Products and methods for improving plant growth features

Abstract

The application concerns methods for improving a plant growth feature of plants using certain bacteria or agricultural active compositions comprising the bacteria. Plants and plant parts treated with or heterologously disposed with said bacteria or compositions are also disclosed. Further, novel bacterial strains, and populations and agricultural active compositions comprising the same are provided.

Description

[0001] PRODUCTS AND METHODS FOR IMPROVING PLANT GROWTH FEATURES

[0002] FIELD OF THE INVENTION

[0003] The invention is broadly in the field of plant biology and bacterial strains, more precisely in the field of agricultural biologicals or agro-biologicals. In particular, the invention relates to products and methods for enhancing certain plant growth characteristics, and to novel bacterial strains useful as biostimulants.

[0004] BACKGROUND OF THE INVENTION

[0005] There is a need for improved agricultural plants that will enable the food production demands with fewer resources and more environmentally sustainable inputs, as well as for plants with improved responses to various biotic and abiotic stresses.

[0006] Crop performance is optimized primarily via technologies directed towards the interplay between crop genotype (e.g. obtained by plant breeding or gene / genome editing) and its surrounding environment (e.g. application of fertilizer and / or synthetic pesticides). While these paradigms have assisted in the increasing global food production, yield growth rates have stalled in many major crops. Shifts in the climate are linked to production instabilities as well as changing pest and disease pressures. In addition, genetically modified (GM) crops and agrochemicals have been challenged in their use in a large number of agricultural important crops and countries, resulting in a lack of acceptance for many GM traits and the exclusion of GM crops and many agrochemicals from global markets. Therefore, there is an urgent need for novel solutions to crop improvement, more particularly, there is a need for innovative, effective, environmentally-sustainable, and publicly- acceptable approaches to improve the biomass, yield, and other agronomically important characteristics of plants.

[0007] A promising practice is the use of microorganisms that enhance plant growth and yield, increase tolerance to unfavorable conditions, and / or improve the resource use efficiency. In particular, a vast array of bacteria that live both within and around the plant tissues supports the plant's health and growth.

[0008] Bacteria influence plant growth through multiple mechanisms, and in some cases through interactions with other bacteria. Specific bacterial strains inhabit various host plant tissues and have been isolated from plant leaves, stems, and roots. Several bacteria have been disclosed that increase plant growth and / or reduce susceptibility to diseases caused by fungi, bacteria, viruses or other plant pathogens. However, the bacterial diversity is so overwhelming and the industrial applicability of specific strains so unpredictable, that much research is needed to develop means and methods to stimulate plant growth and / or yield through microbial activity.

[0009] The present invention aims to address at least some of the needs mentioned above and provides further and / or improved means and methods to enhance agriculturally useful characteristics of an agricultural plant. In this application, the Applicant reports on bacteria of a novel Streptomyces strain that promotes plant growth and yield in economically important food and feed crops. Streptomyces is the most common soil actinomycete (69.4%), followed by Micromonospora, Nocardia, and Streptosporangium (Lechevalier and Lechevalier 1970) and it has been previously demonstrated that actinomycetes can have plant growth stimulating characteristics. For example, in W02016200987 it is shown that a particular Streptomyces strain improves the yield of soybean by a 3.2% increase in seed count. However, counterintuitively to what could be incorrectly perceived from W02016200987 and from review papers (e.g. Vurukonda et al 2018 Int J Mol Sci 19; Olanrewaju and Babalola 2019 Appl Microbiol Biotechnol 103), not every Streptomyces species or strain has plant growth promoting potential. Yandigeri et al (2012 Microbiology 160) discloses that out of the 46 isolated endophytic actinobacteria, only three strains promote the growth of wheat under water-stress conditions. Importantly, some Streptomyces strains have also been shown to have phytotoxic activities (Bo et al 2019 PLoS One 14; Kim et al 2020 J Agric Food Chem 68) and thus kill plants or at least negatively influence plant growth and development. Hence, it is advantageous to develop means and methods to promote plant growth features by making use of the still underexplored diversity within the Streptomyces genus.

[0010] SUMMARY OF THE INVENTION

[0011] The present invention is at least in part based on the inventors' discovery that certain bacteria can be used as an agricultural biological, in particular as a biostimulant, to increase one or more plant traits of agronomic importance, such as in particular the biomass, number of tillers per plant, height, abundance of roots, and / or yield of a plant or part thereof.

[0012] As corroborated in the experimental section, which illustrates certain representative embodiments of the invention, the present inventors have found inter alia that plants, such as wheat, grown from seeds treated with said bacteria demonstrated an increase in dry biomass per plant and grain yield.

[0013] Accordingly, an aspect of the invention relates to a method for improving a plant growth feature of a plant compared to a control or reference plant, the method comprising administering bacteria of a bacterial strain which comprises a 16S polynucleotide having at least 99.8% sequence identity to SEQ ID NO: 1 (see Table 2) to the plant, a part thereof, a seed for growing the plant, or a locus of the plant, while said bacteria are not administered to the control or reference plant. A related aspect provides the use of bacteria of a bacterial strain which comprises a 16S polynucleotide having at least 99.8% sequence identity to SEQ ID NO: 1 for improving a plant growth feature of a plant compared to a control or reference plant. In certain preferred embodiments, biomass and / or yield of the plant may thereby increased. In certain embodiments, the number of tillers, height, and / or root abundance of the plant may thereby be increased.

