DNA (Deoxyribose Nucleic Acid) aptamer for detecting grouper iridovirus infection, as well as screening method and application of DNA aptamer

A nucleic acid aptamer, iridescent virus technology, applied in the field of molecular biology, can solve problems such as economic losses, achieve high affinity and specificity, good application prospects, and small molecular weight.

Active Publication Date: 2015-07-22
SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF5 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in recent years, the outbreak and prevalence of iridescent virus in grouper

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DNA (Deoxyribose Nucleic Acid) aptamer for detecting grouper iridovirus infection, as well as screening method and application of DNA aptamer
  • DNA (Deoxyribose Nucleic Acid) aptamer for detecting grouper iridovirus infection, as well as screening method and application of DNA aptamer
  • DNA (Deoxyribose Nucleic Acid) aptamer for detecting grouper iridovirus infection, as well as screening method and application of DNA aptamer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] 1. Synthesize the random single-stranded DNA library and primers shown in the following sequence

[0035] Random library Library50:

[0036] 5'-GACGCTTACTCAGGTGTGACTCG(50N)CGAAGGACGCAGATGAAGTCTC

[0037] 5' primer: 5'-FITC-GACGCTTACTCAGGTGTGACTCG-3';

[0038]5' primer: 5'-TAMRA-GACGCTTACTCAGGTGTGACTCG-3';

[0039] 3' primer: 5'-Biotin-GAGACTTCATCTGCGTCCTTCG-3';

[0040] 2. Cell-SELEX screening to obtain nucleic acid aptamers that specifically recognize SGIV-infected GS cells

[0041] 2.1 Add 10% fetal calf serum to the 1L15 medium to cultivate GS cells until 95% of the bottom of the culture bottle is covered, add grouper iridescent virus (SGIV) to the culture bottle, and grouper iridescent virus infects normal grouper splenocytes GS cells, after continuing to culture for 48h, remove the medium in the culture flask of the cells infected by the virus, and wash the infected GS cells with 15ml PBS;

[0042] 2.2 Dissolve 10nmol of the above random library in 300μl bindi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a DNA (Deoxyribose Nucleic Acid) aptamer for detecting grouper iridovirus infection, as well as a screening method and an application of the DNA aptamer. Two inverse screening steps are introduced in each screening process; first, a single-stranded DNA library of the former screening process is bound with normal cells to remove nonspecific ssDNA (single-stranded DNA) bound with the normal cells of a grouper; then, supernatant is bound with grouper iridovirus infected cells for screening; and ssDNA separated from the grouper iridovirus infected cells is bound with the normal cells for separation to obtain the supernatant. A PCR (Polymerase Chain Reaction) amplification library prepares the single-stranded DNA library. The above screening flow is repeated; compared with the number of the normal cells in the first screening process, the number of the normal cells in the screening process is increased by 2-6 times; compared with binding time of the library and the cells in the first screening process, the binding time of the library and the cells in the subsequent screening process is increased to 1h from 0.5h; and the binding time of the library and the virus infected cells is shortened to 0.5h from 1h to improve the screening efficiency of each process.

Description

Technical field: [0001] The invention belongs to the field of molecular biology, and in particular relates to a DNA nucleic acid aptamer which can be used for detection of grouper iridescent virus (SGIV) infection at the cell level and tissue level, and a screening method and application thereof. Background technique: [0002] Nucleic acid aptamer is a new type of detection and treatment tool screened by exponential enrichment ligand system evolution (SELEX). Ligand system evolution technology with exponential enrichment is a kind of biological library technology for novel detection and treatment that has attracted wide attention. It uses artificially synthesized, capacity of about 10 14 ~10 15 The random oligonucleotide library is combined with the target substance, and the nucleic acid aptamer of the target substance is obtained after multiple rounds of screening. The nucleic acid aptamers screened by this technology have high specificity and high affinity comparable to...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/115C12N15/10C12Q1/70C12R1/93
Inventor 秦启伟李鹏飞魏世娜杨敏周伶俐俞也频
Owner SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap