Methods and compositions for treating ketohexokinase (KHK)-associated diseases

Abstract

The disclosure relates to methods of treating subjects that would benefit from reduction in expression of ketohexokinase (KHK), such as subjects having a KHK-associated disease, disorder, or condition, e.g., type 2 diabetes, using double-stranded ribonucleic acid (dsRNA) compositions targeting the KHK gene. The disclosure also provides methods for preventing at least one symptom in a subject having a KHK-associated disease, disorder, or condition, e.g., type 2 diabetes.

Description

[0001]Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO METHODS AND COMPOSITIONS FOR TREATING KETOHEXOKINASE (KHK)- ASSOCIATED DISEASES RELATED APPLICATIONS The present application claims the benefit of priority to U.S. Provisional Application No. 63 / 608,906, filed on December 12, 2023, and U.S. Provisional Application No.63 / 659,007, filed on June 12, 2024. The entire contents of each of the foregoing applications are incorporated herein by reference. SEQUENCE LISTING The instant application contains a sequence listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on December 6, 2024, is named 121301-23020.xml and is 2,242,580 bytes in size. BACKGROUND OF THE DISCLOSURE Epidemiological studies have shown that a western diet is one of the leading causes of the modern obesity pandemic. Increase in fructose uptake, associated with the use of enriched soft drinks and processed food, is proposed to be a major contributing factor to the epidemic. High fructose corn sweeteners started gaining widespread use in the food industry by 1967. Although glucose and fructose have the same caloric value per molecule, the two sugars are metabolized differently and utilize different GLUT transporters. Fructose is almost exclusively metabolized in the liver, and unlike the glucose metabolism pathway, the fructose metabolism pathway is not regulated by feedback inhibition by the product (Khaitan Z et al., (2013) J. Nutr. Metab. Article ID 682673, 1-12). While hexokinase and phosphofructokinase (PFK) regulate the production of glyceraldehyde-3-P from glucose, fructokinase or ketohexokinase (KHK), which is responsible for phosphorylation of fructose to fructose-1-phosphate in the liver, it is not down regulated by increasing concentrations of fructose-1-phosphate. As a result, all fructose entering the cell is rapidly phosphorylated. (Cirillo P. et al ., (2009) J. Am. Soc. Nephrol.20: 545-553). Continued utilization of ATP to phosphorylate the fructose to fructose-1-phosphate results in intracellular phosphate depletion, ATP depletion, activation of AMP deaminase and formation of uric acid (Khaitan Z. et al., (2013) J. Nutr. Metab. Article ID 682673, 1-12). Increased uric acid further stimulates the up-regulation of KHK (Lanaspa M.A. et al., (2012) PLOS ONE 7(10): 1-11) and causes endothelial cell and adipocyte dysfunction. Fructose-1- phosphate is subsequently converted to glyceraldehyde by the action of aldolase B and is phosphorylated to glyceraldehyde-3-phosphate. The latter proceeds downstream to the glycolysis pathway to form pyruvate, which enters the citric acid cycle, wherefrom, under well-fed conditions, citrate is exported to the cytosol from the mitochondria, providing Acetyl Coenzyme A for lipogenesis. 1 ME151168599v.1 1 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO The phosphorylation of fructose by KHK, and subsequent activation of lipogenesis leads to, for example, fatty liver, hypertriglyceridemia, dyslipidemia, and insulin resistance. Proinflammatory changes in renal proximal tubular cells have also been shown to be induced by KHK activity (Cirillo P. et al., (2009) J. Am. Soc. Nephrol.20: 545-553). The phosphorylation of fructose by KHK is associated with diseases, disorders or conditions such as liver disease (e.g., fatty liver, steatohepatitis), dyslipidemia (e.g., hyperlipidemia, high LDL cholesterol, low HDL cholesterol, hypertriglyceridemia, postprandial hypertriglyceridemia), disorders of glycemic control (e.g., insulin resistance, type 2 diabetes), cardiovascular disease (e.g., hypertension, endothelial cell dysfunction), kidney disease (e.g., acute kidney disorder, tubular dysfunction, proinflammatory changes to the proximal tubules, chronic kidney disease), metabolic syndrome, adipocyte dysfunction, visceral adipose deposition, obesity, hyperuricemia, gout, eating disorders, and excessive sugar craving. In particular, there are unmet needs in type 2 diabetes (T2D) such an an inability to sustain glycemic control with the majority of patients progressing through lines of therapy to insulin, lack of management of associated comorbidities, and patient adherence. Type 2 diabetes is a serious condition with approximately 450 million people afflicted worldwide. Accordingly, there is a need in the art for compositions and methods for treating diseases, disorders, and conditions associated with KHK activity. SUMMARY OF THE DISCLOSURE The present disclosure is based, at least in part, on the discovery that administration, e.g., subcutaneous administration, of an RNAi agent targeting the KHK gene, e.g., AD-1613400, to subjects who would benefit from inhibiting or reducing the expression of a KHK gene, e.g., a subject suffering or prone to suffering from a KHK-associated disease disorder, or condition, such as type 2 diabetes, lowers the levels of KHK mRNA and KHK protein, and lowers the fructose metabolism of these subjects. Accordingly, in one aspect, the present disclosure provides a method of reducing the level of KHK mRNA in a subject. The method includes administering to the subject a therapeutically effective amount, e.g., a fixed dose of about 25 mg to about 1200 mg, of a dsRNA agent, or a pharmaceutically acceptable salt thereof, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’- GCAGGAAGCACUGAGAUUCGU -3’ of SEQ ID NO:18 and the antisense strand comprises the nucleotide sequence 5’- ACGAAUCUCAGTGCUUCCUGCAC -3’ of SEQ ID NO:20, thereby reducing the level of KHK mRNA in the subject. In some embodiments, the subject suffers from a KHK-associated disease, disorder, or condition. Further in some embodiments, the subjectsuffers from at least one condition chosen from a liver disease (e.g., fatty liver, steatohepatitis, non-alcoholic steatohepatitis (NASH)), dyslipidemia (e.g., hyperlipidemia, high LDL cholesterol, low HDL cholesterol, hypertriglyceridemia, postprandial hypertriglyceridemia), disorders of glycemic 2 ME151168599v.1 2 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO control (e.g., insulin resistance, type 2 diabetes), cardiovascular disease (e.g., hypertension, endothelial cell dysfunction), kidney disease (e.g., acute kidney disorder, tubular dysfunction, proinflammatory changes to the proximal tubules, chronic kidney disease), metabolic syndrome, adipocyte dysfunction, visceral adipose deposition, obesity, hyperuricemia, gout, eating disorders, and excessive sugar craving. In another aspect, the present disclosure provides a method of treating a subject suffering from a KHK-associated disease, disorder, or condition, e.g., type 2 diabetes. The method includes administering to the subject a therapeutically effective amount, e.g., a fixed dose of about 25 mg to about 1200 mg, of a dsRNA agent, or a pharmaceutically acceptable salt thereof, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’- GCAGGAAGCACUGAGAUUCGU -3’ of SEQ ID NO:18 and the antisense strand comprises the nucleotide sequence 5’- ACGAAUCUCAGTGCUUCCUGCAC -3’ of SEQ ID NO:20, thereby treating the subject suffering from a KHK-associated disease, disorder, or condition, e.g., type 2 diabetes. In one embodiment, KHK mRNA level in the subject is reduced to at least about 70%, 65%, 60%, 55%, or 50% of baseline level after 3 months of treatment, and / or after 6 months of treatment. In another aspect, the present disclosure provides a method of preventing at least one symptom in a subject having a disease, disorder or condition that would benefit from reduction in expression of a KHK gene, e.g., type 2 diabetes. The method includes administering to the subject a prophylactically effective amount, e.g., a fixed dose of about 25 mg to about 1200 mg, of a dsRNA agent, or a pharmaceutically acceptable salt thereof, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’- GCAGGAAGCACUGAGAUUCGU -3’ of SEQ ID NO:18 and the antisense strand comprises the nucleotide sequence 5’- ACGAAUCUCAGTGCUUCCUGCAC -3’ of SEQ ID NO:20, thereby preventing at least one symptom in a subject having a disease, disorder or condition that would benefit from reduction in expression of a KHK gene, e.g., type 2 diabetes. In another aspect, the present disclosure provides a method of reducing fructose metabolism in a subject having a disease, disorder or condition that would benefit from reduction in expression of a KHK gene, e.g., type 2 diabetes. The method includes administering to the subject a therapeutically effective amount, e.g., a fixed dose of about 25 mg to about 1200 mg, of a dsRNA agent, or a pharmaceutically acceptable salt thereof, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’- GCAGGAAGCACUGAGAUUCGU -3’ of SEQ ID NO:18 and the antisense strand comprises the nucleotide sequence 5’- ACGAAUCUCAGTGCUUCCUGCAC -3’ of SEQ ID NO:20, thereby reducing fructose metabolism in the subject having a disease, disorder or condition that would benefit from reduction in expression of a KHK gene, e.g., type 2 diabetes. In another aspect, the present disclosure provides a method of improving insulin sensitivity in a subject having a disease, disorder or condition that would benefit from reduction in expression of a 3 ME151168599v.1 3 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO KHK gene, e.g., type 2 diabetes. The method includes administering to the subject a therapeutically effective amount, e.g., a fixed dose of about 25 mg to about 1200 mg, of a dsRNA agent, or a pharmaceutically acceptable salt thereof, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’- GCAGGAAGCACUGAGAUUCGU -3’ of SEQ ID NO:18 and the antisense strand comprises the nucleotide sequence 5’- ACGAAUCUCAGTGCUUCCUGCAC -3’ of SEQ ID NO:20, thereby improving insulin sensitivity in the subject having a disease, disorder or condition that would benefit from reduction in expression of a KHK gene, e.g., type 2 diabetes. In another aspect, the present disclosure provides a method of reducing fatty acid synthesis in a subject having a disease, disorder or condition that would benefit from reduction in expression of a KHK gene, e.g., type 2 diabetes. The method includes administering to the subject a therapeutically effective amount, e.g., a fixed dose of about 25 mg to about 1200 mg, of a dsRNA agent, or a pharmaceutically acceptable salt thereof, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’- GCAGGAAGCACUGAGAUUCGU -3’ of SEQ ID NO:18 and the antisense strand comprises the nucleotide sequence 5’- ACGAAUCUCAGTGCUUCCUGCAC -3’ of SEQ ID NO:20, thereby reducing fatty acid synthesis in the subject having a disease, disorder or condition that would benefit from reduction in expression of a KHK gene, e.g., type 2 diabetes. In one embodiment, the administration of the dsRNA agent, or a pharmaceutically acceptable salt thereof, to the subject causes a decrease in KHK enzymatic activity, and / or a decrease in KHK protein accumulation in the subject. In one embodiment, the administration of the dsRNA agent, or a pharmaceutically acceptable salt thereof, to the subject causes a decrease in fibroblast growth factor 21 (FGF21) level, e.g., serum and / or urine FGF21 levels, and / or an increase in fructose level, e.g., serum and / or urine fructose levels, in the subject. In certain embodiments, the administration of the dsRNA, or a pharmaceutically acceptable salt thereof, to the subject causes a decrease in fructose metabolism. In certain embodiments, the administration of the dsRNA, or a pharmaceutically acceptable salt thereof, causes a decrease in the level of KHK in the subject, especially hepatic KHK, especially KHK-C in a subject with elevated KHK. In certain embodiments, the administration of the dsRNA, or a pharmaceutically acceptable salt thereof, to the subject causes an improved insulin sensitivity and / or glymeric control in a subject having type 2 diabetes. In certain embodiments, the administration of the dsRNA, or a pharmaceutically acceptable salt thereof, causes a normalization of serum lipids, e.g., triglycerides including postprandial triglycerides, LDL, HDL, or cholesterol, in a subject with at least one abnormal serum lipid level. In certain embodiments, the administration of the dsRNA, or a pharmaceutically acceptable salt thereof, causes a normalization of lipid deposition, e.g., a decrease of lipid deposition in the liver (e.g., decrease of NAFLD or NASH), a decrease of visceral fat deposition, a decrease in body weight. In certain embodiments, the administration of the dsRNA, or a 4 ME151168599v.1 4 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO pharmaceutically acceptable salt thereof, causes a normalization of insulin or glucose response in a subject with abnormal insulin response not related to an immune response to insulin, or abnormal glucose response. In certain embodiments, the administration of the dsRNA, or a pharmaceutically acceptable salt thereof, causes a decrease in the level of uric acid, e.g., serum uric acid, in a subject with elevated serum uric acid, e.g., elevated serum uric acid associated with gout. In certain embodiments, the administration of the dsRNA, or a pharmaceutically acceptable salt thereof, results in an improvement of kidney function, or a stoppage or reduction of the rate of loss of kidney function. In certain embodiments, the dsRNA, or a pharmaceutically acceptable salt thereof, causes a reduction of hypertension, i.e., elevated blood pressure. In certain embodiments, the KHK-associated disorder is a liver disease, e.g., fatty liver disease (also called heptatic steatosis) such as NAFLD or NASH. In certain embodiments, the KHK- associated disorder is dyslipidemia, e.g., elevated serum triglycerides, elevated serum LDL, elevated serum cholesterol, lowered serum HDL, postprandial hypertriglyceridemia. In another embodiment, the KHK-associated disorder is a disorder of glycemic control, e.g., insulin resistance not resulting from an immune response against insulin, glucose resistance, type 2 diabetes. In certain embodiments, the KHK-associated disorder is a cardiovascular disease, e.g., hypertension, endothelial cell dysfunction. In certain embodiments, the KHK-associated disorder is a kidney disease, e.g., acute kidney disorder, tubular dysfunction, proinflammatory changes to the proximal tubules, chronic kidney disease. In certain embodiments, the disease is metabolic syndrome. In certain embodiments, the KHK-associated disorder is a disease of lipid deposition or dysfunction, e.g., visceral adipose deposition, fatty liver, obesity. In certain embodiments, the KHK-associated disorder is a disease of elevated uric acid, e.g., gout, hyperuricemia. In certain embodiments the KHK-associated disorder is an eating disorder such as excessive sugar craving. In one embodiment, the KHK-associated disorder is type 2 diabetes. In one embodiment, the subject is a human subject. In some embodiments, the subject is overweight to obese. In one embodiment, the subject is an overweight human. In one embodiment, the subject is an obese human. In one embodiment, the subject is an overweight healthy human. In one embodiment, the subject is an obese healthy human. In some embodiments, the dsRNA agent comprises at least one nucleotide modification. In some embodiments, substantially all of the nucleotides of the sense strand comprise a nucleotide modification. In some embodiments, substantially all of the nucleotides of the antisense strand comprise a nucleotide modification. In some embodiments, substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand comprise a nucleotide modification. 5 ME151168599v.1 5 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO In some embodiments, at least one of the nucleotide modifications is selected from the group consisting of a deoxy-nucleotide modification, a 2'-O-methyl nucleotide modification, and a 2'-fluoro nucleotide modification. In some embodiments, the nucleotide modifications are selected from the group consisting of a deoxy-nucleotide modification, a 2'-O-methyl nucleotide modification, and a 2'-fluoro nucleotide modification. In some embodiments, each strand of the dsRNA agent is no more than 30 nucleotides in length. In some embodiments, each strand of the dsRNA agent is independently 19-30 nucleotides in length. In some embodiments, each strand of the dsRNA agent is independently 19-25 nucleotides in length. In some embodiments, each strand is of the dsRNA agent independently 21-23 nucleotides in length. In some embodiments, at least one strand of the dsRNA agent comprises a 3’ overhang of at least 1 nucleotide. In some embodiments, at least one strand of the dsRNA agent comprises a 3’ overhang of at least 2 nucleotides. In some embodiments, the dsRNA agent further comprises a ligand. In some embodiments, the ligand is conjugated to the 3’ end of the sense strand of the dsRNA agent. In some embodiments, the ligand is an N-acetylgalactosamine (GalNAc) derivative. In some the is In some embodiments, the dsRNA agent is conjugated to the ligand as shown in the following schematic 6 ME151168599v.1 6 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO and, wherein X is O or S. In some embodiments, X is O. In some embodiments, the sense strand comprises the nucleotide sequence 5’- gscsaggaagCfAfCfugagauucgu-3’ of SEQ ID NO:17 and the antisense strand comprises the nucleotide sequence 5’- asdCsgadAudCucagdTgCfuuccugcsasc -3’ of SEQ ID NO:19, wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U; Cf and Uf are 2′-deoxy-2’-fluoro (2’-F) C and U; dC, dA, and dT are 2′-deoxy C, A, and T; and s is a phosphorothioate linkage. In some embodiments, the dsRNA agent is conjugated to the ligand as shown in the following schematic In one aspect, the present disclosure provides a method of treating a subject suffering from a disease, disorder or condition that would benefit from reduction in expression of a KHK gene, e.g., type 2 diabetes, the method comprising administering to the subject a fixed dose of about 25 mg to about 1200 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, targeting a KHK gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’- gscsaggaagCfAfCfugagauucgu-3’ of SEQ ID NO:17 and the antisense strand comprises the nucleotide sequence 5’- asdCsgadAudCucagdTgCfuuccugcsasc -3’ of SEQ ID NO:19, wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U; Cf and Uf are 2′-deoxy-2’-fluoro (2’-F) C and U; dC, dA, and dT are 2′-deoxy C, A, and T; and s is a phosphorothioate linkage; and wherein a ligand is conjugated to the 3’ end of the sense strand as shown in the following schematic 7 ME151168599v.1 7 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO wherein X is O, thereby treating the subject suffering from type 2 diabetes. In one aspect, the present disclosure provides a method of preventing at least one symptom in a subject having a disease, disorder or condition that would benefit from reduction in expression of a KHK gene, e.g., type 2 diabetes, the method comprising administering to the subject a fixed dose of about 25 mg to about 1200 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, targeting a KHK gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’- gscsaggaagCfAfCfugagauucgu-3’ of SEQ ID NO:17 and the antisense strand comprises the nucleotide sequence 5’- asdCsgadAudCucagdTgCfuuccugcsasc -3’ of SEQ ID NO:19, wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U; Cf and Uf are 2′- deoxy-2’-fluoro (2’-F) C and U; dC, dA, and dT are 2′-deoxy C, A, and T; and s is a phosphorothioate linkage; and wherein a ligand is conjugated to the 3’ end of the sense strand as shown in the following wherein X is O, thereby preventing at least one symptom in the subject having type 2 diabetes. In one aspect, the present disclosure provides a method of reducing fructose metabolism in a subject having a disease, disorder or condition that would benefit from reduction in expression of a KHK gene, e.g., type 2 diabetes, the method comprising administering to the subject a fixed dose of 8 ME151168599v.1 8 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO about 25 mg to about 1200 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, targeting a KHK gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’- gscsaggaagCfAfCfugagauucgu-3’ of SEQ ID NO:17 and the antisense strand comprises the nucleotide sequence 5’- asdCsgadAudCucagdTgCfuuccugcsasc -3’ of SEQ ID NO:19, wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U; Cf and Uf are 2′- deoxy-2’-fluoro (2’-F) C and U; dC, dA, and dT are 2′-deoxy C, A, and T; and s is a phosphorothioate linkage; and wherein a ligand is conjugated to the 3’ end of the sense strand as shown in the following wherein X is O, thereby reducing fructose metabolism in the subject having type 2 diabetes. In one aspect, the present disclosure provides a method of reducing fatty acid synthesis in a subject having a disease, disorder or condition that would benefit from reduction in expression of a KHK gene, e.g., type 2 diabetes, the method comprising administering to the subject a fixed dose of about 25 mg to about 1200 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, targeting a KHK gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’- gscsaggaagCfAfCfugagauucgu-3’ of SEQ ID NO:17 and the antisense strand comprises the nucleotide sequence 5’- asdCsgadAudCucagdTgCfuuccugcsasc -3’ of SEQ ID NO:19, wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U; Cf and Uf are 2′- deoxy-2’-fluoro (2’-F) C and U; dC, dA, and dT are 2′-deoxy C, A, and T; and s is a phosphorothioate linkage; and wherein a ligand is conjugated to the 3’ end of the sense strand as shown in the following schematic 9 ME151168599v.1 9 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO wherein X is O, thereby reducing fatty acid synthesis in the subject having type 2 diabetes. In one aspect, the present disclosure provides a method of improving insulin sensitivity in a subject having a disease, disorder or condition that would benefit from reduction in expression of a KHK gene, e.g., type 2 diabetes, the method comprising administering to the subject a fixed dose of about 25 mg to about 1200 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, targeting a KHK gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’- gscsaggaagCfAfCfugagauucgu-3’ of SEQ ID NO:17 and the antisense strand comprises the nucleotide sequence 5’- asdCsgadAudCucagdTgCfuuccugcsasc -3’ of SEQ ID NO:19, wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U; Cf and Uf are 2′- deoxy-2’-fluoro (2’-F) C and U; dC, dA, and dT are 2′-deoxy C, A, and T; and s is a phosphorothioate linkage; and wherein a ligand is conjugated to the 3’ end of the sense strand as shown in the following wherein X is O, thereby improving insulin sensitivity in the subject having type 2 diabetes. In one embodiment, the methods of the disclosure further include administering an additional therapeutic to the subject. 