Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method for detecting ratio of sodium ions to potassium ions, kit and system

A potassium ion and DNA molecule technology is applied in the field of sodium/potassium ion ratio detection methods, kits and systems, and can solve the problems of complicated operation, no direct determination of sodium/potassium ion ratio, and high price.

Active Publication Date: 2013-04-24
INST OF CHEM CHINESE ACAD OF SCI
View PDF6 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The advantage of the enzymatic method is that no special equipment is required, but the disadvantage is that it is more expensive
[0011] (5) Atomic spectrophotometry can also be used to detect potassium and sodium ions in serum, but the operation is complicated and the error is large, and it is not as simple as flame photometry
So far, there is no direct method for the determination of the sodium / potassium ion ratio

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting ratio of sodium ions to potassium ions, kit and system
  • Method for detecting ratio of sodium ions to potassium ions, kit and system
  • Method for detecting ratio of sodium ions to potassium ions, kit and system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0080] The DNA that can form different G-quadruplex structures in the presence of sodium and potassium ions used in this example is AGGGTTAGGGTTAGGGTTAGGG, and the cyanine dye used is the compound of the following formula

[0081]

[0082] 1) Prepare standard solution samples and test solutions

[0083] A certain amount of DNA was dissolved in Tris-HCl buffer solution with a pH value of 7.2 to prepare a DNA stock solution with a concentration of 100 μmol / L for later use.

[0084] Take 200 μL of methanol solution with a concentration of 200 μmol / L cyanine dye, add 1.5 ml Tris-HCl buffer solution, and then add 250 μL of DNA mother solution and mix well to obtain a mixed solution of DNA and cyanine dye.

[0085] Take 150 μL each of the 13 parts of the above-mentioned DNA and cyanine dye mixed solution, and add 350 μL of sodium / potassium ion ratios of 1 (40mmol / 40mmol), 2 (50mmol / 25mmol), 3 (300mmol) to 10 of the DNA solutions. / 100mmol), 4 (40mmol / 10mmol), 5 (100mmol / 20mmol),...

Embodiment 2

[0094] The DNA that can form different G-quadruplex structures in the presence of sodium and potassium ions used in this example is TGAGGGTGGGGAGGGTGGGGAA, and the cyanine dye used is the compound of the following formula

[0095]

[0096] 1) Prepare standard solution samples and test solutions

[0097] A certain amount of DNA was dissolved in boric acid-borax buffer solution with a pH value of 8.2 to prepare a DNA stock solution with a concentration of 200 μmol / L for later use.

[0098] Take 300 μL of methanol solution with a concentration of 600 μmol / L cyanine dye, add 9.1 ml of boric acid-borax buffer, and then add 300 μL of DNA solution and mix well. Divide the above sample into 10 parts on average, each sample solution is 0.9mL.

[0099] Take 6 samples among them, add 0.1mL sodium / potassium ion ratio respectively 1 (100mmol / 100mmol), 2 (40mmol / 20mmol), 4 (160mmol / 40mmol), 6 (300mmol / 50mmol), 8 (80mmol / 10mmol), 10 (150mmol / 15mmol) solution samples, and 6 standard sol...

Embodiment 3

[0108] The DNA that can form different G-quadruplex structures in the presence of sodium and potassium ions used in this example is GGGCCAGGGAGCGGGGCGGAGGGGG, and the cyanine dye used is the compound of the following formula

[0109]

[0110] 1) Prepare standard solution samples and test solutions

[0111] A certain amount of DNA was dissolved in Tris-HCl buffer solution with a pH value of 7.2 to prepare a DNA stock solution with a concentration of 600 μmol / L for later use.

[0112] Take 300 μL of methanol solution with a concentration of 1.2 mmol / L cyanine dye, add 19.2 ml of Tris-HCl buffer, and then add 300 μL of DNA solution and mix well. Divide the above sample into 10 parts on average, each sample solution is 1.98mL.

[0113] Take 6 samples among them, add 1mL sodium / potassium ion ratio respectively 1 (50mmol / 50mmol), 2 (40mmol / 20mmol), 4 (40mmol / 10mmol), 6 (240mmol / 40mmol), 8 (400mmol / 50mmol), 10 (100mmol / 10mmol) solution samples.

[0114] Add 20 μL of the urine ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for detecting a ratio of sodium ions to potassium ions, a kit and a system. The invention relates to a method for detecting mol ratio of sodium ions to potassium ions in solution, comprising the following steps: (1) preparing a plurality of solution samples according to difference of ratios of sodium ions to potassium ions, wherein each solution sample contains cyanine dye with the same concentration and DNA molecules capable of respectively forming different G-quadruplex structures with the existence of sodium ions and potassium ions; (2) detecting fluorescence intensity level where wavelength is collected; (3) plotting by using the ratio of sodium ions to potassium ions in each solution sample as a horizontal ordinate or a vertical ordinate and using the fluorescence intensity level where wavelength is collected detected in the step (2) as a horizontal ordinate or a vertical ordinate so as to obtain a specification curve of ratios of sodium ions to potassium ions; (4) adding the DNA molecules in a liquid sample to be detected, and adjusting the pH value so as to obtain a test solution; (5) detecting the fluorescence intensity level of the wavelength where the wavelength is collected; and (6) finding out corresponding ratio of sodium ions to potassium ions in the test solution in the specification curve of ratios of sodium ions to potassium ions.

Description

technical field [0001] The invention belongs to the field of biomedicine, and in particular relates to a sodium / potassium ion ratio detection method, a kit and a system. Background technique [0002] Sodium and potassium in the human body are the main cations to maintain the physiological activities of cells, maintain the normal osmotic pressure and acid-base balance of the body, participate in the metabolism of sugar and protein, and ensure the normal function of neuromuscular. index. The levels of sodium and potassium ions in urine and serum can be used clinically to diagnose some kidney and heart diseases. [0003] The level of sodium and potassium ions in the human body is in a balanced state, and changes in its ratio have an important impact on human health. Monitoring the sodium / potassium ratio may be more important for health than the absolute values ​​of the two alone. Clinically, hyperaldosteronism can be diagnosed by measuring the salivary sodium / potassium ratio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N21/64C12N15/11C09B23/06
CPCC09B23/06C09B23/0008G01N21/6428
Inventor 孙红霞唐亚林向俊锋杨千帆管爱娇刘岩
Owner INST OF CHEM CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More