Reverse transcriptase and use thereof

By providing a new reverse transcriptase Len-RT derived from Bacillus senophora, the existing reverse transcriptase has solved the problems of low fidelity, low cDNA yield and intolerant high temperature in the reverse transcription reaction, and achieved efficient reverse transcription of complex structural RNA at high temperatures to generate cDNA of long fragment length, which is suitable for a variety of application scenarios.

WO2025118254A1PCT designated stage expired Publication Date: 2025-06-12SHENZHEN HUADA GENE INST
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2023/137302
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2023-12-07
Publication Date
2025-06-12

AI Technical Summary

Technical Problem

The existing reverse transcriptases have insufficient fidelity, low cDNA yield, low gene capture and intolerant high temperature in the reverse transcription reaction, which limits the research and development of the transcriptome.

Method used

A novel reverse transcriptase Len-RT is provided, which contains a reverse transcriptase or a biologically active fragment of a highly identical mutation sequence compared to existing reverse transcriptases. It is derived from Bacillus senophobia and has excellent thermal stability, continuous synthesis ability and template switching activity.

Benefits of technology

Len-RT can effectively mediate the reverse transcription of complex structural RNA at higher temperatures. The resulting reverse transcription product fragments are long in length and have high fidelity. They are suitable for many application scenarios such as reverse transcription reactions, library preparation and transcriptome sequencing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2023137302-FTAPPB-I100001
    Figure PCTCN2023137302-FTAPPB-I100001
  • Figure PCTCN2023137302-FTAPPB-I100002
    Figure PCTCN2023137302-FTAPPB-I100002
  • Figure PCTCN2023137302-FTAPPB-I100003
    Figure PCTCN2023137302-FTAPPB-I100003
Patent Text Reader

Abstract

Provided is a new reverse transcriptase or a biologically active fragment thereof. The reverse transcriptase or biologically active fragment thereof comprises a mutated sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity to SEQ ID NO: 1, wherein the mutation comprises at least one of substitution, deletion and insertion.
Need to check novelty before this filing date? Find Prior Art

Description

Reverse transcriptase and its applications Technical Field

[0001] The present disclosure relates to the field of molecular biology, and in particular to a reverse transcriptase or a biologically active fragment thereof and applications thereof. Background Art

[0002] Reverse transcriptase is a special DNA polymerase that can perform reverse transcription, synthesizing complementary DNA based on RNA as a template. The sources of reverse transcriptase are diverse, with the main source being RNA viruses. Common reverse transcriptases include Moloney murine leukemia virus reverse transcriptase (MMLV RT), human immunodeficiency virus reverse transcriptase (HIV RT), and avian myeloblastosis virus reverse transcriptase (AMV RT). In practical applications, reverse transcriptase is often used to study RNA molecules, such as in reverse transcription PCR (RT-PCR) or template-switch-based RNA sequencing processes.

[0003] Although a variety of reverse transcriptases, such as the modified MMLV reverse transcriptase, have been used in template switching-based RNA sequencing, these reverse transcriptases still have shortcomings such as low fidelity, low cDNA yield, low gene capture, and high temperature intolerance, which to some extent limit the research and development of the transcriptome.

[0004] Therefore, there is an urgent need to provide a reverse transcriptase with high thermal stability, strong processivity and excellent template switching activity.

[0005] Summary of the Invention

[0006] To this end, embodiments of the present disclosure provide a reverse transcriptase or a biologically active fragment thereof and applications thereof.

[0007] An embodiment of the first aspect of the present disclosure provides a reverse transcriptase or a biologically active fragment thereof, comprising a mutant sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity to SEQ ID NO: 1, wherein the mutation comprises at least one of a substitution, a deletion and an insertion.

[0008] In some embodiments, the reverse transcriptase or a biologically active fragment thereof is derived from Lentibacillus sp.

[0009] In some embodiments, the reverse transcriptase or a biologically active fragment thereof comprises the sequence shown in SEQ ID NO: 1.

[0010] An embodiment of the second aspect of the present disclosure provides a polynucleotide encoding the reverse transcriptase or a biologically active fragment thereof or a complementary sequence thereof as described in any embodiment of the first aspect of the present disclosure.

[0011] In some embodiments, the polynucleotide comprises the sequence shown in SEQ ID NO:2.

[0012] An embodiment of the third aspect of the present disclosure provides a vector comprising the polynucleotide as described in any embodiment of the second aspect of the present disclosure.

[0013] An embodiment of the fourth aspect of the present disclosure provides a cell, wherein the cell comprises the polynucleotide according to any embodiment of the second aspect of the present disclosure or expresses the reverse transcriptase or a biologically active fragment thereof according to any embodiment of the first aspect of the present disclosure.

[0014] An embodiment of the fifth aspect of the present disclosure provides a composition comprising the reverse transcriptase or a biologically active fragment thereof according to any embodiment of the first aspect of the present disclosure and an enzyme buffer,

[0015] In some embodiments, the enzyme buffer comprises one or more selected from Tris-hydrochloric acid, ammonium sulfate, magnesium chloride, potassium chloride, and PBS.

[0016] An embodiment of the sixth aspect of the present disclosure provides a kit comprising at least one of the following: a reverse transcriptase or a biologically active fragment thereof as described in any embodiment of the first aspect of the present disclosure, a polynucleotide as described in any embodiment of the second aspect of the present disclosure, a vector as described in any embodiment of the third aspect of the present disclosure, a cell as described in any embodiment of the fourth aspect of the present disclosure, and a composition as described in any embodiment of the fifth aspect of the present disclosure.

[0017] The embodiments of the seventh aspect of the present disclosure propose the use of the reverse transcriptase or its biologically active fragment as described in any embodiment of the first aspect of the present disclosure, the polynucleotide as described in any embodiment of the second aspect of the present disclosure, the vector as described in any embodiment of the third aspect of the present disclosure, the cell as described in any embodiment of the fourth aspect of the present disclosure, and the composition as described in any embodiment of the fifth aspect of the present disclosure in catalyzing reverse transcription reactions.

[0018] An embodiment of an eighth aspect of the present disclosure provides a reverse transcription method, comprising:

[0019] mixing the reverse transcriptase or a biologically active fragment thereof according to any embodiment of the first aspect of the present disclosure with an RNA template to obtain a reaction mixture;

[0020] The reaction mixture is subjected to a reverse transcription reaction to obtain a DNA product, wherein the DNA product is fully or partially complementary to the RNA template.

[0021] In some embodiments, the reaction temperature of the reverse transcription reaction is 40-55°C.

[0022] In some embodiments, the reaction temperature of the reverse transcription reaction is 42-50°C.

[0023] An embodiment of the ninth aspect of the present disclosure provides a method for preparing a library, comprising:

[0024] Mixing the reverse transcriptase or a biologically active fragment thereof as described in any embodiment of the first aspect of the present disclosure with the RNA to be tested to obtain a library preparation mixture;

[0025] The library preparation mixture is subjected to a reverse transcription reaction to obtain the library.

[0026] In some embodiments, the library is used for transcriptome sequencing.

[0027] In some embodiments, it is used for NGS transcriptome sequencing and / or third-generation transcriptome sequencing.

[0028] In some embodiments, the transcriptome sequencing includes single-cell transcriptome sequencing and / or spatial transcriptome sequencing.

[0029] In some embodiments, the library preparation is based on template switching.

[0030] In some embodiments, the library is used for one or more of Smart-seq, STOmics, Nanopore sequencing, Drop seq, such as 10×Genomics 3′ sequencing.

[0031] The embodiments of the present disclosure achieve the following beneficial effects:

[0032] The embodiments of the present disclosure propose a new reverse transcriptase (abbreviated as Len-RT). Compared with existing reverse transcriptases, the Len-RT provided by the present disclosure has excellent catalytic performance, for example, it can mediate the reverse transcription of complex structure RNA at relatively high temperatures, and the obtained reverse transcription product fragments are longer, etc., which is suitable for multiple application scenarios such as reverse transcription reactions (including ordinary cDNA synthesis, RACE, etc.), library preparation based on reverse transcription reactions such as template switching, and transcriptome sequencing. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] In order to more clearly illustrate the technical solutions in the present disclosure or related technologies, the following briefly introduces the drawings required for use in the embodiments or related technical descriptions. Obviously, the drawings described below are only embodiments of the present disclosure. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0034] FIG1 is a schematic diagram showing the sequence alignment results of the reverse transcriptase Len-RT and similar reverse transcriptases in the embodiments of the present disclosure.

[0035] FIG2 is a schematic diagram of the SDS-PAGE analysis results of the reverse transcriptase Len-RT in the embodiments of the present disclosure.

[0036] FIG3 is a schematic diagram of the polymerization activity assay results of the reverse transcriptase Len-RT in the embodiments of the present disclosure.

[0037] FIG4 is a schematic diagram of the Smart-Seq process based on template conversion in an embodiment of the present disclosure.

[0038] FIG5 is a schematic diagram of the performance evaluation results of the reverse transcriptase Len-RT in sequencing according to an embodiment of the present disclosure. DETAILED DESCRIPTION

[0039] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0040] The present disclosure is made based on the following knowledge of the inventors:

[0041] Reverse transcriptase is a special type of DNA polymerase that can perform reverse transcription, synthesizing DNA using RNA as a template. Reverse transcriptases come from a variety of sources, with RNA viruses being the primary source. Common reverse transcriptases include Moloney murine leukemia virus reverse transcriptase (MMLV RT), human immunodeficiency virus reverse transcriptase (HIV RT), and avian myeloblastosis virus reverse transcriptase (AMV RT). In practical applications, reverse transcriptases are often used to study RNA molecules, such as in reverse transcription PCR (RT-PCR) or template-switching RNA sequencing processes. Reverse transcriptase properties that directly affect the efficiency of reverse transcription of RNA into DNA include the reverse transcriptase's thermal stability, processivity, fidelity, and template-switching activity.

[0042] Thermal stability

[0043] The thermal stability of reverse transcriptase, that is, its ability to withstand high temperatures, is an important factor affecting cDNA synthesis. Increasing the reaction temperature helps denature RNA with a strong secondary structure and / or a high GC content, allowing the reverse transcriptase to read the sequence. The optimal temperature of most reverse transcriptases is about 40°C, while the reverse transcriptase Len-RT provided in the embodiments of the present disclosure is not affected by its reverse transcription activity under 50°C. This is conducive to the synthesis of full-length cDNA and improves the yield, thereby enabling better reverse transcription of RNA with complex structure.

