Chimeric antigen receptor targeting CD19 and BCMA and use thereof
By developing chimeric antigen receptors targeting CD19 and BCMA, CD19-BCMA dual-target CAR was constructed and bound to lentiviral vectors, infecting T cells to produce CAR-T cells, solving the problem of limited range of therapeutic indications for existing single-target CAR-T cells, and achieving efficient killing of target cells and reducing the risk of immune escape.
Patent Information
- Application Number
- PCT/CN2024/142286
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-12-21
- Filing Date
- 2024-12-25
- Publication Date
- 2025-06-26
AI Technical Summary
The existing single-target CAR-T cell therapy has a limited range of therapeutic indications for B cells and plasma cells, and it is prone to immune escape from tumor cells due to reduced target protein expression.
A chimeric antigen receptor targeting CD19 and BCMA was developed, and CD19 and BCMA recognition sequences were linked through β-stranded linker to construct CD19-BCMA dual-target CAR, bound to lentiviral vectors, infected T cells to generate CAR-T cells, to target CD19 and BCMA targets simultaneously, and reduce the risk of immune evasion.
It realizes efficient killing of target cells expressing CD19 and BCMA simultaneously, reduces immune escape caused by reduced target protein expression, and improves the killing efficiency of CAR-T cells.
Smart Images

Figure CN2024142286_26062025_PF_FP_ABST
Abstract
Description
A chimeric antigen receptor targeting CD19 and BCMA and its application This invention claims the priority of a Chinese patent application titled "A chimeric antigen receptor targeting CD19 and BCMA and its application" with the application number 2023117818079, filed with the Chinese Patent Office on December 21, 2023. The entire content is incorporated herein by reference. Technical Field This invention belongs to the field of antibody technology and specifically relates to a chimeric antigen receptor targeting CD19 and BCMA and its application. Background Art CD19 is a transmembrane glycoprotein expressed on the surface of B cell lineage cells with a size of 95KDa. As a member of the immunoglobulin (Ig) superfamily, it is one of the components of the B cell surface signal transduction complex, participates in regulating the signal transduction process of the B cell receptor, and plays an important regulatory role in B lymphocyte activation [1] . Except for pluripotent hematopoietic stem cells and plasma cells, CD19 is expressed at all stages of B lymphocyte differentiation and even during tumor transformation [2] . CD19 is also expressed on the surface of most B cell lymphomas, mantle cell lymphomas, ALLs, CLLs, and some acute myeloid leukemia cells. CD19 is not expressed in hematopoietic stem cells, and this feature reduces the risk of autoimmune diseases and irreversible spinal cord injury during drug treatment targeting CD19. Therefore, CD19 is considered a very promising immunotherapy target in the treatment of leukemia and lymphoma. B cell maturation antigen (BCMA), also known as CD269, is a member of the tumor necrosis factor superfamily (Tumor necrosis factor receptor superfamily member 17, TNFRS17), consisting of 185 amino acid residues, belonging to type III transmembrane protein, with an extracellular domain rich in cysteine and having a certain degree of conservation [3,4] . As a cell surface protein expressed only on the B cell lineage, it, together with two other TNF receptor superfamily members, B cell activation factor (BAFF) and its receptor (BAFF-R), and transmembrane activator and calcium modulator and cyclophilin ligand (TACI), plays an important regulatory role in B cell proliferation, survival, and maturation and differentiation into plasma cells [5-8]。Different from BAFF-R and TACI, BCMA is mainly expressed on the surface of plasma cells or malignant plasma cells, and its expression can also be detected on the surface of memory B cells and plasmacytoid dendritic cells that can differentiate into malignant plasma cells. [9-11] 。BCMA is basically not expressed in naive B cells, pluripotent stem cells, and non-lymphoid tissues.
