304, 305, 306, 307, 308, and 309 of PRAME as shown in reference to SEQ ID NO:38 correspond to the PRAME 301-309 (LYVDSLFFL) amino acid residues at positions 4, 5, 6, 7, 8, and 9 of the polypeptide. In some embodiments of the first aspect, the activating T cell antigen is the CD3 molecule. In some embodiments of the first aspect, the first antigen-binding fragment comprises HCDR1 as shown in SEQ ID NO:1, HCDR2 as shown in SEQ ID NO:2, and HCDR3 as shown in SEQ ID NO:3; wherein the amino acid sequences of the HCDRs are defined according to Kabat. In some embodiments of the first aspect, the first antigen-binding fragment is in the form of a single-domain antibody. In some embodiments of the first aspect, the first antigen-binding fragment comprises a monovalent or multivalent (e.g., 1, 2, 3, 4, 5, or 6-valent) single-domain antibody that binds to the HLA-A24 / PRAME complex. In some specific embodiments of the first aspect, the first antigen-binding fragment comprises a bivalent single-domain antibody that binds to the HLA-A24 / PRAME complex. In some embodiments, the first antigen-binding fragment comprises the heavy chain variable regions of two monovalent single-domain antibodies that bind to the HLA-A24 / PRAME complex. In some embodiments of the first aspect, the first antigen-binding fragment comprises the heavy-chain variable regions of two monovalent single-domain antibodies that bind to the HLA-A24 / PRAME complex and are directly fused. In some embodiments of the first aspect, the first antigen-binding fragment comprises the heavy-chain variable regions of two monovalent single-domain antibodies that bind to the HLA-A24 / PRAME complex and are linked by a linker. In some embodiments, the linker is a GS-type flexible peptide linker. In some embodiments, the linker is (G4S)n, (SG4)n or G4(SG4)n, where n is an integer from 1 to 10, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or an integer or range of integers between any two of the above values. In some embodiments, the linker is (G4S)n, (SG4)n or G4(SG4)n, where n is an integer from 2 to 4, such as 2, 3 or 4. In some specific embodiments, the linker is GGGGSGGGGSGGGGS (SEQ ID NO:94). In some embodiments of the first aspect, the second antigen-binding fragment comprises an HCDR1 as shown in SEQ ID NO:6, an HCDR2 as shown in SEQ ID NO:7, an HCDR3 as shown in SEQ ID NO:8, an LCDR1 as shown in SEQ ID NO:9, an LCDR2 as shown in SEQ ID NO:10 and an LCDR3 as shown in SEQ ID NO:11; wherein the amino acid sequences of the HCDRs are defined according to Kabat. In some embodiments of the first aspect, the second antigen-binding fragment is in the form of a single-chain antibody (scFv) or a Fab fragment. In some specific embodiments of the first aspect, the second antigen-binding fragment is in the form of an scFv. In some embodiments of the first aspect, the first antigen-binding fragment comprises the amino acid sequence shown in SEQ ID NO:4. In some embodiments of the first aspect, the first antigen-binding fragment comprises the amino acid sequence shown in SEQ ID NO:5. In some embodiments of the first aspect, the first antigen-binding fragment comprises the amino acid sequence shown in SEQ ID NO:14. In some embodiments of the first aspect, the first antigen-binding fragment comprises the amino acid sequence shown in SEQ ID NO:15. In some embodiments of the first aspect, the amino acid sequence shown in SEQ ID NO:14 comprises two amino acid sequences shown in SEQ ID NO:4. In some embodiments of the first aspect, the amino acid sequence shown in SEQ ID NO:15 comprises two amino acid sequences shown in SEQ ID NO:5. In some embodiments of the first aspect, the second antigen-binding fragment comprises a heavy chain variable region having an amino acid sequence as shown in SEQ ID NO:12 and a light chain variable region having an amino acid sequence as shown in SEQ ID NO:13. In some embodiments of the first aspect, the first antigen-binding fragment comprises the amino acid sequence as shown in SEQ ID NO:4; and the second antigen-binding fragment comprises a heavy chain variable region having an amino acid sequence as shown in SEQ ID NO:12 and a light chain variable region having an amino acid sequence as shown in SEQ ID NO:13. In some embodiments of the first aspect, the first antigen-binding fragment comprises the amino acid sequence as shown in SEQ ID NO:5; and the second antigen-binding fragment comprises a heavy chain variable region having an amino acid sequence as shown in SEQ ID NO:12 and a light chain variable region having an amino acid sequence as shown in SEQ ID NO:13. In some embodiments of the first aspect, the first antigen-binding fragment comprises the amino acid sequence as shown in SEQ ID NO:14; and the second antigen-binding fragment comprises a heavy chain variable region having an amino acid sequence as shown in SEQ ID NO:12 and a light chain variable region having an amino acid sequence as shown in SEQ ID NO:13. In some embodiments of the first aspect, the first antigen-binding fragment comprises the amino acid sequence as shown in SEQ ID NO:15; and the second antigen-binding fragment comprises a heavy chain variable region having an amino acid sequence as shown in SEQ ID NO:12 and a light chain variable region having an amino acid sequence as shown in SEQ ID NO:13. In some embodiments of the first aspect, the amino acid sequence of the first antigen-binding fragment differs from the amino acid sequence shown in SEQ ID NO:4, 5, 14 or 15 by about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid substitutions, deletions and / or additions. In some embodiments of the first aspect, the amino acid sequence of the first antigen-binding fragment has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher homology with the amino acid sequence shown in SEQ ID NO:4, 5, 14 or 15. In some embodiments of the first aspect, the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO: 4, 5, 14 or 15 may also be truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids, while still maintaining a similar function of the first antigen-binding fragment. In some embodiments of the first aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may also be added to the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO: 4, 5, 14 or 15, and the resulting amino acid sequence still maintains a similar function of the first antigen-binding fragment. In some embodiments of the first aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may also be added or deleted from a region other than the C-terminal or N-terminal of the amino acid sequence shown in SEQ ID NO: 4, 5, 14 or 15, as long as the altered amino acid sequence substantially maintains a similar function of the first antigen-binding fragment. In some embodiments of the first aspect, the amino acid sequence of the heavy chain variable region of the second antigen-binding fragment comprises the amino acid sequence shown in SEQ ID NO: 12. In some embodiments of the first aspect, the amino acid sequence of the heavy chain variable region of the second antigen-binding fragment differs from the amino acid sequence shown in SEQ ID NO: 12 by about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid substitutions, deletions, and / or additions. In some embodiments of the first aspect, the amino acid sequence of the heavy chain variable region of the second antigen-binding fragment has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher homology with the amino acid sequence shown in SEQ ID NO: 12. In some embodiments of the first aspect, the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO: 12 may also be truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids, while still maintaining a similar function of the heavy chain variable region of the second antigen-binding fragment. In some embodiments of the first aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may also be added to the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO:12, and the resulting amino acid sequence still maintains a similar function to the heavy chain variable region of the second antigen-binding fragment. In some embodiments of the first aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may be added or deleted from a region other than the C-terminal or N-terminal of the amino acid sequence shown in SEQ ID NO:12, as long as the altered amino acid sequence substantially maintains a similar function to the heavy chain variable region of the second antigen-binding fragment. In some embodiments of the first aspect, the amino acid sequence of the light chain variable region of the second antigen-binding fragment comprises the amino acid sequence shown in SEQ ID NO:13. In some embodiments of the first aspect, the amino acid sequence of the light chain variable region of the second antigen-binding fragment differs from the amino acid sequence shown in SEQ ID NO:13 by about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid substitutions, deletions, and / or additions. In some embodiments of the first aspect, the amino acid sequence of the light chain variable region of the second antigen-binding fragment has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher homology with the amino acid sequence shown in SEQ ID NO:13. In some embodiments of the first aspect, the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO:13 may also be truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids while still maintaining a similar function to the light chain variable region of the second antigen-binding fragment. In some embodiments of the first aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids may also be added to the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO:13, and the resulting amino acid sequence still maintains a similar function to the light chain variable region of the second antigen-binding fragment. In some embodiments of the first aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids can also be added or deleted in a region other than the C-terminus or N-terminus of the amino acid sequence shown in SEQ ID NO: 13, provided that the function of the light chain variable region of the second antigen-binding fragment is substantially maintained after the change. In some embodiments of the first aspect, the first antigen-binding fragment and the second antigen-binding fragment are linked by an Fc fragment of an antibody heavy chain constant region, and the Fc fragment of the antibody heavy chain constant region includes a first Fc fragment and a second Fc fragment, wherein the amino acids at positions 354 and 366 of the first Fc fragment are C and W respectively, or the amino acids at positions 349, 366, 368 and 407 of the first Fc fragment are C, S, A and V respectively; and the amino acids at positions 354 and 366 of the second Fc fragment are C and W respectively, or the amino acids at positions 349, 366, 368 and 407 of the second Fc fragment are C, S, A and V respectively; wherein the amino acid positions of the antibody constant region are determined according to EU numbering. In some specific embodiments of the first aspect, the first antigen-binding fragment and the second antigen-binding fragment are linked by an Fc fragment of an antibody heavy chain constant region, and the Fc fragment of the antibody heavy chain constant region includes a first Fc fragment and a second Fc fragment, wherein the amino acids at positions 354 and 366 of the first Fc fragment are C and W respectively, and the amino acids at positions 349, 366, 368 and 407 of the second Fc fragment are C, S, A and V respectively; wherein the amino acid positions of the antibody constant region are determined according to EU numbering. In some embodiments of the first aspect, the first antigen-binding fragment and the second antigen-binding fragment are linked by an Fc fragment of an antibody heavy chain constant region, and the Fc fragment of the antibody heavy chain constant region includes a first Fc fragment and a second Fc fragment, wherein the amino acids at positions 234, 235 and 331 of the first Fc fragment and the second Fc fragment are F, E and S respectively; wherein the amino acid positions of the antibody constant region are determined according to EU numbering. In some embodiments of the first aspect, the first antigen-binding fragment and the second antigen-binding fragment are linked by an Fc fragment of an antibody heavy chain constant region, and the Fc fragment of the antibody heavy chain constant region includes a first Fc fragment and a second Fc fragment, wherein one of the first Fc fragment and the second Fc fragment is linked to the first antigen-binding fragment, and the other of the first Fc fragment and the second Fc fragment is linked to the second antigen-binding fragment. In some embodiments of the first aspect, the first antigen-binding fragment (e.g., at the C-terminus) is linked to the N-terminus of the first Fc fragment (e.g., an amino acid sequence such as SEQ ID NO: 33). In some embodiments of the first aspect, the second antigen-binding fragment (e.g., at the C-terminus) is linked to the N-terminus of the second Fc fragment (e.g., an amino acid sequence such as SEQ ID NO: 34). In some embodiments of the first aspect, the Fc fragment of the antibody heavy chain constant region is an Fc fragment of the IgG1 subtype. In some embodiments, the first Fc fragment is an Fc fragment of the IgG1 subtype; and / or the second Fc fragment is an Fc fragment of the IgG1 subtype. In some embodiments of the first aspect, the Fc fragment of the antibody heavy chain constant region is an Fc fragment of the IgG1m3 subtype. In some embodiments, the first Fc fragment is an Fc fragment of the IgG1m3 subtype; and / or the second Fc fragment is an Fc fragment of the IgG1m3 subtype. In some embodiments of the first aspect, the bispecific antibody comprises a first arm that binds to the HLA-A24 / PRAME complex and a second arm that binds to an activating T cell antigen, wherein the first arm comprises an amino acid sequence as shown in SEQ ID NO: 35 or 36; and the second arm comprises an amino acid sequence as shown in SEQ ID NO: 37. In some embodiments of the first aspect, wherein the amino acid sequence of the first arm comprises an amino acid sequence as shown in SEQ ID NO: 35 or 36. In some embodiments of the first aspect, the amino acid sequence of the first arm differs from the amino acid sequence shown in SEQ ID NO: 35 or 36 by about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid substitutions, deletions, and / or additions. In some embodiments of the first aspect, the amino acid sequence of the first arm has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher homology with the amino acid sequence shown in SEQ ID NO: 35 or 36. In some embodiments of the first aspect, the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO: 35 or 36 can also be truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids, while still maintaining a similar function of the first arm. In some embodiments of the first aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids can also be added to the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO: 35 or 36, and the resulting amino acid sequence still retains the similar function of the first arm. In some embodiments of the first aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids can also be added or deleted from a region other than the C-terminal or N-terminal of the amino acid sequence shown in SEQ ID NO: 35 or 36, as long as the altered amino acid sequence substantially retains the similar function of the first arm. In some embodiments of the first aspect, the amino acid sequence of the second arm comprises the amino acid sequence shown in SEQ ID NO: 37. In some embodiments of the first aspect, the amino acid sequence of the second arm differs from the amino acid sequence shown in SEQ ID NO: 37 by about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid substitutions, deletions, and / or additions. In some embodiments of the first aspect, the amino acid sequence of the second arm has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher homology with the amino acid sequence shown in SEQ ID NO: 37. In some embodiments of the first aspect, the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO: 37 can also be truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids, while still retaining the similar function of the second arm. In some embodiments of the first aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids can also be added to the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO: 37, and the resulting amino acid sequence still retains the similar function of the second arm. In some embodiments of the first aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids can also be added or deleted from a region other than the C-terminal or N-terminal of the amino acid sequence shown in SEQ ID NO: 37, as long as the altered amino acid sequence substantially retains the similar function of the second arm. In a second aspect, the present application provides a single-domain antibody that binds to the HLA-A24 / PRAME complex, comprising: HCDR1 as shown in SEQ ID NO:1, HCDR2 as shown in SEQ ID NO:2, and HCDR3 as shown in SEQ ID NO:3; wherein the amino acid sequence of the HCDR is defined according to Kabat. In some embodiments of the second aspect, the binding epitope of the single-domain antibody to the HLA-A24 / PRAME complex comprises one or more residues among positions 301-309 of PRAME as shown in reference SEQ ID NO:38. In some embodiments, the amino acid sequence of positions 301-309 of PRAME as shown in reference SEQ ID NO:38 is LYVDSLFFL (SEQ ID NO:19). In some embodiments of the second aspect, the binding epitope of the single-domain antibody to the HLA-A24 / PRAME complex comprises at least one of the residues at positions 304, 305, 306, 307, 308, and 309 of PRAME as shown in reference SEQ ID NO:38. In some specific embodiments of the second aspect, the binding epitope of the single-domain antibody to the HLA-A24 / PRAME complex comprises the residues at positions 304, 305, 306, 307, 308, and 309 of PRAME as shown in reference SEQ ID NO:38. In some embodiments, the residues at positions 304, 305, 306, 307, 308, and 309 of PRAME as shown in reference SEQ ID NO:38 correspond to the PRAME 301-309 (LYVDSLFFL) amino acid residues at positions 4, 5, 6, 7, 8, and 9 of the polypeptide. In some embodiments of the second aspect, the single-domain antibody is in the form of a monovalent or multivalent single-domain antibody that binds to the HLA-A24 / PRAME complex. In some embodiments of the second aspect, the single-domain antibody is in the form of a monovalent single-domain antibody that binds to the HLA-A24 / PRAME complex. In some embodiments of the second aspect, the single-domain antibody is in the form of a bivalent single-domain antibody that binds to the HLA-A24 / PRAME complex. In some embodiments of the second aspect, the single-domain antibody comprises the heavy chain variable regions of two monovalent forms of single-domain antibodies that bind to the HLA-A24 / PRAME complex. In some specific embodiments of the second aspect, the single-domain antibody comprises the heavy-chain variable regions of two monovalent forms of single-domain antibodies that bind to the HLA-A24 / PRAME complex and are directly fused. In some specific embodiments of the second aspect, the single-domain antibody comprises the heavy-chain variable regions of two monovalent forms of single-domain antibodies that bind to the HLA-A24 / PRAME complex and are linked by a linker. In some embodiments, the linker is a GS-type flexible peptide linker. In some embodiments, the linker is (G4S)n, (SG4)n or G4(SG4)n, where n is an integer from 1 to 10, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or an integer or integer range between any two of the above values. In some embodiments, the linker is (G4S)n, (SG4)n or G4(SG4)n, where n is an integer from 2 to 4, such as 2, 3 or 4. In some specific embodiments, the linker is GGGGSGGGGSGGGGS (SEQ ID NO:94). In some embodiments of the second aspect, the single-domain antibody comprises the amino acid sequence shown in SEQ ID NO:4. In some embodiments of the second aspect, the single-domain antibody comprises the amino acid sequence shown in SEQ ID NO:5. In some embodiments of the second aspect, the single-domain antibody comprises the amino acid sequence shown in SEQ ID NO:14. In some embodiments of the second aspect, the single-domain antibody comprises the amino acid sequence shown in SEQ ID NO:15. In some embodiments of the second aspect, the amino acid sequence of the single-domain antibody differs from the amino acid sequence shown in SEQ ID NO:4, 5, 14 or 15 by about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid substitutions, deletions and / or additions. In some embodiments of the second aspect, the amino acid sequence of the single-domain antibody has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher homology with the amino acid sequence shown in SEQ ID NO:4, 5, 14 or 15. In some embodiments of the second aspect, the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO:4, 5, 14 or 15 can also be truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids, while still maintaining the function of the single-domain antibody similar to that described above. In some embodiments of the second aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids can also be added to the C-terminal or N-terminal region of the amino acid sequence shown in SEQ ID NO: 4, 5, 14 or 15, and the resulting amino acid sequence still maintains a similar function to the said single-domain antibody. In some embodiments of the second aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids can also be added to or deleted from a region other than the C-terminal or N-terminal of the amino acid sequence shown in SEQ ID NO: 4, 5, 14 or 15, as long as the altered amino acid sequence substantially maintains a similar function to the said single-domain antibody. In a third aspect, the present application provides a nucleic acid molecule encoding the bispecific antibody described in the first aspect or the single-domain antibody described in the second aspect. In some embodiments of the third aspect, the nucleic acid molecule can include a DNA molecule and an RNA molecule. The nucleic acid molecule can be single-stranded or double-stranded and can be cDNA. In some embodiments of the third aspect, the nucleic acid molecule is operably linked to a regulatory nucleotide sequence that can be recognized by a host cell transformed with the said vector. In a fourth aspect, the present application provides a pharmaceutical composition comprising the bispecific antibody described in the first aspect or the single-domain antibody described in the second aspect, and a pharmaceutically acceptable excipient, diluent or carrier. In some embodiments of the fourth aspect, the pharmaceutical composition is used for preventing or treating HLA-A24 / PRAME positive tumors. In some embodiments of the fourth aspect, the HLA-A24 / PRAME positive tumors are selected from: melanoma, non-small cell lung cancer, small cell lung cancer, breast cancer (such as triple-negative breast cancer), renal cell carcinoma, esophageal cancer, head and neck cancer (such as head and neck squamous cell carcinoma), cervical cancer, bladder cancer, hepatocellular carcinoma, gastric cancer, Hodgkin lymphoma, neuroblastoma, acute leukemia (such as acute granulocytic leukemia or acute myeloid leukemia) and chronic leukemia (such as chronic granulocytic leukemia or chronic myeloid leukemia). In some embodiments of the fourth aspect, the pharmaceutical composition may further comprise one or more of the following substances: lubricants such as talc, magnesium stearate and mineral oil; wetting agents; emulsifiers; suspending agents; preservatives such as benzoic acid, sorbic acid and calcium propionate; sweeteners and / or flavoring agents, etc. In some embodiments of the fourth aspect, the pharmaceutical composition in the present application can be formulated into forms such as tablets, pills, powders, lozenges, elixirs, suspensions, emulsions, solutions, syrups, suppositories or capsules. In some embodiments of the fourth aspect, the pharmaceutical composition of the present application can be delivered by any physiologically acceptable administration method, including but not limited to: oral administration, parenteral administration, nasal administration, rectal administration, intraperitoneal administration, intravascular injection, subcutaneous administration, transdermal administration, inhalation administration, etc. In some embodiments of the fourth aspect, a pharmaceutical composition for therapeutic use can be formulated in the form of a lyophilized preparation or an aqueous solution for storage by mixing reagents with the required purity with pharmaceutically acceptable carriers, excipients, etc. as appropriate. In a fifth aspect, the present application provides the use of the bispecific antibody described in the first aspect, the single-domain antibody described in the second aspect, or the pharmaceutical composition described in the fourth aspect in the preparation of a drug for preventing or treating HLA-A24 / PRAME positive tumors. In some embodiments of the fifth aspect, the HLA-A24 / PRAME positive tumors are selected from: melanoma, non-small cell lung cancer, small cell lung cancer, breast cancer (such as triple-negative breast cancer), renal cell carcinoma, esophageal cancer, head and neck cancer (such as head and neck squamous cell carcinoma), cervical cancer, bladder cancer, hepatocellular carcinoma, gastric cancer, Hodgkin lymphoma, neuroblastoma, acute leukemia (such as acute granulocytic leukemia or acute myeloid leukemia), and chronic leukemia (such as chronic granulocytic leukemia or chronic myeloid leukemia). In a sixth aspect, the present application provides a method for preventing or treating HLA-A24 / PRAME positive tumors, including administering to an individual in need the bispecific antibody described in the first aspect, the single-domain antibody described in the second aspect, or the pharmaceutical composition described in the fourth aspect. In some embodiments of the sixth aspect, the HLA-A24 / PRAME positive tumors are selected from: melanoma, non-small cell lung cancer, small cell lung cancer, breast cancer (such as triple-negative breast cancer), renal cell carcinoma, esophageal cancer, head and neck cancer (such as head and neck squamous cell carcinoma), cervical cancer, bladder cancer, hepatocellular carcinoma, gastric cancer, Hodgkin lymphoma, neuroblastoma, acute leukemia (such as acute granulocytic leukemia or acute myeloid leukemia), and chronic leukemia (such as chronic granulocytic leukemia or chronic myeloid leukemia). In a seventh aspect, the present application provides the use of the bispecific antibody described in the first aspect or the single-domain antibody described in the second aspect in the preparation of a product for detecting HLA-A24 / PRAME positive cells. In some embodiments of the seventh aspect, the product is a kit, test strip, test card, or microfluidic device. In some embodiments of the seventh aspect, the product may further comprise a detection label, such as colloidal gold, chemiluminescent label, fluorescent label, nanoparticle label, etc. In some embodiments of the seventh aspect, the product may further include other reagents for detection, such as enzymes or colloidal gold-labeled antigens or antibodies, substrates, reference standards, diluents, washing solutions, etc. In some embodiments of the seventh aspect, the product may further include reagents for processing biological samples for detection, and the biological sample may be blood. In some embodiments of the seventh aspect, the product may further include an instruction manual for product use. This application also provides a vector comprising a nucleic acid molecule encoding the bispecific antibody described in the first aspect or the single-domain antibody described in the second aspect, and a host cell comprising the nucleic acid molecule or the vector. In other aspects, this application also provides a method for producing the bispecific antibody described in the first aspect or the single-domain antibody described in the second aspect. In some embodiments, the method for producing the bispecific antibody described in the first aspect or the single-domain antibody described in the second aspect includes culturing a host cell to facilitate the expression of the nucleic acid molecule. In some embodiments, the method for producing the bispecific antibody described in the first aspect or the single-domain antibody described in the second aspect further includes recovering the bispecific antibody or the single-domain antibody from the host cell culture medium. It should be understood that the above detailed description is only to make those skilled in the art understand the content of this application more clearly, and is not intended to limit in any way. Those skilled in the art can make various modifications and changes to the described embodiments. The following examples are for illustrative purposes only and are not intended to limit the scope of this application. Examples Example 1: Preparation of Recombinant Proteins In the process of preparing the bispecific antibody targeting HLA-A24 / PRAME and CD3, a variety of different recombinant proteins are required, including the extracellular region of human CD3E (hCD3E, SEQ ID NO: 17) and the extracellular region of human CD3D (hCD3D, SEQ ID NO: 18). At the same time, referring to the literature