[0044] Continuous synthesis capacity

[0045] The processivity of a reverse transcriptase refers to the number of nucleotides that bind to a single binding site on the enzyme. Reverse transcriptases with high processivity are able to synthesize longer cDNA chains in shorter reaction times. The reverse transcriptase Len-RT provided by the disclosed embodiments performs well in producing long cDNA bands even when used with low-quality and low-abundance RNA samples. The enzyme is also suitable for isolating RNA from microorganisms, plants, animals, and clinical trial samples, as these samples are easily degraded during handling and in an RNase-rich environment.

[0046] Fidelity

[0047] The fidelity of a reverse transcriptase refers to the accuracy of the sequence during reverse transcription of RNA into DNA, which affects the precision of RNA sequencing. The reverse transcriptase Len-RT provided in the disclosed embodiments has high fidelity and is suitable for transcriptome sequencing, particularly NGS transcriptome sequencing, third-generation transcriptome sequencing, single-cell transcriptome sequencing, and / or spatial transcriptome sequencing.

[0048] Template switching activity

[0049] The template switching activity of reverse transcriptase refers to the property of converting the template from RNA to template switching oligos (TSO) to continue cDNA synthesis during the reverse transcription process. During the reverse transcription process, after the first cDNA chain is reverse transcribed based on the RNA template, the reverse transcriptase will add TSO to the C oligonucleotide at the 5' end of the non-template chain to initiate the replication of the second cDNA chain. The reverse transcriptase Len-RT provided by the embodiments of the present disclosure has excellent template switching activity, which is necessary for obtaining complete cDNA based on RNA and is conducive to the effective amplification of the full-length transcript library.

[0050] Bacterial group II introns

[0051] Bacterial group II introns are large catalytic RNAs that include intronic ribozymes and intron-encoded reverse transcriptases. Group II reverse transcriptases derived from group II introns typically exhibit high fidelity, strong processivity, and unique template switching activity (directly connecting RNA sequencing adapters to cDNA), and have significant potential applications in RT-PCR and RNA sequencing. The reverse transcriptase Len-RT provided herein is a reverse transcriptase derived from a bacterial group II intron of Lentibacillus sp.

[0052] In the disclosed embodiments, "naturally occurring" or "wild-type" refers to a form found in nature. For example, a naturally occurring or wild-type polypeptide or polynucleotide sequence is a sequence present in an organism that has not been intentionally modified by human manipulation. A "mutant" means a sequence that has at least one amino acid alteration relative to a native or wild-type amino acid sequence. In some embodiments, the alteration (mutation) comprises at least one of a substitution, a deletion, and an insertion.

[0053] An embodiment of the first aspect of the present disclosure provides a reverse transcriptase or a biologically active fragment thereof, comprising a mutant sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity to SEQ ID NO: 1, wherein the mutation comprises at least one of a substitution, a deletion and an insertion.

[0054] In some embodiments, a biologically active fragment can include any number of consecutive amino acid residues of the reverse transcriptase Len-RT. The disclosed embodiments also include polynucleotides encoding any such biologically active fragments.

[0055] The amino acid sequence of reverse transcriptase Len-RT (SEQ ID NO: 1) is shown below:

[0056] In some embodiments, the reverse transcriptase or a biologically active fragment thereof is derived from Lentibacillus sp.

[0057] In some embodiments, the reverse transcriptase or a biologically active fragment thereof comprises the sequence shown in SEQ ID NO: 1.

[0058] The reverse transcriptase Len-RT or a biologically active fragment thereof provided in the embodiments of the present disclosure may comprise a sequence having at least 80%, at least 85%, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.91%, 99.92%, 99.93%, 99.94%, 99.95%, 99.96%, 99.97%, 99.98%, 99.99% but less than 100% identity to SEQ ID NO: 1, wherein the sequence has one or more amino acid mutations compared to SEQ ID NO: 1.

[0059] In the disclosed embodiments, the term "percent identity" with respect to nucleic acid or polypeptide sequences is defined as the percentage of nucleotide or amino acid residues in a candidate sequence that are identical to a known polypeptide, after aligning the sequences to maximize percent identity and introducing gaps (if necessary) to achieve the maximum percent homology. N-terminal or C-terminal insertions or deletions should not be construed as affecting homology. Homology or identity at the nucleotide or amino acid sequence level can be determined by BLAST (Basic Local Alignment Search Tool) analysis, which uses the algorithm employed by the programs blastp, blastn, blastx, tblastn, and tblastx (Altschul (1997), Nucleic Acids Res [Nucleic Acids Research]. 25, 3389-3402 and Karlin (1990), Proc. Natl. Acad. Sci. USA [Proceedings of the National Academy of Sciences of the United States of America] 87, 2264-2268), which is customized for sequence similarity searches.

[0060] In the disclosed embodiments, the term "biologically active fragment" refers to any fragment, derivative, homolog, or analog of Len-RT reverse transcriptase and its mutants that possesses in vivo or in vitro activity characteristic of a biomolecule, including, for example, reverse transcriptase activity. In some embodiments, the biologically active fragment, derivative, homolog, or analog of Len-RT reverse transcriptase possesses any degree of Len-RT biological activity in any in vivo or in vitro assay of interest.

[0061] The term "amino acid" refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that act in a manner similar to that of naturally occurring amino acids. Naturally occurring amino acids are those amino acids encoded by the genetic code, as well as those that have been subsequently modified, such as hydroxyproline, γ-carboxyglutamate, and O-phosphoserine. Amino acid analogs refer to compounds that have the same basic chemical structure as naturally occurring amino acids, i.e., a carbon atom bonded to a hydrogen atom, a carboxyl group, an amino group, and an R group, such as homoserine, norleucine, methionine sulfoxide, and methionine methylsulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain essentially the same chemical structure as naturally occurring amino acids. Amino acid mimetics refer to compounds that have a structure different from the general chemical structure of an amino acid but act in a manner similar to that of a naturally occurring amino acid. The amino acid sequences set forth in the embodiments of the present disclosure (e.g., the amino acid sequence set forth in SEQ ID NO: 1) may contain the above-mentioned amino acid analogs and mimetics or related modifications, as long as they do not affect the basic properties of the corresponding amino acid or the activity of the entire enzyme or its active fragment.

[0062] An embodiment of the second aspect of the present disclosure provides a polynucleotide encoding the reverse transcriptase or a biologically active fragment thereof or a complementary sequence thereof as described in any embodiment of the first aspect of the present disclosure.

[0063] In some embodiments, the polynucleotide comprises the sequence shown in SEQ ID NO:2.

[0064] The polynucleotide sequence encoding Len-RT reverse transcriptase (SEQ ID NO: 2) is shown below:

[0065] It should be noted that due to the principle of codon degeneracy, the polynucleotide sequence that translates the amino acid sequence is not the only constant sequence, and any nucleotide sequence that can encode the same amino acid sequence is within the scope of protection of this patent.

[0066] As used herein, "nucleic acid" refers to DNA, RNA, single-stranded, double-stranded, or more highly aggregated hybridization motifs and any chemical modifications thereof. Modifications include, but are not limited to, those that provide chemical groups that introduce additional charge, polarizability, hydrogen bonding, electrostatic interactions, points of attachment and interaction with nucleic acid ligand bases or nucleic acid ligands as a whole. Such modifications include, but are not limited to, peptide nucleic acids (PNA), phosphodiester group modifications (e.g., phosphorothioate, methylphosphonate), 2'-position sugar modifications, 5-position pyrimidine modifications, 8-position purine modifications, modifications at exocyclic amines, substitutions of 4-thiouridine, substitutions of 5-bromo- or 5-iodo-uracil, backbone modifications, methylation, unusual base pairing combinations such as isobases, isocytidines, and isoguanidines. Nucleic acids may also contain non-natural bases, such as nitroindole. Modifications may also include 3' and 5' modifications, such as capping with fluorophores (e.g., quantum dots) or other moieties. The nucleic acid sequence proposed in the embodiments of the present disclosure (eg, the nucleic acid sequence shown in SEQ ID NO: 2) may contain the above-mentioned non-natural bases or related modifications, as long as they do not affect the basic properties of the corresponding nucleotides.

[0067] An embodiment of the third aspect of the present disclosure provides a vector comprising the polynucleotide as described in any embodiment of the second aspect of the present disclosure.

[0068] "Vector" refers to a polynucleotide that is capable of replicating in a host organism independently of the host chromosome. Preferred vectors include plasmids and typically have an origin of replication. Vectors may include, for example, transcription and translation terminators, transcription and translation initiation sequences, and promoters for regulating expression of a particular nucleic acid.

[0069] An embodiment of the fourth aspect of the present disclosure provides a cell, wherein the cell comprises the polynucleotide according to any embodiment of the second aspect of the present disclosure or expresses the reverse transcriptase or a biologically active fragment thereof according to any embodiment of the first aspect of the present disclosure.

[0070] Len-RT of the present invention can be expressed in a variety of host cells, including Escherichia coli, other bacterial hosts, yeast, filamentous fungi, and a variety of higher eukaryotic cells such as COS, CHO, and HeLa cell lines and myeloma cell lines. Techniques for gene expression in microorganisms are described, for example, in Smith, Gene Expression in Recombinant Microorganisms (Bioprocess Technology, Volume 22), Marcel Dekker, 1994. Examples of bacteria that can be used for expression include, but are not limited to, Escherichia, Enterobacter, Azotobacter, Erwinia, Bacillus, Pseudomonas, Klebsiella, Proteus, Salmonella, Serratia, Shigella, Rhizobium, Vitreoscilla, and Paracoccus. Filamentous fungi that can be used as expression hosts include, for example, the following genera: Aspergillus, Trichoderma, Neurospora, Penicillium, Cephalosporium, Aspergillus, Podospora, Mucor, Coccidioides, and Pyrospora. See, for example, U.S. Patent No. 5,679,543 and Stahl and Tudzynski, eds., Molecular Biology in Filamentous Fungi, John Wiley & Sons, 1992. Synthesis of heterologous proteins in yeast is well known and described in the literature. Sherman, F et al., Methods in Yeast Genetics, Cold Spring Harbor Laboratory (1982) is a well-known work that describes various methods that can be used to produce enzymes in yeast.

[0071] There are many expression systems for producing polypeptides known to those of ordinary skill in the art. (See, for example, Gene Expression Systems, ed. Fernandex and Hoeffler, Academic Press, 1999; Sambrook and Russell, supra; and Ausubel et al., supra). Typically, the polynucleotide encoding the polypeptide is under the control of a promoter that is functional in the desired host cell. Many different promoters are available and known to those skilled in the art and can be used in the expression vectors of the present invention, depending on the specific application. Typically, the promoter selected depends on the cell in which the promoter will be active. Other expression control sequences, such as ribosome binding sites, transcription termination sites, etc., may also be optionally included. A construct comprising one or more of these control sequences is referred to as an "expression cassette." Thus, the nucleic acid encoding the joined polypeptide is integrated for high-level expression in the desired host cell.

[0072] An embodiment of the fifth aspect of the present disclosure provides a composition comprising the reverse transcriptase or a biologically active fragment thereof according to any embodiment of the first aspect of the present disclosure and an enzyme buffer,

[0073] In some embodiments, the enzyme buffer comprises one or more selected from Tris-hydrochloric acid, ammonium sulfate, magnesium chloride, potassium chloride, and PBS.

[0074] An embodiment of the sixth aspect of the present disclosure provides a kit comprising at least one of the following: a reverse transcriptase or a biologically active fragment thereof as described in any embodiment of the first aspect of the present disclosure, a polynucleotide as described in any embodiment of the second aspect of the present disclosure, a vector as described in any embodiment of the third aspect of the present disclosure, a cell as described in any embodiment of the fourth aspect of the present disclosure, and a composition as described in any embodiment of the fifth aspect of the present disclosure.

[0075] The embodiments of the seventh aspect of the present disclosure propose the use of the reverse transcriptase or its biologically active fragment as described in any embodiment of the first aspect of the present disclosure, the polynucleotide as described in any embodiment of the second aspect of the present disclosure, the vector as described in any embodiment of the third aspect of the present disclosure, the cell as described in any embodiment of the fourth aspect of the present disclosure, and the composition as described in any embodiment of the fifth aspect of the present disclosure in catalyzing reverse transcription reactions.

[0076] An embodiment of an eighth aspect of the present disclosure provides a reverse transcription method, comprising:

[0077] mixing the reverse transcriptase or a biologically active fragment thereof according to any embodiment of the first aspect of the present disclosure with an RNA template to obtain a reaction mixture;

[0078] The reaction mixture is subjected to a reverse transcription reaction to obtain a DNA product, wherein the DNA product is fully or partially complementary to the RNA template.

[0079] In some embodiments, the reaction temperature of the reverse transcription reaction is 40-55°C. In some embodiments, the reaction temperature of the reverse transcription reaction is 42-50°C. The reverse transcription activity of the reverse transcriptase Len-RT provided in the embodiments of the present disclosure is not affected under the condition of 50°C. This is conducive to the synthesis of full-length cDNA and improves the yield, thereby enabling better reverse transcription of RNA with complex structure.

[0080] An embodiment of the ninth aspect of the present disclosure provides a method for preparing a library, comprising:

[0081] Mixing the reverse transcriptase or a biologically active fragment thereof as described in any embodiment of the first aspect of the present disclosure with the RNA to be tested to obtain a library preparation mixture;

[0082] The library preparation mixture is subjected to a reverse transcription reaction to obtain the library.

[0083] In some embodiments, the library is used for transcriptome sequencing.

[0084] In some embodiments, it is used for NGS transcriptome sequencing and / or third-generation transcriptome sequencing.

[0085] In some embodiments, the transcriptome sequencing includes single-cell transcriptome sequencing and / or spatial transcriptome sequencing.

[0086] In some embodiments, the library preparation is based on template switching.

[0087] In some embodiments, the library is used for one or more of Smart-seq, STOmics, Nanopore sequencing, Drop seq, such as 10×Genomics 3′ sequencing.

[0088] In summary, the new reverse transcriptase Len-RT proposed in the embodiments of the present disclosure has excellent catalytic performance compared to existing reverse transcriptases. For example, it can mediate the reverse transcription of complex structure RNA at relatively high temperatures, the obtained reverse transcription products have high fidelity and long fragment length, etc. It is suitable for reverse transcription reactions (including ordinary cDNA synthesis, RACE, etc.), library preparation based on reverse transcription reactions such as template switching, and transcriptome sequencing, and other application scenarios.

[0089] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0090] Unless otherwise specified, the quantitative tests in the following examples were performed three times, and the results were averaged.

[0091] Example 1 Identification of the novel reverse transcriptase Len-RT

[0092] The disclosed embodiments identified a novel reverse transcriptase, Len-RT, by performing metagenomic sequencing and subsequent analysis on samples from deep-sea hydrothermal sediments in the western Pacific Ocean.

[0093] (1) Metagenomic DNA was extracted from deep-sea hydrothermal sediment samples using the MGIEasy Microbial DNA Extraction Kit (Cat. No. 1000027955), and metagenomic sequence data were obtained through library construction and sequencing.

[0094] (2) Assemble the obtained metagenomic sequence data and perform species and functional annotation;

[0095] (3) The sequence of interest was compared with that of similar enzymes (Clustal Omega online sequence alignment website) and a structural model was constructed.

[0096] Preliminary identification indicates that the reverse transcriptase Len-RT provided by the present disclosure may be derived from Lentibacillus sp., specifically from bacterial type II introns. Bacterial type II introns have mobile reverse transcription elements, so the sequence of Len-RT is considered to be a sequence of interest.

[0097] The alignment results of Len-RT amino acid sequence (SEQ ID NO: 1) with similar reverse transcriptases marathon RT and TGI RT are shown in FIG1 . The sequence identities of Len-RT with similar enzymes marathon RT and TGI RT are 39.76% and 42.82%, respectively.

[0098] The sequence of marathon RT is shown in SEQ ID NO: 3:

[0099] The sequence of TGI RT is shown in SEQ ID NO: 4:

[0100] The above results indicate that the reverse transcriptase Len-RT provided in the embodiments of the present disclosure is a new type of reverse transcriptase with a novel sequence and a broad modification space. It can provide a new enzyme skeleton for the modification needs of different application scenarios and has excellent application potential.

[0101] Example 2 Determination of polymerization activity of reverse transcriptase Len-RT

[0102] In the disclosed embodiment, the reverse transcriptase Len-RT (SEQ ID NO: 1) was prepared by synthesis, expression and purification based on the Len-RT gene sequence, and then its polymerization activity was measured.

[0103] 2.1 Preparation of reverse transcriptase Len-RT

[0104] (1) The Len-RT gene sequence (SEQ ID NO: 1) was synthesized and cloned into the pET-28a expression vector (Changzhou Xinyi Biotechnology Co., Ltd.), where the cloning sites were Nde I and Xho I. The protein purification tag SUMO was added to the vector using the In-Fusion method;

[0105] (2) The above vector was transformed into Escherichia coli BL21 (DE3) competent cells, inoculated on a plate, and incubated at 37°C overnight;

[0106] (3) Pick 3-6 single colonies from the plate and inoculate them into a conical flask containing 50 ml of liquid culture medium (product number: A507002-0250, purchased from Sangon) and culture at 37°C for 5-7 h until the OD600 of the bacterial solution reaches 0.6-4.0;

[0107] (4) Inoculate 2 L of LB medium with the above bacterial solution at a 1% inoculum volume and culture at 37°C for 2-4 h until the OD600 of the bacterial solution reaches 0.8-1.0;

[0108] (5) Isopropyl-β-D-thiogalactopyranoside (IPTG, catalog number: A600168-0025, purchased from BBI) was added to the above bacterial solution to a final concentration of 0.5 mM. The cells were then placed in a shaker precooled to 16°C and cultured at 220 rpm for 12-16 h to induce the cells to express the reverse transcriptase Len-RT.

[0109] (6) Centrifuge the mixture obtained in (5) at 8000 g for 30 min and collect the precipitated bacteria;

[0110] (7) Add affinity solution A to the precipitate at a ratio of 1:20 to resuspend the bacteria, and then use ultrasound to disrupt the bacteria in an ice bath environment;

[0111] (8) The ultrasonically disrupted resuspension was centrifuged at 12,000 rpm for 60 min at 4°C, and the supernatant was filtered through a 0.22 μM filter membrane to serve as the sample loaded on the purification column;

[0112] (9) The sample was added to a pretreated affinity chromatography column (HisTrap FF) at a rate of 3 ml / min and then washed with Ni column affinity solution A (20 CV, 20 mM Tris-HCl, 300 mM NaCl, 20 mM Imidazole, 5% Glycerol, pH 7.8);

[0113] (10) Linear elution was performed using Ni column affinity solution B (10.5 CV, 0-70%, 20 mM Tris-HCl, 300 mM NaCl, 500 mM Imidazole, 5% Glycerol, pH 7.8). The eluted protein was collected when the UV absorption peak reached 50 mAu and the collection was stopped when the UV absorption peak dropped to 100 mAu.

[0114] (11) The collected eluate was added to a pretreated anion exchange chromatography column (HiTrap Q HP 5 ml) at a flow rate of 5 ml / min, and the flow-through was collected;

[0115] (12) Dilute the collected flow-through 9-fold with diluent (20 mM Tris-HCl, 5% Glycerol, pH 8.0) and add it to a pretreated cation exchange chromatography column (HiTrap SP HP 5 ml);

[0116] (12) Column Q was flushed with solution A (10 CV, 20 mM Tris-HCl, 50 mM NaCl, 5% Glycerol, pH 8.0) at a flow rate of 5 ml / min until the baseline was stable.

[0117] (13) Gradient elution was performed using Q column B solution (0-100%, 10 CV, 20 mM Tris-HCl, 1 M NaCl, 5% Glycerol, pH 8.0) at a flow rate of 5 ml / min to collect the target protein;

[0118] (14) The collected target protein was subjected to SDS-PAGE analysis to determine the protein purity of the target protein reverse transcriptase Len-RT;

[0119] (15) The purified reverse transcriptase Len-RT was dialyzed using dialysis buffer (40 mM Tris-HCl, 200 mM KCl, 2 mM DTT, 0.2 mM EDTA, 5% Glycerol, pH 8.0) and stored in enzyme storage solution (10 mM Tris-HCl, 100 mM KCl, 1 mM DTT, 0.1 mM EDTA, 50% Glycerol, pH 8.0) for subsequent analysis.

[0120] The SDS-PAGE analysis of reverse transcriptase Len-RT is shown in Figure 2. The target protein reverse transcriptase Len-RT has a clear band and high purity, which can be used for subsequent activity determination.

[0121] 2.2 Determination of polymerization activity of reverse transcriptase Len-RT

[0122] (1) Synthesize oligo(dT16) and 50 nt poly(rA), wherein the sequence of oligo(dT16) is TTTTTTTTTTTTTTTT (SEQ ID NO: 5), and the sequence of poly(rA) is AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO: 6);

[0123] (2) Reverse transcription was performed at 37°C. After 10 min, 1 μL of 0.5 M EDTA was added to terminate the reaction. The specific reaction system is shown in Table 1, where the concentration of reverse transcriptase Len-RT was 0.57 mg / mL and the concentration of commercial reverse transcriptase α-RT used as a control was 1 mg / mL.

[0124] Table 1 Reverse transcription reaction system

[0125] (3) The concentration of the generated dsDNA was determined using the Qubit kit.

[0126] The polymerization activity measurement results of the reverse transcriptase Len-RT are shown in Figure 3. When the reverse transcriptase Len-RT provided by the present disclosure is used, the dsDNA concentration produced by the reverse transcription reaction is as high as 24.3 ng / μL, while the dsDNA concentration produced by the control commercial reverse transcriptase α-RT enzyme is only 21.8 ng / μL. In addition, the initial concentration of the reverse transcriptase Len-RT is only 0.57 mg / mL, which is much lower than the concentration of the α-RT enzyme (1 mg / mL). The above results show that the reverse transcriptase Len-RT provided by the present disclosure has excellent polymerization activity, and it can also perform reverse transcription function at low concentrations, with high polymerization efficiency and low application cost, and has good application potential.

[0127] Example 3 Performance evaluation of reverse transcriptase Len-RT in sequencing

[0128] The present disclosure uses the transcriptome sequencing method Smart-Seq based on template switching to construct a library to evaluate the performance of the reverse transcriptase Len-RT in actual sequencing. The process can be referred to Picelli et al. (Picelli S, Faridani OR, AK, Winberg G, Sagasser S, Sandberg R. Full-length RNA-seq from single cells using Smart-seq2. Nat Protoc. 2014; 9(1):171-181. doi:10.1038 / nprot.2014.006).

[0129] 3.1 cDNA synthesis based on template switching

[0130] First, cDNA was synthesized based on template switching. The reverse transcription reaction system used was shown in Table 2. The reaction was carried out in a PCR instrument with the following program settings: 42°C / 50°C, 1h; 85°C, 15min; 4°C, ∞.

[0131] Table 2 Reverse transcription reaction system based on template switching

[0132] The Smart-Seq process is shown in Figure 4. First, an mRNA with a poly A tail is used as a template. The added Oligo-dT30VN primer will complement its poly A tail and, under the action of reverse transcriptase, reverse transcription is performed to synthesize the first-strand cDNA. Subsequently, due to the 5' cap structure of the mRNA template and the terminal transferase properties of the reverse transcriptase, when the first-strand cDNA is extended to the end of the mRNA template, a non-templated CCC base is added to the 3' end of the cDNA chain. The rGrG+G on the added template switching oligomer (TSO) will complement the CCC at the 3' end of the first-strand cDNA. At this point, under the action of the template switching activity of the reverse transcriptase, the reaction template is converted from the original mRNA to the TSO, and extension is carried out along it, completing the synthesis of cDNA.

[0133] The specific sequences of each molecule are as follows:

[0134] TSO: AAGCAGTGGTATCAACGCAGAGTACATrGrG+G (SEQ ID NO: 7);

[0135] Oligo-dT30VN:AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN (SEQ ID NO: 8).

[0136] 3.2 cDNA enrichment

[0137] After the reverse transcription reaction was complete, 5 μL of the reaction product (synthesized cDNA) was added to a 25 μL reaction system (Table 3) for PCR enrichment. The reaction was performed in a PCR instrument with the following program: 15 cycles of initial denaturation at 95°C for 5 minutes, followed by 98°C for 20 seconds, 58°C for 20 seconds, and 72°C for 3 minutes, with a final reaction at 72°C for 5 minutes.

[0138] Table 3 Enrichment PCR reaction system

[0139] It should be noted that Oligo-dT30VN and TSO have partially identical sequences, so cDNA can be enriched by PCR using ISPCR primers (AAGCAGTGGTATCAACGCAGAGT, SEQ ID NO: 9) to amplify the cDNA to ng level.

[0140] (3) After the reaction, the enriched cDNA was quantified using the Qubit dsDNA HS Assay Kit (Cat. No.: Q32854, purchased from Invitrogen) and agarose gel electrophoresis.

[0141] The performance evaluation results of the reverse transcriptase Len-RT in sequencing are shown in Figure 5. The cDNA fragment length and Smart-Seq yield generated by Len-RT reverse transcription were significantly higher than those of MMLV reverse transcriptase. This demonstrates that the reverse transcriptase Len-RT provided by the embodiments of the present disclosure is particularly suitable for transcriptome sequencing, especially for NGS transcriptome sequencing, third-generation transcriptome sequencing, single-cell transcriptome sequencing, and / or spatial transcriptome sequencing.

[0142] Furthermore, at 50°C, the reverse transcription activity of the reverse transcriptase Len-RT provided in the examples of the present disclosure remained unaffected, demonstrating its excellent thermal stability, exceeding the optimal temperature of around 40°C for most reverse transcriptase reactions. This facilitates the reverse transcription of complex RNA structures, suggesting that the Len-RT provided in the examples of the present disclosure is suitable for reverse transcription and sequencing of full-length transcriptomes.

[0143] In summary, the reverse transcriptase Len-RT provided in the embodiments of the present disclosure has high thermal stability, strong processivity and excellent template switching activity, and is a new type of reverse transcriptase with important application value.

[0144] In the description of this specification, the reference terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" mean that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art can combine and combine different embodiments or examples described in this specification and features of different embodiments or examples without contradiction.

[0145] It should be noted that, in this document, relational terms such as "first" and "second" are used only to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any actual relationship or order between these entities or operations. Moreover, the term "comprises" or any other variant thereof is intended to cover non-exclusive inclusion, so that a process, method, article or device that includes a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device. In the absence of further restrictions, the elements defined by the sentence "comprise a..." do not exclude the presence of other identical elements in the process, method, article or device that includes the elements.

[0146] Although the embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention.

Claims

1. A reverse transcriptase or a bioactive fragment thereof, wherein the reverse transcriptase or the bioactive fragment thereof comprises a mutant sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity compared to SEQ ID NO: 1, and wherein the mutation comprises at least one of substitution, deletion and insertion.

2. The reverse transcriptase or the bioactive fragment thereof according to claim 1, wherein the reverse transcriptase or the bioactive fragment thereof is derived from Lentibacillus sp.

3. The reverse transcriptase or the bioactive fragment thereof according to claim 1, wherein the reverse transcriptase or the bioactive fragment thereof comprises the sequence shown in SEQ ID NO:

1.

4. A polynucleotide encoding the reverse transcriptase or the bioactive fragment thereof or its complementary sequence according to any one of claims 1 to 3, optionally, the polynucleotide comprises the sequence shown in SEQ ID NO:

2.

5. A vector comprising the polynucleotide according to claim 4.

6. A cell comprising the polynucleotide according to claim 4 or expressing the reverse transcriptase or the bioactive fragment thereof according to any one of claims 1 to 3.

7. A composition comprising the reverse transcriptase or the bioactive fragment thereof according to any one of claims 1 to 3 and an enzyme buffer, optionally, the enzyme buffer comprises one or more selected from the group consisting of Tris-hydrochloride, ammonium sulfate, magnesium chloride, potassium chloride, and PBS.

8. A kit comprising at least one of the following: the reverse transcriptase or the bioactive fragment thereof according to any one of claims 1 to 3, the polynucleotide according to claim 4, the vector according to claim 5, the cell according to claim 6, and the composition according to claim 7.

9. Use of the reverse transcriptase or the bioactive fragment thereof according to any one of claims 1 to 3, the polynucleotide according to claim 3, the vector according to claim 5, the cell according to claim 6, the kit according to claim 7, or the composition according to claim 7 in catalyzing a reverse transcription reaction.

10. A reverse transcription method, comprising: mixing the reverse transcriptase or the bioactive fragment thereof according to any one of claims 1 to 3 with an RNA template to obtain a reaction mixture; performing a reverse transcription reaction on the reaction mixture to obtain a DNA product, wherein the DNA product is fully or partially complementary to the RNA template.

11. The reverse transcription method according to claim 10, wherein the reaction temperature of the reverse transcription reaction is 40 - 55 °C, preferably 42 - 50 °C.

12. A library preparation method, comprising: mixing the reverse transcriptase or the bioactive fragment thereof according to any one of claims 1 to 3 with the RNA to be tested to obtain a library preparation mixture; performing a reverse transcription reaction on the library preparation mixture to obtain the library.

13. The library preparation method according to claim 12, wherein the library is used for transcriptome sequencing, preferably for NGS transcriptome sequencing and / or third-generation transcriptome sequencing, Preferably, the transcriptome sequencing includes single-cell transcriptome sequencing and / or spatial transcriptome sequencing.

14. The library preparation method according to claim 12, wherein the library preparation is based on template switching, Optionally, the library is used for one or more of Smart-seq, STOmics, Nanopore sequencing, Drop seq such as 10×Genomics 3' sequencing.

Citation Information

Patent Citations

  • A method of preparing high-performance M-MLV reverse transcriptase

    CN106906237A

  • Thermal stability reverse transcriptase mutant and application thereof

    CN111647576A

  • High fidelity reverse transcriptases and uses thereof

    CN1422336A

  • Mutant reverse transcriptase and methods of use

    US20080227661A1

  • Mutant reverse transcriptase and methods of use

    WO2007022045A2