Potassium ion concentration detection kit and system thereof

A technology of potassium ion concentration and kit, which is applied in the field of biomedicine and can solve problems such as complex operation and large errors

Active Publication Date: 2012-10-17
INST OF CHEM CHINESE ACAD OF SCI
View PDF1 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0011] (5) Atomic spectrophotometry can also be used to detect potassium and sodium ions in serum,

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Potassium ion concentration detection kit and system thereof
  • Potassium ion concentration detection kit and system thereof
  • Potassium ion concentration detection kit and system thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0069] The DNA capable of forming a G quadruplex used in this example is AGGGTTAGGGTTAGGGTTAGGG, and the cyanine dye used is a compound of the following formula

[0070]

[0071] 1) Prepare standard solution samples and test solutions

[0072] A certain amount of DNA was dissolved in Tris-HCl buffer solution with a pH value of 6.2 to prepare a DNA stock solution with a concentration of 200 μmol / L for later use.

[0073] Take 300 μL of methanol solution with a concentration of 200 μmol / L cyanine dye, add 19.2 ml of Tris-HCl buffer, and then add 300 μL of DNA solution and mix well. Divide the above sample into 10 parts on average, each sample solution is 1.98mL.

[0074] Take 6 samples among them, add a certain amount of KCl solution with a concentration of 200mmol / L, and then use Tris-HCl buffer solution to make the volume to 2mL, and the concentrations of potassium ions are 0, 0.05, 0.1, 0.25, 0.5, 0.8mmol / L standard solution sample.

[0075] Add 20 μL of the urine sampl...

Embodiment 2

[0084] The DNA capable of forming a G quadruplex used in this example is TGAGGGTGGGGAGGGTGGGGAA DNA, and the cyanine dye used is a compound of the following formula

[0085]

[0086] 1) Prepare standard solution samples and test solutions

[0087] A certain amount of DNA was dissolved in boric acid-borax buffer solution with a pH value of 8.2 to prepare a DNA stock solution with a concentration of 200 μmol / L for later use.

[0088] Take 300 μL of methanol solution with a concentration of 600 μmol / L cyanine dye, add 19.2 ml of boric acid-borax buffer, and then add 300 μL of DNA solution and mix well. Divide the above sample into 10 parts on average, each sample solution is 1.98mL.

[0089] Take 6 samples among them, add a certain amount of KCl solution with a concentration of 200mmol / L respectively, and then use boric acid-borax buffer solution to set the volume to 2mL, and the concentrations of potassium ions are respectively 0, 0.05, 0.1, 0.25, 0.5, 0.8mmol / L standard so...

Embodiment 3

[0098] The DNA capable of forming a G quadruplex used in this example is GGGCCAGGGAGCGGGGCGGAGGGGG, and the cyanine dye used is a compound of the following formula

[0099]

[0100] 1) Prepare standard solution samples and test solutions

[0101] A certain amount of DNA was dissolved in Tris-HCl buffer solution with a pH value of 7.2 to prepare a DNA stock solution with a concentration of 600 μmol / L for later use.

[0102] Take 300 μL of methanol solution with a concentration of 1.2 mmol / L cyanine dye, add 19.2 ml of Tris-HCl buffer, and then add 300 μL of DNA solution and mix well. Divide the above sample into 10 parts on average, each sample solution is 1.98mL.

[0103] Take 6 samples among them, add a certain amount of KCl solution with a concentration of 200mmol / L, and then use Tris-HCl buffer solution to make the volume to 2mL, so that the concentrations of potassium ions are 0, 0.05, 0.1, 0.25, 0.5, 0.8mmol / L standard solution sample.

[0104] Add 20 μL of the urin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a potassium ion concentration detection kit and a system thereof. The kit and the system, which utilize characteristics comprising that potassium ion regulation allows G-quadruplex DNA structure transformation to be formed and cyanine dye supermolecular aggregates identify the G-quadruplex DNA structure transformation, have high specificities, and are not affected by sodium ions in a sample. Reagent components are simple and the reaction process is simple, so errors generated by operations can be effectively reduced, and the test accuracy is high. The kit and the system of the invention allow rapid detection to be realized without special or extra apparatuses, and the detection cost is low, so the popularization and the application of the kit and the system are convenient.

Description

technical field [0001] The invention belongs to the field of biomedicine, and in particular relates to a potassium ion concentration detection kit and system. Background technique [0002] Potassium in the human body is the main cation for maintaining the physiological activities of cells. It is necessary to maintain the normal osmotic pressure and acid-base balance of the body, participate in the metabolism of sugar and protein, and ensure the normal function of neuromuscular. Its content is an important indicator of human physiological activities. The levels of potassium ions in urine and serum can be clinically used to diagnose some kidney and heart diseases. [0003] Under normal circumstances, the potassium ion concentration of the human body has a reasonable reference range, such as in serum: 3.5-5.5mmol / L; in urine: 25-125mmol / 24h. When the potassium ion is higher than the reference value, hyperkalemia is manifested. The main reasons are: acute renal failure, severe ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): G01N21/29G01N21/33G01N21/64
CPCC09B23/06C09B23/0008G01N21/643G01N21/78G01N33/52
Inventor 唐亚林孙红霞杨千帆尚倩姜薇盖伟向俊锋
Owner INST OF CHEM CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap