28results about How to "Realize visual detection" patented technology

The invention provides a micro-fluidic chip and a preparation method and application thereof, and belongs to the field of in vitro diagnose.The micro-fluidic chip comprises aptamer magnetic beads, a reactor and multivalent DNA nanowire reaction liquid, the aptamer magnetic beads comprise aptamer magnetic beads labeled by biotinylated staphylococcus aureus aptamers and aptamer magnetic beads labeled by biotinylated escherichia coli aptamers; the aptamer magnetic beads comprise aptamer magnetic beads labeled by biotinylated staphylococcus aureus aptamers and aptamer magnetic beads labeled by biotinylated escherichia coli aptamers; the reactor comprises two sample micro-chambers, two magnetic suction chambers, two snakelike mixing channels, two detection chambers and a sample outlet; the multivalent DNA nanowire reaction solution is a mixed solution comprising a multivalent DNA nanowire, heme and Tris-HCl. The micro-fluidic chip provided by the invention has the advantages of high sensitivity, strong specificity, low cost and simplicity in operation.

The invention relates to the technical field of communication, and provides a short message platform abnormal behavior detection method and system and computer equipment. The method comprises the following steps: acquiring short message sending data information of a detected account within a preset time period, and constructing a short message sending behavior chain of the detected account within the preset time period based on the short message sending data information; judging whether the detected account has an abnormal short message sending behavior within the preset time period or not based on the short message sending behavior chain; if yes, obtaining corresponding equipment information of the detected account in the preset time period, and generating a target short message abnormal behavior score of the detected account based on the short message sending behavior chain and the equipment information; and determining management measures of the detected account based on the target short message abnormal behavior score. According to the method, the accuracy of a short message sending abnormal behavior detection result is improved, and complex and hidden short message sending abnormal behaviors can be identified.

The invention discloses a fluorescent bimetal MOFs (Metal-Organic Frameworks) membrane sensor and a method capable of sensitively detecting ciprofloxacin. The fluorescent bimetal MOFs membrane sensor comprises a substrate and a fluorescent bimetal MOFs material, wherein the fluorescent bimetal MOFs material is mainly formed by mixing a bimetal ion A solution and an organic ligand B solution; the bimetallic ion A solution comprises metal ions A1 and metal ions A2, the metal ions A1 are europium ions, the metal ions A2 are terbium ions, the organic ligand B solution comprises an organic ligand B, and the organic ligand B is 5 '-adenylic acid. The fluorescent bimetallic MOFs membrane sensor disclosed by the invention can be used for carrying out direct fluorescent quantitative detection on ciprofloxacin in a crude extraction solution of a real sample, so that the integration of pretreatment and detection is realized, and a simple, convenient and efficient means is provided for rapid and sensitive detection of antibiotics.

The invention relates to a finger-pressing type nucleic acid detection micro-fluidic chip, which comprises a bottom layer, a flow channel layer, a finger-pressing layer and a thin film layer, the flow channel layer comprises an LAMP reaction chamber, a CRISPR reaction chamber, a water storage chamber, a Tesla valve, a finger-pressing chamber and a test paper reaction chamber, the LAMP reaction chamber comprises a nucleic acid extraction-free reaction system based on LAMP, the CRISPR reaction chamber comprises a CRISPR-based cas12b reaction system, and the test paper reaction chamber comprises a Tesla valve, a finger-pressing chamber and a test paper reaction system. The water storage chamber is mainly used for diluting a mixed system, and the Tesla valve is used for preventing crosstalk of the two reaction systems; the finger pressing layer comprises an LAMP reaction chamber button and a CRISPR reaction chamber button, when the LAMP reaction chamber button is pressed, liquid in the LAMP reaction chamber is pumped into the CRISPR reaction chamber, when the two buttons are pressed at the same time, a reaction mixing system is pumped into the water storage chamber to be mixed, and then the reaction mixing system is further pumped into the test paper reaction chamber. The chip can be widely applied to the field of rapid diagnosis of nucleic acid molecules, the detection cost is reduced, manual operation is simplified, and the detection efficiency is improved.

The invention discloses a fluorescent nanosensor based on the Strecker-like method for synthesizing isoindole and combining cadmium telluride quantum dots and its application, which is a composite system composed of 2,3-naphthalene dicarboxaldehyde and potassium sulfite as probe solutions and combined with cadmium telluride quantum dots. Cadmium telluride quantum dots are used as a fluorescence source to emit bright red fluorescence, 2,3-naphthalene dicarboxaldehyde and potassium sulfite are open-type probe solutions, and the addition of carbamate pesticides interacts with 2,3-naphthalene dicarboxaldehyde and potassium sulfite to synthesize an isoindole derivative to emit green fluorescence, thereby realizing the detection of carbamate pesticides based on the ratio fluorescence principle. The nanosensor relies on the fluorescence open-type response detection signal, presenting a significant change from bright red to green fluorescence, having a good visualization effect, and having high sensitivity, good selectivity, strong anti-interference ability, and low detection limit.

The invention relates to the technical field of biochemistry, in particular to a lateral flow analysis test strip for detecting a vascular endothelial growth factor 165. In the test strip provided by the invention, a detection line and a quality control line are marked on a nitrocellulose membrane, the detection line is coated with a VEGF165 antibody, and the quality control line is coated with a conjugate of streptavidin and a biotinylated VEGF165 aptamer complementary chain. Compared with an existing VEGF165 detection method, the method has the advantages that the VEGF165 aptamer is introduced, compared with a whole antibody system, the cost is reduced, the limitation that the variety of VEGF165 antibodies in the market is limited and most of the VEGF165 antibodies need to be imported is overcome to a certain extent, signal amplification detection can be achieved without a complex and high-cost DNA amplification technology, visual detection is achieved, and the method is suitable for large-scale popularization and application. The detection limit can be as low as 0.12 ng / mL.

The invention discloses a forge piece rapid detection device and method based on a line laser measuring instrument, and solves the problems that an existing forge piece detection method is low in efficiency and small in application range, and the surface domain characteristics of a forge piece cannot be obtained. The method comprises the following steps: obtaining point cloud data of one side of a to-be-detected forging, turning over the to-be-detected forging to obtain point cloud data of the other side, registering the point cloud data of the front side and the back side of the to-be-detected forging and reconstructing the section contour, on the basis, extracting the characteristic size of the to-be-detected forging, and realizing rapid detection of the to-be-detected forging. The detection efficiency is greatly improved, the detection time of an inspector is saved by 75%, and meanwhile, the labor cost is saved.

The invention discloses a preparation method and application of a red light carbon dot material, and belongs to the technical field of composite material preparation and pH and heavy metal ion detection. The invention aims to solve the problems that the existing red light carbon quantum dot material cannot eliminate cross interference among metal ions and cannot realize selective detection of heavy metal ions under a strong acid condition. The method comprises the following steps: 1, sequentially adding 2, 3-diaminophenazine, sulfanilic acid and boric acid into ethanol, and then carrying out ultrasonic treatment and constant-temperature reaction; and 2, filtering, washing, dialyzing and freeze-drying. The method is applied to visual detection of pH and heavy metal ions. The invention is used for preparation and application of the red light carbon dot material.

The invention discloses a method for rapidly detecting hydrogen sulfide in a solution, which comprises the following steps: firstly, sufficiently reacting a nano AgI dispersion liquid with a solution to be detected under an acidic condition to obtain an iodide ion solution, then introducing a CsPbBr3 quantum dot solution into the iodide ion solution, standing for reaction, and determining the hydrogen sulfide in the solution according to fluorescence color change information of the solution after reaction or a right shift change value of a peak position of a fluorescence emission peak. The visual detection on the hydrogen sulfide content is realized. The CsPbBr3 quantum dot is used as a fluorescent probe and can directly react with iodide ions formed by conversion of hydrogen sulfide, conditions such as introduction of other trigger media and the like are not needed, obvious solution fluorescence emission peak appearance position change and fluorescence color change can be initiated, and efficient visual detection of the hydrogen sulfide content is realized; the method has the advantages of simplicity in operation, high sensitivity, rich color change and the like and is suitable for popularization and application.

