113 results about "DNA Aptamers" patented technology

The present invention relates to a molecular imaging probe for tumor diagnosis, and provides a sugar nucleic acid molecular imaging probe, the probe comprises a DNA aptamer sequence and more than one glycosyl nucleoside module, and is labeled by radionuclide, the DNA aptamer sequence can specifically target tumor cells after functional folding; the glycosyl nucleoside module is a glycosyl modified nucleoside derivative, is accurately modified at the 5'end or / and the 3 'end of the aptamer through DNA solid-phase synthesis, has the imaging characteristics of biological safety, high sensitivity and high resolution, and has an excellent diagnosis effect on part of cancers which are difficult to diagnose by a traditional method. The invention also provides a preparation method and a use method of the sugar nucleic acid molecular imaging probe, so that sugar modification of the aptamer is convenient, rapid, accurate, controllable and modularized, and the sugar nucleic acid molecular imaging probe has huge clinical application potential and transformation value in cancer diagnosis.

The invention provides a preparation method of a TiO2 / Au-C3N4 heterojunction photoelectrochemical biosensor and an application of the TiO2 / Au-C3N4 heterojunction photoelectrochemical biosensor. Comprising the following steps: step 1, preparing TiO2 / FTO; step 2, preparation of TiO2 / Au-C3N4 (titanium dioxide / Au-C3N4); step 3, preparing a nucleic acid aptamer; and step 4, using the confining liquid mercaptohexanol. The preparation method comprises the following steps: firstly, preparing a TiO2 thin film by an electrophoretic deposition method, and then combining the TiO2 thin film with graphite phase carbon nitride (g-C3N4) doped with high-conductivity noble metal gold nanoparticles (Au NPs) to form a heterojunction; under an illumination condition, Au NPs and photons interact to generate a regional surface plasma resonance phenomenon, and a strong electromagnetic field and high-concentration high-energy carriers are formed on the surface of the nano structure in the process, so that the photocurrent response of the composite material is remarkably enhanced; besides, the introduced Au NPs can also form an Au-S bond with the DNA aptamer containing the-SH group, and more binding sites are provided, so that the capture capability of the aptamer is enhanced.

The invention discloses a malaria-related biomarker detection chip based on an integrated organic electrochemical transistor as well as a preparation method and application of the malaria-related biomarker detection chip. According to the malaria-related biomarker detection chip based on the integrated organic electrochemical transistor, the integrated organic electrochemical transistor comprises an insulating substrate, a source electrode, a drain electrode and a gate electrode, the source electrode, the drain electrode and the gate electrode are arranged on the top of the insulating substrate, and an organic conductive channel is arranged between the source electrode and the drain electrode; the gate electrode and the organic conductive channel are located on the same plane, the gate electrode is a three-dimensional gold electrode obtained on the surface of a two-dimensional gold electrode by adopting an electrochemical deposition method, and the surface of the three-dimensional gold electrode is modified with a single-stranded DNA aptamer for identifying malaria-related biomarkers. The invention can realize high-sensitivity detection of malaria-related biomarkers, and has important significance for early diagnosis of diseases.

The invention relates to the technical field of functional materials, in particular to a metal-DNA aptamer self-assembled nano material as well as a preparation method and application thereof. The metal-DNA aptamer self-assembled nano material comprises two DNA aptamers, a copper source and ascorbic acid, wherein the two DNA aptamers are used for modifying an azide group and an alkynyl group respectively; and copper is coordinated with a five-membered ring formed by a reaction through a copper-catalyzed azide-alkynyl cycloaddition reaction, so that the Cu-DNA aptamer self-assembled nano material is obtained. The problem that an existing metal-DNA self-assembly nanometer material cannot stably exist in a physiological environment is solved, and meanwhile, the application of the metal-DNA self-assembly nanometer material in chemokinetic tumor treatment is achieved by precisely recognizing tumor cells in a targeted mode.

The invention discloses a preparation method and application of a chlorogenic acid carbon quantum dot microsphere capsule, a natural active product chlorogenic acid (CHA) in coffee is used as a raw material, and chlorogenic acid carbon quantum dots (CHA CDs) with anti-inflammatory and antioxidant activity are synthesized through a hydration method; then, the chlorogenic acid carbon quantum dots (CHACDs) are packaged with chitosan, and meanwhile, the chitosan on the outer layer of the capsule is modified with the DNA aptamer, so that the chlorogenic acid carbon quantum dot microsphere capsule Apt-CS (at) CHA CDs are obtained. The chlorogenic acid carbon quantum dot microsphere capsule disclosed by the invention not only has anti-inflammatory and antioxidant activity, but also can regulate intestinal flora, enhance intestinal barrier function and immune conditions; moreover, the microsphere capsule can be retained in the intestinal tract for a long time, so that the microsphere capsule can resist inflammation and remove high-level reactive oxygen species (ROS), can be retained in the intestinal tract for a long time and play a role in regulating intestinal flora, finally, the disease development of IBS is comprehensively relieved, and the microsphere capsule has a very good application prospect.