[0018] Prepare the complex of the PRAME antigen peptide LYVDSLFFL (SEQ ID NO: 19) and the dtSCT (disulfide trap single-chain trimer) structure of HLA-A24 (MIP-P3, SEQ ID NO: 20). These recombinant proteins have a large number of post-translational modifications (such as glycosylation or disulfide bonds, etc.), so the use of mammalian cell expression systems will be more conducive to maintaining the structure and function of recombinant proteins. Adding a His tag (His, SEQ ID NO: 21) or the Fc segment of mouse antibody IgG2a (mFc, SEQ ID NO: 22) to the C-terminus of the recombinant protein will be more conducive to the purification of the recombinant protein and the identification of monoclonal antibody function. When preparing recombinant antibodies, the heavy chain constant region of the antibody can be the human IgG1 subtype (SEQ ID NO: 23) or various mutants of the selected human IgG1 subtype, such as: IgG1H (SEQ ID NO: 24), IgG1K (SEQ ID NO: 25), IgG1m3-H (SEQ ID NO: 26), IgG1m3-K (SEQ ID NO: 27), IgG1m3-H1n1 (SEQ ID NO: 28) or IgG1m3-Kn1 (SEQ ID NO: 29), and the light chain constant region can be the human λ subtype (SEQ ID NO: 30) or the human κ subtype (SEQ ID NO: 31). According to the amino acid sequences of various recombinant proteins in the Uniprot database, design and synthesize the genes of the above recombinant proteins (including the His tag or mFc coding gene). Use conventional molecular biology techniques to clone the synthesized recombinant protein genes into appropriate eukaryotic expression vectors (such as pcDNA3.1 from Invitrogen), and then use liposomes (such as 293fectin from Invitrogen) or other cationic transfection reagents (such as PEI) to transfect the prepared recombinant protein expression plasmid into HEK293 cells (such as HEK293F from Invitrogen), and culture for 3-4 days under serum-free suspension culture conditions. Then harvest the culture supernatant by centrifugation or other methods. The recombinant protein expressed by His tag fusion is purified in one step by using a metal chelate affinity column (such as GE's HisTrap FF, etc.). The recombinant protein expressed by mFc fusion is purified in one step by using a ProteinA / G affinity column (such as GE's Mabselect SURE, etc.). Then, the recombinant protein storage buffer is replaced with PBS (pH 7.0) or other suitable buffer using a desalting column (such as GE's Hitrap desaulting, etc.). If necessary, the recombinant protein sample can be filtered and sterilized, and then stored in aliquots at -20°C. Example 2: Screening and activity evaluation of anti-HLA-A24 / PRAME monoclonal antibodies 2.1 Llama immunization and preparation of single domain antibody library One healthy adult llama was selected, and blood was collected before immunization to keep the background serum. For the first immunization, 0.4 mg of MIP-P3-His fusion protein was emulsified with Freund's complete adjuvant and injected subcutaneously at multiple points for immunization; for booster immunization at intervals of two weeks, 0.4 mg of MIP-P3-His fusion protein was emulsified with Freund's incomplete adjuvant and injected subcutaneously at multiple points for immunization, for a total of 5 booster immunizations, and blood was collected before each immunization for antibody titer analysis; for the seventh immunization, no adjuvant was added, 0.4 mg of MIP-P3-His fusion protein was taken as an antigen, and multiple subcutaneous injections were injected for shock immunization, and 150 mL of peripheral blood was collected 3 days later for lymphocyte separation. 150mL of llama peripheral blood lymphocytes were isolated using a camel peripheral blood lymphocyte isolation kit (Solarbio, CAT#P5750); total RNA of lymphocytes was extracted using a cell total RNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., CAT#DP430); the extracted total RNA was used as a template to synthesize the camel heavy chain variable region using a first-strand cDNA synthesis kit (Thermo scientific, CAT#K1621), and the reverse transcription primers were gene-specific primers, and the primer pairing region was located in the CH2 domain of the antibody heavy chain constant region, with a specific sequence of PCal-CH2R: TCCTTCCCCGTCAGCCAGTCCT (SEQ ID NO:95). The synthesized cDNA was immediately stored at -70°C for future use; then the cDNA obtained by reverse transcription was used as a template, and references were used to synthesize the variable region of the camel heavy chain.