10 ME151168599v.1 10 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO In one embodiment, the methods of the disclosure further comprise measuring the fructose level, e.g., the serum and / or urine fructose level, in the subject. In one embodiment, the methods of the disclosure further comprise measuring the FGF21 level, e.g., the serum and / or urine FGF21 level, in the subject. In one embodiment, the methods of the disclosure further comprise measuring a lipid level, e.g., the serum and / or urine lipid level, in a subject. In certain embodiments, the methods of the disclosure further include measuring the level of Hemoglobin A1C (HbA1c) in a subject. In certain embodiments, the methods of the disclosure further include measuring insulin or glucose sensitivity in a subject. In certain embodiments, the methods of the disclosure further include measuring liver fat in a subject, e.g., by assessing changes in liver magnetic resonance imaging (MRI). In one embodiment, the methods of the disclosure further comprise measuring the uric acid level, e.g., the serum and / or urine uric acid level, in the subject. In certain embodiments, a decrease in the levels of expression or activity of fructose metabolism indicates that the KHK-associated disease is being treated or prevented. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 25 mg, about 75 mg, about 100 mg, about 150 mg, about 200 mg, about 300 mg, about 400 mg, about 450 mg, about 500 mg, about 600 mg, about 700 mg, about 800 mg, about 900 mg, about 1000 mg, about 1100 mg, or about 1200 mg. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 550-650 mg. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 600 mg. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject every month, every 2 months, every 3 months, every 4 months, every 5 months, every 6 months, or every 12 months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 25 mg every three months. In some embodiments, thedsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a doseof about 75 mg every three months. In some embodiments, the dsRNA agent, or a pharmaceuticallyacceptable salt thereof, is administered to the subject at a dose of about 150 mg every three months. Insome embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administeredto the subject at a dose of about 300 mg every three months. In some embodiments, the dsRNA agent,or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 600 mgevery three months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable saltthereof, is administered to the subject at a dose of about 450 mg every three months. In someembodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to thesubject at a dose of about 1200 mg every three months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 25 mg every six months. In some embodiments, thedsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose11 ME151168599v.1 11 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WOof about 75 mg every six months. In some embodiments, the dsRNA agent, or a pharmaceuticallyacceptable salt thereof, is administered to the subject at a dose of about 150 mg every six months. Insome embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administeredto the subject at a dose of about 300 mg every six months. In some embodiments, the dsRNA agent,or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 600 mgevery six months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable saltthereof, is administered to the subject at a dose of about 450 mg every six months. In someembodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to thesubject at a dose of about 1200 mg every six months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject intravenously, intramuscularly, or subcutaneously. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered subcutaneously to the subject at a dose of about 25 mg every three months. In someembodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administeredsubcutaneously to the subject at a dose of about 75 mg every three months. In some embodiments, thedsRNA agent, or a pharmaceutically acceptable salt thereof, is administered subcutaneously to thesubject at a dose of about 150 mg every three months. In some embodiments, the dsRNA agent, or apharmaceutically acceptable salt thereof, is administered subcutaneously to the subject at a dose ofabout 300 mg every three months. In some embodiments, the dsRNA agent, or a pharmaceuticallyacceptable salt thereof, is administered subcutaneously to the subject at a dose of about 600 mg everythree months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof,is administered subcutaneously to the subject at a dose of about 450 mg every three months. In someembodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administeredsubcutaneously to the subject at a dose of about 1200 mg every three months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered subcutaneously to the subject at a dose of about 25 mg every six months. In someembodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administeredsubcutaneously to the subject at a dose of about 75 mg every six months. In some embodiments, thedsRNA agent, or a pharmaceutically acceptable salt thereof, is administered subcutaneously to thesubject at a dose of about 150 mg every six months. In some embodiments, the dsRNA agent, or apharmaceutically acceptable salt thereof, is administered subcutaneously to the subject at a dose ofabout 300 mg every six months. In some embodiments, the dsRNA agent, or a pharmaceuticallyacceptable salt thereof, is administered subcutaneously to the subject at a dose of about 600 mg everysix months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered subcutaneously to the subject at a dose of about 450 mg every six months. In someembodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administeredsubcutaneously to the subject at a dose of about 1200 mg every six months. 12 ME151168599v.1 12 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO In another aspect, the present disclosure provides a kit for performing the methods as described herein, comprising a) the dsRNA agent, or a pharmaceutically acceptable salt thereof, and b) instructions for use, and c) optionally, means for administering the dsRNA agent, or a pharmaceutically acceptable salt thereof, to the subject. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 schematically depicts KHK-mediated fructose metabolism. Figure 2 schematically depicts the Phase 1 study design, Part A, of ALN-KHK in healthy overweight to obese subjects. Dose 1: 25 mg; Dose 2: 75 mg; Dose 3: 150 mg; Dose 4: 300 mg; and Dose 5: 600 mg. The primary and select secondary endpoints are shown. Figure 3 schematically depicts the study design, Part B, of ALN-KHK in obese subjects with type 2 diabetes. Figure 4 graphically depicts the mean (SE) AUC serum fructose results after fructose tolerance test performed at the indicated time points in subjects administered with placebo or ALN- KHK at a dose of 25 mg, 75 mg, 150 mg, 300 mg, or 600 mg. Figure 5 schematically depicts the salt form of AD-1613400. Figure 6 is a graph showing mean serum fructose after fructose tolerance test (FTT) at the indicated time points in subjects administered with placebo or ALN-KHK at a dose of 25 mg, 75 mg, 150 mg, 300 mg, or 600 mg. Figure 7 is a graph showing the change from Time 0 in urinary fructose in response to FTT at the indicated time points in subjects administered with placebo or ALN-KHK at a dose of 25 mg, 75 mg, 150 mg, 300 mg, or 600 mg. Figure 8 is a graph showing the mean absolute change from baseline in serum FGF21 after FTT at the indicated time points in subjects admininstered with placebo or ALN-KHK at a dose of 25 mg, 75 mg, 150 mg, 300 mg, or 600 mg. Figure 9 is a graph showing FGF21-positive incremental AUC in response to FTT over time in subjects admininstered with placebo or ALN-KHK at a dose of 25 mg, 75 mg, 150 mg, 300 mg, or 600 mg. DETAILED DESCRIPTION OF THE DISCLOSURE The present disclosure is based, at least in part, on the discovery that administration, e.g., subcutaneous administration, of an RNAi agent targeting the KHK gene, e.g., AD-1613400, to subjects who would benefit from inhibiting or reducing the expression of a KHK gene, e.g., a subject suffering or prone to suffering from a KHK-associated disease disorder, or condition, such as type 2 diabetes, lowers the levels of KHK mRNA and KHK protein, and lowers the fructose metabolism in the subject. The present disclosure provides iRNA compositions, which effect the RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts of a KHK gene. The KHK gene may be 13 ME151168599v.1 13 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WOwithin a cell, e.g., a cell within a subject, such as a human. The present disclosure also providesmethods of using the iRNA compositions of the disclosure for inhibiting the expression of a KHK gene, and for treating a subject who would benefit from inhibiting or reducing the expression of a KHK gene, e.g., a subject suffering or prone to suffering from a KHK-associated disease disorder, or condition, such as a subject suffering or prone to suffering from type 2 diabetes. The following detailed description discloses how to make and use compositions containing iRNAs to inhibit the expression of a KHK gene, as well as compositions and methods for treating subjects having diseases and disorders that would benefit from inhibition and / or reduction of the expression of this gene.I. DefinitionsIn order that the present disclosure may be more readily understood, certain terms are first defined. In addition, it should be noted that whenever a value or range of values of a parameter are recited, it is intended that values and ranges intermediate to the recited values are also intended to be part of this disclosure. The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element, e.g., a plurality of elements. The term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to". The term "or" is used herein to mean, and is used interchangeably with, the term "and / or," unless context clearly indicates otherwise. The term “about” is used herein to mean within the typical ranges of tolerances in the art. For example, “about” can be understood as about 2 standard deviations from the mean. In certain embodiments, about means +10%. In certain embodiments, about means +5%. When about is present before a series of numbers or a range, it is understood that “about” can modify each of the numbers in the series or range. As used herein, “ketohexokinase,” used interchangeably with the term “KHK,” refers to the naturally occurring gene that encodes an enzyme that catalyzes conversion of fructose to fructose-1- phosphate. The product of this gene is the first enzyme in the pathway that catabolizes dietary fructose. Alternatively spliced transcript variants encoding different isoforms have been identified. The gene is also known as fructokinase. Exemplary nucleotide and amino acid sequences of KHK can be found, for example, at GenBank Accession No. XM_017004061.1 (Homo sapiens KHK; SEQ ID NO:1; reverse complement, SEQ ID NO:2); NM_006488.3 (Homo sapiens KHK; SEQ ID NO:3; reverse complement, SEQ ID NO:4); NM_000221.3 (Homo sapiens KHK; SEQ ID NO:5; reverse complement, SEQ ID NO:6); GenBank Accession No. NM_001310524.1 (Mus musculus KHK; SEQ ID NO:7; reverse complement, SEQ ID NO:8); GenBank Accession No. NM_031855.3 (Rattus 14 ME151168599v.1 14 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO norvegicus KHK; SEQ ID NO:9; reverse complement, SEQ ID NO:10); GenBank Accession No. XM_005576322.2 (Macaca fascicularis KHK, SEQ ID NO:11; reverse complement, SEQ ID NO:12). The KHK (Ketohexokinase) gene is located on chromosome 2p23 and encodes ketohexokinase, also known as fructokinase. KHK is a phosphotransferase enzyme with an alcohol as the phosphate acceptor. KHK belongs to the ribokinase family of carbohydrate kinases (Trinh et al ., ACTA Cryst., D65: 201-211). Two isoforms of ketohexokinase have been identified, KHK-A and KHK-C, that result from alternative splicing of the full length mRNA. These isoforms differ by inclusion of either exon 3a or 3c, and differ by 32 amino acids between positions 72 and 115. KHK-C mRNA is expressed at high levels, predominantly in the liver, kidney and small intestine. KHK-C has a much lower Km for fructose binding than KHK-A, and as a result, is highly effective in phosphorylating dietary fructose. The sequence of a human KHK-C mRNA transcript may be found at, for example, GenBank Accession No. NM_006488.3 (Homo sapiens KHK; SEQ ID NO:3). The sequence of a human KHK-A mRNA transcript may be found at, for example GenBank Accession No. NM_000221.3; SEQ ID NO:5). The sequence of full-length human KHK mRNA is provided in GenBank Accession No. GI: XM_017004061.1 (SEQ ID NO:1). The iRNA agents provided herein can be capable of silencing one or both KHK isoforms. Additional examples of KHK mRNA sequences are readily available through publicly available databases, e.g., GenBank, UniProt, OMIM, and the Macaca genome project web site. Further information on KHK can be found, for example, at www.ncbi.nlm.nih.gov / gene / ?term=khk. The entire contents of each of the foregoing GenBank Accession numbers and the Gene database numbers are incorporated herein by reference as of the date of filing this application. The term KHK, as used herein, also refers to variations of the KHK gene including variants provided in the SNP database. Numerous seuqnce variations within the KHK gene have been identified and may be found at, for example, NCBI dbSNP and UniProt (see, e.g., www.ncbi.nlm.nih.gov / snp / ?term=KHK, the entire contents of which is incorporated herein by reference as of the date of filing this application. As used herein, “target sequence” refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a KHK gene, including mRNA that is a product of RNA processing of a primary transcription product. In one embodment, the target portion of the sequence will be at least long enough to serve as a substrate for iRNA-directed cleavage at or near that portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a KHK gene. The target sequence of a KHK gene may be from about 9-36 nucleotides in length, e.g., about 15-30 nucleotides in length. For example, the target sequence can be from about 15-30 nucleotides, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18- 29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 15 ME151168599v.1 15 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20- 22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the disclosure. As used herein, the term “strand comprising a sequence” refers to an oligonucleotide comprising a chain of nucleotides that is described by the sequence referred to using the standard nucleotide nomenclature. “G,” “C,” “A,” “T” and “U” each generally stand for a nucleotide that contains guanine, cytosine, adenine, thymidine and uracil as a base, respectively. However, it will be understood that the term “ribonucleotide” or “nucleotide” can also refer to a modified nucleotide, as further detailed below, or a surrogate replacement moiety (see, e.g., Table 1). The skilled person is well aware that guanine, cytosine, adenine, and uracil can be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety. For example, without limitation, a nucleotide comprising inosine as its base can base pair with nucleotides containing adenine, cytosine, or uracil. Hence, nucleotides containing uracil, guanine, or adenine can be replaced in the nucleotide sequences of dsRNA featured in the disclosure by a nucleotide containing, for example, inosine. In another example, adenine and cytosine anywhere in the oligonucleotide can be replaced with guanine and uracil, respectively to form G-U Wobble base pairing with the target mRNA. Sequences containing such replacement moieties are suitable for the compositions and methods featured in the disclosure. The terms “iRNA”, “RNAi agent,” “iRNA agent,”, “RNA interference agent” as used interchangeably herein, refer to an agent that contains RNA as that term is defined herein, and which mediates the targeted cleavage of an RNA transcript via an RNA-induced silencing complex (RISC) pathway. iRNA directs the sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). The iRNA modulates, e.g., inhibits, the expression of KHK gene in a cell, e.g., a cell within a subject, such as a mammalian subject. In one embodiment, an RNAi agent of the disclosure includes a single stranded RNA that interacts with a target RNA sequence, e.g., a KHK target mRNA sequence, to direct the cleavage of the target RNA. Without wishing to be bound by theory it is believed that long double stranded RNA introduced into cells is broken down into siRNA by a Type III endonuclease known as Dicer (Sharp et al. (2001) Genes Dev.15:485). Dicer, a ribonuclease-III-like enzyme, processes the dsRNA into 19- 23 base pair short interfering RNAs with characteristic two base 3' overhangs (Bernstein, et al., (2001) Nature 409:363). The siRNAs are then incorporated into an RNA-induced silencing complex (RISC) where one or more helicases unwind the siRNA duplex, enabling the complementary antisense strand to guide target recognition (Nykanen, et al., (2001) Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases within the RISC cleave the target to induce silencing (Elbashir, et al., (2001) Genes Dev.15:188). Thus, in one aspect the disclosure relates to a single stranded RNA (sssiRNA) generated within a cell and which promotes the formation of a RISC 16 ME151168599v.1 16 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO complex to effect silencing of the target gene, i.e., a KHK gene. Accordingly, the term “siRNA” is also used herein to refer to an RNAi as described above. In another embodiment, the RNAi agent may be a single-stranded RNAi agent that is introduced into a cell or organism to inhibit a target mRNA. Single-stranded RNAi agents (ssRNAi) bind to the RISC endonuclease, Argonaute 2, which then cleaves the target mRNA. The single- stranded siRNAs are generally 15-30 nucleotides and are chemically modified. The design and testing of single-stranded RNAi agents are described in U.S. Patent No.8,101,348 and in Lima et al., (2012) Cell 150: 883-894, the entire contents of each of which are hereby incorporated herein by reference. Any of the antisense nucleotide sequences described herein may be used as a single- stranded siRNA as described herein or as chemically modified by the methods described in Lima et al., (2012) Cell 150;:883-894. In another embodiment, an “iRNA” for use in the compositions and methods of the disclosure is a double-stranded RNA and is referred to herein as a “double stranded RNAi agent,” “double- stranded RNA (dsRNA) molecule,” “dsRNA agent,” or “dsRNA”. The term “dsRNA”, refers to a complex of ribonucleic acid molecules, having a duplex structure comprising two anti-parallel and substantially complementary nucleic acid strands, referred to as having “sense” and “antisense” orientations with respect to a target RNA, i.e., a KHK gene. In some embodiments of the disclosure, a double-stranded RNA (dsRNA) triggers the degradation of a target RNA, e.g., an mRNA, through a post-transcriptional gene-silencing mechanism referred to herein as RNA interference or RNAi. In general, the majority of nucleotides of each strand of a dsRNA molecule are ribonucleotides, but as described in detail herein, each or both strands can also include one or more non-ribonucleotides, e.g., a deoxyribonucleotide and / or a modified nucleotide. In addition, as used in this specification, an “RNAi agent” may include ribonucleotides with chemical modifications; an RNAi agent may include substantial modifications at multiple nucleotides. As used herein, the term “modified nucleotide” refers to a nucleotide having, independently, a modified sugar moiety, a modified internucleotide linkage, and / or a modified nucleobase. Thus, the term modified nucleotide encompasses substitutions, additions or removal of, e.g., a functional group or atom, to internucleoside linkages, sugar moieties, or nucleobases. The modifications suitable for use in the agents of the disclosure include all types of modifications disclosed herein or known in the art. Any such modifications, as used in a siRNA type molecule, are encompassed by “RNAi agent” for the purposes of this specification and claims. The duplex region may be of any length that permits specific degradation of a desired target RNA through a RISC pathway, and may range from about 9 to 36 base pairs in length, e.g., about 15- 30 base pairs in length, for example, about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs in length, such as about 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18- 27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21- 17 ME151168599v.1 17 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO 30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the disclosure. The two strands forming the duplex structure may be different portions of one larger RNA molecule, or they may be separate RNA molecules. Where the two strands are part of one larger molecule, and therefore are connected by an uninterrupted chain of nucleotides between the 3’-end of one strand and the 5’-end of the respective other strand forming the duplex structure, the connecting RNA chain is referred to as a “hairpin loop.” A hairpin loop can comprise at least one unpaired nucleotide. In some embodiments, the hairpin loop can comprise at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 23 or more unpaired nucleotides. Where the two substantially complementary strands of a dsRNA are comprised by separate RNA molecules, those molecules need not, but can be covalently connected. Where the two strands are connected covalently by means other than an uninterrupted chain of nucleotides between the 3’- end of one strand and the 5’-end of the respective other strand forming the duplex structure, the connecting structure is referred to as a “linker.” The RNA strands may have the same or a different number of nucleotides. The maximum number of base pairs is the number of nucleotides in the shortest strand of the dsRNA minus any overhangs that are present in the duplex. In addition to the duplex structure, an RNAi may comprise one or more nucleotide overhangs. In one embodiment, an RNAi agent of the disclosure is a dsRNA, each strand of which comprises less than 30 nucleotides, e.g., 17-27, 19-27, 17-25, 19-25, or 19-23, that interacts with a target RNA sequence, e.g., a KHK target mRNA sequence, to direct the cleavage of the target RNA. In another embodiment, an RNAi agent of the disclosure is a dsRNA, each strand of which comprises 19-23 nucleotides, that interacts with a target RNA sequence, e.g., a KHK target mRNA sequence, to direct the cleavage of the target RNA. In one embodiment, the sense strand is 21 nucleotides in length. In another embodiment, the antiosense strand is 23 nucleotides in length. As used herein, the term “nucleotide overhang” refers to at least one unpaired nucleotide that protrudes from the duplex structure of an iRNA, e.g., a dsRNA. For example, when a 3'-end of one strand of a dsRNA extends beyond the 5'-end of the other strand, or vice versa, there is a nucleotide overhang. A dsRNA can comprise an overhang of at least one nucleotide; alternatively the overhang can comprise at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides or more. A nucleotide overhang can comprise or consist of a nucleotide / nucleoside analog, including a deoxynucleotide / nucleoside. The overhang(s) can be on the sense strand, the antisense strand or any combination thereof. Furthermore, the nucleotide(s) of an overhang can be present on the 5'-end, 3'-end or both ends of either an antisense or sense strand of a dsRNA. In one embodiment, the antisense strand of a dsRNA has a 1-10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3’-end and / or the 5’-end. In one embodiment, the sense strand of a dsRNA has a 1-10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at 18 ME151168599v.1 18 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO the 3’-end and / or the 5’-end. In another embodiment, one or more of the nucleotides in the overhang is replaced with a nucleoside thiophosphate. In certain embodiments, the overhang on the sense strand or the antisense strand, or both, can include extended lengths longer than 10 nucleotides, e.g., 10-30 nucleotides, 10-25 nucleotides, 10-20 nucleotides or 10-15 nucleotides in length. In certain embodiments, an extended overhang is on the sense strand of the duplex. In certain embodiments, an extended overhang is present on the 3’end of the sense strand of the duplex. In certain embodiments, an extended overhang is present on the 5’end of the sense strand of the duplex. In certain embodiments, an extended overhang is on the antisense strand of the duplex. In certain embodiments, an extended overhang is present on the 3’end of the antisense strand of the duplex. In certain embodiments, an extended overhang is present on the 5’end of the antisense strand of the duplex. In certain embodiments, one or more of the nucleotides in the extended overhang is replaced with a nucleoside thiophosphate. The terms “blunt” or “blunt ended” as used herein in reference to a dsRNA mean that there are no unpaired nucleotides or nucleotide analogs at a given terminal end of a dsRNA, i.e., no nucleotide overhang. One or both ends of a dsRNA can be blunt. Where both ends of a dsRNA are blunt, the dsRNA is said to be blunt ended. To be clear, a “blunt ended” dsRNA is a dsRNA that is blunt at both ends, i.e., no nucleotide overhang at either end of the molecule. Most often such a molecule will be double-stranded over its entire length. The term “antisense strand” or "guide strand" refers to the strand of an iRNA, e.g., a dsRNA, which includes a region that is substantially complementary to a target sequence, e.g., a KHK mRNA. As used herein, the term “region of complementarity” refers to the region on the antisense strand that is substantially complementary to a sequence, for example a target sequence, e.g., a KHK nucleotide sequence, as defined herein. Where the region of complementarity is not fully complementary to the target sequence, the mismatches can be in the internal or terminal regions of the molecule. Generally, the most tolerated mismatches are in the terminal regions, e.g., within 5, 4, 3, or 2 nucleotides of the 5’- and / or 3’-terminus of the iRNA. The term “sense strand” or "passenger strand" as used herein, refers to the strand of an iRNA that includes a region that is substantially complementary to a region of the antisense strand as that term is defined herein. As used herein, the term “cleavage region” refers to a region that is located immediately adjacent to the cleavage site. The cleavage site is the site on the target at which cleavage occurs. In some embodiments, the cleavage region comprises three bases on either end of, and immediately adjacent to, the cleavage site. In some embodiments, the cleavage region comprises two bases on either end of, and immediately adjacent to, the cleavage site. In some embodiments, the cleavage site specifically occurs at the site bound by nucleotides 10 and 11 of the antisense strand, and the cleavage region comprises nucleotides 11, 12 and 13. 19 ME151168599v.1 19 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO As used herein, and unless otherwise indicated, the term “complementary,” when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence, as will be understood by the skilled person. Such conditions can, for example, be stringent conditions, where stringent conditions can include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50oC or 70oC for 12-16 hours followed by washing (see, e.g., “Molecular Cloning: A Laboratory Manual, Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press). Other conditions, such as physiologically relevant conditions as can be encountered inside an organism, can apply. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides. Complementary sequences within an iRNA, e.g., within a dsRNA as described herein, include base-pairing of the oligonucleotide or polynucleotide comprising a first nucleotide sequence to an oligonucleotide or polynucleotide comprising a second nucleotide sequence over the entire length of one or both nucleotide sequences. Such sequences can be referred to as “fully complementary” with respect to each other herein. However, where a first sequence is referred to as “substantially complementary” with respect to a second sequence herein, the two sequences can be fully complementary, or they can form one or more, but generally not more than 5, 4, 3 or 2 mismatched base pairs upon hybridization for a duplex up to 30 base pairs, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., inhibition of gene expression via a RISC pathway. However, where two oligonucleotides are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs shall not be regarded as mismatches with regard to the determination of complementarity. For example, a dsRNA comprising one oligonucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 21 nucleotides that is fully complementary to the shorter oligonucleotide, can yet be referred to as “fully complementary” for the purposes described herein. “Complementary” sequences, as used herein, can also include, or be formed entirely from, non-Watson-Crick base pairs and / or base pairs formed from non-natural and modified nucleotides, in so far as the above requirements with respect to their ability to hybridize are fulfilled. Such non- Watson-Crick base pairs include, but are not limited to, G:U Wobble or Hoogstein base pairing. The terms “complementary,” “fully complementary” and “substantially complementary” herein can be used with respect to the base matching between the sense strand and the antisense strand of a dsRNA, or between the antisense strand of an iRNA agent and a target sequence, as will be understood from the context of their use. As used herein, a polynucleotide that is “substantially complementary to at least part of” a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a 20 ME151168599v.1 20 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO contiguous portion of the mRNA of interest (e.g., an mRNA encoding KHK). For example, a polynucleotide is complementary to at least a part of a KHK mRNA if the sequence is substantially complementary to a non-interrupted portion of an mRNA encoding KHK. Accordingly, in some embodiments, the antisense strand polynucleotides disclosed herein are fully complementary to the target KHK sequence. In other embodiments, the antisense strand polynucleotides disclosed herein are substantially complementary to the target KHK sequence and comprise a contiguous nucleotide sequence which is at least about 80% complementary over its entirelength to the equivalent region of the nucleotide sequence of SEQ ID NOs: 1, 3, 5, 7, 9, or 11, or afragment of any one of SEQ ID NOs:1, 3, 5, 7, 9, or 11, such as about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about % 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary. In one embodiment, an RNAi agent of the disclosure includes a sense strand that is substantially complementary to an antisense polynucleotide which, in turn, is complementary to a target KHK sequence, and wherein the sense strand polynucleotide comprises a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to the equivalent region ofthe nucleotide sequence of SEQ ID NOs: 2, 4, 6, 8, 10, or 12, or a fragment of any one of SEQ IDNOs:2, 4, 6, 8, 10, or 12, such as about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about % 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary. In some embodiments, an iRNA of the disclosure includes an antisense strand that is substantially complementary to the target KHK sequence and comprises a contiguous nucleotide sequence which is at least about 80% complementary over its entire length to the equivalent region of the nucleotide sequence of any one of the sense strands in Table 2, or a fragment of any one of the sense strands in Table 2, such as about about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary, or 100% complementary. A “pharmaceutically acceptable salt” of the dsRNA of the disclosure being used in the methods of the disclosure includes any salt which is pharmaceutically acceptable, e.g., a sodium salt of the dsRNA agent. In one embodiment, the pharmaceutically acceptable salt of the dsRNA of the disclosure being used in the methods of the disclosure has the following molecular formula: C533H685F4N177O322P43S6Na43. The sodium salt form of AD-1613400 (ALN-KHK) is shown in Figure 5. The term “ALN-KHK” refers to an agent comprised of a synthetic small interfering RNA (siRNA) (drug substance AD-1613400) covalently linked to a triantennary N-acetylgalactosamine (GalNAc) ligand. The term “ALN-KHK” also includes pharmaceutically acceptable salts of the siRNA agent, such as sodium salts. ALN-KHK is used in the methods of the invention for reducing the hepatic expression of ketohexokinase (KHK) that phosphorylates fructose to fructose 1 phosphate as a strategy for suppressing hepatic lipogenesis and, thus, improving insulin sensitivity in individuals with type 2 diabetes mellitus (T2DM). 21 ME151168599v.1 21 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO The term “inhibiting,” as used herein, is used interchangeably with “reducing,” “silencing,” “downregulating,” “suppressing” and other similar terms, and includes any level of inhibition. The phrase “inhibiting expression of a KHK gene,” as used herein, includes inhibition of expression of any KHK gene (such as, e.g., a mouse KHK gene, a rat KHK gene, a monkey KHK gene, or a human KHK gene) as well as variants or mutants of a KHK gene that encode a KHK protein. Thus, the KHK gene may be a wild-type KHK gene, a mutant KHK gene, or a transgenic KHK gene in the context of a genetically manipulated cell, group of cells, or organism. “Inhibiting expression of a KHK gene” includes any level of inhibition of a KHK gene, e.g., at least partial suppression of the expression of a KHK gene, such as an inhibition by at least about 20%. In certain embodiments, inhibition is by at least about 25%, at least about 30%, at least about 35%,at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%. The expression of a KHK gene may be assessed based on the level of any variable associated with KHK gene expression, e.g., KHK mRNA level or KHK protein level. The expression of a KHK gene may also be assessed indirectly based on, for example, the levels of circulating fructose level in a sample, such as a serum or urine sample. Inhibition may be assessed by a decrease and / or increase in an absolute or relative level of one or more of these variables compared with a control level. The control level may be any type of control level that is utilized in the art, e.g., a pre-dose baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g., buffer only control or inactive agent control). In one embodiment, at least partial suppression of the expression of a KHK gene, is assessed by a reduction of the amount of KHK mRNA which can be isolated from, or detected, in a first cell or group of cells in which a KHK gene is transcribed and which has or have been treated such that the expression of a KHK gene is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has or have not been so treated (control cells). The degree of inhibition may be expressed in terms of: (mRNAincontrolcells) - (mRNAin treated cells) ^100 % (mRNAincontrol cells) Inhibition of the expression of a KHK protein may be manifested by a reduction in the level of the KHK protein that is expressed by a cell or group of cells or in a subject sample (e.g., the level of protein in a blood sample derived from a subject). As explained above, for the assessment of mRNA suppression, the inhibition of protein expression levels in a treated cell or group of cells may 22 ME151168599v.1 22 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO similarly be expressed as a percentage of the level of protein in a control cell or group of cells, or the change in the level of protein in a subject sample, e.g., blood or serum derived therefrom. The level of KHK mRNA that is expressed by a cell or group of cells may be determined using any method known in the art for assessing mRNA expression. In one embodiment, the level of expression of KHK in a sample is determined by detecting a transcribed polynucleotide, or portion thereof, e.g., mRNA of the KHK gene. RNA may be extracted from cells using RNA extraction techniques including, for example, using acid phenol / guanidine isothiocyanate extraction (RNAzol B; Biogenesis), RNeasyTM RNA preparation kits (Qiagen®) or PAXgeneTM (PreAnalytixTM, Switzerland). Typical assay formats utilizing ribonucleic acid hybridization include nuclear run-on assays, RT-PCR, RNase protection assays, northern blotting, in situ hybridization, and microarray analysis. In some embodiments, the level of expression of KHK is determined using a nucleic acid probe. The term “probe”, as used herein, refers to any molecule that is capable of selectively binding to a specific KHK. Probes can be synthesized by one of skill in the art, or derived from appropriate biological preparations. Probes may be specifically designed to be labeled. Examples of molecules that can be utilized as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules. Isolated mRNA can be used in hybridization or amplification assays that include, but are not limited to, Southern or northern analyses, polymerase chain reaction (PCR) analyses and probe arrays. One method for the determination of mRNA levels involves contacting the isolated mRNA with a nucleic acid molecule (probe) that can hybridize to KHK mRNA. In one embodiment, the mRNA is immobilized on a solid surface and contacted with a probe, for example by running the isolated mRNA on an agarose gel and transferring the mRNA from the gel to a membrane, such as nitrocellulose. In an alternative embodiment, the probe(s) are immobilized on a solid surface and the mRNA is contacted with the probe(s), for example, in an Affymetrix® gene chip array. A skilled artisan can readily adapt known mRNA detection methods for use in determining the level of KHK mRNA. An alternative method for determining the level of expression of KHK in a sample involves the process of nucleic acid amplification or reverse transcriptase (to prepare cDNA) of for example mRNA in the sample, e.g., by RT-PCR (the experimental embodiment set forth in Mullis, 1987, U.S. Patent No.4,683,202), ligase chain reaction (Barany (1991) Proc. Natl. Acad. Sci. USA 88:189-193), self sustained sequence replication (Guatelli et al . (1990) Proc. Natl. Acad. Sci. USA 87:1874-1878), transcriptional amplification system (Kwoh et al . (1989) Proc. Natl. Acad. Sci. USA 86:1173-1177), Q-Beta Replicase (Lizardi et al . (1988) Bio / Technology 6:1197), rolling circle replication (Lizardi et al ., U.S. Patent No.5,854,033) or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules 23 ME151168599v.1 23 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO are present in very low numbers. In particular aspects of the disclosure, the level of expression