[0012] 。In addition, BCMA is expressed in almost all multiple myeloma (MM) cell lines, and its expression in malignant plasma cells is higher than that in normal plasma cells. [13,14] , These evidences make it a very promising ideal target in the CAR T cell therapy of MM. Currently, the first approved CAR-T drug is Kymariah, whose target is CD19. It is used to treat patients with refractory / relapsed B-cell acute lymphoblastic leukemia, and has significant long-term efficacy. The BCMA CAR-T drug, Icarisib injection, has an overall response rate (ORR) of 96%. Although CD19 CAR-T can effectively target most B cells, it cannot eliminate terminally differentiated plasma cells, while BCMA CAR-T can effectively eliminate plasma cells but cannot target naive B cells, etc. The indication ranges of the two single-target CAR-T cell therapies are limited, and it is easy for tumor cells to undergo immune escape due to the reduction of target proteins. Therefore, developing a chimeric antigen receptor that can simultaneously target CD19 and BCMA targets and reduce tumor immune escape caused by the reduction of target protein expression is the key to solving the above problems. [1] Carter, R.H. and D.T. Fearon, CD19: lowering the threshold for antigen receptor stimulation of B lymphocytes. Science, 1992. 256(5053): p. 105-7. [2] Scheuermann, R.H. and E. Racila, CD19 antigen in leukemia and lymphoma diagnosis and immunotherapy. Leuk Lymphoma, 1995. 18(5-6): p. 385-97. [3]Madry, C., et al., The characterization of murine BCMA gene defines it as a new member of the tumor necrosis factor receptor superfamily. Int Immunol, 1998. 10(11): p. 1693-702. [4]Sanchez, E., et al., Serum B-cell maturation antigen is elevated in multiple myeloma and correlates with disease status and survival. Br J Haematol, 2012. 158(6): p. 727-38. [5]Marsters, S.A., et al., Interaction of the TNF homologues BLyS and APRIL with the TNF receptor homologues BCMA and TACI. Curr Biol, 2000. 10(13): p. 785-8. [6]Gross, J.A., et al., TACI and BCMA are receptors for a TNF homologue implicated in B-cell autoimmune disease. Nature, 2000. 404(6781): p. 995-9. [7]Thompson, J.S., et al., BAFF binds to the tumor necrosis factor receptor-like molecule B cell maturation antigen and is important for maintaining the peripheral B cell population. J Exp Med, 2000. 192(1): p. 129-35. [8]Sasaki, Y., et al., TNF family member B cell-activating factor (BAFF) receptor-dependent and-independent roles for BAFF in B cell physiology. J Immunol, 2004. 173(4): p. 2245-52. [9]Avery, D.T., et al., BAFF selectively enhances the survival of plasmablasts generated from human memory B cells. J Clin Invest, 2003. 112(2): p. 286-97.
[0010] O'Connor, B.P., et al., BCMA is essential for the survival of long-lived bone marrow plasma cells. J Exp Med, 2004. 199(1): p. 91-8.
[0011] Tai, Y.T., et al., Novel anti-B-cell maturation antigen antibody-drug conjugate (GSK2857916) selectively induces killing of multiple myeloma. Blood, 2014. 123(20): p. 3128-38.
[0012] Carpenter, R.O., et al., B-cell maturation antigen is a promising target for adoptive T-cell therapy of multiple myeloma. Clin Cancer Res, 2013. 19(8): p. 2048-60.
[0013] Lee, L., et al., Evaluation of B cell maturation antigen as a target for antibody drug conjugate mediated cytotoxicity in multiple myeloma. Br J Haematol, 2016. 174(6): p. 911-22.