The present application relates to a kind of termite inner nest structure distribution visualization nondestructive detection equipment and positioning method, the nondestructive detection device includes signal transmitter, signal array receiver and acquisition host, the acquisition host is connected with signal transmitter and signal array receiver, acquisition host is equipped with signal transmission module, signal acquisition module, signal processing module and signal visualization module.The present application uses the detection method of active source diffraction secondary sound source, carries out the detection positioning of ant nest structure, accurately tracks and locates the distribution of ant road by arranging signal transmitter and array type arrangement sound source sensor, accurately detects the termite nest structure in dam interior, more effectively eliminates potential leakage hidden danger caused by ant nest.

The invention discloses a battery confluence plate, a battery and a welding method of the battery confluence plate and a roll core. The battery confluence plate comprises a confluence plate main body, a roll core connecting part, a positive pole connecting part and a center hole, a positive pole connecting part is arranged at the central position of the convergence plate main body; a central hole is formed in the central position of the positive pole connecting part; a positive pole output cover plate of the battery is arranged right above the positive pole connecting part; the top surface of the positive pole connecting part is fixedly connected with the bottom surface of the positive pole output cover plate; a plurality of radially distributed convergence disc hollow grooves are formed in the convergence disc main body; a roll core connecting part is arranged between any two adjacent hollow grooves of the convergence disc; and the roll core connecting part is used for being connected with a positive tab at the top of a roll core of the battery in a welding manner in a laser lap welding manner. According to the battery confluence plate, the battery and the welding method of the battery confluence plate and the roll core disclosed by the invention, the confluence plate can be reliably connected with the positive tab at the top of the battery roll core, and the connection reliability is ensured.

This invention belongs to the field of nucleic acid aptamer technology. This invention provides a high-affinity and specific phalloidin nucleic acid aptamer and its applications. The base sequence of the high-affinity and specific phalloidin nucleic acid aptamer is shown in SEQ.ID.NO.1. The nucleic acid aptamer obtained by this invention exhibits strong specificity for phalloidin; after detection by graphene oxide fluorescence quenching, the measured fluorescence intensity reaches 867.6 (au), while its effects on other toxins and blank controls are not significant. Furthermore, it has high affinity for phalloidin, with a Kd value of 240 nM (0.203 ng / Kg). After 5' end FAM fluorescent labeling, the nucleic acid aptamer obtained by this invention can achieve visual detection of phalloidin under ultraviolet transmission irradiation.

The invention relates to the technical field of microbiological detection, in particular to a primer and probe combination for rapidly detecting T4 type acanthamoeba protozoa by using RPA-LFS and a use method of the primer and probe combination. A downstream primer is [5 '-biotin]-GACTTGATGTTGTTGGGGGATCCACTCGAC; the method comprises the following steps of: designing a probe, wherein the probe is [FITC]-TGG CCGAGATTACCCAGCAAATCTTCGATG [dSpacer] CCAAGAACATATGG [3 'C3Spacer], and the probe is used for detecting the temperature of the probe; an upstream primer is not needed. According to the primer probe combination for rapidly detecting the T4-type acanthamoeba protozoa by using the RPA-LFS and the use method thereof, the established RPA-LFS detection method only needs a very small amount of DNA templates, the lowest DNA template dosage detected at present is 15.5 * 10 <-4 > ng per reaction, the dependence on laboratory equipment is overcome, field detection can be performed under bedside and home conditions, the operation is simple, the cost is low, and the primer probe combination is suitable for large-scale popularization and application. The method does not depend on high-quality technicians, so that patients and the masses can carry out detection, the detection process is simplified, and the detection period is shortened.

The invention relates to the technical field of nano materials and analysis and detection, in particular to a reagent for rapidly detecting aureomycin and a rapid aureomycin detection method. After the 3-mercaptopropionic acid modified AgInS2 quantum dots are added into aureomycin, the fluorescence intensity and color of the AgInS2 QDs are changed due to electrostatic interaction and band gap transition, so that a fluorescence colorimetric sensor is constructed to realize ultra-sensitive detection of the aureomycin. In order to realize on-site detection of aureomycin, a portable device equipped with a smart phone and an AgInS2 QDs sensor integration are also designed. A cloud server data analysis system based on a machine learning algorithm is integrated into the smart phone, so that color data collection, correction, explanation and display are facilitated. According to the invention, a user-friendly field detection solution is provided for aureomycin detection by utilizing the functions of capturing and processing fluorescence color signals of a modern smart phone.

