Method for detecting nucleic acid based on exponential hairpin assembly and colorimetry

A technology for exponential card issuing assembly and card issuing, applied in the field of molecular biology, can solve the problems of difficult grass-roots promotion and application, long amplification reaction time, non-specific amplification, etc., and achieves the effects of high sensitivity, good specificity and short reaction time.

Active Publication Date: 2014-05-28
青岛简码基因科技有限公司
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the conventional PCR technology has the following defects: (1) It needs repeated thermal denaturation to untie the DNA double strand, and its application depends on high-quality thermal cyclers; (2) It often causes non-specific amplification; (3) Amplification The response time is long, usually several hours, and it is difficult to promote the application at the grassroots level
In 2013, Liu et al. used the colorimetric properties of gold nanoparticles combined with HCR reaction to realize the enzyme-free colorimetric detection of target DNA, but this method is a linear amplification process, the reaction time is long (1 hour), and the sensitivity is not high.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting nucleic acid based on exponential hairpin assembly and colorimetry
  • Method for detecting nucleic acid based on exponential hairpin assembly and colorimetry
  • Method for detecting nucleic acid based on exponential hairpin assembly and colorimetry

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1: the feasibility of verification method and the correctness of its principle

[0036] In this example, the exponential assembly reaction between the target strand and the four hairpin DNAs can form a large DNA polymer in a relatively short period of time, and the speed and molecular weight of the generated product are much higher than that of the linear assembly reaction. Compare the electrophoresis results to verify the method The feasibility and correctness of the principle.

[0037] The principle of index card issuing assembly experiment is as follows: figure 1 As shown, the target nucleic acid molecule hybridizes with the foothold sequence of the first hairpin DNA, and under the drive of free energy, the first hairpin DNA is opened to expose the sequences that can combine with the second and third hairpin DNA ; This sequence hybridizes with the foothold sequences of the second and third hairpin DNAs respectively, and opens the second and third hairpin ...

Embodiment 2

[0047] Example 2: Rapid detection of target DNA using index hairpin assembly colorimetry

[0048] In this example, different concentrations of target DNA were detected to verify the sensitivity of the nucleic acid detection method stated in the present invention.

[0049] The experimental principle of index hairpin assembly colorimetric rapid detection of target DNA is as follows: figure 2 As shown, the EHA reaction can realize the advantage of exponential signal amplification of DNA and the colorimetric properties of nano-gold to achieve rapid and sensitive detection of target DNA. When the target nucleic acid molecule exists, one end of the target nucleic acid molecule can complementarily pair with the sulfhydryl DNA base modified on the gold nanoparticles, and the other end of the target nucleic acid molecule acts as the initiator chain to initiate the EHA reaction, and the DNA can be rapidly synthesized in a short period of time. Growth, so that the surface of nano-gold ...

Embodiment 3

[0058] Example 3: The specific detection of the target DNA is realized by using the method of colorimetric detection of DNA by index hairpin assembly.

[0059] This embodiment detects that one base is mismatched in the target DNA (mismatched target:

[0060] CACAGACCAGAGCAATCCACAACCTAAACCGTTAGAGCCAAC, ie SEQ ID NO.7), delete a base (deleted target: CACAGACCAGAGCAATCCACAACCAAACC GTTAGAGCCAAC, ie SEQ ID NO.8), add a base (inserted target: CACAGACCAGAGCAATCCACAACCAGAAACCGTTAGAGCCAAC, ie SEQ ID NO.9), for investigation The ability of the method of the invention to distinguish base differences when detecting nucleic acids.

[0061] Reaction conditions:

[0062] Take 75 μL of sulfhydryl DNA (SEQ ID NO.6) modified gold nanoparticles, and add 5 μL to the system respectively to a final concentration of 5×10 -10 M's target DNA T (SEQ ID NO.5), 5 x 10 -10 M mismatched target (SEQ ID NO.7), 5×10 -10 M deleted target (SEQ ID NO.8), 5×10 -10 M inserted target (SEQ ID NO.9), followed b...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for detecting nucleic acid based on exponential hairpin assembly and colorimetry. The method comprises the following steps in sequence: 1) hybridizing target nucleic acid molecules and DNA (deoxyribonucleic acid) on nanogold; 2) initiating four hairpin DNAs to perform self-assembly reaction by the target nucleic acid molecules and generating large DNA polymers; 3) adding salts of divalent cations or monovalent cations into a reaction solution, and performing different degrees of aggregation on the nanogold combined with the target nucleic acid molecules, wherein the color of the nanogold changes from red to blue. According to the method, a system is simple, and the four hairpin DNAs are designed easily; the visual inspection of a target can be realized; the method has high temperature adaptability, high reaction speed, high sensitivity, high specificity and short reaction time, and can be applied to the field of clinical detection, food safety detection, environment monitoring and the like; the detection limit reaches 8.45 pM.

Description

Technical field: [0001] The invention belongs to the field of molecular biology and relates to a new method for rapidly detecting nucleic acid based on index hairpin assembly and colorimetry. Background technique: [0002] Nucleic acid detection has been widely used in clinical diagnosis, environmental monitoring, prevention and control of infectious diseases and many other aspects. Polymerase chain reaction (Polymerase Chain Reaction, PCR) has become the most widely used DNA amplification method due to its high sensitivity. However, the conventional PCR technology has the following defects: (1) It needs repeated thermal denaturation to untie the DNA double strand, and its application depends on high-quality thermal cyclers; (2) It often causes non-specific amplification; (3) Amplification The reaction time is long, usually several hours, and it is difficult to popularize and apply at the grassroots level. Since the early 1990s, many laboratories have attempted to develop ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6816C12Q2525/301C12Q2563/137C12Q2563/155
Inventor石超马翠萍王文硕吴志伟
Owner青岛简码基因科技有限公司