[0014] Eckhert, E., R. Hewitt, and M. Liedtke, B-cell maturation antigen directed monoclonal antibody therapies for multiple myeloma. Immunotherapy, 2019. 11(9): p. 801-811. Summary of the Invention In view of the above deficiencies, the present invention provides a chimeric antigen receptor targeting CD19 and BCMA and its application. The chimeric antigen receptor provided by the present invention is CD19-BCMA double beta CAR, which has the amino acid sequence shown in SEQ ID NO: 1. The present invention uses a β-stranded linker to connect the CD19 recognition sequence in the form of murine ScFv and the BCMA recognition sequence in the form of human VHH. The BCMA recognition sequence is between the heavy chain and light chain variable regions of the CD19 recognition sequence to construct a CD19-BCMA dual-target CAR. In addition to the extracellular recognition region of CD19-BCMA, the CAR structure also includes a leader sequence, a CD8 hinge region, a CD8 transmembrane domain, a 4-1BB co-stimulatory signaling region, and a CD3ζ signaling domain. This dual-target CAR is constructed into a lentiviral vector and infects T cells to generate CAR-T, which can target both CD19 and BCMA targets simultaneously, greatly reducing tumor immune escape caused by reduced expression of target proteins. The βTanCAR-T constructed by the present invention has a higher killing efficiency on target cells than GS TanCAR-T, and when the target cells express both CD19 and BCMA, the dual-target βTanCAR-T group has a better killing effect on target cells than the two single-target cells of CD19 and BCMA. Terms: In the present invention, the term "amino acid" includes natural amino acids, synthetic amino acids, and amino acid analogs and amino acid mimetics that function in a manner similar to natural amino acids. Natural amino acids are amino acids encoded by the genetic code. Amino acid analogs refer to amino acids with the same basic chemical structure as naturally occurring amino acids. Amino acids may be referred to herein by their commonly known three-letter symbols or by the single-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. In the present invention, the term "nucleotide sequence" refers to the order of bases in DNA or RNA, that is, the order of A, T, G, C in DNA, or the order of A, U, G, C in mRNA, and also includes the order of bases in rRNA, tRNA, and mRNA. In the present invention, the term "single domain antibody" or "VHH" refers to a type of antibody that lacks the antibody light chain and only has the heavy chain variable region. In the present invention, the term "chimeric antigen receptor" or "CAR" generally refers to a group of polypeptides, which are generally two in the simplest embodiment, and when in immune effector cells, provide cells with specificity for target cells (usually cancer cells) and generate intracellular signals. In some embodiments, CAR includes at least one extracellular antigen binding domain (such as VHH, scFv or a portion thereof), a transmembrane domain and a cytoplasmic signaling domain (also referred to herein as "intracellular signaling domain"), which includes a functional signaling domain derived from a stimulatory molecule and / or a co-stimulatory molecule as defined below. In the present invention, the term "human natural phage display antibody library screening" refers to the screening of human natural phage display antibody library using target protein or overexpression cell line as antigen. According to the screening results, a sufficient number of monoclones are selected for primary screening, positive clones are selected for sequencing, and sequence diversity analysis is performed to select sequence-specific antibody clones, and then antibody sample preparation is performed. In this specification, "human natural phage display antibody library" and "human natural library" can be used interchangeably. In the present invention, the term "functional variant" generally refers to an amino acid sequence having substantially the same function as that of the variant and having at least 85% sequence identity therewith. As used herein, the term "natural killer cell" or "T cell" generally refers to a type of cytotoxic lymphocyte of the immune system. In the present invention, the term "expression" generally refers to the transcription and / or translation of a specific nucleotide sequence. In the present invention, the term "vector" refers to a nucleic acid molecule capable of propagating another nucleic acid to which it is linked. The term includes vectors that are self-replicating nucleic acid structures and vectors that are incorporated into the genome of a host cell into which they are introduced. Certain vectors are capable of directing the expression of nucleic acids to which they are operably linked. Such vectors are referred to herein as "expression vectors." The technical solution of the present invention includes: On the one hand, the present invention provides a chimeric antigen receptor that simultaneously targets CD19 and BCMA, and the chimeric antigen receptor is CD19-BCMA double beta CAR. Specifically, the chimeric antigen receptor has the amino acid sequence shown in SEQ ID NO: 1. Specifically, the chimeric antigen receptor connects the CD19 sequence and the BCMA sequence with a β-stranded linker as the antigen recognition region. Preferably, the antigen recognition region has the amino acid sequence shown in SEQ ID NO: 2. Preferably, the CD19 sequence is a CD19 sequence in the form of ScFv, and has the light chain amino acid sequence shown in SEQ ID NO: 4 and the heavy chain amino acid sequence shown in SEQ ID NO: 5. Preferably, the BCMA sequence is a BCMA sequence in the form of VHH, and has the amino acid sequence shown in SEQ ID NO: 6. Further preferably, the BCMA sequence is between the heavy chain and the light chain variable regions of the CD19 sequence. On the other hand, the present invention provides a nucleic acid molecule that encodes the chimeric antigen receptor described in the above claims. On yet another hand, the present invention provides a lentiviral vector, and the lentiviral vector includes the above nucleic acid molecule. Specifically, the lentiviral vector is the Pre Lenti EF1 CAR V2 WPmut lentiviral vector. On yet another hand, the present invention provides a host cell, and the host cell contains the above lentiviral vector. Specifically, the host cell includes genetically engineered immune cells. More specifically, the genetically engineered immune cells include T cells, NK cells, CTL cells, monocytes, macrophages, NKT cells, dendritic cells or any combination thereof. Preferably, the genetically engineered immune cell is a CAR-NKT cell. On yet another hand, the present invention provides the use of the above chimeric antigen receptor, nucleic acid molecule, lentiviral vector or host cell in the preparation of a drug or a kit. Specifically, the drug is a drug for treating tumors or autoimmune diseases. More specifically, the tumors include T cell malignancies or B cell malignancies. Preferably, the T cell malignancies include acute lymphoblastic leukemia, T cell large granular lymphocytic leukemia, adult T cell leukemia / lymphoma, T cell prolymphocytic leukemia, or peripheral T cell lymphoma. Preferably, the B cell malignancies include non-Hodgkin lymphoma or chronic lymphocytic leukemia. More specifically, the autoimmune diseases include but are not limited to systemic lupus erythematosus, rheumatoid arthritis, Sjogren's syndrome, systemic sclerosis, myositis, dermatomyositis, ankylosing spondylitis, hyperthyroidism, juvenile diabetes, idiopathic thrombocytopenic purpura, autoimmune hemolytic anemia, ulcerative colitis, Crohn's disease, atopic dermatitis, vasculitis, neuromyelitis optica, or psoriatic arthritis. Specifically, the kit is used to detect CD19 and / or BCMA proteins. In another aspect, the present invention provides a pharmaceutical composition, which includes the above chimeric antigen receptor, nucleic acid molecule, lentiviral vector, or host cell. In another aspect, the present invention provides a kit, which includes the above chimeric antigen receptor, nucleic acid molecule, lentiviral vector, or host cell. The beneficial effects of the present invention are as follows: The chimeric antigen receptor provided by the present invention is CD19-BCMA double beta CAR, which has the amino acid sequence shown in SEQ ID NO: 1. The present invention uses a β-stranded linker to connect the CD19 recognition sequence in the form of murine ScFv and the BCMA recognition sequence in the form of human VHH. The BCMA recognition sequence is between the heavy chain and light chain variable regions of the CD19 recognition sequence to construct a CD19-BCMA dual-target CAR. This dual-target CAR is constructed into a lentiviral vector and infects T cells to generate CAR-T, which can simultaneously target CD19 and BCMA targets, greatly reducing tumor immune escape caused by reduced expression of target proteins. The βTanCAR-T constructed by the present invention has a higher killing efficiency for target cells compared to GS TanCAR-T, and when target cells simultaneously express CD19 and BCMA, the dual-target βTanCAR-T group has a more excellent killing effect on target cells than the two single-target cells of CD19 and BCMA. Brief Description of the Drawings Figure 1 is a map of the shuttle plasmid Pre-Lenti-EF1-CAR V2 Wpmut. Figure 2 shows the map of plasmid Pre Lenti EF1 CAR V2 WPmut-CD19-BCMA double beta CAR. Figure 3 shows the map of plasmid Pre Lenti EF1 CAR V2 WPmut-CD19-BCMA double GS CAR. Figure 4 shows the total amplification fold of CD19-BCMA dual-target CAR-T cells. Figure 5 shows the flow cytometry diagram for detecting the positive rate of CAR in the dual-target group. Figure 6 shows the killing effect of CD19-BCMA TanCAR-T cells on MM.1S. Figure 7 shows the killing effect of CD19-BCMATanCAR-T cells on K562-CD19. Figure 8 shows the killing effect of CD19-BCMATanCAR-T cells on Daudi. Figure 9 shows the IFN-γ secretion of CD19-BCMA TanCAR-T cells. Detailed implementation manners The present invention will be described below in conjunction with specific embodiments. The following embodiments are not used to limit the present invention, but only to illustrate the present invention, so that the technical solutions of the present invention can be more easily understood and mastered. The experimental methods described in the following embodiments are all conventional methods unless otherwise specified; the reagents and materials can be obtained from commercial channels unless otherwise specified. The envelope plasmid (ZL003) and packaging plasmids (ZL004, ZL006) are all produced by our company. The production method is the traditional alkaline lysis method. For the detailed steps, refer to our company's patent CN111979230A "Fermentation Medium, Preparation Method and Application for Large-Scale Production of Plasmid Vectors". The experimental materials used in the present invention are shown in Table 1: Table 1 Experimental materials Example 1 Construction of CD19-BCMA dual-target CAR vector 1. Construction of Pre Lenti EF1 CAR V2 WPmut lentiviral vector (1) The 5'LTR of the shuttle plasmid pRRLSIN.cPPT.PGK-GFP.WPRE (http: / / n2t.net / addgene:12252) is the RSV promoter. Replacing the promoter of 5'LTR from RSV to CMV helps to efficiently transcribe the viral genome sequence; the original plasmid of 3'LTR has removed the U3 region (3'LTR△U3) and has been designed for self-inactivating (SIN), and the 3'LTR sequence remains unchanged. (2) Replace the hPGK promoter driving the expression of exogenous transgenic genes with the EF1 promoter, and replace the EGFP gene with a multiple cloning sequence (SEQ ID NO: 7: GGATCCGAATTCCTCGAGACTAGTTCTAGAGCGGCCGCGTCGAC); (3) Replace the ampicillin resistance gene with the kanamycin resistance gene derived from the pUC57-Kan (GenBank: LT671993.1) plasmid; (4) Modify the WPRE element of pRRLSIN.cPPT.PGK-GFP.WPRE so that the truncated X protein is not expressed. Specifically, within the sequence of the WPRE wild-type element, remove the promoter driving the transcription of the X protein, and change the A of the start codon ATG to T. The new sequence is named WPREmut. The above-mentioned modified shuttle plasmid is named Pre-Lenti-EF1-CAR V2 Wpmut, and the sequence is shown in SEQ ID NO: 8. The map of the shuttle plasmid is shown in Figure 1, and the annotations in the map are shown in Table 2 below. Table 2 Annotations of each element of the shuttle plasmid Pre-Lenti-EF1-CAR V2 WPmut 2. Construction of the CD19-BCMA dual-target CAR vector In this example, two plasmids that can simultaneously target CD19 and BCMA were constructed. The CD19 sequence in the ScFv form and the BCMA sequence in the VHH form were respectively linked by a G4S linker or a β-stranded linker as the antigen recognition region, combined with the CD8 sequence as the hinge region and transmembrane region, and the intracellular domains of 4-1BB and CD3ζ molecules as the cytoplasmic region. These two CAR sequences were constructed into the Pre Lenti EF1 CAR V2 WPmut lentiviral vector, and the CD19-BCMA dual-target CAR plasmids Pre Lenti EF1 CAR V2 WPmut-CD19-BCMA double beta CAR and Pre Lenti EF1 CAR V2 WPmut-CD19-BCMA double GS CAR were obtained. The maps are shown in Figures 2 - 3. The CAR sequences are CD19-BCMA double beta CAR and CD19-BCMA double GS CAR; the amino acid sequence of the CD19-BCMA double beta CAR is as shown in SEQ ID NO: 1; the amino acid sequence of the CD19-BCMA double GS CAR is as shown in SEQ ID NO: 3. Example 2 Preparation of CD19-BCMA Dual-Target Lentivirus Mix the plasmids Pre-Lenti-EF1-CAR V2 WPmut-CD19-BCMA double GS CAR and Pre-Lenti-EF1-CAR V2 WPmut-CD19-BCMA double beta CAR with the packaging plasmid ZL004, envelope plasmid ZL003, and packaging plasmid ZL006 at a ratio of 7:5:3:5. Add the mixture of the above four plasmids to a centrifuge tube containing 293TS basal medium. Add PEIpro to another centrifuge tube at a ratio of plasmid:PEIpro = 1:2. After incubating both tubes at room temperature for 5 min, slowly add the mixture containing PEIpro to the mixture containing the plasmids, gently shake the centrifuge tube to mix evenly, and incubate at room temperature for 15 min. Then add the transfection mixture dropwise to the 293TS cell suspension with a density of 5.0 - 8.0×10 6 cells / mL. At 6 - 8 h after transfection, feed with OPM-CHO PFF06 feeding medium containing glutamine. After 48 h, collect the supernatant of the medium to obtain the crude lentivirus. After steps such as centrifugation filtration, enzymatic digestion, ultrafiltration concentration, and sterile filtration, mix the virus solution with 20% HSA at a ratio of 9:1 to obtain the lentiviruses LV2202-230612-GS and LV2202-230612-beta. Aliquot the prepared lentiviruses and store them at -80°C. Use flow cytometry to measure the transduction titer of the lentiviruses. The transduction titers of LV2202-230612-GS and LV2202-230612-beta lentiviruses are 6.228×10 8 TU / mL and 6.129×10 8 TU / mL. Example 3 Preparation of CD19-BCMA TanCAR-T Peripheral blood was collected from healthy volunteers, and CD3-positive T cells were purified using Miltenyi CD3 Regent. The time was recorded as D0. The cell culture medium used was TexMACS GMP Medium (containing 5% serum substitute), and T cells were activated using TransAct CD3 / CD28 activation reagent (1:100) and IL-2 (100 IU / ml). Twenty-four hours after T cell activation, the cells were infected with lentivirus (MOI = 5). On the 12th day after activation (D12), an appropriate amount of cells was taken from each group for detection of the CAR positive rate; at 72 h, D5, and D7, the cell density was adjusted to 5×10 5 cells / mL and continued to be cultured. At D9, the medium was replenished, and a cell killing experiment was performed at D12. Figure 4 shows the total amplification fold of CAR-T cells. The results show that there was no significant difference in the total amplification fold of T cells in each group infected with lentivirus. Example 4 Detection of the CAR Positive Rate of CD19-BCMA TanCAR-T Cells To evaluate the expression of dual-target CAR-T cells (βTanCAR-T, GS TanCAR-T), on the 12th day after T cell activation in the present invention, the CAR positive rate was detected using target protein binding flow cytometry. The measurement results are shown in Figure 5. The GS TanCAR-T group was 22.7%, and the βTanCAR-T group was 19.2%. When detected by flow cytometry, the line type of the dual-target βTanCAR-T group was an oblique straight line, while the line type of the GS TanCAR-T group was biased towards BCMA protein staining, indicating that the binding of CD19 protein to the CAR on the cell surface in the GS TanCAR-T group was blocked. Example 5 Detection of the Killing Efficiency of CD19-BCMA TanCAR-T Cells against Target Cells To compare the killing efficiency of two dual-target CAR-T cells (βTanCAR-T, GS TanCAR-T), single-target CAR-T cells (CD19 CAR-T, BCMA CAR-T), and the non-infected lentivirus group (Mock T) against tumor cells, in this study, T cells cultured for 12 days in each group and the corresponding tumor cell lines (MM.1S: expressing BCMA; K562-CD19: expressing CD19; Daudi: expressing BCMA and CD19) were co-cultured, and the killing efficiency was detected by measuring lactate dehydrogenase (LDH). The effector-to-target ratios were set to 0.5:1 and 1:1 in the experiment. The target cells were 3×10 4 cells / well, and the total volume was 200 μL / well in a 96-well round bottom plate, with 3 replicates for each group. After 16 h of lysis, after 1 h of lysis, the supernatant was harvested by centrifugation and the substrate was added for OD 490nm detection, and the killing percentage was calculated according to the detection results. As shown in