The present invention provides an ICON probe, a detection kit and an application for DNA methylation of a human LINE transposon, and belongs to the technical field of gene detection. The nucleotide sequence of the ICON probe for DNA methylation of a human LINE transposon provided by the present invention is SEQ ID NO: 1, G indicates that Bipyridine is modified on g, and T indicates that the amino group is modified on t. Biotin‑X‑X‑NHS is used to biotin-label the three amino groups on the LINE1 ICON probe. Under the mediation of osmium acid, Bipyridine forms a stable cross-link with the methyl group on the methylated C in the LINE1 of the genome. After denaturation treatment, the LINE1 ICON probe is not eluted. At the same time, the biotin on the LINE1 ICON probe binds to the streptavidin in the tyramide signal amplification detection reagent to amplify the fluorescent signal, thereby achieving the purpose of rapid and visual detection at the in situ level of the cell.

The invention discloses a doped polymer dot as well as a preparation method and application thereof, and the doped polymer dot Ru (at) Pdots is prepared by taking a derivative of hydrophobic bipyridine ruthenium as a doped dye and a polymer dot with a co-reactant as an inclusion through a nano precipitation method. A self-enhanced polymer point-Ru (at) Pdots is synthesized by introducing intramolecular electron transfer and intermolecular resonance energy transfer processes, the Ru (at) Pdots serve as a self-enhanced ECL probe, an ECL imaging array capable of being used for visual detection is prepared, nitrogen free radicals on side chains of the Ru (at) Pdots are consumed after iodine in a detection solution is oxidized, and therefore ECL of the Ru (at) Pdots is quenched. The method not only realizes visual detection of iodine content in natural seawater, but also provides thinking and possibility for detection of radioactive substances in nuclear pollution.

This invention discloses a combined ultrasound probe device, comprising a control unit, a motion unit, a pressure detection unit, a temperature detection unit, a camera unit, a combined ultrasound probe unit, a water system unit, an external control unit, and a transducer unit. The control unit is used for control and data interconnection; the motion unit is used for movement of the probe unit and transducer unit; the pressure detection unit is used to detect the contact pressure between the water bag and the human body; the temperature detection unit is used to detect the temperature of the medium water; the camera unit is used to acquire image data from the water bag; the combined ultrasound probe unit is used to acquire image data from the target area; the water system unit is used for water intake and drainage of the water bag; the external control unit communicates with the control unit for data exchange and information interconnection; and the transducer unit is used for ultrasound emission and transmission of transducer data parameters to the external control unit. This invention can find the optimal target position and precisely control the treatment energy while maintaining a comfortable treatment position for the patient.

The application belongs to the field of detection, and specifically discloses a fluorescent probe, a preparation method and application thereof; the fluorescent probe comprises a compound shown in formula (I). 2+ The fluorescent probe has high sensitivity and selectivity, is not interfered by other metal ions, has a short detection time, can be detected within 30 min, can be detected completely within 30 s at most, can realize visual detection when applied to a test strip, and can be applied to the detection of Hg 2+ in environmental samples, such as actual water samples and soil samples.

This invention belongs to the field of immunoassay detection and discloses a ZrMPNs-NlucmAb bioluminescent signal probe and its application. The probe consists of a ZrMPNs signal carrier and its electrostatically adsorbed bioluminescent enzyme-labeled monoclonal antibody NlucmAb. This invention utilizes the ZrMPNs-NlucmAb probe to construct a bioluminescent test strip (BLFA), which requires no external light source and achieves a high luminescent signal in a furazine (FZ)-Nluc system, thus enabling sensitive detection of OTA. The limit of detection (LOD) of BLFA is 0.02 ng / mL, which is 9 times more sensitive than traditional gold nanoparticle-based LFAs. The cross-reactivity rates of this BLFA to OTB and OTC are 122.2% and 111.1%, respectively, and it does not recognize other common fungal toxins, exhibiting good specificity. Its application in the detection of OTA in cereals shows great promise.