[0019] Primers were synthesized and the camel VHH gene was isolated by nested PCR amplification. Finally, the amplified VHH gene was cloned into the vector pADSCFV-S (see Chinese Patent Application No. 201510097117.0).

[0020] ) to construct a VHH library. The library capacity of this antibody library reached 2.0E8, and the accuracy rate was 66.67%. 2.2 Screening of camel immune library Reference (see Chinese Patent Application No. 201510097117.0)

[0020] ), using the recombinant protein MIP-P3-mFc prepared in Example 1 as an antigen, a solid-phase screening strategy was used (the experimental protocol refers to Phage Display: A General Laboratory Manual, edited by (US) Clackson, T. and (US) Lowman, H.B.; translated by Ma Lan et al., Chemical Industry Press, May 2008

[0021] ) to screen the phage library displaying camel single-domain antibodies constructed above. A total of three rounds of screening were carried out by means of binding, elution, neutralization, infection, and amplification. Finally, a TCRm antibody N83G3 (SEQ ID NO: 4) that specifically binds to MIP-P3-His was obtained. Using conventional molecular biology methods, the nucleotide sequence of the variable region of N83G3 was cloned into a eukaryotic expression vector (such as pcDNA3.1 of Invitrogen) fused with the nucleotide sequence encoding the Fc segment (Fc, SEQ ID NO: 32) of human antibody IgG1 to express the N83G3-Fc recombinant protein. 2.3 Affinity analysis of anti-HLA-A24 / PRAME antibody The affinity of the anti-HLA-A24 / PRAME monoclonal antibody was determined by surface plasmon resonance technology using a Biacore T200. Related reagents and consumables such as an amino coupling kit (BR-1000-50), a human antibody capture kit (BR-1008-39), an S series CM5 chip (14100530), and 10×HBS-EP (BR100669) at pH 7.4 were all purchased from GE healthcare. According to the instructions in the kit, the surface of the carboxylated CM5 chip was activated with 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS). The anti-human IgG (Fc) antibody (capture antibody) was diluted to 25 μg / mL with 10 mM sodium acetate at pH 5.0, and then injected at a flow rate of 10 μL / min to achieve a coupling amount of approximately 10,000 response units (RU). After injecting the capture antibody, 1 M ethanolamine was injected to block the unreacted groups. For kinetic measurements, the anti-HLA-A24 / PRAME monoclonal antibody was diluted to 1 μg / mL and injected at 10 μL / min to ensure that about 60 RU of the antibody was captured by the anti-human Fc antibody. Then, a series of concentration gradients of MIP-P3-His were set (for example, 0.37 nM, 1.11 nM, 3.33 nM, 10 nM, and 30 nM), were injected from low concentration to high concentration at a flow rate of 30 μL / min, with a binding time of 90 s and a dissociation time of 1200 s. The chip surface was regenerated by injecting 3 M MgCl2 at a flow rate of 10 μL / min for 30 s. Using Biacore T200 evaluation software version 3.2.1, the association rate (Ka) and dissociation rate (K d ) were calculated by fitting the association and dissociation sensorgrams with a 1:1 binding model. At a ratio of K d / K a , the dissociation equilibrium constant (K D ) was calculated. The fitting results are shown in Table 1. Table 1. Affinity constants of anti-HLA-A24 / PRAME antibody binding to MIP-P3-His 2.4 Binding of anti-HLA-A24 / PRAME antibody to PRAME 301-309 (LYVDSLFFL)-pulsed HT-29 cells HT-29 (human colon cancer cells, purchased from Nanjing Kebai Biotechnology Co., Ltd.), which do not express the PRAME protein and have two different HLA-A genes, HLA-A02 and HLA-A24. Take HT-29 in the logarithmic growth phase, after digestion and centrifugation, resuspend it in 1640 medium (Gibco, C11875500BT) to 1×10 7 cells / mL, and seed 1 mL / well in a 6-well cell culture plate. PRAME 301-309 peptide (LYVDSLFFL, SEQ ID NO:19, commissioned by GenScript Biotech Corporation for synthesis) was diluted to 114 nM with 1640 medium, and 1 mL / well was added to the 6-well cell culture plate containing cells. The cell plate was placed in a CO2 incubator at 37 °C for 3 hours for pulsing. After the pulsing was completed, the cells were washed once with PBS solution and resuspended in PBS to 2×10 6 cells / mL, and 100 μL / well was seeded in a 96-well V-bottom plate. The test sample N83G3 and the negative control antibody DP47 were diluted with PBS (refer to US Patent Application US20160200833A1

[0022] Preparation, where the amino acid sequences of the heavy chain variable region and the light chain variable region are shown in SEQ ID NO: 96 and 97 respectively) were serially diluted. The initial concentration of the anti-HLA-A24 / PRAME antibody was 40 nM, and it was serially diluted 4-fold, with a total of 8 concentration points. 100 μL of the anti-HLA-A24 / PRAME antibody was added to the wells containing cells and incubated at 4°C for 1 hour. Then, it was washed 3 times with 200 μL of PBS solution, and goat anti-human IgG-FITC (Beijing Zhongshan Jinqiao Biotechnology Co., Ltd., ZF-0308), 100 μL / well, was added and incubated at 4°C in the dark for 30 minutes. After that, it was washed 3 times with 200 μL of PBS solution, resuspended with 100 μL of PBS solution, and detected on a flow cytometer (ACEA, Novocyte) in the FITC channel. The results showed that the anti-HLA-A24 / PRAME antibody N83G3 could bind PRAME well. 301-309 Pulsed HT-29 cells (Figure 1). Example 3: Humanization and Activity Evaluation of Anti-HLA-A24 / PRAME Monoclonal Antibody 3.1 Humanization of Anti-HLA-A24 / PRAME Monoclonal Antibody Humanization studies were carried out on the TCRm antibody N83G3 to reduce its immunogenicity. The humanization protocol adopted the classical framework transplantation strategy.

