Method for detecting ratio of sodium ions to potassium ions, kit and system
A potassium ion and DNA molecule technology is applied in the field of sodium/potassium ion ratio detection methods, kits and systems, and can solve the problems of complicated operation, no direct determination of sodium/potassium ion ratio, and high price.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0080] The DNA that can form different G-quadruplex structures in the presence of sodium and potassium ions used in this example is AGGGTTAGGGTTAGGGTTAGGG, and the cyanine dye used is the compound of the following formula
[0081]
[0082] 1) Prepare standard solution samples and test solutions
[0083] A certain amount of DNA was dissolved in Tris-HCl buffer solution with a pH value of 7.2 to prepare a DNA stock solution with a concentration of 100 μmol / L for later use.
[0084] Take 200 μL of methanol solution with a concentration of 200 μmol / L cyanine dye, add 1.5 ml Tris-HCl buffer solution, and then add 250 μL of DNA mother solution and mix well to obtain a mixed solution of DNA and cyanine dye.
[0085] Take 150 μL each of the 13 parts of the above-mentioned DNA and cyanine dye mixed solution, and add 350 μL of sodium / potassium ion ratios of 1 (40mmol / 40mmol), 2 (50mmol / 25mmol), 3 (300mmol) to 10 of the DNA solutions. / 100mmol), 4 (40mmol / 10mmol), 5 (100mmol / 20mmol),...
Embodiment 2
[0094] The DNA that can form different G-quadruplex structures in the presence of sodium and potassium ions used in this example is TGAGGGTGGGGAGGGTGGGGAA, and the cyanine dye used is the compound of the following formula
[0095]
[0096] 1) Prepare standard solution samples and test solutions
[0097] A certain amount of DNA was dissolved in boric acid-borax buffer solution with a pH value of 8.2 to prepare a DNA stock solution with a concentration of 200 μmol / L for later use.
[0098] Take 300 μL of methanol solution with a concentration of 600 μmol / L cyanine dye, add 9.1 ml of boric acid-borax buffer, and then add 300 μL of DNA solution and mix well. Divide the above sample into 10 parts on average, each sample solution is 0.9mL.
[0099] Take 6 samples among them, add 0.1mL sodium / potassium ion ratio respectively 1 (100mmol / 100mmol), 2 (40mmol / 20mmol), 4 (160mmol / 40mmol), 6 (300mmol / 50mmol), 8 (80mmol / 10mmol), 10 (150mmol / 15mmol) solution samples, and 6 standard sol...
Embodiment 3
[0108] The DNA that can form different G-quadruplex structures in the presence of sodium and potassium ions used in this example is GGGCCAGGGAGCGGGGCGGAGGGGG, and the cyanine dye used is the compound of the following formula
[0109]
[0110] 1) Prepare standard solution samples and test solutions
[0111] A certain amount of DNA was dissolved in Tris-HCl buffer solution with a pH value of 7.2 to prepare a DNA stock solution with a concentration of 600 μmol / L for later use.
[0112] Take 300 μL of methanol solution with a concentration of 1.2 mmol / L cyanine dye, add 19.2 ml of Tris-HCl buffer, and then add 300 μL of DNA solution and mix well. Divide the above sample into 10 parts on average, each sample solution is 1.98mL.
[0113] Take 6 samples among them, add 1mL sodium / potassium ion ratio respectively 1 (50mmol / 50mmol), 2 (40mmol / 20mmol), 4 (40mmol / 10mmol), 6 (240mmol / 40mmol), 8 (400mmol / 50mmol), 10 (100mmol / 10mmol) solution samples.
[0114] Add 20 μL of the urine ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com