The application relates to a preparation method of cobalt-modified polyheptazine imide and application thereof in rhodamine B photosensitization detection of paracetamol, and relates to the technical field of visual super-sensitive detection of colorless paracetamol. Method: the cobalt-modified polyheptazine imide is used to detect paracetamol in the following modes: mode one, rhodamine B-cobalt-modified polyheptazine imide is uniformly mixed with a paracetamol solution to obtain a to-be-detected suspension; the suspension is stirred and adsorbed in a Porphyrin multi-channel photocatalytic reactor under the condition of no light, a filter membrane is used for filtration after 532nm visible light is turned on, and ultraviolet-visible spectrophotometry is used for detection; mode two, the to-be-detected suspension is injected into a liquid-core optical fiber probe and is packaged, then a 532nm single-wavelength light source is turned on, and light irradiation is performed for 3-5min. The application can obtain the preparation method of cobalt-modified polyheptazine imide and application thereof in rhodamine B photosensitization detection of paracetamol.

The invention discloses a preparation method of a ratio fluorescence chromatography test strip and application of the ratio fluorescence chromatography test strip in patulin detection. The preparation method comprises the following steps: S1, preparing blue carbon dots; s2, preparing a gold nanocluster; and S3, preparing the ratiometric fluorescent probe. On the basis of a strategy of red fluorescence quenching and blue fluorescence opening, a sulfydryl functionalized AuNCs solution has abundant functional groups (-SH) which are complexed with patulin, the red fluorescence is gradually quenched, and the blue fluorescence is opened, so that the function of detecting patulin is realized, and the change of the fluorescence color from red to blue is realized. The whole fluorescence signal response can be completed within 10 seconds; besides, along with continuous increase of the patulin concentration, red fluorescence is gradually quenched, blue fluorescence is gradually enhanced, and a series of fluorescence intensity changes are shown under an ultraviolet lamp, so that visual detection of patulin is realized. According to the invention, convenient and rapid preliminary food health detection can be realized.

The invention discloses fluorescent hydrogel microspheres for rapidly detecting tetracycline as well as a preparation method and a detection method of the fluorescent hydrogel microspheres. The fluorescent hydrogel microsphere is mainly prepared from sodium alginate and a fluorescent complex, wherein the sodium alginate is a carrier of the fluorescent complex; the fluorescent complex is mainly formed by self-assembling guanylic acid, a europium ion compound and luminol; the fluorescent hydrogel microspheres are formed by dropwise adding a mixed solution of sodium alginate and a fluorescent complex into a calcium salt solution and solidifying; the fluorescent hydrogel microspheres are added into a sample solution containing tetracycline, after a reaction is carried out for a period of time at room temperature in a dark place, quantitative detection of tetracycline is realized by utilizing the ratio fluorescence change of the fluorescent hydrogel microspheres, and the detection limit is 5 mu g / kg. The fluorescent hydrogel microsphere provided by the invention is simple to prepare and mild in synthesis condition, after the fluorescent hydrogel microsphere responds to tetracycline, the hue change is obvious, the change is visible to naked eyes, and the fluorescent hydrogel microsphere has the advantages of simplicity, convenience, rapidness, sensitivity and the like.

The present invention belongs to the technical field of cell biology and molecular biology, and relates to a biological probe for identifying antler polypeptide and a recombinant plasmid thereof. The biological probe is designed and prepared based on the cyclized rearranged fluorescent protein cpFP technology and biological subcloning technology. The probe includes cyclized rearranged Mcherry fluorescent protein and interactive proteins TβRI-R and TβRI-F for identifying antler polypeptide respectively connected at both ends thereof, and constitutes a recombinant plasmid with an expression vector plasmid. After the probe is transfected into living cells, it can be self-expressed in the living cells. When the probe expressed in the cells interacts with the antler polypeptide, the probe shows red fluorescence, which can reflect whether the antler polypeptide enters the cell by dynamically and real-time detecting the presence or absence of the fluorescent signal, thereby realizing visual detection of the antler polypeptide; the probe fusion protein expression can also be realized through a prokaryotic expression system, and then the antler polypeptide is detected by scanning the intensity of the fluorescence emission wavelength, thereby realizing the detection of the antler polypeptide in the liquid.