of KHK is determined by quantitative fluorogenic RT-PCR (i.e., the TaqManTM System). The expression levels of KHK mRNA may be monitored using a membrane blot (such as used in hybridization analysis such as northern, Southern, dot, and the like), or microwells, sample tubes, gels, beads or fibers (or any solid support comprising bound nucleic acids). See U.S. Patent Nos.5,770,722, 5,874,219, 5,744,305, 5,677,195 and 5,445,934, which are incorporated herein by reference. The determination of KHK expression level may also comprise using nucleic acid probes in solution. In some embodiments, the level of mRNA expression is assessed using branched DNA (bDNA) assays or real time PCR (qPCR). The level of KHK protein expression may be determined using any method known in the art for the measurement of protein levels. Such methods include, for example, electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, fluid or gel precipitin reactions, absorption spectroscopy, a colorimetric assays, spectrophotometric assays, flow cytometry, immunodiffusion (single or double), immunoelectrophoresis, western blotting, radioimmunoassay (RIA), enzyme-linked immunosorbent assays (ELISAs), immunofluorescent assays, electrochemiluminescence assays, and the like. In some embodiments, the efficacy of the methods of the disclosure are assessed by adecrease in KHK mRNA or protein level (e.g., in a liver biopsy). In certain embodiments, a punctureliver biopsy sample serves as the tissue material for monitoring the reduction in the KHK gene or protein expression. In other embodiments, a blood sample serves as the subject sample for monitoring the reduction in the KHK protein expression. A reduction in the expression of KHK may also be assessed indirectly by measuring a decrease in fructose metabolism by detecting one or more indicators of fructose metabolism, e.g., the presence of fructose in the serum and / or urine indicating lack of fructose metabolism. In addition, a reduction in the expression of KHK may be assessed indirectly by measuring a decrease in the circulating level of FGF21, and / or an increase in serum and / or urine fructose levels in response to an oral fructose load. Alternatively, a reduction in the expression of KHK may be assessed by measuring the level of hemoglobin A1C (HbA1C), or by measuring glucose homeostasis, e.g., by assessing area under the curve (AUC) for glucose and insulin in response to a glucose load, or by measuring liver fat, e.g., by assessing changes in liver magnetic resonance imaging (MRI). In some embodiments of the methods of the disclosure, the iRNA is administered to a subject such that the iRNA is delivered to a specific site within the subject. The inhibition of expression of KHK may be assessed using measurements of the level or change in the level of KHK mRNA or KHK protein in a sample derived from fluid or tissue from the specific site within the subject (e.g., liver or blood). As used herein, the terms detecting or determining a level of an analyte are understood to mean performing the steps to determine if a material, e.g., protein, RNA, is present. As used herein, 24 ME151168599v.1 24 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO methods of detecting or determining include detection or determination of an analyte level that is below the level of detection for the method used. The phrase “contacting a cell with an RNAi agent,” such as a dsRNA, as used herein, includes contacting a cell by any possible means. Contacting a cell with an RNAi agent includes contacting a cell in vitro with the iRNA or contacting a cell in vivo with the iRNA. The contacting may be done directly or indirectly. Thus, for example, the RNAi agent may be put into physical contact with the cell by the individual performing the method, or alternatively, the RNAi agent may be put into a situation that will permit or cause it to subsequently come into contact with the cell. Contacting a cell in vitro may be done, for example, by incubating the cell with the RNAi agent. Contacting a cell in vivo may be done, for example, by injecting the RNAi agent into or near the tissue where the cell is located, or by injecting the RNAi agent into another area, e.g., the bloodstream or the subcutaneous space, such that the agent will subsequently reach the tissue where the cell to be contacted is located. For example, the RNAi agent may contain and / or be coupled to a ligand, e.g., GalNAc3, that directs the RNAi agent to a site of interest, e.g., the liver. Combinations of in vitro and in vivo methods of contacting are also possible. For example, a cell may also be contacted in vitro with an RNAi agent and subsequently transplanted into a subject. In one embodiment, contacting a cell with an iRNA includes “introducing” or “delivering the iRNA into the cell” by facilitating or effecting uptake or absorption into the cell. Absorption or uptake of an iRNA can occur through unaided diffusive or active cellular processes, or by auxiliary agents or devices. Introducing an iRNA into a cell may be in vitro and / or in vivo. For example, for in vivo introduction, iRNA can be injected into a tissue site or administered systemically. In vivo delivery can also be done by a beta-glucan delivery system, such as those described in U.S. Patent Nos.5,032,401 and 5,607,677, and U.S. Publication No.2005 / 0281781, the entire contents of which are hereby incorporated herein by reference. In vitro introduction into a cell includes methods known in the art such as electroporation and lipofection. Further approaches are described herein below and / or are known in the art. As used herein, a “subject” is an animal, such as a mammal, including a primate (such as a human, a non-human primate, e.g., a monkey, and a chimpanzee), a non-primate (such as a cow, a pig, a camel, a llama, a horse, a goat, a rabbit, a sheep, a hamster, a guinea pig, a cat, a dog, a rat, a mouse, a horse, and a whale), or a bird (e.g., a duck or a goose). In an embodiment, the subject is a human, such as a human being treated or assessed for a disease, disorder, or condition that would benefit from reduction in KHK expression; a human at risk for a disease, disorder, or condition that would benefit from reduction in KHK expression; a human having a disease, disorder, or condition that would benefit from reduction in KHK expression; and / or human being treated for a disease, disorder, or condition that would benefit from reduction in KHK expression as described herein. In one embodiment, the subject is an overweight human. In one embodiment, the subject is an obese human. 25 ME151168599v.1 25 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO In one embodiment, the subject is an overweight healthy human. In one embodiment, the subject is an obese healthy human. In one embodiment, the subject is homozygous for the gene encoding a functional KHK protein. In another embodiment, the subject is heterozygous for the gene encoding a functional KHK protein. In yet another embodiment, the subject is heterozygous for the gene encoding a functional KHK protein and a gene encoding a loss of function variant of KHK. As used herein, the terms “treating” or “treatment” refer to a beneficial or desired result including, but not limited to, alleviation or amelioration of one or more symptoms associated with KHK gene expression and / or KHK protein production, e.g., a KHK-associated disease, such as a liver disease (e.g., fatty liver, steatohepatitis, non-alcoholic steatohepatitis (NASH)), dyslipidemia (e.g., hyperlipidemia, high LDL cholesterol, low HDL cholesterol, hypertriglyceridemia, postprandial hypertriglyceridemia), disorders of glycemic control (e.g., insulin resistance, type 2 diabetes), cardiovascular disease (e.g., hypertension, endothelial cell dysfunction), kidney disease (e.g., acute kidney disorder, tubular dysfunction, proinflammatory changes to the proximal tubules, chronic kidney disease), metabolic syndrome, adipocyte dysfunction, visceral adipose deposition, obesity, hyperuricemia, gout, eating disorders, and excessive sugar craving. "Treatment" can also mean prolonging survival as compared to expected survival in the absence of treatment. The term “lower” in the context of a KHK-associated disease refers to a statistically significant decrease in such level. The decrease can be, for example, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or more. In certain embodiments, a decrease is at least 20%. ”Lower” in the context of the level of KHK in a subject is preferably down to a level accepted as within the range of normal for an individual without such disorder. As used herein, “prevention” or “preventing,” when used in reference to a disease, disorder or condition thereof, may be treated or ameliorated by a reduction in expression of a KHK gene, refers to a reduction in the likelihood that a subject will develop a symptom associated with such a disease, disorder, or condition, e.g., a symptom of unwanted or excessive KHK expression and / or activity, e.g., increased fructose metabolism, elevated uric acid and lipid levels. Without being bound by mechanism, it is known that fructose phosphorylation catalyzed by KHK to form fructose-1- phosphate is not regulated by feedback inhibition which can result in depletion of ATP and intracellular phosphate, and increased AMP levels, which results in the production of uric acid. Further, the fructose-1-phosphate is metabolized to glyceraldehyde which feeds into the citric acid cycle increasing the production of acetyl Co-A stimulating fatty acid synthesis. Diseases and conditions associated with elevated uric acid and fatty acid synthesis include, e.g., liver disease (e.g., fatty liver, steatohepatitis including non-alcoholic steatohepatitis (NASH)), dyslipidemia (e.g., hyperlipidemia, high LDL cholesterol, low HDL cholesterol, hypertriglyceridemia, postprandial hypertriglyceridemia), disorders of glycemic control (e.g., insulin resistance not related to immune 26 ME151168599v.1 26 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO response to insulin, type 2 diabetes), cardiovascular disease (e.g., hypertension, endothelial cell dysfunction), kidney disease (e.g., acute kidney disorder, tubular dysfunction, proinflammatory changes to the proximal tubules, chronic kidney disease), metabolic syndrome, disease of lipid deposition or dysfunction (e.g., adipocyte dysfunction, visceral adipose deposition, obesity), disease of elevated uric acid (e.g., hyperuricemia, gout), and eating disorders such as excessive sugar craving. The failure to develop a disease, disorder or condition, or the reduction in the development of a symptom or comorbidity associated with such a disease, disorder or condition (e.g., by at least about 10% on a clinically accepted scale for that disease or disorder), or the exhibition of delayed signs or symptoms or disease progression by days, weeks, months or years is considered effective prevention. As used herein, the term "KHK-associated disease,” is a disease or disorder that is caused by, or associated with, KHK gene expression or KHK protein production. The term "KHK-associated disease” includes a disease, disorder or condition that would benefit from a decrease in KHK gene expression or protein activity. Non-limiting examples of KHK-associated diseases include, for example, liver disease (e.g., fatty liver, steatohepatitis including non-alcoholic steatohepatitis (NASH)), dyslipidemia (e.g., hyperlipidemia, high LDL cholesterol, low HDL cholesterol, hypertriglyceridemia, postprandial hypertriglyceridemia), disorders of glycemic control (e.g., insulin resistance not related to immune response to insulin, type 2 diabetes), cardiovascular disease (e.g., hypertension, endothelial cell dysfunction), kidney disease (e.g., acute kidney disorder, tubular dysfunction, proinflammatory changes to the proximal tubules, chronic kidney disease), metabolic syndrome, disease of lipid deposition or dysfunction (e.g., adipocyte dysfunction, visceral adipose deposition, obesity), disease of elevated uric acid (e.g., hyperuricemia, gout), and eating disorders such as excessive sugar craving. In one embodiment, the KHK-associated disease is type 2 diabetes. In certain embodiments, the KHK-associated disorder is a liver disease, e.g., fatty liver disease (also called hepatic steatosis) such as NAFLD or NASH. In certain embodiments, the KHK- associated disorder is dyslipidemia, e.g., elevated serum triglycerides, elevated serum LDL, elevated serum cholesterol, lowered serum HDL, postprandial hypertriglyceridemia. In another embodiment, the KHK-associated disorder is a disorder of glycemic control, e.g., insulin resistance not resulting from an immune response against insulin, glucose resistance, type 2 diabetes. In one embodiment, the KHK-associated disorder is type 2 diabetes. In certain embodiments, the KHK-associated disorder is a cardiovascular disease, e.g., hypertension, endothelial cell dysfunction. In certain embodiments, the KHK-associated disorder is a kidney disease, e.g., acute kidney disorder, tubular dysfunction, proinflammatory changes to the proximal tubules, chronic kidney disease. In certain embodiments, the disease is metabolic syndrome. In certain embodiments, the KHK-associated disorder is a disease of lipid deposition or dysfunction, e.g., visceral adipose deposition, fatty liver, obesity. In certain embodiments, the KHK-associated disorder is a disease of elevated uric acid, e.g., gout, hyperuricemia. In certain embodiments the KHK-associated disorder is an eating disorder such as excessive sugar craving. 27 ME151168599v.1 27 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO "Therapeutically effective amount," as used herein, is intended to include the amount of an RNAi agent that, when administered to a subject having a KHK-associated disease, disorder, or condition, is sufficient to effective treatment of the disease (e.g., by diminishing, ameliorating or maintaining the existing disease or one or more symptoms of disease). The "therapeutically effective amount" may vary depending on the RNAi agent, how the agent is administered, the disease and its severity and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the subject to be treated. “Prophylactically effective amount,” as used herein, is intended to include the amount of an iRNA that, when administered to a subject having a KHK-associated disease, disorder, or condition, is sufficient to prevent or ameliorate the disease or one or more symptoms of the disease. Ameliorating the disease includes slowing the course of the disease or reducing the severity of later-developing disease. The "prophylactically effective amount" may vary depending on the iRNA, how the agent is administered, the degree of risk of disease, and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated. A "therapeutically-effective amount" or “prophylacticaly effective amount” also includes an amount of an RNAi agent that produces some desired local or systemic effect at a reasonable benefit / risk ratio applicable to any treatment. iRNA employed in the methods of the present disclosure may be administered in a sufficient amount to produce a reasonable benefit / risk ratio applicable to such treatment. A “fixed dose” (e.g., a dose in mg) means that one dose of an iRNA agent is used for all subjects regardless of any specific subject-related factors, such as weight. A fixed dose is different from a weight-based dose (e.g., a dose in mg / kg) which refers to a dose of the iRNA agent that will change depending on the subject’s weight. In certain embodiments, an RNAi agent is administered to the subject as a fixed dose of about 25 mg to about 1200 mg, about 50 mg to about 1200 mg, about 75 mg to about 1200 mg, about 100 mg to about 1200 mg, about 150 mg to about 1200 mg, about 200 mg to about 1200 mg, about 250 mg to about 1200 mg, about 300 mg to about 1200 mg, about 350 mg to about 1200 mg, about 400 mg to about 1200 mg, about 450 mg to about 1200 mg, about 500 mg to about 1200 mg, about 550 mg to about 1200 mg, about 600 mg to about 1200 mg, about 700 mg to about 1200 mg, about 800 mg to about 1200 mg, about 900 mg to about 1200 mg, about 1000 mg to about 1200 mg, about 25 mg to about 600 mg, about 75 mg to about 600 mg, about 150 mg to about 600 mg, about 300 to about 600 mg, about 450 to about 600 mg, about 25 mg to about 100 mg, about 100 mg to about 150 mg, 150 mg to about 200 mg, 200 mg to about 250 mg, about 250 mg to about 300 mg, about 300 mg to about 350 mg, about 350 mg to about 400 mg, about 400 mg to about 450 mg, about 450 mg to about 500 mg, about 500 mg to about 550 mg, about 550 mg to about 600 mg, about 650 mg to about 700 mg, about 700 mg to about 750 mg, about 750 mg to about 800 mg, about 800 mg to about 850 mg, about 850 mg to about 900 mg, about 900 mg to about 950 mg, about 950 mg to about 1000 mg, 28 ME151168599v.1 28 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO about 1000 mg to about 1050 mg, about 1050 mg to about 1100 mg, about 1150 mg to about 1200 mg, about 25 mg to about 150 mg, about 75 mg to about 200 mg, about 100 mg to about 250 mg, about 150 mg to about 300 mg, about 200 mg to about 350 mg, about 250 mg to about 400 mg, about 300 mg to about 450 mg, about 350 mg to about 500 mg, about 400 mg to about 600 mg, about 500 mg to about 800 mg, about 600 mg to about 900 mg, or about 1100 mg to about 1200 mg. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a fixed dose of , e.g., a fixed dose of about 25, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, or 1200 mg. Values and ranges intermediate to the foregoing recited values are also intended to be part of this disclosure. The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human subjects and animal subjects without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio. The phrase "pharmaceutically-acceptable carrier" as used herein means a pharmaceutically- acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject being treated. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium state, sodium lauryl sulfate and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates and / or polyanhydrides; (22) bulking agents, such as polypeptides and amino acids (23) serum component, such as serum albumin, HDL and LDL; and (22) other non-toxic compatible substances employed in pharmaceutical formulations. The term “lower” in the context of the level of KHK gene expression or KHK protein production in a subject, or a disease marker or symptom refers to a statistically significant decrease in such level. The decrease can be, for example, at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or below the level of detection for the detection method. In certain embodiments, the expression of the target is normalized, i.e., decreased towards or 29 ME151168599v.1 29 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO to a level accepted as within the range of normal for an individual without such disorder, e.g., normalization of body weight, blood pressure, or a serum lipid level. As used here, “lower” in a subject can refer to lowering of gene expression or protein production in a cell in a subject does not require lowering of expression in all cells or tissues of a subject. For example, as used herein, lowering in a subject can include lowering of gene expression or protein production in the liver of a subject. The term “lower” can also be used in association with normalizing a symptom of a disease or condition, i.e. decreasing the difference between a level in a subject suffering from a KHK-associated disease towards or to a level in a normal subject not suffering from a KHK-associated disease. For example, if a subject with a normal weight of 70 kg weighs 90 kg prior to treatment (20 kg overweight) and 80 kg after treatment (10 kg overweight), the subject’s weight is lowered towards a normal weight by 50% (10 / 20 x 100%). Similarly, if the HDL level of a woman is increased from 50 mg / dL (poor) to 57 mg / dL, with a normal level being 60 mg / dL, the difference between the prior level of the subject and the normal level is decreased by 70% (difference of 10 mg / dL between subject level and normal is decreased by 7 mg / dL, 7 / 10 x 100%). As used herein, if a disease is associated with an elevated value for a symptom, “normal” is considered to be the upper limit of normal. If a disease is associated with a decreased value for a symptom, “normal” is considered to be the lower limit of normal. The term “sample,” as used herein, includes a collection of similar fluids, cells, or tissues isolated from a subject, as well as fluids, cells, or tissues present within a subject. Examples of biological fluids include blood, serum and serosal fluids, plasma, cerebrospinal fluid, ocular fluids, lymph, urine, saliva, and the like. Tissue samples may include samples from tissues, organs or localized regions. For example, samples may be derived from particular organs, parts of organs, or fluids or cells within those organs. In certain embodiments, samples may be derived from the liver (e.g., whole liver or certain segments of liver or certain types of cells in the liver, such as, e.g., hepatocytes). In some embodiments, a “sample derived from a subject” refers to blood or plasma drawn from the subject. II. Methods of the Disclosure The present disclosure provides methods for treating or preventing at least one symptom in a subject suffering from a disorder that would benefit from reduction in KHK expression, e.g., a KHK- associated disease, e.g., type 2 diabetes. The present disclosure also provides methods for reducing fructose metabolism in a subject, e.g., a subject suffering from a disease, disorder or condition that would benefit from reduction in expression of a KHK gene, e.g., type 2 diabetes. The present disclosure further provides methods of improving insulin sensitivity in a subject having type 2 diabetes and methods of reducing fatty acid synthesis in a subject having type 2 diabetes. The methods include administering to the subject a fixed dose of about 25 mg to about 1200 mg of a dsRNA agent, or a pharmaceutically acceptable salt thereof, of the disclosure. In some 30 ME151168599v.1 30 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a fixed dose of about 25 mg to about 1200 mg, about 50 mg to about 1200 mg, about 75 mg to about 1200 mg, about 100 mg to about 1200 mg, about 150 mg to about 1200 mg, about 200 mg to about 1200 mg, about 250 mg to about 1200 mg, about 300 mg to about 1200 mg, about 350 mg to about 1200 mg, about 400 mg to about 1200 mg, about 450 mg to about 1200 mg, about 500 mg to about 1200 mg, about 550 mg to about 1200 mg, about 600 mg to about 1200 mg, about 700 mg to about 1200 mg, about 800 mg to about 1200 mg, about 900 mg to about 1200 mg, about 1000 mg to about 1200 mg, about 25 mg to about 600 mg, about 75 mg to about 600 mg, about 150 mg to about 600 mg, about 300 to about 600 mg, about 450 to about 600 mg, about 25 mg to about 100 mg, about 100 mg to about 150 mg, 150 mg to about 200 mg, 200 mg to about 250 mg, about 250 mg to about 300 mg, about 300 mg to about 350 mg, about 350 mg to about 400 mg, about 400 mg to about 450 mg, about 450 mg to about 500 mg, about 500 mg to about 550 mg, about 550 mg to about 600 mg, about 650 mg to about 700 mg, about 700 mg to about 750 mg, about 750 mg to about 800 mg, about 800 mg to about 850 mg, about 850 mg to about 900 mg, about 900 mg to about 950 mg, about 950 mg to about 1000 mg, about 1000 mg to about 1050 mg, about 1050 mg to about 1100 mg, about 1150 mg to about 1200 mg, about 25 mg to about 150 mg, about 75 mg to about 200 mg, about 100 mg to about 250 mg, about 150 mg to about 300 mg, about 200 mg to about 350 mg, about 250 mg to about 400 mg, about 300 mg to about 450 mg, about 350 mg to about 500 mg, about 400 mg to about 600 mg, about 500 mg to about 800 mg, about 600 mg to about 900 mg, or about 1100 mg to about 1200 mg. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a fixed dose of , e.g., a fixed dose of about 25, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1000, 1100, or 1200 mg. In one embodiment, a KHK-associated disease, disorder, or condition includes, but is not limited to, liver disease (e.g., fatty liver, steatohepatitis, non-alcoholic steatohepatitis (NASH)), dyslipidemia (e.g., hyperlipidemia, high LDL cholesterol, low HDL cholesterol, hypertriglyceridemia, postprandial hypertriglyceridemia), disorders of glycemic control (e.g., insulin resistance, type 2 diabetes), cardiovascular disease (e.g., hypertension, endothelial cell dysfunction), kidney disease (e.g., acute kidney disorder, tubular dysfunction, proinflammatory changes to the proximal tubules, chronic kidney disease), metabolic syndrome, adipocyte dysfunction, visceral adipose deposition, obesity, hyperuricemia, gout, eating disorders, and excessive sugar craving. Accordingly, in one aspect, the present disclosure provides methods of treating a subject having a disorder that would benefit from reduction in KHK expression, e.g., a KHK-associated disease, such as liver disease (e.g., fatty liver, steatohepatitis, non-alcoholic steatohepatitis (NASH)), dyslipidemia (e.g., hyperlipidemia, high LDL cholesterol, low HDL cholesterol, hypertriglyceridemia, postprandial hypertriglyceridemia), disorders of glycemic control (e.g., insulin resistance, type 2 diabetes), cardiovascular disease (e.g., hypertension, endothelial cell dysfunction), kidney disease (e.g., acute kidney disorder, tubular dysfunction, proinflammatory changes to the proximal tubules, chronic kidney disease), metabolic syndrome, adipocyte dysfunction, visceral adipose deposition, 31 ME151168599v.1 31 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO obesity, hyperuricemia, gout, eating disorders, and excessive sugar craving. The methods include administering to the subject a therapeutically effective amount of dsRNA agent, or a pharmaceutically acceptable salt thereof, that inhibits expression of KHK, thereby treating the disorder in the subject. In one embodiment, the KHK-associated disease is type 2 diabetes. In one aspect, the disclosure provides methods of preventing at least one symptom in a subject having a disorder that would benefit from reduction in KHK expression, e.g., a KHK- associated disease, e.g., type 2 diabetes. The methods include administering to the subject a prophylactically effective amount of dsRNA agent, or a pharmaceutically acceptable salt thereof, that inhibits expression of KHK, thereby preventing at least one symptom in the subject. Dyslipidemia (e.g., hyperlipidemia, high LDL cholesterol, low HDL cholesterol, hypertriglyceridemia, postprandial hypertriglyceridemia), disorders of glycemic control (e.g., insulin resistance, type 2 diabetes), metabolic syndrome, adipocyte dysfunction, visceral adipose deposition, obesity, and excessive sugar craving are associated with elevated fructose metabolism. Characteristics or diagnostic criteria for the conditions are provided below. Animal models of metabolic disorder and the component features include various high fat- or high fructose-fed animal models. Genetic models include leptin deficient B6.Cg-Lepob / J, commonly known as ob or ob / ob mice, which are available from The Jackson Laboratory. Normal and abnormal fasting levels of the lipids are provided in the table below. 32 ME151168599v.1 32 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO Postprandial hypertriglyceridemia can be initiated by overproduction or decreased catabolism of triglyceride-rich lipoproteins (TRLs) and is a consequence of predisposing genetic variations and medical conditions such as obesity and insulin resistance. Insulin resistance can be characterized by the presence of at least one of: 1. A fasting blood glucose level of 100-125 mg / dL taken at two different times; or 2. An oral glucose tolerance test with a result of a glucose level of 140-199 mg / dL at 2 hours after glucose consumption. As used herein, insulin resistance does not include a lack of response to insulin as a result of an immune response to administered insulin as often occurs in late stages of insulin dependent diabetes, especially type 1 diabetes. Type 2 diabetes can be characterized by at least one of: 1. A fasting blood glucose level > 126 mg / dL taken at two different times; 2. A hemoglobin A1c (A1C) test with a result of > 6.5% or higher; or 3. An oral glucose tolerance test with a result of a glucose level > 200 mg / dL at 2 hours after glucose consumption. Pharmacological treatments for type 2 diabetes and insulin resistance can include treatment with agents to normalize blood sugar such as metformin (e.g., glucophage, glumetza), sulfonylureas (e.g., glyburide, glipizide, glimepiride), meglitinides (e.g., repaglinide, nateglinide), thiazolidinediones (rosiglitazone, pioglitazone), DPP-4 inhibitors (sitagliptin, saxagliptin, linagliptin), GLP-1 receptor antagonists (exenatide, liraglutide), and SGLT2 inhibitors (e.g., canagliflozin, dapagliflozin). Obesity can be characterized as disease of excess body fat. Body mass index (BMI), which is calculated by dividing body weight in kilograms (kg) by height in meters (m) squared, provides a reasonable estimate of body fat for most, but not all, people. Generally, a BMI below 18.5 is characterized as underweight, 18-.5 to 24.9 is normal, 25.0-29.9 is overweight, 30.0-34.9 is obese (class I), 35-39.9 is obese (class II), and 40.0 and higher is extremely obese (class III). Methods for assessment of subcutaneous vs. visceral fat are provided, for example, in Wajchenberg (2000) Subcutaneous and visceral adipose tissue: their relation to the metabolic syndrome, Endocr Rev.21:697-738, which is incorporated herein by reference. Metabolic syndrome can be characterized by a cluster of conditions defined as at least three of the five following metabolic risk factors: 1. Large waistline (> 35 inches for women or > 40 inches for men); 2. High triglyceride level (> 150 mg / dl); 3. Low HDL cholesterol (< 50 mg / dl for women or < 40 mg / dl for men); 4. Elevated blood pressure (> 130 / 85) or on medicine to treat high blood pressure; and 33 ME151168599v.1 33 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO 5. High fasting blood sugar (> 100 mg / dl) or being in medicine to treat high blood sugar. The agents for treatment of metabolic syndrome depend on the specific risk factors present, e.g., normalize lipids when lipids are abnormal, normalize glucose or insulin sensitivity when they are abnormal. Metabolic syndrome, insulin resistance, and type 2 diabetes can be associated with decreased renal function or the potential for decreased renal function. In certain embodiments, the compositions and methods of the disclosure are for use in treatment of subjects with dyslipidemia, disorders of glycemic control, metabolic syndrome, and obesity. For example, in certain embodiments, the compositions and methods of the disclosure are for use in subjects with metabolic syndrome, insulin resistance, or type 2 diabetes and chronic kidney disease. In certain embodiments, the compositions and methods are for use in subjects with metabolic syndrome, insulin resistance, or type 2 diabetes who are suffering from one or more of cardiovascular disease, hypothyroidism, or inflammatory disease; or elderly subjects (e.g., over 65). In certain embodiments, the compositions and methods are for use in subjects with metabolic syndrome, insulin resistance, or type 2 diabetes who are also taking a drug that can reduce kidney function as demonstrated by the drug label. For example, in certain embodiments the compositions and methods of the disclosure are for use in subjects with metabolic syndrome, insulin resistance, or type 2 diabetes who are being treated with oral coagulants or probencid. For example, in certain embodiments the compositions and methods of the disclosure are for use in subjects with metabolic syndrome, insulin resistance, or type 2 diabetes who are being treated with diuretics, especially thiazide diuretics. In certain embodiments, the compositions and methods of the disclosure are used in combination with other agents to reduce serum uric acid. In certain embodiments, the compositions and methods of the disclosure are used in combination with agents for treatment of symptoms of metabolic syndrome, insulin resistance, or type 2 diabetes. In certain embodiments, subjects are treated with e.g., agents to decrease blood pressure, e.g., diuretics, beta-blockers, ACE inhibitors, angiotensin II receptor blockers, calcium channel blockers, alpha blockers, alpha-2 receptor antagonists, combined alpha- and beta-blockers, central agonists, peripheral adrenergic inhibitors, and blood vessel dialators; agents to decrease cholesterol, e.g., statins, selective cholesterol absorption inhibitors, resins, or lipid lowering therapies; or agents to normalize blood sugar, e.g., metformin, sulfonylureas, meglitinides, thiazolidinediones, DPP-4 inhibitors, GLP-1 receptor antagonists, and SGLT2 inhibitors. In certain embodiments, the compositions and methods of the disclosure are used for treatment of subjects with reduced kidney function or susceptible to reduced kidney function, e.g., due to age, comorbidities, or drug interactions. The iRNA and additional therapeutic agents may be administered at the same time or in the same combination, e.g., parenterally, or the additional therapeutic agent can be administered as part of a separate composition or at separate times or by another method known in the art or described herein. 34 ME151168599v.1 34 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO In addition, the present disclosure provides methods of reducing fructose metabolism in a cell, such as a cell in a subject. The methods include contacting the cell with an RNAi agent or pharmaceutical composition comprising an iRNA agent of the disclosure. In the methods of the disclosure the cell may be contacted in vitro or in vivo, i.e., the cell may be within a subject. A cell suitable for treatment using the methods of the disclosure may be any cell that expresses a KHK gene. A cell suitable for use in the methods of the disclosure may be a mammalian cell, e.g., a primate cell (such as a human cell or a non-human primate cell, e.g., a monkey cell or a chimpanzee cell), a non-primate cell (such as a cow cell, a pig cell, a camel cell, a llama cell, a horse cell, a goat cell, a rabbit cell, a sheep cell, a hamster, a guinea pig cell, a cat cell, a dog cell, a rat cell, a mouse cell, a lion cell, a tiger cell, a bear cell, or a buffalo cell), a bird cell (e.g., a duck cell or a goose cell), or a whale cell. In one embodiment, the cell is a human cell, e.g., a human liver cell. KHK expression is inhibited in the cell by at least about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or about 100%. In preferred embodiments, KHK expression is inhibited by at least 20%. In one embodiment, the in vivo methods of the disclosure may include administering to a subject a composition containing an iRNA, where the iRNA includes a nucleotide sequence that is complementary to at least a part of an RNA transcript of the KHK gene of the mammal to be treated. When the organism to be treated is a mammal such as a human, the composition can be administered by any means known in the art including, but not limited to oral, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal and intrathecal), intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), nasal, rectal, and topical (including buccal and sublingual) administration. In certain embodiments, the compositions are administered by intravenous infusion or injection. In certain embodiments, the compositions are administered by subcutaneous injection, e.g., using a pre-filled syringe. In some embodiments, the administration is via a depot injection. A depot injection may release the iRNA, or a pharmaceutically acceptable salt thereof, in a consistent way over a prolonged time period. Thus, a depot injection may reduce the frequency of dosing needed to obtain a desired effect, e.g., a desired inhibition of KHK, or a therapeutic or prophylactic effect. A depot injection may also provide more consistent serum concentrations. Depot injections may include subcutaneous injections or intramuscular injections. In preferred embodiments, the depot injection is a subcutaneous injection. In some embodiments, the administration is via a pump. The pump may be an external pump or a surgically implanted pump. In certain embodiments, the pump is a subcutaneously implanted osmotic pump. In other embodiments, the pump is an infusion pump. An infusion pump may be used for intravenous, subcutaneous, arterial, or epidural infusions. In preferred embodiments, the infusion 35 ME151168599v.1 35 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO pump is a subcutaneous infusion pump. In other embodiments, the pump is a surgically implanted pump that delivers the iRNA, or a pharmaceutically acceptable salt thereof, to the liver. An iRNA, or a pharmaceutically acceptable salt thereof, of the disclosure may be present in a pharmaceutical composition, such as in a suitable buffer solution. The buffer solution may comprise acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof. In one embodiment, the buffer solution is phosphate buffered saline (PBS). The pH and osmolarity of the buffer solution containing the iRNA can be adjusted such that it is suitable for administering to a subject. Alternatively, an iRNA, or a pharmaceutically acceptable salt thereof, of the disclosure may be administered as a pharmaceutical composition, such as a dsRNA liposomal formulation. The mode of administration may be chosen based upon whether local or systemic treatment is desired and based upon the area to be treated. The route and site of administration may be chosen to enhance targeting. In one aspect, the present disclosure also provides methods for inhibiting the expression of an KHK gene in a mammal. The methods include administering to the mammal a composition comprising a dsRNA that targets a KHK gene in a cell of the mammal, thereby inhibiting expression of the KHK gene in the cell. In some embodiment, the methods include administering to the mammal a composition comprising a dsRNA, or a pharmaceutically acceptable salt thereof, that targets a KHK gene in a cell of the mammal, thereby inhibiting expression of the KHK gene in the cell. In another embodiment, the methods include administering to the mammal a pharmaceutical composition comprising a dsRNA agent, or a pharmaceutically acceptable salt thereof, that targets a KHK gene in a cell of the mammal. Reduction in gene expression can be assessed by any methods known it the art and by methods, e.g. qRT-PCR, described herein. Reduction in protein production can be assessed by any methods known it the art and by methods, e.g. ELISA, enzymatic activity, described herein. For example, a reduction in the expression of KHK may be determined by determining the mRNA expression level of KHK using methods routine to one of ordinary skill in the art, e.g., Northern blotting, qRT-PCR; by determining the protein level of KHK using methods routine to one of ordinary skill in the art, such as Western blotting, immunological techniques. In certain embodiments, a puncture liver biopsy sample serves as the tissue material for monitoring the reduction in the KHK gene or protein expression. In other embodiments, a blood sample serves as the subject sample for monitoring the reduction in the KHK protein expression. A reduction in the expression of KHK may also be assessed indirectly by measuring a decrease in fructose metabolism by detecting one or more indicators of fructose metabolism, e.g., the presence of fructose in the serum and / or urine indicating lack of fructose metabolism. In addition, a reduction in the expression of KHK may be assessed indirectly by measuring a decrease in the circulating level of FGF21, and / or an increase in serum and / or urine fructose levels in response to an oral fructose load. Alternatively, a reduction in the expression of KHK may be assessed by measuring the level of hemoglobin A1C (HbA1C), or by measuring glucose homeostasis, e.g., by assessing area under the curve (AUC) for 36 ME151168599v.1 36 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO glucose and insulin in response to a glucose load, or by measuring liver fat, e.g., by assessing changes in liver magnetic resonance imaging (MRI). In some embodiments, the methods further comprise determining whether the subject is overweight to obese. In some embodiments, a subject is overweight if their body mass index (BMI) is 25.0-29.9 kg / m2. In some embodiments, a subject is obese if their BMI is over 30 kg / m2. Obesity can be a characteristic of a subject having, or at risk of developing, type 2 diabetes. In one embodiment, a subject that would benefit from the reduction of the expression of KHK is, for example, a subject that has type 2 diabetes and prediabetes, or obesity; a subject that has high levels of fats in the blood, such as cholesterol, or has high blood pressure; a subject that has certain metabolic disorders, including metabolic syndrome; a subject that has rapid weight loss; a subject that has certain infections, such as hepatitis C infection, or a subject that has been exposed to some toxins. The iRNA, or a pharmaceutically acceptable salt thereof, can be adeministered by any known methods in the art. In some embodiments, the iRNA, or a pharmaceutically acceptable salt thereof, is administered to the subject intravenously, intramuscularly, or subcutaneously. The iRNA, or a pharmaceutically acceptable salt thereof, can be administered by intravenous infusion over a period of time, on a regular basis. In certain embodiments, after an initial treatment regimen, the treatments can be administered on a less frequent basis. Administration of the iRNA, or a pharmaceutically acceptable salt thereof, can reduce KHK levels, e.g., in a cell, tissue, blood, urine or other compartment of the patient by at least about 5%, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 39, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or at least about 99% or more. In a preferred embodiment, administration of the iRNA, or a pharmaceutically acceptable salt thereof, can reduce KHK levels, e.g., in a cell, tissue, blood, urine or other compartment of the patient by at least 20%. Before administration of a full dose of the iRNA, or a pharmaceutically acceptable salt thereof, patients can be administered a smaller dose, such as a 5% infusion reaction, and monitored for adverse effects, such as an allergic reaction. In another example, the patient can be monitored for unwanted immunostimulatory effects, such as increased cytokine (e.g., TNF-alpha or INF-alpha) levels. Alternatively, the iRNA, or a pharmaceutically acceptable salt thereof, can be administered subcutaneously, i.e., by subcutaneous injection. One or more injections may be used to deliver the desired daily dose of iRNA, or a pharmaceutically acceptable salt thereof, to a subject. The injections may be repeated over a period of time. The administration may be repeated on a regular basis. In certain embodiments, after an initial treatment regimen, the treatments can be administered on a less frequent basis. A repeat-dose regimen may include administration of a therapeutic amount of iRNA, or a pharmaceutically acceptable salt thereof, on a regular basis, such as every other day or to once a year. In certain embodiments, the iRNA, or a pharmaceutically acceptable salt thereof, is 37 ME151168599v.1 37 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO administered about once per week, once every 7-10 days, once every 2 weeks, once every 3 weeks, once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, once every 9 weeks, once every 10 weeks, once every 11 weeks, once every 12 weeks, once per month, once every 2 months, once every 3 months (once per quarter), once every 4 months, once every 5 months, or once every 6 months, or every 12 months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 25 mg every three months. In some embodiments, thedsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a doseof about 75 mg every three months. In some embodiments, the dsRNA agent, or a pharmaceuticallyacceptable salt thereof, is administered to the subject at a dose of about 150 mg every three months. Insome embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administeredto the subject at a dose of about 300 mg every three months. In some embodiments, the dsRNA agent,or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 600 mgevery three months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable saltthereof, is administered to the subject at a dose of about 450 mg every three months. In someembodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to thesubject at a dose of about 1200 mg every three months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 25 mg every six months. In some embodiments, thedsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a doseof about 75 mg every six months. In some embodiments, the dsRNA agent, or a pharmaceuticallyacceptable salt thereof, is administered to the subject at a dose of about 150 mg every six months. Insome embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administeredto the subject at a dose of about 300 mg every six months. In some embodiments, the dsRNA agent,or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 600 mgevery six months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable saltthereof, is administered to the subject at a dose of about 450 mg every six months. In someembodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to thesubject at a dose of about 1200 mg every six months. In one embodiment, the method includes administering a composition featured herein such that expression of the target KHK gene is decreased, such as for about 1, 2, 3, 4, 5, 6, 7, 8, 12, 16, 18, 24 hours, 28, 32, or abour 36 hours. In one embodiment, expression of the target KHK gene is decreased for an extended duration, e.g., at least about two, three, four days or more, e.g., about one week, two weeks, three weeks, or four weeks or longer. Administration of the dsRNA, or a pharmaceutically acceptable salt thereof, according to the methods of the disclosure may result in a reduction of the severity, signs, symptoms, and / or markers of such diseases or disorders in a patient with a disorder of lipid metabolism. By “reduction” in this context is meant a statistically significant decrease in such level. The reduction can be, for example, 38 ME151168599v.1 38 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or about 100%. Efficacy of treatment or prevention of disease can be assessed, for example by measuring disease progression, disease remission, symptom severity, reduction in pain, quality of life, dose of a medication required to sustain a treatment effect, level of a disease marker or any other measurable parameter appropriate for a given disease being treated or targeted for prevention. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring any one of such parameters, or any combination of parameters. Comparisons of the later readings with the initial readings provide a physician an indication of whether the treatment is effective. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring any one of such parameters, or any combination of parameters. In connection with the administration of an iRNA, or a pharmaceutically acceptable salt thereof, or pharmaceutical composition thereof, "effective against" a KHK-associated disorder indicates that administration in a clinically appropriate manner results in a beneficial effect for at least a statistically significant fraction of patients, such as a improvement of symptoms, a cure, a reduction in disease, extension of life, improvement in quality of life, or other effect generally recognized as positive by medical doctors familiar with treating the disorder and the related causes. A treatment or preventive effect is evident when there is a statistically significant improvement in one or more parameters of disease status, or by a failure to worsen or to develop symptoms where they would otherwise be anticipated. As an example, a favorable change of at least 10% in a measurable parameter of disease, and preferably at least 20%, 30%, 40%, 50% or more can be indicative of effective treatment. Efficacy for a given iRNA drug or formulation of that drug can also be judged using an experimental animal model for the given disease as known in the art. The disclosure further provides methods for the use of a iRNA agent, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition of the disclosure, e.g., for treating a subject that would benefit from reduction and / or inhibition of KHK expression, e.g., a subject having a KHK- associated disease disorder, or condition, in combination with other pharmaceuticals and / or other therapeutic methods, e.g., with known pharmaceuticals and / or known therapeutic methods, such as, for example, those which are currently employed for treating these disorders. The iRNA agent and an additional therapeutic agent and / or treatment may be administered at the same time and / or in the same combination, e.g., subcutaneously, or the additional therapeutic agent can be administered as part of a separate composition or at separate times and / or by another method known in the art or described herein. III. Delivery of an iRNA of the Disclosure The delivery of an iRNA of the disclosure to a cell e.g., a cell within a subject, such as a human subject (e.g., a subject in need thereof, such as a subject having a KHK-associated disorder, e.g., type 2 diabetes) can be achieved in a number of different ways. For example, delivery may be 39 ME151168599v.1 39 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO performed by contacting a cell with an iRNA of the disclosure either in vitro or in vivo. In vivo delivery may also be performed directly by administering a composition comprising a dsRNA, or a pharmaceutically acceptable salt thereof, to a subject. Alternatively, in vivo delivery may be performed indirectly by administering one or more vectors that encode and direct the expression of the iRNA. One or more injections may be used to deliver the desired fixed dose of iRNA to the subject. The injections may be repeated over a period of time. In some embodiments, the subcutaneous injection is achieved using a pre-filled syringe. The administration may be repeated on a regular basis. In certain embodiments, the iRNA is administered about once per month to about once per quarter, i.e., about every three months, or about once per quarter to about twice per year, i.e., about once every six months. In certain embodiments, the iRNA is administered once per month. In other embodiments, the iRNA is administered every three months (once per quarter). In yet another embodiment, the iRNA is administered every six months (biannually). In some embodiments, the fixed dose is administered to the subject at an interval of once every month to every two months. In some embodiments, the fixed dose is administered to the subject at an interval of once every three to six months. In some embodiments, the fixed dose is administered to the subject at an interval of once every month. In some embodiments, the fixed dose is administered to the subject at an interval of once every two months. In some embodiments, the fixed dose is administered to the subject at an interval of once every three months. In some embodiments, the fixed dose is administered to the subject at an interval of once every four months. In some embodiments, the fixed dose is administered to the subject at an interval of once every five months. In some embodiments, the fixed dose is administered to the subject at an interval of once every six months. In some embodiments, the method comprises administering to the subject a fixed dose of about 25 mg to about 1200 mg, about 50 mg to about 1200 mg, about 75 mg to about 1200 mg, about 100 mg to about 1200 mg, about 150 mg to about 1200 mg, about 200 mg to about 1200 mg, about 250 mg to about 1200 mg, about 300 mg to about 1200 mg, about 350 mg to about 1200 mg, about 400 mg to about 1200 mg, about 450 mg to about 1200 mg, about 500 mg to about 1200 mg, about 550 mg to about 1200 mg, about 600 mg to about 1200 mg, about 700 mg to about 1200 mg, about 800 mg to about 1200 mg, about 900 mg to about 1200 mg, about 1000 mg to about 1200 mg, about 25 mg to about 600 mg, about 75 mg to about 600 mg, about 150 mg to about 600 mg, about 300 to about 600 mg, about 450 to about 600 mg, about 25 mg to about 100 mg, about 100 mg to about 150 mg, 150 mg to about 200 mg, 200 mg to about 250 mg, about 250 mg to about 300 mg, about 300 mg to about 350 mg, about 350 mg to about 400 mg, about 400 mg to about 450 mg, about 450 mg to about 500 mg, about 500 mg to about 550 mg, about 550 mg to about 600 mg, about 650 mg to about 700 mg, about 700 mg to about 750 mg, about 750 mg to about 800 mg, about 800 mg to about 850 mg, about 850 mg to about 900 mg, about 900 mg to about 950 mg, about 950 mg to about 1000 mg, 40 ME151168599v.1 40 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO about 1000 mg to about 1050 mg, about 1050 mg to about 1100 mg, about 1150 mg to about 1200 mg, about 25 mg to about 150 mg, about 75 mg to about 200 mg, about 100 mg to about 250 mg, about 150 mg to about 300 mg, about 200 mg to about 350 mg, about 250 mg to about 400 mg, about 300 mg to about 450 mg, about 350 mg to about 500 mg, about 400 mg to about 600 mg, about 500 mg to about 800 mg, about 600 mg to about 900 mg, or about 1100 mg to about 1200 mg, e.g., a fixed dose of about 25, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1000, 1100, or 1200 mg, of a dsRNA agent, or a pharmaceutically acceptable salt thereof, that inhibits expression of KHK. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 25 mg every three months. In some embodiments, thedsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a doseof about 75 mg every three months. In some embodiments, the dsRNA agent, or a pharmaceuticallyacceptable salt thereof, is administered to the subject at a dose of about 150 mg every three months. Insome embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administeredto the subject at a dose of about 300 mg every three months. In some embodiments, the dsRNA agent,or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 600 mgevery three months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable saltthereof, is administered to the subject at a dose of about 1200 mg every three months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, isadministered to the subject at a dose of about 25 mg every six months. In some embodiments, thedsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a doseof about 75 mg every six months. In some embodiments, the dsRNA agent, or a pharmaceuticallyacceptable salt thereof, is administered to the subject at a dose of about 150 mg every six months. Insome embodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administeredto the subject at a dose of about 300 mg every six months. In some embodiments, the dsRNA agent,or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 600 mgevery six months. In some embodiments, the dsRNA agent, or a pharmaceutically acceptable saltthereof, is administered to the subject at a dose of about 450 mg every six months. In someembodiments, the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to thesubject at a dose of about 1200 mg every six months. IV. iRNAs for Use in the Methods of the Disclosure Suitable double-stranded RNAi agents for use in the methods of the disclosure include the dsRNA agent AD-1613400. AD-1613400 comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’- gscsaggaagCfAfCfugagauucgu-3’ of SEQ ID NO:17 and the antisense strand comprises the nucleotide sequence 5’- asdCsgadAudCucagdTgCfuuccugcsasc -3’ of SEQ ID NO:19, wherein a, g, c 41 ME151168599v.1 41 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO and u are 2′-O-methyl (2′-OMe) A, G, C, and U; Cf and Uf are 2′-deoxy-2’-fluoro (2’-F) C and U; dC, dA, and dT are 2′-deoxy C, A, and T; and s is a phosphorothioate linkage; and wherein a ligand is conjugated to the 3’ end of the sense strand as shown in the following schematic wherein X is O. Suitable double-stranded RNAi agents for use in the methods of the disclosure also include dsRNA agents comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises a nucleotide sequence differing by no more than 4, 3, 2, or 1 modified or unmodified nucleotides from the nucleotide sequence 5’- gscsaggaagCfAfCfugagauucgu- 3’ of SEQ ID NO:17 and the antisense strand comprises a nucleotide sequence differing by no more than 4, 3, 2, or 1 modified or unmodified nucleotides from the nucleotide sequence 5’- asdCsgadAudCucagdTgCfuuccugcsasc -3’ of SEQ ID NO:19, wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U; Cf and Uf are 2′-deoxy-2’-fluoro (2’-F) C and U; dC, dA, and dT are 2′- deoxy C, A, and T; and s is a phosphorothioate linkage; and wherein a ligand is conjugated to the 3’ end of the sense strand as shown in the following schematic Suitable double-stranded RNAi agents for use in the methods of the disclosure also include a pharmaceutically acceptable salt form of the dsRNA agent AD-1613400. Any salt that is pharmaceutically acceptable, e.g., a sodium salt of the dsRNA agent may be used. In one 42 ME151168599v.1 42 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO embodiment, the pharmaceutically acceptable salt of the dsRNA of the disclosure being used in the methods of the disclosure has the structure shown in Figure 5. Additional dsRNA agents that may be used in the methods of the disclosure are described in International PCT Publication Nos. WO 2022 / 182574 and WO 2021 / 178736, the entire contents of each of which are incorporated herein by reference. V. Pharmaceutical Compositions of the Disclosure The present disclosure also includes pharmaceutical compositions and formulations which include the iRNAs of the disclosure. In one embodiment, provided herein are pharmaceutical compositions containing an iRNA, as described herein, and a pharmaceutically acceptable carrier. The pharmaceutical compositions containing the iRNA of the disclosure are useful for treating a disease or disorder associated with the expression or activity of a KHK gene, e.g., a KHK-associated disease, e.g., type 2 diabetes. Such pharmaceutical compositions are formulated based on the mode of delivery. The pharmaceutical compositions comprising RNAi agents of the disclosure may be, for example, solutions with or without a buffer, or compositions containing pharmaceutically acceptable carriers. Such compositions include, for example, aqueous or crystalline compositions, liposomal formulations, micellar formulations, emulsions, and gene therapy vectors. In the methods of the disclosure, the RNAi agent may be administered in a solution. In some embodiments, the solution is a sterile solution. An RNAi agent may be administered in an unbuffered solution, e.g., in saline or in water. Alternatively, the RNAi agent may also be administered in a suitable buffer solution. The buffer solution may comprise acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof. In one embodiment, the buffer solution is phosphate buffered saline (PBS). The pH and osmolarity of the buffer solution containing the RNAi agent can be adjusted such that it is suitable for administering to a subject. In some embodiments, the buffer solution further comprises an agent for controlling the osmolarity of the solution, such that the osmolarity is kept at a desired value, e.g., at the physiologic values of the human plasma. Solutes which can be added to the buffer solution to control the osmolarity include, but are not limited to, proteins, peptides, amino acids, non-metabolized polymers, vitamins, ions, sugars, metabolites, organic acids, lipids, or salts. In some embodiments, the agent for controlling the osmolarity of the solution is a salt. In certain embodiments, the agent for controlling the osmolarity of the solution is sodium chloride or potassium chloride. In some embodiments, the pharmaceutical compositions of the disclosure are pyrogen free or non-pyrogenic. The pharmaceutical compositions of the present disclosure can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration can be topical (e.g., by a transdermal patch), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and 43 ME151168599v.1 43 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO transdermal, oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subdermal, e.g., via an implanted device; or intracranial, e.g., by intraparenchymal, intrathecal or intraventricular, administration. One example is compositions that are formulated for systemic administration via parenteral delivery, e.g., by subcutaneous (SC), intramuscular (IM), or intravenous (IV) delivery. The pharmaceutical compositions of the disclosure may be administered in dosages sufficient to inhibit expression of a KHK gene. In some embodiments, a fixed dose of about 25 mg to about 1200 mg of the iRNA agents is administered to the subject. In some embodiments, the method comprises administering to the subject a fixed dose of about 25 mg to about 1200 mg, about 50 mg to about 1200 mg, about 75 mg to about 1200 mg, about 100 mg to about 1200 mg, about 150 mg to about 1200 mg, about 200 mg to about 1200 mg, about 250 mg to about 1200 mg, about 300 mg to about 1200 mg, about 350 mg to about 1200 mg, about 400 mg to about 1200 mg, about 450 mg to about 1200 mg, about 500 mg to about 1200 mg, about 550 mg to about 1200 mg, about 600 mg to about 1200 mg, about 700 mg to about 1200 mg, about 800 mg to about 1200 mg, about 900 mg to about 1200 mg, about 1000 mg to about 1200 mg, about 25 mg to about 600 mg, about 75 mg to about 600 mg, about 150 mg to about 600 mg, about 300 to about 600 mg, about 450 to about 600 mg, about 25 mg to about 100 mg, about 100 mg to about 150 mg, 150 mg to about 200 mg, 200 mg to about 250 mg, about 250 mg to about 300 mg, about 300 mg to about 350 mg, about 350 mg to about 400 mg, about 400 mg to about 450 mg, about 450 mg to about 500 mg, about 500 mg to about 550 mg, about 550 mg to about 600 mg, about 650 mg to about 700 mg, about 700 mg to about 750 mg, about 750 mg to about 800 mg, about 800 mg to about 850 mg, about 850 mg to about 900 mg, about 900 mg to about 950 mg, about 950 mg to about 1000 mg, about 1000 mg to about 1050 mg, about 1050 mg to about 1100 mg, about 1150 mg to about 1200 mg, about 25 mg to about 150 mg, about 75 mg to about 200 