Figure 6, when the effector-to-target ratio was 0.5:1 and 1:1, compared with single-target BCMA CAR-T, the killing efficiency of dual-target βTanCAR-T against MM.1S was improved (P<0.05); conversely, when the effector-to-target ratio was 0.5:1 and 1:1, the killing efficiency of GS TanCAR-T against MM.1S was significantly lower than that of the βTanCAR-T group. As shown in Figure 7, there was no significant difference in the killing efficiency of dual-target βTanCAR-T against K562-CD19 compared with CD19 CAR-T, and it was significantly higher than that of GS TanCAR-T. As shown in Figure 8, when the effector-to-target ratio was 1:1, there was no significant difference in the killing efficiency of dual-target βTanCAR-T against Daudi compared with single-target CD19 CAR-T and BCMA CAR-T, but it was higher than that of GS TanCAR-T; when the low effector-to-target ratio was 0.5:1, the killing efficiency of dual-target βTanCAR-T against Daudi was significantly higher than that of other groups. In summary, the killing efficiency of the dual-target GS TanCAR-T group was significantly lower than that of the βTanCAR-T group, and due to the problem of CD19 binding blockage, it showed a lower killing efficiency than the single-target group in the killing detection of K562-CD19 and Daudi; compared with the single-target groups (BCMA CAR-T, Nova CAR-T group), there was no obvious difference in the killing efficiency of the dual-target βTanCAR-T group against target cells at high effector-to-target ratios; at low effector-to-target ratios, the βTanCAR-T group had a higher killing efficiency against target cells. Example 6 Detection of IFN-γ secretion of CD19-BCMA dual-target CAR-T cells After co-culturing the T cells of each group on the 12th day of culture and each tumor target cell line for 16 h, cell killing was detected. In this example, an appropriate amount of supernatant after co-culturing for 16 h with an effector-to-target ratio of 0.5:1 was collected for the detection of the secretion of the cytokine IFN-γ. The detailed operation steps refer to the BD OptEIA TM Human IFN-γ ELISA Kit II kit instruction manual. The brief steps are as follows: add an appropriate amount of sample diluent to the supernatant of each group for gradient dilution. The Mock T control group is diluted 5-fold, and the other groups are diluted 50-fold, 100-fold, and 200-fold respectively; prepare the standard solution and the internal control sample. Take out the coated plate from the sealed bag, add 50 μL of ELISA Diluent to each well, add the standard solution, the internal control sample solution, and the test sample solution to the well plate in sequence, cover with the sealing film, and incubate at room temperature (18 - 25 °C) for 2 h; after incubation, wash the plate, repeat 4 - 5 times, then add 100 μL / well of the Working Detector working solution, and incubate at room temperature for 1 h; repeat washing the plate 6 - 7 times, then add TMB and incubate at room temperature in the dark for half an hour, then add the stop solution. Put the well plate into the microplate reader and measure the absorbance at a wavelength of 450 nm, and analyze the data to obtain the experimental results. As shown in Figure 9, when co-cultured with MM.1S expressing BCMA, there was no significant difference in the secretion of IFN-γ between the βTanCAR-T group and the single-target BCMA CAR-T group, but the secretion was higher than that of the GS TanCAR-T group (P < 0.05). When co-cultured with K562-CD19 expressing the CD19 protein, there was no significant difference in the secretion of IFN-γ between the βTanCAR-T group and the single-target CD19 CAR-T group, but the secretion of IFN-γ was significantly increased compared with the GS TanCAR-T group (P < 0.0001). When co-cultured with Daudi cells expressing both CD19 and BCMA proteins, the secretion of IFN-γ in the βTanCAR-T group was significantly increased compared with other groups (P < 0.0001). The above detailed description is a specific description of one of the feasible embodiments of the present invention, and this embodiment is not intended to limit the patent scope of the present invention. It should be noted that all equivalent implementations or changes made without departing from the present invention should be included within the scope of the technical solution of the present invention. Therefore, the protection scope of the present invention shall be subject to the appended claims.