[0023] . The amino acid sequence of N83G3 was compared with the human antibody germline gene sequences in the IMGT database to select appropriate germline gene sequences to provide framework regions 1 to 3 (FR1 + FR2 + FR3) of the antibody, and appropriate J region gene sequences were selected to provide framework region 4 (FR4). This template can be selected based on various factors, such as: the relative total length of the antibody, the size of the CDRs, the amino acid residues at the junctions between the antibody framework regions (FR) and hypervariable regions (CDRs), the overall sequence homology, etc. The selected template can be a mixture of multiple sequences or can be a consensus template, with the aim of maintaining the appropriate conformation of the parental complementarity-determining regions (CDRs) as much as possible. At the same time, considering the characteristics of the humanized antibody such as solubility, stability, and expression yield, back mutations were carried out on 4 hot-spot amino acids 37F / 44E / 45R / 47F in its FR2, and finally the humanized mutant N83G3-h5 (SEQ ID NO: 5) was obtained. 3.2 Affinity Analysis of Humanized Antibody Referring to Example 2.3, the affinity analysis of the humanized molecule N83G3-h5 of the anti-HLA-A24 / PRAME monoclonal antibody N83G3 was carried out using Biacore T200, and the results are shown in Table 2. Table 2. Affinity Analysis of the Humanized Molecule N83G3-h5 of Anti-HLA-A24 / PRAME Antibody N83G3 Example 4: Preparation and Identification of TCRm×CD3 Bispecific Antibody Against HLA-A24 / PRAME Complex 4.1 Preparation of TCRm×CD3 Bispecific Antibody The nucleotide sequences encoding the variable regions of bivalent N83G3 (2N83G3, SEQ ID NO:14) and the single-chain antibody against CD3 (IMCR-ScFv, SEQ ID NO:16, see anti-CD3 v9 of US Patent No. 5821337A

[0024] ) were cloned into appropriate eukaryotic expression vectors respectively to co-express and construct the bispecific antibody against HLA-A24 / PRAME complex and CD3. That is, the nucleotide sequence encoding 2N83G3 was cloned into the eukaryotic expression vector fused with the nucleotide sequence of the Fc fragment IgG1m3-FcH1n1 (SEQ ID NO:33) encoding Hole mutation The nucleotide sequence encoding IMCR-anti-CD3-ScFv was cloned into the eukaryotic expression vector fused with the nucleotide sequence of the Fc fragment IgG1m3-FcKn1 (SEQ ID NO:34) encoding Knob mutation to construct the bispecific antibody 2N83G3×IMCR. The constructed eukaryotic expression vectors expressing 2N83G3-G1m3-FcH1n1 (SEQ ID NO:35) and IMCR-ScFv-G1m3-FcKn1 (SEQ ID NO:37) were co-transfected into HEK293F cells using liposomes and cultured for 3 - 5 days under serum-free suspension culture conditions, and then the culture supernatant was harvested by centrifugation or other methods. The bispecific antibody in the culture supernatant was purified using a Protein A affinity chromatography column (such as Mabselect SURE of GE Healthcare etc.), and then the recombinant protein storage buffer was replaced with PBS (pH 7.0) or other appropriate buffers using a desalting column (such as Hitrap desaulting of GE Healthcare etc.). The desalted protein solution was purified by size exclusion chromatography (SEC) using Superdex200 (GE) to obtain the target protein. If necessary, the antibody sample can be filtered and sterilized, and then aliquoted and stored at -20°C for later use. 4.2 Construction of Humanized TCRm×CD3 Bispecific Antibody Against HLA-A24 / PRAME Complex Referring to Example 4.1, the nucleotide sequence encoding the variable region of bivalent N83G3-h5 (2N83G3-h5, SEQ ID NO: 15) and the nucleotide sequence encoding the single-chain antibody against CD3 (IMCR-ScFv, SEQ ID NO: 16) were respectively cloned into appropriate eukaryotic expression vectors to co-express and construct a bispecific antibody against HLA-A24 / PRAME and CD3. That is, the nucleotide sequence encoding 2N83G3-h5 was cloned into a eukaryotic expression vector fused with the nucleotide sequence of the Fc fragment IgG1m3-FcH1n1 (SEQ ID NO: 33) encoding the Hole mutation, and the nucleotide sequence encoding IMCR-ScFv was cloned into a eukaryotic expression vector fused with the nucleotide sequence of the Fc fragment IgG1m3-FcKn1 (SEQ ID NO: 34) encoding the Knob mutation to construct the humanized bispecific antibody 2N83G3-h5×IMCR. 4.3 Affinity analysis of humanized bispecific antibody Referring to Example 2.3, the humanized bispecific antibody was analyzed for affinity using Biacore T200, and the results are shown in Tables 3 and 4. Table 3. Affinity constants of humanized bispecific antibody binding to MIP-P3-His Table 4. Affinity constants of humanized bispecific antibody binding to CD3 4.4 Activation of tumor cells by humanized bispecific antibody-mediated Jurkat-Dual cells K562 human chronic myeloid leukemia cells (high expression of PRAME, negative for HLA-A24, purchased from the Cell Resource Center of the Institute of Basic Medicine, Chinese Academy of Medical Sciences). Our company transfected the HLA-A24 gene into K562 cells to construct the K562 / HLA-A24 cell line (PRAME + / HLA-A24 + ). K562 / HLA-A24 cells in the logarithmic growth phase were collected, centrifuged and resuspended in 1640 medium to 5×10 5 cells / mL, and 100 μL / well was plated in a 96-well cell culture plate. Jurkat-Dual cells (purchased from Invivogen) in the logarithmic growth phase were collected, centrifuged and resuspended in 1640 medium to 1×10 6cells / mL, and plated at 50 μL / well in a 96-well cell culture plate to obtain a final E:T ratio of 1:1. Then, 2N83G3×IMCR bispecific antibody (2N83G3×IMCR BsAb, 50 μL / well) or 2N83G3-h5×IMCR bispecific antibody (2N83G3-h5×IMCR BsAb, 50 μL / well) or irrelevant antibody DP47×IMCR bispecific antibody (DP47×IMCR BsAb, 50 μL / well) with an initial concentration of 80 nM and 10 concentration points with 4-fold serial dilutions were added. After incubating the cell plate in a CO2 incubator at 37 °C for 20 hours, the supernatant was taken and detected according to the QUANTI-Luc TM Instruction Manual (QUANTI-Luc TM , Invivogen, rep-qlc2), and the activation of tumor cells mediated by HLA-A24 / PRAME×CD3 bispecific antibody against Jurkat-Dual cells was analyzed. The results showed that both 2N83G3×IMCR BsAb and 2N83G3-h5×IMCR BsAb could mediate the activation of Jurkat-Dual cells by K562 / HLA-A24 tumor cells (Figure 2). 4.5 Killing of Tumor Cells by Humanized Bispecific Antibodies Mediated by PBMC 4.5.1 Expression of Intracellular PRAME and HLA-A Locus Typing in Tumor Cells K562 (human chronic myeloid leukemia cells), HT-29 (human colon cancer cells), SK-Hep-1 (human hepatoma cells, purchased from the Cell Resource Center of the Institute of Basic Medicine, Chinese Academy of Medical Sciences), MEG-01 (human chronic myelogenous leukemia cells, purchased from Nanjing Kebai Biotechnology Co., Ltd.), A375 (human malignant melanoma cells, purchased from Nanjing Kebai Biotechnology Co., Ltd.), and U-2OS (human osteosarcoma cells, purchased from Nanjing Kebai Biotechnology Co., Ltd.) were used to detect the intracellular PRAME expression level by Western blotting (entrusted to Beijing Liebake Technology Co., Ltd.) and HLA-A locus typing detection (entrusted to Beijing CapitalBio Technology Co., Ltd.). The results are shown in Table 5: Except for HT-29 cells, K562, SK-Hep-1, MEG-01, A375, and U-2OS cells all expressed PRAME, but A375 and U-2OS cells were HLA-A24 negative. That is, only SK-Hep-1, MEG-01 cells, and the surface of K562 / HLA-A24 cells were HLA-A24 + / PRAME + . Table 5. Expression of Intracellular PRAME and HLA-A Locus Typing in Tumor Cells 4.5.2 Isolation of human peripheral blood mononuclear cells (PBMCs) Collect blood (50 mL) from normal volunteers. The blood samples were provided by the inventors and their colleagues as volunteers, and all volunteers had signed informed consent forms. The inclusion criteria for volunteers were as follows: 1. Age greater than 18 years old; 2. No HIV or HBV infection; 3. Normal blood routine test results; 4. Not pregnant or lactating women. PBMCs were isolated from the whole blood of volunteers using Ficoll density gradient centrifugation and cultured in RPMI 1640 medium. 4.5.3 Humanized bispecific antibody 2N83G3-h5×IMCR mediates the killing of tumor cells by PBMCs K562 / HLA-A24 cells, SK-Hep-1 cells, MEG-01 cells, A375 cells, U-2OS cells, HT-29 cells, and K562 cells in the logarithmic growth phase were collected separately. After centrifugation, the cells were resuspended in RPMI 1640 medium to a concentration of 5×10 5 cells / mL and seeded at 100 μL / well in a 96-well cell culture plate. Then, 2N83G3-h5×IMCR bispecific antibody (50 μL / well) or irrelevant antibody DP47×IMCR bispecific antibody (50 μL / well) with an initial concentration of 80 nM and 4-fold serial dilutions at 10 concentration points was added. Finally, 50 μL / well of PBMCs (effector cells) was added to obtain a final E:T ratio of 5:1. At the same time, separate target cell controls (K562 / HLA-A24 cells, SK-Hep-1 cells, MEG-01 cells, A375 cells, U-2OS cells, HT-29 cells, or K562 cells), separate effector cell controls (PBMCs), and separate medium blank controls were set up, and the volume was adjusted to 200 μL with medium. After incubating the cell culture plate in a CO2 incubator at 37 °C for 20 hours, the supernatant was taken, and the killing rate of bispecific antibody-mediated T cells against tumor cells was detected and analyzed with reference to the instructions of the CytoTox Non-Radioactive Cytotoxicity Assay (Promega, G1780). The results showed that the humanized bispecific antibody 2N83G3-h5×IMCR only mediated the killing of K562 / HLA-A24, SK-Hep-1, and MEG-01 tumor cells by PBMCs, and the EC Non-Radioactive Cytotoxicity Assay, Promega, G1780) instruction manual. The killing rate of bispecific antibody-mediated T cells against tumor cells was detected and analyzed. The results showed that the humanized bispecific antibody 2N83G3-h5×IMCR only mediated the killing of K562 / HLA-A24, SK-Hep-1, and MEG-01 tumor cells by PBMCs, and the EC 50The values are 0.01234, 0.2405, and 0.2599, respectively (Figure 3). 4.6 Activation of Jurkat-Dual cells by HT-29 cells pulsed with alanine-substituted peptides mediated by humanized bispecific antibodies Referring to Example 2.4, PRAME 301-309 Peptides were replaced with alanine at positions 1, 2, 3, 4, 5, 6, 7, 8, and 9, respectively, and the corresponding peptides were synthesized and used to pulse HT-29 cells. The amino acid sequence of the irrelevant peptide is shown in SEQ ID NO: 98. The results showed that the ability of the humanized bispecific antibody 2N83G3-h5×IMCR to activate Jurkat-Dual cells pulsed with peptides substituted with alanine at positions 6, 7, 8, and 9 decreased significantly, and the ability to activate Jurkat-Dual cells decreased significantly after substitution at positions 4 and 5 (Figure 4). Example 5: Specificity verification 5.1 Specificity verification of the humanized bispecific antibody 2N83G3-h5×IMCR and peptides similar to the PRAME 301-309 peptide Cross-reactivity against homologous peptides (sharing key recognition residues) derived from normal tissues may cause severe and unpredictable toxicities caused by TCR-like antibodies or TCR-based T cell therapies (see, for example, Linette et al., Blood, (2013), 122:863-71, which reported fatal toxicities of the MAGE A3-TCR therapy due to off-target reactivity against proteins expressed by cardiac tissue