mg, about 100 mg to about 250 mg, about 150 mg to about 300 mg, about 200 mg to about 350 mg, about 250 mg to about 400 mg, about 300 mg to about 450 mg, about 350 mg to about 500 mg, about 400 mg to about 600 mg, about 500 mg to about 800 mg, about 600 mg to about 900 mg, or about 1100 mg to about 1200 mg, e.g., about 25, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150 or 1200 mg, of a dsRNA agent, or a pharmaceutically acceptable salt thereof, that inhibits expression of KHK. A repeat-dose regimen may include administration of a therapeutic amount of iRNA on a regular basis, such as every month, every two months, every three months, every four months, every five months, every six months, once every 3-6 months, or once a year. In certain embodiments, the iRNA is administered about once per month to about once per quarter to about once per six months. After an initial treatment regimen, the treatments can be administered on a less frequent basis. Duration of treatment can be determined based on the severity of disease. The skilled artisan will appreciate that certain factors can influence the dosage and timing required to effectively treat a subject, including but not limited to mutations present in the subject, previous treatments, the general health or age of the subject, and other diseases present. Moreover, 44 ME151168599v.1 44 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO treatment of a subject with a prophylactically or therapeutically effective amount, as appropriate, of a composition can include a single treatment or a series of treatments. The RNAi agent can be delivered in a manner to target a particular tissue (e.g., hepatocytes). Pharmaceutical compositions of the present disclosure include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions can be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids, and self-emulsifying semisolids. Formulations include those that target the liver. The pharmaceutical formulations of the present disclosure, which can conveniently be presented in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers. VII. Kits The present disclosure also provides kits for performing any of the methods of the disclosure. Such kits include one or more RNAi agent(s) and instructions for use, e.g., instructions for administering a fixed dose of a double stranded RNAi agent(s). The double stranded RNAi agent may be in a vial or a pre-filled syringe. The kits may optionally further comprise means for administering the double stranded RNAi agent (e.g., an injection device, such as a pre-filled syringe), or means for measuring the inhibition of KHK (e.g., means for measuring the inhibition of KHK mRNA, KHK protein, and / or KHK activity). Such means for measuring the inhibition of KHK may comprise a means for obtaining a sample from a subject, such as, e.g., a plasma sample. The kit may be packaged in a number of different configurations such as one or more containers in a single box. The different components can be combined, e.g., according to instructions provided with the kit. The kits of the disclosure may optionally further comprise means for determining the therapeutically effective or prophylactically effective amount. The present disclosure also provides vials comprising the dsRNA agent, or a pharmaceutically acceptable salt thereof, of the disclosure or the pharmaceutical composition of the disclosure. The present disclosure further provides syringes comprising the dsRNA agent, or a pharmaceutically acceptable salt thereof, of the disclosure or the pharmaceutical composition of the disclosure. In some embodiments, the RNAi agent (e.g., AD-1613400), or a pharmaceutically acceptable salt thereof, described herein is administered (e.g., subcutaneously) in a syringe, such as a pre-filled syringe to a subject in need thereof. Pre-filled syringes are designed to fit into specialized syringes, which can be used to administer the RNAi agent, or a pharmaceutically acceptable salt thereof, described herein. Pre-filled syringes offer several advantages inlcuding convenience, affordability, accuracy, sterility, and safety (Makwana et al., Int J Pharm Investig.2011 Oct-Dec; 1(4): 200–206; incorporated in its entirety herein by reference). Pre-filled syringes also assure that patients receive 45 ME151168599v.1 45 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO accurate dosages. This is especially advantageous for patients who need to self-inject medication, but have no medical training. In some embodiments, the RNAi agent (e.g., AD-1613400) stored inside of a pre-filled syringe is in a sterile solution. In some embodiments the pre-filled syringe is made of glass. In some embodiments the pre- filled syringe is made of plastic. In some embodiments, the kit further comprises instructions, for example, for administering the RNAi agent (e.g., AD-1613400), or a pharmaceutically acceptable salt thereof, in a syringe, such as a pre-filled syringe. For example, the instructions may be performed under the supervision of a drug investigator. These instructions simply embody the disclosure provided herein. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the iRNAs and methods featured in the disclosure, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. 46 ME151168599v.1 46 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO EXAMPLES Example 1. A Phase 1 / 2, Randomized, Double-Blind, Placebo-Controlled, 2-Part Study of the Safety, Tolerability, Efficacy, Pharmacokinetics, and Pharmacodynamics of Single Dose ALN- KHK in Overweight to Obese Adult Healthy Subjects and Multiple Dose ALN-KHK in Obese Patients with Type 2 Diabetes Mellitus (T2DM) Rising obesity rates are attributed in part to high dietary sugar consumption, including fructose, which is linked to development of hepatosteatosis and type 2 diabetes. Relative to glucose, fructose is preferentially metabolized in the liver and can contribute to development of hepatic steatosis, which is strongly associated with hepatic insulin resistance and type 2 diabetes. Fisher FM et al. Mol Metab 2016;6:14–21; Softic S et al. J Clin Invest 2017;127:4059–74. ALN-KHK has the potential to provide sustained glycemic control through a distinct mechanism as compared to other therapies, with a profile that allows infrequent administration thus improving adherence. ALN-KHK comprises an siRNA targeting KHK mRNA conjugated to a GalNAc-containing ligand. KHK catalyzes the first step of fructose metabolism, the phosphorylation of fructose to fructose-1-phosphate (F1P). F1P drives numerous pathological processes that include gluconeogenesis and de novo lipogenesis, which contribute to insulin resistance and relatedcomorbidities such as NASH. (Figure 1). KHK-mediated fructose metabolism contributes to hepaticsteatosis and insulin resistance. Loss of function mutations in humans cause essential fructosuria, a benign and asymptomatic condition. In Part A of the study, single ascending doses (SAD) of ALN-KHK were administered subcutaneously in overweight to obese adult healthy subjects. In Part B of the study, multiple-doses (MD) of ALN-KHK are administered subcutaneously to obese patients with Type 2 Diabetes Mellitus (T2DM). Objectives of the study included the evaluation of safety and tolerability for ALN-KHK, the characterization of plasma and urine pharmacokinetics for ALN-KHK, and the evaluation of the pharmacodynamics effect of ALN-KHK on circulating serum and urinary fructose and circulating fibroblast growth factor 21 (FGF21) in response to an oral fructose load. Further objectives also include assessement of the effects of repeat dosing on hemoglobin A1C (HbA1C), homeostatic model assessment of insulin resistance (HOMA-IR), and further evaluation of the pharmacodynamics effect of ALN-KHK on glucose homeostasis as assessed by area under the curve (AUC) for glucose and insulin in response to a glucose load, and the pharmacodynamics effect of ALN-KHK on liver fat assessed by the changes in liver magnetic resonance imaging (MRI). The unmodified and modified sequences for AD-1613400 (ALN_KHK) are included in Table 2 below. Table 2. Sequences of AD-1613400 47 ME151168599v.1 47 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO Summary of Objectives and Endpoints Part A: Abbreviations: ADA=anti-drug antibodies; AE=adverse event; AUC=area under the curve; Cmax=maximum plasma concentration; ECG=electrocardiogram; fe=fraction of drug excreted; FGF21=fibroblast growth factor 21; HbA1C=hemoglobin A1C; HOMA-IR=Homeostatic Model Assessment of Insulin Resistance; hsCRP=high- sensitivity C-reactive protein; PD=pharmacodynamic(s); PK=pharmacokinetic(s); tmax=time to maximum plasma concentration; TNF=tumor necrosis factor. Part B: 48 ME151168599v.1 48 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO Abbreviations: ADA=anti-drug antibodies; AE=adverse event; AUC=area under the curve; ECG=electrocardiogram; ELF score= Enhanced Liver Fibrosis score; FGF21=fibroblast growth factor 21; HbA1C=hemoglobin A1C; HOMA-IR=Homeostatic Model Assessment of Insulin Resistance; hsCRP=high-sensitivity C-reactive protein; IL-6=interleukin 6; MRI=magnetic resonance imaging; PD=pharmacodynamic(s); PK=pharmacokinetic(s); TNF=tumor necrosis factor. 49 ME151168599v.1 49 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO Summary of Study Design This is a first-in-human, randomized, double-blind, placebo-controlled SAD and MD Phase 1 / 2 study designed to evaluate the safety, tolerability, efficacy, PK, and PD effects of ALN-KHK administered subcutaneously (SC) in overweight to obese healthy subjects and obese patients with Type 2 Diabetes Mellitus (T2DM), respectively. This study is conducted in 2 parts: • Part A: SAD part in overweight to obese healthy adult subjects • Part B: MD part in adult obese patients with Type 2 Diabetes Mellitus (T2DM) A single SC dose of study drug was administered in Part A. In Part B, two doses of study drug are planned to be administered 12 weeks apart. Part A. SAD in Overweight to Obese Healthy Volunteers 40 overweight to obese non-diabetic healthy volunteers were enrolled in the study. There were 5 SAD cohorts in Part A to evaluate single doses of study drug as indicated in Figure 2. Each cohort was randomized in a 3:1 ratio to receive a single dose of ALN-KHK or placebo. There were 8 subjects in each cohort. Two optional dose cohorts may be added to better understand safety, tolerability, efficacy, PK and PD of single-dose administration of ALN-KHK up to a maximum dose of 1200 mg defined by PK / PD modeling data, confirmed by the safety, tolerability, and response to the fructose tolerance test of all prior dose cohorts. Participants were observed for a 3-month double-blind period post-dose. After completion of the Month 3 visit, subjects treated with ALN-KHK were observed for up to 6 months for safety assessments. On Day 1 / baseline, subjects were randomized (3:1) to receive a single SC dose of ALN-KHK (25 mg to 600 mg) or placebo. Healthy volunteers who were dosed remained inpatient in the study site until discharge on Day 3. Study assessments were taken. Target engagement was assessed through response to an FTT. Fructose ingestion leads to an increase in circulating serum fructose and an associated increase in urinary fructose. Hepatic FGF21 is induced through the metabolism of fructose to F1P, which leads to an increase in circulating levels of the hepatokine FGF21; therefore an FGF21 was used as a marker of target engagement. Dushay JR et al. Mol Metab 2014;4:51–7. Based on its mechanism of action, treatment with ALN-KHK was expected to decrease circulating FGF21 following fructose ingestion. For the FTT, after an overnight fast for 12-14 hours, participants consumed 75 g of fructose dissolved in water. The FTT was conducted at Days −1, 29, 57, 85, and 169. Serum samples were collected before fructose ingestion and at 30, 60, 90, 120, 180, and 240 minutes after ingestion. A spot urine sample was obtained immediately before the fructose ingestion, and urine samples were collected over the ensuing 6 hours were pooled. Part B. MD in Obese Patients with T2DM 50 ME151168599v.1 50 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO Patients will include an HbA1C ≥7.5% to <10% and a BMI of ≥30 to ≤39.9 kg / m2to be eligible for randomization in Part B of the study. Patients in Part B are randomized in a 1:1 ratio to a multiple dose regimen of either ALN-KHK or placebo (Figure 3). Randomization is stratified by screening HbA1C (≤8.5% vs >8.5%). Patients are administered ALN-KHK at an individual dose level not to exceed 1200 mg, that is safe and tolerable as determined during Part A, or placebo for 2 SC doses of study drug over a 6-month double-blind Treatment period. Permitted therapies for patients with T2DM enrolling in this study include diet and exercise and / or monotherapy with metformin. After study drug administration on Day 1, patients have safety, tolerability, efficacy, and PD assessments through Month 6. All patients who complete Month 6 assessments have safety / PD follow-up monitoring to collect laboratory samples and perform safety / PD assessments at Month 9. The primary endpoint will be change in HbA1c. Additional parameters will include response to glucose load and MRI-PDFF (Magnetic Resonance Imaging Proton Density Fat Fraction). Inclusion Criteria Include Age and Sex 1. Male or female, aged 18-65 years, inclusive Participant and Disease Characteristics 2. Stable euthyroid status (no known changes in thyroid function or changes in dosing of exogenous thyroid medication in the last 4 months) at screening. Part A Specific Criteria 1. BMI ≥27 kg / m2to <34.9 kg / m2Part B Specific Criteria 1. HbA1C ≥7.5% to <10%. 2. BMI ≥30 kg / m2to ≤39.9 kg / m23. Confirmed T2DM diagnosis (≤8 years) based on medical history and HbA1C at screening. Exclusion Criteria Include Laboratory Assessments 1. Any clinical safety laboratory result considered clinically significant and unacceptable by the Investigator. Prior / Concomitant Therapy 1. Received an investigational agent within the last 30 days or 5 half-lives, whichever is longer, prior to the first dose of study drug, or are in follow-up of another clinical study prior to study enrollment. Any agent that has received health agency authorization (including for emergency use) by local or regional regulatory authorities is not considered investigational. Part A-specific criteria 51 ME151168599v.1 51 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO 1. History of Type 1 or Type 2 diabetes, maturity onset diabetes of the young (MODY)or family history of MODY, gestational diabetes, diabetes associated with any therapy (e.g., steroids). 2. Abnormal liver enzyme labs.3. Has an estimated glomerular filtration (eGFR) of <60 mL / min / 1.73 m2 at screening.Part B-specific criteria 1. History of Type 1 diabetes. Results – Part A In Part A of this Phase I study, healthy overweight to obese human volunteers with a BMI 27- 34.9 kg / m2were randomized 3:1 and were subcutaneously administered a single 25 mg, 75 mg, 150 mg, 300 mg, or 600 mg dose of ALN-KHK or placebo. Five dose cohorts (25, 75, 150, 300, and 600 mg) were evaluated over a 3-month period with follow up for up to 9 months. The primary endpoint assessed safety and tolerability. Secondary endpoints characterized pharmacokinetics and pharmacodynamics of ALN-KHK after a fructose tolerance test (FTT) prior to dosing and on Days 29, 57, 85, and 169. Forty participants enrolled (N=30, ALN-KHK; N=10, placebo; mean (SD) age, 45.4 (11.5) years; mean (SD) BMI, 29.7 (1.7) kg / m2; 67.5% male). Cohorts were generally well balanced in terms of age and key disease-related baseline characteristics (Table 3). One participant in the 150 mg cohort discontinued the study early owing to a personal reason. A second participant in this cohort was lost to follow-up after Day 85 of the study. Table 3. Patient Baseline Demographics 52 ME151168599v.1 52 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO BMI, body mass index; HbA1c, glycated hemoglobin; SD, standard deviation. Adverse events (AEs) were reported in 40% of participants receiving placebo and 33.3% of participants receiving ALN-KHK (Table 4). By data cutoff, all adverse events were mild, non-serious, and resolved. Two events (injection-site reactions) in the ALN-KHK 300 mg cohort were considered related to study drug; both cases were mild, transient, and resolved within 24 hours. Table 4. Frequency of AEs aMost common AEs are those occurring in >5% of patients. AE, adverse event; PY, patient-years. Secondary Endpoint: Assessment of Plasma and Urine Pharmacokinetics 53 ME151168599v.1 53 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO Peak plasma ALN-KHK was observed 3-10 hours after administration, and the elimination half-life was 5-8 hours. Concentrations of ALN-KHK in plasma were dose-proportional across the 25- 600 mg dose range. Urine excretion of ALN-KHK was less than 25%. Secondary Endpoint: Change from Baseline in Serum Fructose After Fructose Tolerance Test Increasing doses of ALN-KHK were generally associated with dose- and time-dependent increases in serum fructose area under the curve (AUC) and urinary fructose fraction excreted after FTT. Preliminary data showed a mean (SD) increase from baseline of 178.0% (84.4%) in serum fructose AUC with 300 mg at Day 85. Figure 4 depicts the fructose AUC data for the fructose tolerance test performed at various timepoints following ALN-KHK treatment. At day -1, all groups showed comparable results. However, from day 29 onwards, a dose dependent increase in serum fructose AUC was observed, indicating effective silencing of KHK in the livers of these subjects, providing evidence for target engagement. At the lowest ALN-KHK dose (25 mg), there was no significant increase in area under the concentration–time curve (AUC) for serum fructose. An increase in AUC was observed with the 75 mg and higher doses. The AUC at each dose was highest at Day 57 and Day 85. The effect was sustained to Day 169 with the 600 mg dose (Figure 4). With ALN-KHK 600 mg, mean increases of serum fructose from Day −1 (baseline) of greater than 2.5-fold were sustained to Day 169 (Figure 6). Secondary Endpoint: Change from Baseline in Urinary Fructose After Fructose Tolerance Test An increase in urinary fructose excretion was observed with the 75 mg and higher doses of ALN- KHK. With the 600 mg dose, mean (standard error of the mean) change in urinary fructose at Day 85 compared with Day −1 was 1751 (458) mg. (Figure 7). Mean fructose urinary excretion fraction of the total 75 g fructose load peaked at Day 85 for ALN-KHK 600 mg at 2.3%. Secondary Endpoint: Change from Baseline in Circulating FGF21 After Fructose Tolerance Test Decreased FGF21 was also observed in a dose- and time-dependent fashion. The mean suppression of serum FGF21 after FTT evident from change from baseline increased in a dose-dependent manner (Figure 8). Basal FGF21 level was not affected (data not shown). Mean reductions in FGF21-positive incremental AUC from Day −1 became more prominent with increasing doses of ALN-KHK (≥75 mg) through Day 85, with partial recovery at Day 169 (Figure 9). ALN-KHK appears safe and well-tolerated with target engagement confirmed. 54 ME151168599v.1 54 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO All adverse events were mild, non-serious, and resolved. They were generally balanced between ALN-KHK and placebo. Injection site reactions in 2 (6.7%) of ALN-KHK participants. There were no safety signals identified, including hepatic safety signals. Target engagement was observed based on increasing serum fructose, urine fructose, and suppression of serum fibroblast growth factor 21 (FGF21) in a dose-dependent manner following a fructose tolerance test (FTT). Interim results of this first clinical study of ALN-KHK demonstrate an encouraging safety and tolerability profile with target engagement in overweight to obese adults, supporting its further evaluation in patients with type 2 diabetes. These results support a potential for quarterly or bi-annual subcutaneous dosing. 55 ME151168599v.1 55 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO Table 1. Abbreviations of nucleotide monomers used in nucleic acid sequence representation. It will be understood that these monomers, when present in an oligonucleotide, are mutually linked by 3'^5’phosphodiester bonds; and it is understood that when the nucleotide contains a 2’-fluoro modification, then the fluoro replaces the hydroxy at that position in the parent nucleotide (i.e., it is a 2’-deoxy-2’-fluoronucleotide). The abbreviations are understood to omit the 3’-phosphate (i.e. they are 3’-OH) when placed at the 3’-terminal position of an oligonucleotide (unless the 3’-end is linked to a ligand). 56 ME151168599v.1 56 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO 57 ME151168599v.1 57 Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO 58 ME151168599v.1 58