Claims
1. A chimeric antigen receptor that simultaneously targets CD19 and BCMA, characterized in that: The chimeric antigen receptor is CD19-BCMA double beta CAR, having an amino acid sequence as shown in SEQ ID NO:
1.
2. The chimeric antigen receptor according to claim 1, characterized in that The chimeric antigen receptor connects the CD19 sequence and the BCMA sequence with a β-stranded linker as the antigen recognition region.
3. The chimeric antigen receptor according to claim 2, characterized in that The antigen recognition region has an amino acid sequence as shown in SEQ ID NO:
2.
4. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the chimeric antigen receptor according to any one of claims 1 to 3.
5. A lentiviral vector, characterized in that: The lentiviral vector comprises the nucleic acid molecule of claim 4.
6. The lentiviral vector according to claim 5, characterized in that The lentiviral vector is a Pre Lenti EF1 CAR V2 WPmut lentiviral vector.
7. A host cell, characterized in that The host cell comprises the lentiviral vector described in any one of claims 5-6.
8. The host cell according to claim 7, characterized in that The host cells include engineered immune cells.
9. The host cell according to claim 8, characterized in that The engineered immune cells include T cells, NK cells, CTL cells, monocytes, macrophages, NKT cells, dendritic cells or any combination thereof.
10. The host cell according to claim 9, characterized in that The engineered immune cells are CAR-T cells.
11. Use of the chimeric antigen receptor according to any one of claims 1 to 3, the nucleic acid molecule according to claim 4, the lentiviral vector according to any one of claims 5 to 6, or the host cell according to any one of claims 7 to 10 in the preparation of a drug or a kit.
12. The use according to claim 11, characterized in that: The medicine is a medicine for treating tumors or autoimmune diseases.
13. The use according to claim 11, characterized in that: The kit is used to detect CD19 and / or BCMA protein.
14. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the chimeric antigen receptor described in any one of claims 1-3, the nucleic acid molecule described in claim 4, the lentiviral vector described in any one of claims 5-6, or the host cell described in any one of claims 7-10.
15. A kit, characterized in that: The kit comprises the chimeric antigen receptor described in any one of claims 1 to 3, the nucleic acid molecule described in claim 4, the lentiviral vector described in any one of claims 5 to 6, or the host cell described in any one of claims 7 to 10.
Citation Information
Patent Citations
BCMA (B-cell maturation antigen) chimeric antigen receptor on basis of single-domain antibodies and application of BCMA chimeric antigen receptor
CN109134665A
Double-target chimeric antigen receptor (CAR) capable of simultaneously targeting CD19 and BCMA and application of double-target CAR
CN112592927A
Construction and application of novel bispecific chimeric antigen receptor
CN114478803A
Chimeric antigen receptor targeting CD19 and BCMA and application thereof
CN117801120A
CD19-and BCMA-based combined car-t immunotherapy
WO2020108645A1