[0025] ). Therefore, the specificity of these agents is crucial. To thoroughly define the specificity of the antibodies developed by the company, based on PRAME 301-309Data on alanine mutants in the peptide that affect the active site of N83G3-h5 (see Example 4.6). Through databases (IEDB and HLA Ligand Atlas), potential off-target peptides were retrieved according to the defined formulas xYxxSLFFx, xYxDxLFFx, xYxxxLFFx, xYxxxxFFx, xxxxxLFFx, xYxxSLFxx, xxxDxLFFx, xxxxxSLFFx, xxxxxxxFFx, xYxxxxxFx respectively. A total of 50 peptides derived from different proteins were found, all of which had high affinity for HLA-A24. GeneScript Biotech Corporation was commissioned to synthesize these peptides. Then, the cross-reactivity of the humanized bispecific antibody 2N83G3-h5×IMCR was verified using the method of activating Jurkat-Dual cells with peptide-pulsed HT-29 cells, as described in Example 5.5. The results showed that the humanized bispecific antibody 2N83G3-h5×IMCR only mediated the activation of Jurkat-Dual cells by HT-29 cells pulsed with similar peptides 8 / 11 / 12 / 16, but compared with PRAME 301-309 peptide-pulsed HT-29 cells, the EC 50 values increased by 337-fold / 93-fold / 482-fold / 97-fold respectively; the humanized bispecific antibody 2N83G3-h5×IMCR did not mediate the activation of Jurkat-Dual cells by HT-29 cells pulsed with the remaining 46 similar peptides (Table 6). Table 6. Similar peptides of PRAME 301-309 peptides 5.2 The humanized bispecific antibody 2N83G3-h5×IMCR does not mediate the killing of HLA-A24 and similar peptide segment double-positive cells by PBMC 5.2.1 Construction of PRAME and similar peptide segment 8 / 11 / 12 / 16 protein expression plasmids Referring to the UniProt database, the full-length genes of PRAME (SEQ ID NO: 38), XCR1 (similar peptide segment 8, SEQ ID NO: 39), KIFBP (similar peptide segment 11, SEQ ID NO: 40), CPVL (similar peptide segment 12, SEQ ID NO: 41) and PLD1 (similar peptide segment 16, SEQ ID NO: 42) were synthesized. Using conventional molecular biology techniques, the synthesized recombinant protein genes were cloned into appropriate eukaryotic expression vectors to construct full-length gene expression plasmids based on fusion GFP. Similarly, referring to the UniProt database, the full-length gene of HLA-A2402 (SEQ ID NO: 43) was synthesized, and the synthesized gene was cloned into an appropriate eukaryotic expression vector using conventional molecular biology techniques to construct a full-length gene expression plasmid. 5.2.2 Humanized bispecific antibody 2N83G3-h5×IMCR mediates the killing of HT-29 cells transfected with PRAME or similar peptide segments 8 / 11 / 12 / 16 genes by PBMC One day before transfection, plate HT-29 cells so that the cells reach 50 - 90% confluence on the day of transfection. That is, take the logarithmically growing HT-29, digest and centrifuge, resuspend with 1640 medium and count. Take 1.5×10 6 cells and inoculate them into a T25 cell culture flask, and culture overnight at 37℃ in a CO2 incubator. The next day, refer to the transfection reagent ( DNA transfection reagent, Polyplus, 101000006) instruction manual, and transfect the PRAME and similar peptide segment 8 / 11 / 12 / 16 gene expression plasmids into HT-29 cells respectively, and culture in a CO2 incubator at 37℃ for 48 hours for transfection. After digesting and centrifuging the cells transfected for 48 hours, verify according to Example 4.5. The results show that the humanized bispecific antibody 2N83G3-h5×IMCR only mediates the killing of HT-29 cells transfected with the PRAME gene by PBMC, and can hardly mediate the killing of HT-29 cells transfected with similar peptide segments 8 / 11 / 12 / 16 genes (Figure 5). 5.2.3 Humanized bispecific antibody 2N83G3-h5×IMCR mediates the killing of 293T cells transfected with PRAME or similar peptide segments 8 / 11 / 12 / 16 genes by PBMC 293T (human embryonic kidney cells, which do not express PRAME and are HLA-A24 negative, purchased from the Cell Resource Center of the Institute of Basic Medicine, Chinese Academy of Medical Sciences). One day before transfection, plate 293T cells so that the cells reach 50 - 90% confluence on the day of transfection. That is, for 293T cells in the logarithmic growth phase, after digestion and centrifugation, resuspend them in 1640 medium and count. Take 1.5×10 6 cells and inoculate them into a T25 cell culture flask, and culture them overnight at 37°C in a CO2 incubator. The next day, refer to the transfection reagent ( DNA transfection reagent, Polyplus, 101000006) instructions, and co-transfect the HLA-A2402 gene and the PRAME or similar peptide segment 8 / 11 / 12 / 16 gene into 293T cells respectively, and culture them in a CO2 incubator at 37°C for 24 hours for transfection. After digesting and centrifuging the cells transfected for 24 hours, verify them according to Example 4.5. The results show that the humanized bispecific antibody 2N83G3-h5×IMCR only mediates the killing of 293T cells co-transfected with HLA-A2402 + PRAME gene by PBMC, and can hardly mediate the killing of 293T cells co-transfected with HLA-A2402 + similar peptide segment 8 / 11 / 12 / 16 gene (Figure 6). cells (Figure 6). Since the humanized bispecific antibody 2N83G3-h5×IMCR only mediates the activation of Jurkat-Dual cells by HT-29 cells pulsed with similar peptide segment 8 / 11 / 12 / 16, but compared with HT-29 cells pulsed with PRAME 301-309 peptide, the EC 50 value of HT-29 cells pulsed with similar peptide segment 8 / 11 / 12 / 16 increases by about 90 - 500 times, and it can hardly mediate the killing of HT-29 cells transfected with similar peptide segment 8 / 11 / 12 / 16 gene and the killing of 293T cells co-transfected with HLA-A2402 + similar peptide segment 8 / 11 / 12 / 16 gene. Therefore, the TCRm×CD3 bispecific antibody against HLA-A24 / PRAME complex in this application only has a specific killing effect on HLA-A24 + / PRAME + tumors. Example 6: Antitumor activity of the humanized bispecific antibody 2N83G3-h5×IMCR in a mouse model of PBMC immune reconstitution Collect blood from normal volunteers (50 mL each), and the blood collected is provided by the inventors and their colleagues as volunteers. All volunteers have signed informed consent forms. The inclusion criteria for volunteers are: 1. Over 18 years old; 2. No HIV or HBV infection; 3. Normal blood routine test; 4. Not pregnant or lactating women. PBMC was isolated from the peripheral blood of healthy individuals using Ficoll density gradient centrifugation. Forty 7-8-week-old female NOG mice (Beijing Vital River Laboratory Animal Technology Co., Ltd.) were selected, and 1×10 7 personal PBMC were inoculated into the tail vein of NOG mice. Seven days after the inoculation of human PBMC, 1×10 7 K562 / HLA-A24 cells were subcutaneously inoculated into the right side of each mouse. The inoculation day was defined as day 0. When the average tumor volume reached 110 mm 3 , the mice were randomly grouped according to tumor size. The experiment was divided into four groups: the bispecific antibody 2N83G3-h5×IMCR (2N83G3-h5×IMCR BsAb) 1 mg / kg group (group 2), the bispecific antibody 2N83G3-h5×IMCR 0.1 mg / kg group (group 3), the bispecific antibody 2N83G3-h5×IMCR 0.01 mg / kg group (group 4), and the bispecific antibody irrelevant antibody DP47×IMCR (DP47×IMCR BsAb) 1.5 mg / kg group (group 1), with 8 mice in each group. Administration was by tail vein injection, and the drug was administered three times at a frequency of once a week. Efficacy evaluation was based on the growth volume of the tumor. The results showed that the humanized bispecific antibody 2N83G3-h5×IMCR had a significant effect on inhibiting tumor growth at doses of 1 mg / kg and 0.1 mg / kg, with relative tumor inhibition rates TGI (%) of 97.45% and 72.49% respectively, and P < 0.001 (Figure 7). Sequence information References [1]Ikeda H,LethéB,Lehmann F,et al.,Characterization of an antigen that is recognized on a melanoma showing partial HLA loss by CTL expressing an NK inhibitory receptor.Immunity.1997;6(2):199-208. [2]Wadelin F,Fulton J,McEwan PA,Spriggs KA,Emsley J,Heery DM.Leucine-rich repeat protein PRAME:expression,potential functions and clinical implications for leukaemia.Mol Cancer.2010;9:226. [3]Goodison S,Urquidi V.The cancer testis antigen PRAME as a biomarker for solid tumor cancer management.Biomark Med.2012;6(5):629-632. [4]Figueiredo DL,Mamede RC,Proto-Siqueira R,Neder L,Silva WA Jr,Zago MA.Expression of cancer testis antigens in head and neck squamous cell carcinomas.Head Neck.2006;28(7):614-619. [5]van't Veer LJ,Dai H,van de Vijver MJ,et al.,Gene expression profiling predicts clinical outcome of breast cancer.Nature.2002;415(6871):530-536. [6]Neumann E, Engelsberg A, Decker J, et al., Heterogeneous expression of the tumor-associated antigens RAGE-1, PRAME, and glycoprotein 75 in human renal cell carcinoma: candidates for T-cell-based immunotherapies?Cancer Res. 1998;58(18):4090-4095. [7]Thongprasert S, Yang PC, Lee JS, et al., The prevalence of expression of MAGE-A3 and PRAME tumor antigens in East and South East Asian non-small cell lung cancer patients. Lung Cancer. 2016;101:137-144. [8]van Baren N, Chambost H, Ferrant A, et al., PRAME, a gene encoding an antigen recognized on a human melanoma by cytolytic T cells, is expressed in acute leukaemia cells. Br J Haematol. 1998;102(5):1376-1379. [9]Radich JP, Dai H, Mao M, et al., Gene expression changes associated with progression and response in chronic myeloid leukemia. Proc Natl Acad Sci USA. 2006;103(8):2794-2799.

[0010] Willenbrock K, Kuppers R, Renne C, et al., Common features and differences in the transcriptome of large cell anaplastic lymphoma and classical Hodgkin's lymphoma. Haematologica. 2006;91(5):596 - 604.

[0011] Doolan P, Clynes M, Kennedy S, Mehta JP, Crown J, O'Driscoll L. Prevalence and prognostic and predictive relevance of PRAME in breast cancer. Breast Cancer Res Treat. 2008;109(2):359 - 365.

[0012] Oberthuer A, Hero B, Spitz R, Berthold F, Fischer M. The tumor - associated antigen PRAME is universally expressed in high - stage neuroblastoma and associated with poor outcome. Clin Cancer Res. 2004;10(13):4307 - 4313.

[0013] Ikeda, H., Lethe, B., Lehmann, F., Van Baren, N., Baurain, J.F., De Smet, C., Chambost, H., Vitale, M., Moretta, A., Boon, T., Coulie, P.G. (1997) Characterization of an antigen that is recognized on amelanoma showing partial HLA loss by CTL expressing an NK inhibitory receptor. Immunity, 6, 199–208.

[0014] A. Margaret Merchant et al., An efficient route to human bispecific IgG, Nature Biotechnology, Volume 16, 1998.

[0015] . Kabat, Sequences of Proteins of Immunological Interest,National Institutes of Health, Bethesda,Md. (1991).

[0016] . A1-Lazikani et al., J. Mol. Biol. 273:927-948(1997).

[0017] . Martin et al., Proc. Natl. Acad. Sci. USA86:9268-9272(1989).

[0018] . Kotsiou, E., Brzostek, J., Lenart, I., et al., (2010) Dimerization of solubledisulfide trap single-chain major histocompatibility complex class I molecules dependent on peptide binding affinity. Antioxid Redox Signal 15(3):635-644.

[0019] E., Poignavent, V., Vincke, C., et al. (2018) Ritzenthaler C, Muyldermans S, Monsion B. Construction of High-Quality Camel Immune Antibody Libraries. Methods Mol Biol 1701:169-187.

[0020] CN 201510097117.0

[0021] Phage Display: A General Experimental Guide / Edited by (US) Clackson, T., (US) Lowman, H.B.; Translated by Ma Lan et al. Chemical Industry Press, May 2008.

[0022] US20160200833A1

[0023] Tan, P., Mitchell, D, A., Buss, T, N., et al. (2022) "Superhumanized" antibodies: reduction of immunogenic potential by complementarity-determining region grafting with human germline sequences: application to an anti-CD28. J Immunol 169(2):1119-1125.

[0024] US 5821337A

[0025] Linette et al., Blood, (2013), 122:863-71.