Disclosed herein is a cortisol sensor, comprising or consisting of: i) a metal nanoparticle; ii) a plurality of cortisol binding ligands conjugated to the surface of the metal nanoparticle; and iii) a plurality of peptides conjugated to the surface of the metal nanoparticle, for reducing non-specific binding of the cortisol binding ligands and / or improving stability of the metal nanoparticle in solution. In particular, the metal nanoparticle is a gold nanoparticle, the cortisol binding ligand is a cortisol DNA aptamer, and the peptide is CALNN. Also disclosed is a method of detecting the presence or quantity of cortisol in a sample, comprising or consisting the steps of: a) providing the cortisol sensor; b) contacting the cortisol sensor to the sample in a saline environment; and c) determining the degree of aggregation of the cortisol sensor. In particular, the degree of aggregation is measured by UV-visible spectroscopy.

The invention relates to the technical field of biological medicines, in particular to a preparation method of an inhibitor targeting a MAX-PD-L1 promoter specific binding motif and a double-target inhibitor, through ChIP-seq and site-directed mutagenesis experiments, a core binding motif of MAX and a PD-L1 promoter, such as 5 '-CAC [GA] TG-3', is defined, it is ensured that the inhibitor only targets a key site of MAX-PD-L1 interaction, and the activity of the MAX-PD-L1 promoter specific binding motif is improved. The off-target effect is avoided, and a high-specificity target spot is provided for subsequent inhibitor design. The cell permeability of the DNA aptamer screened based on the specific binding motif is improved after cholesterol modification, and the affinity of the DNA aptamer is obviously higher than that of a traditional antibody. A small molecule compound virtually screened through a molecular docking model is optimized through hydrogen bond and hydrophobic interaction, and then the binding affinity with MAX is improved. After treatment with the inhibitor, the combination inhibition rate of MAX and the PD-L1 promoter is high, the transcriptional activity of PD-L1 is obviously reduced, the killing rate of T cells to tumor cells is also improved, and immune escape is effectively blocked.

The application belongs to the field of chemical biology, and relates to a Fusobacterium nucleatum single-stranded DNA aptamer and a screening method and kit. The nucleotide sequence of the aptamer is as follows: 5'-TGACTGACGACGACTCCGCX1GX2X3X4GX5AGX6X7X8X9X 10 CGTX 11 X 12 X 13 X 14 X 15 X 16 X 17 X 18 X 19 X 20 X 21 X 22 X 23 GX 24 X 25 X26X 27 X 28 AX 29 X 30 GX 31 X 32 X 33 X 34 X 35 X 36 AGACTGCTCGAGCTG-3'. The aptamer obtained by the application has the characteristics of simple operation, high sensitivity, low manufacturing cost and strong specificity, and has a broad application prospect in the detection of Fusobacterium nucleatum.

The present invention relates to the technical field of pesticide residue detection, and in particular to a Cu‑BTC@Ag NPs@TPE‑(COOH)4@DNA aptamer fluorescent probe, and a preparation method and application thereof. In this study, Cu‑trimethylene tricarboxylate MOF-loaded silver nanoparticles were synthesized, and tetracarboxyl tetraphenylethylene with aggregation-inducing fluorescent groups was grafted to obtain a fluorescent material. Then, the DNA aptamer of acetamiprid was used as a recognition element to construct an aptamer probe. It has excellent fluorescence luminescence, and the probe can capture acetamiprid in the sample through the DNA aptamer, resulting in a significant reduction in the fluorescence signal of the aptamer, thereby establishing a fluorescence method for detecting acetamiprid. Since Cu‑BTC@Ag NPs can effectively amplify the fluorescence intensity of TPE‑(COOH)4, the detection limit is 1.16×10 ‑ 12 mol / L.

The present invention relates to a single-stranded DNA aptamer that binds to glutathione to inhibit oxidation of the glutathione or stabilize the glutathione, characterized in that the single-stranded DNA aptamer has one or more stem-loop structures; a method for oxidation prevention and stabilization of glutathione using the aptamer; and application to various fields such as pharmaceuticals, cosmetics, and food, using the aptamer. The aptamer of the present invention can be applied to various fields, such as pharmaceuticals, cosmetics, and food, which require oxidation prevention and stabilization of glutathione.

Disclosed are DNA aptamers. Related compositions and kits are also provided. Also disclosed are methods for amplifying a target DNA sequence using the DNA aptamers, and methods of identifying the DNA aptamers.

Disclosed are DNA aptamers. Related compositions and kits are also provided. Also disclosed are methods for amplifying a target DNA sequence using the DNA aptamers, and methods of identifying the DNA aptamers.

The present disclosure relates generally to nucleic acid aptamers useful, inter alia, for cell transduction, as well as containers (such as pouches) having a surface comprising one or such aptamers, and methods of transduction using such aptamers and containers. One embodiment of the present disclosure provides a DNA aptamer comprising a plurality of nucleotides, the DNA aptamer having a sequence identity of at least 80% to the sequence of SEQ ID NO: 1 (AAACTGCAGCGATTCATTAGTACGGCCTTT).

The present invention addresses the problem of providing a novel method for efficiently producing an aptamer having a high affinity for a target substance. Provided is a single-stranded nucleic acid molecule library comprising a plurality of single-stranded nucleic acid molecules, the multiple single-stranded nucleic acid molecules comprise a single-stranded nucleic acid molecule containing Ds / Pa ', and the single-stranded nucleic acid molecule containing Ds / Pa' comprises a pair of primer binding regions located at the 5'terminal and the 3 'terminal of the single-stranded nucleic acid molecule and a variable region located between the pair of primer binding regions. The pair of primer binding regions is composed of a base sequence shared among the plurality of single-stranded nucleic acid molecules, and the variable region comprises a non-natural base Ds (7-(2-thienyl)-3H-imidazo [4, 5-b] pyridine-3-yl) represented by general formula (I) and a non-natural base Pa'represented by general formula (II).

The invention belongs to the technical field of biomedicine, and particularly relates to a PAD-T cell targeting acute myelogenous leukemia cells and a preparation method and application of the PAD-T cell. The PAD-T cell comprises a T cell, a capsule shell coating the T cell, and a DNA aptamer connected with the capsule shell; wherein the capsule shell is formed by alternately overlapping a first polylysine layer, a first sodium alginate layer and a second polylysine layer, the DNA aptamer layer is an S30-T1 DNA aptamer, and the nucleotide sequence is as shown in SEQ ID NO. 1. According to the invention, the peripheral blood mononuclear cells of a healthy donor can be prepared on a large scale by utilizing a nano coating technology, and the recurrence after hematopoietic stem cell transplantation can be effectively relieved and the occurrence of GVHD can be reduced by combining an immune isolation concept and a biological material-nucleic acid material coated immune cell technology; the clinical application prospect is very high.

Provided are DNA aptamers selected from a DNA library using Cell-SELEX to bind specifically to cancer cells, which are optimized for high binding affinity to cancer cells can be effectively used for the diagnosis of cancer as they have enhanced targeting efficiencies for target cells and tissues as well as high serum stability.

The invention discloses a label-free ratio fluorescence sensor and a method for detecting fentanyl substances, and belongs to the field of analysis and detection.The sensor comprises a recognition element, the recognition element comprises six kinds of guanine-rich DNA aptamers and a signal conversion element, and the signal conversion element comprises a fluorescent dye. According to the invention, a plurality of fentanyl analogues can be rapidly detected.

The invention discloses a chimeric antigen receptor targeting EGFRvIII and application of the chimeric antigen receptor. The chimeric antigen receptor sequentially comprises an EGFRvIII targeting nucleic acid aptamer, a transmembrane domain and an intracellular signal domain from an N end to a C end, the EGFRvIII targeted nucleic acid aptamer is an EGFRvIII specific DNA aptamer obtained on the basis of SELEX (systematic evolution of ligands by exponential enrichment) screening, can only be combined with an extracellular domain of the EGFRvIII, and is not combined with an EGFR (epidermal growth factor receptor) wild type; the intracellular signal domain comprises a costimulatory signal domain and an activation signal domain, the C end of the costimulatory signal domain is connected with the N end of the activation signal domain, and the EGFRvIII specific nucleic acid aptamer screened based on SELEX is adopted as a targeting domain, can only be specifically combined with the extracellular domain of EGFRvIII positive tumor cells, and is not subjected to cross combination with EGFR wild cells and normal cells, so that the EGFRvIII specific nucleic acid aptamer can be used for detecting EGFRvIII positive tumor cells, and the EGFRvIII specific nucleic acid aptamer can be used for detecting EGFRvIII positive tumor cells. The problem of off-target killing caused by the fact that a common antibody scFv fragment of a traditional chimeric antigen receptor (CAR) is easily combined with a wild type EGFR is fundamentally avoided.