This invention relates to a fluorescent probe and its application in DNA detection, achieved by simply mixing SiNDs and Ru(bpy)2(dppx). 2+ A method for ratiometric fluorescence detection of DNA in an aqueous phase was established. (Ru(bpy)2(dppx)) 2+ It can specifically and efficiently recognize DNA, and the interaction between the two does not affect Ru(bpy)2(dppx). 2+ The fluorescence of SiNDs was quenched. Based on this, a SiNDs-Ru(bpy)2(dppx) assay for ratiometric fluorescence detection of DNA was constructed. 2+ The probe possesses advantages such as high sensitivity, good selectivity, and strong anti-interference ability, enabling the visual detection of low-concentration DNA and the quantitative detection of target DNA in human serum.

The application relates to the technical field of nucleic acid detection in biochemistry, and provides a novel coronavirus nucleic acid instant detection system based on CRISPR / Cas12a and a method thereof. The system comprises specific constant-temperature amplification primers N-F / R for a novel coronavirus N gene, and a CRISPR / Cas12a reaction system, wherein the CRISPR / Cas12a reaction system comprises specific crRNA for the N gene, CRISPR / Cas12a protein and a single-stranded DNA reporting system. The lateral flow chromatographic test strip detection method of the constant-temperature amplification CRISPR / Cas12a has high specificity and sensitivity, and visual detection can be realized in about 35 minutes; the freeze-dried reagent simplifies the operation process, accelerates the experiment process, gets rid of cold-chain transportation, saves transportation cost, and can realize reaction under the condition of constant temperature of 37 DEG C; the result is simple to judge and can be observed by naked eyes, and is suitable for family nucleic acid self-test.

This invention relates to boron-nitrogen co-doped fluorescent carbon quantum dots, their preparation method, and their application in the fabrication of chromium / copper ion sensors. It belongs to the field of carbon quantum dot technology and includes the following steps: mixing o-phenylenediamine hydrochloride and boric acid to obtain a mixed solution; adding water to the mixed solution and ultrasonically dissolving it to obtain a mixed solution; treating the mixed solution at high temperature to obtain a boron-nitrogen co-doped carbon material solution; filtering the carbon material solution through a 0.22 μm microporous membrane to obtain a boron-nitrogen co-doped carbon quantum dot aqueous solution, and then dialyzing it using a dialysis bag for 36-48 h; freeze-drying the carbon quantum dot aqueous solution to obtain boron-nitrogen co-doped fluorescent carbon quantum dots. This invention achieves pH-controlled chromium / copper ion sensors using a single quantum dot material and a one-step synthesis process. 6+ / Cu 2+ The dual-channel high-sensitivity detection overcomes the technical barriers of limited probe selectivity, complex processes, and limited functionality in existing probes.

This invention discloses the application of a pyrene-containing fluorescent probe in the detection of straight-chain fatty alcohols, belonging to the field of lyochromic organic small molecule fluorescent probe technology. The structural formula of the pyrene-containing fluorescent probe is shown in formula (1): where R is hydrogen or iodine. This pyrene-containing fluorescent probe can produce ratiometric dual fluorescence emission dependent on the carbon chain length of straight-chain fatty alcohols, and has ratiometric response capability to structurally similar straight-chain fatty alcohol homologues such as methanol, ethanol, n-propanol, n-butanol, n-pentanol, and n-hexanol, and can be used in the detection of straight-chain fatty alcohols.

The invention belongs to the technical field of light-emitting functional materials and temperature sensing, and particularly relates to a fluorescent temperature sensing material based on a 3d / 4f complex and a preparation method and application of the fluorescent temperature sensing material. The fluorescent temperature sensing material based on the 3d / 4f complex provided by the invention is prepared by taking a Schiff base ligand H2L, samarium nitrate hexahydrate and anhydrous zinc acetate as reaction raw materials through an evaporative crystallization method; the structural formula of the Schiff base ligand H2L is shown in the specification; the molecular structural formula of the fluorescent temperature sensing material based on the 3d / 4f complex is [ZnLSm (CH3OH) (NO3) 2]. The fluorescent temperature sensing material based on the 3d / 4f complex provided by the invention can keep stable in a wide temperature range, has a linear fluorescence intensity ratio, can realize quantitative detection or visual detection of temperature, is high in detection sensitivity, can provide a technical basis and a research and development direction for development of the temperature sensing material, and has a wide application prospect. And the method has excellent application value and prospect.