Claims

1. A bispecific antibody comprising a first antigen-binding fragment that binds to the HLA-A24 / PRAME complex and a second antigen-binding fragment that binds to an activating T cell antigen; Preferably, the binding epitope of the first antigen-binding fragment to the HLA-A24 / PRAME complex includes one or more residues 301-309 of PRAME as shown in SEQ ID NO:38; more preferably, the binding epitope of the first antigen-binding fragment to the HLA-A24 / PRAME complex includes at least one of residues 304, 305, 306, 307, 308 and 309 of PRAME as shown in SEQ ID NO:38; and / or Preferably, the activating T cell antigen is a CD3 molecule.

2. The bispecific antibody according to claim 1, wherein The first antigen-binding fragment comprises HCDR1 as shown in SEQ ID NO: 1, HCDR2 as shown in SEQ ID NO: 2, and HCDR3 as shown in SEQ ID NO: 3; preferably, the first antigen-binding fragment is in the form of a single-domain antibody; more preferably, the first antigen-binding fragment comprises a single-domain antibody that binds to the HLA-A24 / PRAME complex in a monovalent or multivalent manner; and / or The second antigen-binding fragment comprises HCDR1 as shown in SEQ ID NO:6, HCDR2 as shown in SEQ ID NO:7, HCDR3 as shown in SEQ ID NO:8, LCDR1 as shown in SEQ ID NO:9, LCDR2 as shown in SEQ ID NO:10 and LCDR3 as shown in SEQ ID NO:11; preferably, the second antigen-binding fragment is in the form of a single-chain antibody (scFv) or a Fab fragment; more preferably, the second antigen-binding fragment is in the form of a scFv; in, The amino acid sequences of the HCDRs are according to the Kabat definition.

3. The bispecific antibody of claim 1 or 2, wherein the first antigen-binding fragment comprises a bivalent single-domain antibody that binds to the HLA-A24 / PRAME complex; Optionally, the first antigen-binding fragment comprises two heavy chain variable regions of monovalent single-domain antibodies that bind to the HLA-A24 / PRAME complex; preferably, the first antigen-binding fragment comprises two heavy chain variable regions of monovalent single-domain antibodies that bind to the HLA-A24 / PRAME complex that are directly fused or two heavy chain variable regions of monovalent single-domain antibodies that bind to the HLA-A24 / PRAME complex that are connected by a linker; more preferably, the linker is a GS-type flexible peptide linker; most preferably, the linker is (G4S)n, (SG4)n or G4(SG4)n, wherein n is an integer from 1 to 10, such as an integer from 2 to 4.

4. The bispecific antibody according to any one of claims 1 to 3, wherein The first antigen-binding fragment comprises an amino acid sequence as shown in SEQ ID NO: 4, 5, 14 or 15; and / or The second antigen-binding fragment comprises a heavy chain variable region with an amino acid sequence as shown in SEQ ID NO:12 and a light chain variable region with an amino acid sequence as shown in SEQ ID NO:

13.

5. The bispecific antibody of any one of claims 1 to 4, wherein the first antigen-binding fragment comprises the amino acid sequence shown in SEQ ID NO: 4; and the second antigen-binding fragment comprises the heavy chain variable region with the amino acid sequence shown in SEQ ID NO: 12 and the light chain variable region with the amino acid sequence shown in SEQ ID NO: 13; The first antigen-binding fragment comprises the amino acid sequence shown in SEQ ID NO: 5; and the second antigen-binding fragment comprises the heavy chain variable region with the amino acid sequence shown in SEQ ID NO: 12 and the light chain variable region with the amino acid sequence shown in SEQ ID NO: 13; or The first antigen-binding fragment comprises the amino acid sequence shown in SEQ ID NO: 14; and the second antigen-binding fragment comprises the heavy chain variable region with the amino acid sequence shown in SEQ ID NO: 12 and the light chain variable region with the amino acid sequence shown in SEQ ID NO: 13; or The first antigen-binding fragment comprises the amino acid sequence shown in SEQ ID NO:15; and the second antigen-binding fragment comprises the heavy chain variable region shown in the amino acid sequence of SEQ ID NO:12 and the light chain variable region shown in the amino acid sequence of SEQ ID NO:

13.

6. The bispecific antibody according to any one of claims 1 to 5, wherein The first antigen-binding fragment and the second antigen-binding fragment are connected through an antibody heavy chain constant region Fc fragment, and the antibody heavy chain constant region Fc fragment includes a first Fc fragment and a second Fc fragment; preferably, the antibody heavy chain constant region Fc fragment is an Fc fragment of the IgG1 subtype; more preferably, the antibody heavy chain constant region Fc fragment is an Fc fragment of the IgG1m3 subtype. Fc fragment; wherein The amino acids at positions 354 and 366 of the first Fc fragment are C and W, respectively, or the amino acids at positions 349, 366, 368 and 407 of the first Fc fragment are C, S, A and V, respectively; and the amino acids at positions 354 and 366 of the second Fc fragment are C and W, respectively, or the amino acids at positions 349, 366, 368 and 407 of the second Fc fragment are C, S, A and V, respectively; preferably, the amino acids at positions 354 and 366 of the first Fc fragment are C and W, respectively, and the amino acids at positions 349, 366, 368 and 407 of the second Fc fragment are C, S, A and V, respectively; and / or The amino acids at positions 234, 235 and 331 of the first Fc fragment and the second Fc fragment are F, E and S, respectively; and / or One of the first Fc fragment and the second Fc fragment is linked to the first antigen-binding fragment, and the other of the first Fc fragment and the second Fc fragment is linked to the second antigen-binding fragment; in, The amino acid positions of antibody constant regions are determined according to EU numbering.

7. The bispecific antibody of any one of claims 1 to 6, comprising a first arm that binds to the HLA-A24 / PRAME complex and a second arm that binds to an activating T cell antigen, wherein The first arm comprises the amino acid sequence shown in SEQ ID NO: 35 or 36; and The second arm comprises the amino acid sequence shown in SEQ ID NO:

37.

8. A nucleic acid molecule encoding the bispecific antibody according to any one of claims 1 to 7.

9. A pharmaceutical composition comprising the bispecific antibody according to any one of claims 1 to 7 and a pharmaceutically acceptable excipient, diluent or carrier.

10. The pharmaceutical composition of claim 9, for preventing or treating HLA-A24 / PRAME positive tumors; preferably, the HLA-A24 / PRAME positive tumors are selected from: melanoma, non-small cell lung cancer, small cell lung cancer, breast cancer (e.g., triple-negative breast cancer), renal cell carcinoma, esophageal cancer, head and neck cancer (e.g., head and neck squamous cell carcinoma), cervical cancer, bladder cancer, hepatocellular carcinoma, gastric cancer, Hodgkin's lymphoma, neuroblastoma, acute leukemia (e.g., acute myeloid leukemia or acute myeloid leukemia) and chronic leukemia (e.g., chronic myeloid leukemia or chronic myeloid leukemia).

11. Use of the bispecific antibody of any one of claims 1 to 7 or the pharmaceutical composition of claim 9 or 10 in the preparation of a medicament for preventing or treating HLA-A24 / PRAME-positive tumors; preferably, the HLA-A24 / PRAME-positive tumors are selected from: melanoma, non-small cell lung cancer, small cell lung cancer, breast cancer (e.g., triple-negative breast cancer), renal cell carcinoma, esophageal cancer, head and neck cancer (e.g., head and neck squamous cell carcinoma), cervical cancer, bladder cancer, hepatocellular carcinoma, gastric cancer, Hodgkin's lymphoma, neuroblastoma, acute leukemia (e.g., acute myeloid leukemia or acute myeloid leukemia) and chronic leukemia (e.g., chronic myeloid leukemia or chronic myeloid leukemia).

12. A method for preventing or treating HLA-A24 / PRAME-positive tumors, comprising administering to an individual in need thereof the bispecific antibody of any one of claims 1 to 7 or the pharmaceutical composition of claim 9 or 10; preferably, the HLA-A24 / PRAME-positive tumor is selected from the group consisting of melanoma, non-small cell lung cancer, small cell lung cancer, breast cancer (e.g., triple-negative breast cancer), renal cell carcinoma, esophageal cancer, head and neck cancer (e.g., head and neck squamous cell carcinoma), cervical cancer, bladder cancer, hepatocellular carcinoma, gastric cancer, Hodgkin's lymphoma, neuroblastoma, acute leukemia (e.g., acute myeloid leukemia or acute myeloid leukemia) and chronic leukemia (e.g., chronic myeloid leukemia or chronic myeloid leukemia).

Images