The invention discloses application of a fluorescence sensor based on a neomycin DNA aptamer, and belongs to the technical field of aptamer sensors. The neomycin DNA aptamer with excellent performance is combined with the nano material with unique chemical performance, the prepared aptamer fluorescence sensor has high sensitivity and specificity, a satisfactory linear relation is shown between the fluorescence value of the system and the neomycin concentration in the range of 0.005-200ng / mL, the detection analysis operation is simple, the detection time is short, and the application prospect is wide. The method can be used for detecting neomycin in food and has a wide application prospect.

The application belongs to the technical field of electrochemiluminescence detection, and discloses a preparation method of a thiamethoxam electrochemiluminescence sensor based on Fe / Zn-MOF@C-dots sensitization, which comprises the following steps: C-dots preparation, Fe / Zn-MOF preparation, Fe / Zn-MOF@C-dots preparation, modification of Fe / Zn-MOF@C-dots to the surface of a glassy carbon electrode through chitosan, then combination of a single strand of thiamethoxam DNA aptamer to the surface of the composite nanomaterial as a recognition element through a crosslinking agent, construction of a biosensor capable of recognizing thiamethoxam, electrochemical method detection and electrochemiluminescence method detection. The Fe / Zn-MOF@C-dots composite material is used as an electrochemiluminescence reagent for the first time, and compared with C-dots, the electrochemiluminescence signal of the Fe / Zn-MOF@C-dots is significantly enhanced; at the same time, the sensor uses DNA aptamer as a specific recognition element of the target molecule thiamethoxam, and effectively improves the selection performance of the sensor. The sensor shows significant repeatability, good selectivity and long-term stability, and can be used as an effective means for detecting thiamethoxam residues in agricultural products and origin environments.

The application provides a SETDB1 aptamer, a PROTAC constructed based on the aptamer and application, and relates to the technical field of biological medicines.The nucleotide sequence of the SETDB1 aptamer is any one of SEQ ID NO.1 or SEQ ID NO.2.Through SELEX screening, a DNA aptamer targeting SETDB1 is identified, and the DNA aptamer is specifically combined with a Tudor domain; based on the screened SETDB1 aptamer, a first PROTAC of SETDB1 is constructed.Single-chain PROTAC and double-chain PROTAC are synthesized, and the above-mentioned PROTACs are all targeted to degrade SETDB1 in tumors, and have no effect on non-tumor cells or tissues.

The invention belongs to the field of aquatic bacteria detection, and relates to a fluorescent array sensor as well as a preparation method and application thereof. The fluorescent array sensor comprises a plurality of DNA aptamers, the DNA aptamers respectively target lipopolysaccharide, peptidoglycan and flagellin, the DNA aptamers of the target lipopolysaccharide are EA5 and LA27, the DNA aptamer of the target peptidoglycan is Antibac2, and the DNA aptamer of the target flagellin is Aptamer 3; the sequence of the EA5 is shown as SEQ ID NO.1, the sequence of the LA27 is shown as SEQ ID NO.2, the sequence of the Antibac2 is shown as SEQ ID NO.3, and the sequence of the Aptamer 3 is shown as SEQ ID NO.4. The invention further discloses a kit for detecting the content of the EA5, the LA27, the Antibac2 and the Aptamer. According to the present invention, the six bacteria can be simultaneously detected, the detection limit is low, the operation process is simple, and the detection accuracy can achieve 97.6%.

The present invention relates to a DNA aptamer specifically binding to an alpha-synuclein protein and uses thereof. Specifically, the present invention relates to a DNA aptamer selected from the group consisting of nucleotide sequences of SEQ ID NOS: 1 to 12 and binding specifically to an α-synuclein protein, and a composition for detecting an α-synuclein protein, a detection kit, a detection chip or a microarray, all comprising the aptamer as an active ingredient. In addition, the present invention relates to a method for detecting an α-synuclein protein, a method for providing information for diagnosing a degenerative brain disease, a composition for diagnosing a degenerative brain disease, and a pharmaceutical composition for preventing or treating a neurodegenerative disease, all using the DNA aptamer of the present invention.