Claims

Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO We claim:

1. A method of reducing KHK mRNA level in a subject, the method comprising administering to the subject a fixed dose of about 25 mg to about 1200 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, targeting a KHK gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’- GCAGGAAGCACUGAGAUUCGU -3’ of SEQ ID NO:18 and the antisense strand comprises the nucleotide sequence 5’- ACGAAUCUCAGTGCUUCCUGCAC -3’ of SEQ ID NO:20, thereby reducing the KHK mRNA level in the subject.

2. A method of treating a subject suffering from type 2 diabetes, the method comprising administering to the subject a fixed dose of about 25 mg to about 1200 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, targeting a KHK gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’- GCAGGAAGCACUGAGAUUCGU -3’ of SEQ ID NO:18 and the antisense strand comprises the nucleotide sequence 5’- ACGAAUCUCAGTGCUUCCUGCAC -3’ of SEQ ID NO:20, thereby treating the subject suffering from type 2 diabetes.

3. A method of preventing at least one symptom in a subject having type 2 diabetes, the method comprising administering to the subject a fixed dose of about 25 mg to about 1200 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, targeting a KHK gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’- GCAGGAAGCACUGAGAUUCGU -3’ of SEQ ID NO:18 and the antisense strand comprises the nucleotide sequence 5’- ACGAAUCUCAGTGCUUCCUGCAC -3’ of SEQ ID NO:20, thereby preventing at least one symptom in a subject having type 2 diabetes.

4. A method of reducing fructose metabolism in a subject having type 2 diabetes, the method comprising administering to the subject a fixed dose of about 25 mg to about 1200 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, targeting a KHK gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’- GCAGGAAGCACUGAGAUUCGU -3’ of SEQ ID NO:18 and the antisense strand comprises the 61 ME151168599v.1Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO nucleotide sequence 5’- ACGAAUCUCAGTGCUUCCUGCAC -3’ of SEQ ID NO:20, thereby reducing fructose metabolism in the subject having type 2 diabetes.

5. A method of improving insulin sensitivity in a subject having type 2 diabetes, the method comprising administering to the subject a fixed dose of about 25 mg to about 1200 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, targeting a KHK gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’- GCAGGAAGCACUGAGAUUCGU -3’ of SEQ ID NO:18 and the antisense strand comprises the nucleotide sequence 5’- ACGAAUCUCAGTGCUUCCUGCAC -3’ of SEQ ID NO:20, thereby improving insulin sensitivity in the subject having type 2 diabetes.

6. A method of reducing fatty acid synthesis in a subject having type 2 diabetes, the method comprising administering to the subject a fixed dose of about 25 mg to about 1200 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, targeting a KHK gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’- GCAGGAAGCACUGAGAUUCGU -3’ of SEQ ID NO:18 and the antisense strand comprises the nucleotide sequence 5’- ACGAAUCUCAGTGCUUCCUGCAC -3’ of SEQ ID NO:20, thereby reducing fatty acid synthesis in the subject having type 2 diabetes.

7. The method of any one of claims 1-6, wherein KHK mRNA level in the subject is reduced to at least about 70%, 65%, 60%, 55%, or 50% of baseline level 6 months after the first administration of the dsRNA agent, or a pharmaceutically acceptable salt thereof.

8. The method of any one of claims 1-7, wherein the administration of the dsRNA agent, or a pharmaceutically acceptable salt thereof, to the subject causes a decrease in KHK enzymatic activity, a decrease in KHK protein accumulation, a decrease in fibroblast growth factor 21 (FGF21) level, an increase in fructose level, an improved glymeric control, a normalization or decrease of serum lipid level, a decrease of lipid deposition in the liver, a decrease of visceral fat deposition, a decrease in body weight, a decrease in uric acid level, an improvement of kidney function, and / or a reduction of hypertension in the subject.

9. The method of any one of claims 1-8, wherein the subject is a human subject. 62 ME151168599v.1Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO 10. The method of any one of claims 1-9, wherein the subject is overweight to obese.

11. The method of any one of claims 1-10, wherein the dsRNA agent comprises at least one nucleotide modification.

12. The method of any one of claims 1-11, wherein substantially all of the nucleotides of the sense strand comprise a nucleotide modification.

13. The method of any one of claims 1-12, wherein substantially all of the nucleotides of the antisense strand comprise a nucleotide modification.

14. The method of any one of claims 1-13, wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand comprise a nucleotide modification.

15. The method of any one of claims 11-14, wherein at least one of the nucleotide modifications is selected from the group consisting of a deoxy-nucleotide modification, a 2'-O-methyl nucleotide modification, and a 2'-fluoro nucleotide modification.

16. The method of claim 15, wherein all of the nucleotide modifications are selected from the group consisting of a deoxy-nucleotide modification, a 2'-O-methyl nucleotide modification, and a 2'-fluoro nucleotide modification.

17. The method of any one of claims 1-16, wherein each strand of the dsRNA agent is no more than 30 nucleotides in length.

18. The method of any one of claims 1-17, wherein each strand of the dsRNA agent is independently 19-30 nucleotides in length.

19. The method of claim 18, wherein each strand of the dsRNA agent is independently 19-25 nucleotides in length.

20. The method of claim 19, wherein each strand of the dsRNA agent is independently 21-23 nucleotides in length.

21. The method of any one of claims 1-20, wherein at least one strand of the dsRNA agent comprises a 3’ overhang of at least 1 nucleotide. 63 ME151168599v.1Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO 22. The method of any one of claims 1-21, wherein at least one strand of the dsRNA agent comprises a 3’ overhang of at least 2 nucleotides.

23. The method of any one of claims 1-22, wherein the dsRNA agent further comprises a ligand.

24. The method of claim 23, wherein the ligand is conjugated to the 3’ end of the sense strand of the dsRNA agent.

25. The method of claim 23 or 24, wherein the ligand is an N-acetylgalactosamine (GalNAc) derivative.

26. The method of any one of claims 23-25, wherein the ligand is27. The method of any one of claims 23-26, wherein the dsRNA agent is conjugated to the ligand as shown in the following schematicand, wherein X is O or S. 64 ME151168599v.1Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO 28. The method of claim 27, wherein X is O.

29. The method of any one of claims 1-28, wherein the sense strand comprises the nucleotide sequence 5’- gscsaggaagCfAfCfugagauucgu-3’ of SEQ ID NO:17 and the antisense strand comprises the nucleotide sequence 5’- asdCsgadAudCucagdTgCfuuccugcsasc -3’ of SEQ ID NO:19, wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U; Cf and Uf are 2′-deoxy-2’- fluoro (2’-F) C and U; dC, dA, and dT are 2′-deoxy C, A, and T; and s is a phosphorothioate linkage.

30. The method of claim 29, wherein the dsRNA agent is conjugated to the ligand as shown in the following schematicand, wherein X is O.

31. A method of treating a subject suffering from type 2 diabetes, the method comprising administering to the subject a fixed dose of about 25 mg to about 1200 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, targeting a KHK gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’- gscsaggaagCfAfCfugagauucgu-3’ of SEQ ID NO:17 and the antisense strand comprises the nucleotide sequence 5’- asdCsgadAudCucagdTgCfuuccugcsasc -3’ of SEQ ID NO:19, wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U; Cf and Uf are 2′-deoxy-2’- fluoro (2’-F) C and U; dC, dA, and dT are 2′-deoxy C, A, and T; and s is a phosphorothioate linkage; and wherein a ligand is conjugated to the 3’ end of the sense strand as shown in the following schematic 65 ME151168599v.1Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WOthereby treating the subject suffering from type 2 diabetes.

32. A method of preventing at least one symptom in a subject having type 2 diabetes, the method comprising administering to the subject a fixed dose of about 25 mg to about 1200 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, targeting a KHK gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’- gscsaggaagCfAfCfugagauucgu-3’ of SEQ ID NO:17 and the antisense strand comprises the nucleotide sequence 5’- asdCsgadAudCucagdTgCfuuccugcsasc -3’ of SEQ ID NO:19, wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U; Cf and Uf are 2′-deoxy-2’- fluoro (2’-F) C and U; dC, dA, and dT are 2′-deoxy C, A, and T; and s is a phosphorothioate linkage; and wherein a ligand is conjugated to the 3’ end of the sense strand as shown in the following schematic 66 ME151168599v.1Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WOthereby preventing at least one symptom in the subject having type 2 diabetes.

33. A method of reducing fructose metabolism in a subject having type 2 diabetes, the method comprising administering to the subject a fixed dose of about 25 mg to about 1200 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, targeting a KHK gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’- gscsaggaagCfAfCfugagauucgu-3’ of SEQ ID NO:17 and the antisense strand comprises the nucleotide sequence 5’- asdCsgadAudCucagdTgCfuuccugcsasc -3’ of SEQ ID NO:19, wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U; Cf and Uf are 2′-deoxy-2’- fluoro (2’-F) C and U; dC, dA, and dT are 2′-deoxy C, A, and T; and s is a phosphorothioate linkage; and wherein a ligand is conjugated to the 3’ end of the sense strand as shown in the following schematic 67 ME151168599v.1Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WOthereby reducing fructose metabolism in the subject having type 2 diabetes.

34. A method of improving insulin sensitivity in a subject having type 2 diabetes, the method comprising administering to the subject a fixed dose of about 25 mg to about 1200 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, targeting a KHK gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’- gscsaggaagCfAfCfugagauucgu-3’ of SEQ ID NO:17 and the antisense strand comprises the nucleotide sequence 5’- asdCsgadAudCucagdTgCfuuccugcsasc -3’ of SEQ ID NO:19, wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U; Cf and Uf are 2′-deoxy-2’- fluoro (2’-F) C and U; dC, dA, and dT are 2′-deoxy C, A, and T; and s is a phosphorothioate linkage; and wherein a ligand is conjugated to the 3’ end of the sense strand as shown in the following schematic 68 ME151168599v.1Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WOthereby improving insulin sensitivity in the subject having type 2 diabetes.

35. A method of reducing fatty acid synthesis in a subject having type 2 diabetes, the method comprising administering to the subject a fixed dose of about 25 mg to about 1200 mg of a double stranded ribonucleic acid (dsRNA) agent, or a pharmaceutically acceptable salt thereof, targeting a KHK gene, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5’- gscsaggaagCfAfCfugagauucgu-3’ of SEQ ID NO:17 and the antisense strand comprises the nucleotide sequence 5’- asdCsgadAudCucagdTgCfuuccugcsasc -3’ of SEQ ID NO:19, wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U; Cf and Uf are 2′-deoxy-2’- fluoro (2’-F) C and U; dC, dA, and dT are 2′-deoxy C, A, and T; and s is a phosphorothioate linkage; and wherein a ligand is conjugated to the 3’ end of the sense strand as shown in the following schematic 69 ME151168599v.1Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WOthereby reducing fatty acid synthesis in the subject having type 2 diabetes.

36. The method of any one of claims 1-35, further comprising administering an additional therapeutic to the subject.

37. The method of any one of claims 1-36, further comprising measuring the serum and / or urine fructose level, the serum and / or urine FGF21 level, the serum and / or urine lipid level, the level of hemoglobin A1C (HbA1C), and / or the serum and / or urine uric acid level in the subject.

38. The method of any one of claims 1-37, further comprising measuring insulin and / or glucose sensitivity, and / or measuring liver fat in the subject.

39. The method of any one of claims 1-38, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 25 mg, about 75 mg, about 150 mg, about 300 mg, about 600 mg, or about 1200 mg.

40. The method of any one of claims 1-39, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 550-650 mg.

41. The method of any one of claims 1-40, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 600 mg.

42. The method of any one of claims 1-41, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject every month, every 2 months, every 3 months, every 4 months, every 5 months, every 6 months, or every 12 months. 70 ME151168599v.1Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO 43. The method of any one of claims 1-42, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 25 mg every three months.

44. The method of any one of claims 1-42, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 75 mg every three months.

45. The method of any one of claims 1-42, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 150 mg every three months.

46. The method of any one of claims 1-42, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 300 mg every three months.

47. The method of any one of claims 1-42, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 600 mg every three months.

48. The method of any one of claims 1-42, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 25 mg every six months.

49. The method of any one of claims 1-42, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 75 mg every six months.

50. The method of any one of claims 1-42, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 150 mg every six months.

51. The method of any one of claims 1-42, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 300 mg every six months. 71 ME151168599v.1Attorney Docket No.: 121301-23020 Alnylam Reference No.: ALN-518-WO 52. The method of any one of claims 1-42, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject at a dose of about 600 mg every six months.

53. The method of any one of claims 1-52, wherein the dsRNA agent, or a pharmaceutically acceptable salt thereof, is administered to the subject intravenously, intramuscularly, or subcutaneously.

54. A kit for performing the method of any one of claims 1-53, comprising a) the dsRNA agent, or a pharmaceutically acceptable salt thereof, and b) instructions for use, and c) optionally, means for administering the dsRNA agent, or a pharmaceutically acceptable salt thereof, to the subject. 72 ME151168599v.1

Images