The application discloses a one-step monoclonal antibody drug electrochemical detection biosensor and a preparation method and application thereof. The application designs and screens an affinity specific DNA aptamer hairpin probe and uses the same as a specific capture unit, then uses a gold-sulfur bond to fix the DNA aptamer hairpin probe on a screen-printed electrode surface, meanwhile, uses a self-assembly interaction between a metal and a mercapto group to fix a blocking agent introduced on the screen-printed electrode surface, and blocks the excess electrode surface reaction sites, so that the one-step monoclonal antibody drug electrochemical detection biosensor is obtained. The one-step monoclonal antibody drug electrochemical detection biosensor has the advantages of simple operation, high sensitivity, less non-specific adsorption, high capture efficiency, stable physical and chemical properties, strong specificity and good selectivity, and can be used for capturing antibody drugs in complex biological samples.

The present invention relates to a high-speed method for selecting a DNA aptamer through a continuous process of adding gold nanoparticles to a reaction solution containing a target material and a single-stranded nucleic acid library and identifying aggregation. By using the method, an aptamer specifically binding to the target material can be effectively selected within a short time without a nucleic acid amplification process.

The present disclosure relates to aptamers that specifically bind to Cytokeratin 8 (CK8) and / or Cytokeratin 18 (CK18) and their use as biomarkers for the detection of cancer, preferably carcinoma or adenocarcinoma. The present disclosure also relates to an intraoperative surgical pathology method that provides for the rapid identification of cancer cells, in particular carcinoma or adenocarcinoma, in a biological sample.

The application relates to the technical field of nanomaterials, in particular to an EpCAM aptamer modified nanomaterial and a preparation method and application thereof, wherein the nanomaterial takes carboxylated mesoporous silica nanoparticles as a carrier, and an EpCAM specific DNA aptamer is covalently coupled to the surface of the nanomaterial; the sequence of the EpCAM specific DNA aptamer is shown as SEQ ID No. 1. The nanomaterial can specifically capture tumor-derived exosomes (EVs) in blood, and can realize sensitive detection of EVs in the 7-day (early stage) and 21-day (late stage) stages of an HT29 colon cancer model and the 7-day stage of an A549 / H460 lung cancer model, thereby providing a minimally invasive liquid biopsy new tool for early diagnosis of colon cancer and lung cancer, and solving the inherent limitation problems of sensitivity and specificity of existing diagnosis means in cancer detection.

The present invention relates to the field of molecular biology, and more particularly to nucleic acid aptamers, derivatives, and applications thereof for detecting TSHR protein. The present invention provides a nucleic acid aptamer for detecting TSHR protein, the nucleotide sequence of which is shown in SEQ NO. 1. The present invention provides a DNA aptamer YC6 with high affinity for TSHR protein, which has been validated at the molecular, cellular, and tissue levels. The present invention discovers that the DNA aptamer YC6 has the ability to recognize and target cells expressing thyrotropin receptors, providing new insights into the diagnosis and treatment of thyroid diseases and thyroid-related eye diseases.

The invention belongs to the technical field of biology, and particularly relates to a DNA aptamer for improving CRISPR / Cas9 mediated exogenous gene integration efficiency based on CtIP protein and application of the DNA aptamer, and the nucleotide sequence of the DNA aptamer is as shown in at least one of SEQ ID NO.1 and SEQ ID NO.10. The invention further discloses a preparation method of the DNA aptamer for improving CRISPR / Cas9 mediated exogenous gene integration efficiency based on CtIP protein. According to the invention, the key factor CtIP protein in DNA double-strand breakage repair is taken as a target for the first time, two aptamers are screened, and the donor vector of a CRISPR / Cas9 system is optimized by utilizing the aptamers, so that the integration efficiency of exogenous genes in HEK-293T cells and Hela cells is improved. The affinity of the CtIP protein specific DNA aptamer obtained through screening reaches the nanomole level, and the Kd value ranges from 42.56 nM to 407.29 nM. An aptamer is inserted into the tail end of a homologous arm of a donor carrier, and directional enrichment of a repair template is realized by utilizing an HMEJ mechanism. The aptamer A6913 and / or A13-32 significantly improves the integration efficiency of the exogenous gene, and the integration efficiency is improved by more than 3 times compared with a control group.

The present invention provides immunostimulatory nucleic acids that have an affinity to a specific target protein. The present invention also provides templates and methods for making and using the immunostimulatory nucleic acids. Further, methods for linking the immunostimulatory nucleic acids to antigens and using the resulting complexes to enhance an immune response are provided.