[0014] A further aspect relates to a method of treating a seed of a plant comprising the step of inoculating the seed with bacteria of a bacterial strain which comprises a 16S polynucleotide having at least 99.8% sequence identity to SEQ ID NO: 1 (see Table 2), such that the bacteria colonize a plant germinated from the inoculated seed and / or the soil or plant growth medium surrounding the growing plant, whereby the plant growth feature of the plant, such as dry biomass and / or grain yield, is increased compared to a plant germinated from a control or reference seed that was not inoculated with said bacteria. In certain embodiments, the seed is coated with the bacteria, incubated with the bacteria, or planted near the bacteria. Without wishing to be bound to any hypothesis, where the bacterial cells colonize the soil or plant growth medium in the vicinity of the plant roots, the bacteria may make accessible and provide to the plant absorbable nutrients.

[0015] Further aspects provide a bacterial strain that comprises a 16S polynucleotide having at least 99.80% sequence identity to SEQ ID NO: 1, preferably at least 99.85%, even more preferably at least 99.90% sequence identity to SEQ ID NO: 1, or still more preferably 100.00% sequence identity to SEQ ID NO: 1. Also provided is a bacterial strain that comprises a 16S polynucleotide having 100.00% sequence identity to a 16S polynucleotide of the bacterial strain that has been deposited under the Budapest Treaty at the Polish Collection of Microorganisms (PCM) on November 10, 2023 under Accession No. B / 00499.

[0016] In another aspect, a bacterial strain is provided that is the strain as deposited under the Budapest Treaty at the Polish Collection of Microorganisms (PCM) on November 10, 2023 under Accession No. B / 00499 (conveniently referred to throughout this specification as strain MED-B-M2A1 or M2A1, see Table 1), or a functional homologue thereof. In some embodiments, the functional homologue is a Streptomyces strain comprising a 16S polynucleotide having a 100.00% sequence identity to that of B / 00499, having at least 96.00% genomic sequence identity with B / 00499 and is still capable of improving a plant growth feature when administered to a plant, a part thereof, a seed for growing the plant or a locus of the plant compared to a control plant to which said functional homologue was not administered.

[0017] A further aspect provides a bacterial population comprising a bacterial strain as disclosed herein.

[0018] Also provided is an agricultural active composition comprising a bacterial strain as disclosed herein or comprising a bacterial composition as disclosed herein. In some embodiments, the agricultural active composition comprises one or more agriculturally acceptable auxiliaries, such as a solvent, a carrier, a surfactant, a sticker, an antifreeze agent, a thickener, a buffering agent, an antifoaming agent, an antioxidant, a preservative, an aroma, a colorant, or a combination thereof. In some embodiments, the agricultural composition is a liquid composition, such as an aqueous composition, such as a sprayable liquid or a concentrate, preferably wherein the composition comprises the bacteria at a concentration of at least about 102CFU / ml. In some embodiments, the agricultural composition is a non-liquid composition, such as a powder, preferably wherein the composition comprises the bacteria at an amount of at least about 102CFU / g.

[0019] A further aspect provides a synthetic composition comprising a plant element and the bacteria as disclosed herein. In one embodiment, the bacteria are heterologously disposed on said plant element. In certain embodiment, said plant element can be a plant leaf, stem, tiller, root, bud, seed, flower, fruit, tuber, bulb, rhizomes and the like. In one embodiment, the synthetic composition is capable of improving plant growth and / or yield as compared to a control plant element not comprising the bacteria or the bacterial strain as disclosed herein. In a particular embodiment, a plant seed is provided comprising at least 10 CFU of the bacteria as disclosed herein. In an even more particular embodiment, a plant seed is provided wherein the bacteria as disclosed herein are heterogeneously disposed on the surface of the plant seed. "Synthetic" as used herein refers to non-naturally occurring and thus man-made. The bacterial strains, products, methods, and uses of the present invention advantageously allow to improve one or more trait of agronomic importance in a plant, such as one or more plant growth features. Hence, the herein described bacterial strains provide several significant advantages to plants, in particular to agricultural plants, such as wheat, barley, maize, and the like. For example, dry biomass, wet biomass, number of tillers per plant, height of the plant, root abundance, seed yield, grain yield and / or fruit yield of a plant can be increased compared to untreated plants by applying the teachings of the present invention. The present invention can thus allow to substitute or even abolish the use of chemical products such as fertilizers, and thereby advantageously facilitate more sustainable agriculture or increase the yield under adverse conditions. The teachings of the present invention can be immediately applied to any plant and, compared to provision of GM plants, do not require additional time for gene identification, generation and characterization of GM lines. Compared to the use of traditional agricultural methods including the application of chemical fertilizers and / or manure, the present approaches can require less resources, can be less labor intensive, and are more environmentally friendly, and thereby also compatible with organic farming practices.

[0020] The above and further aspects and preferred embodiments of the invention are described in the following sections and in the appended claims. The subject-matter of appended claims is hereby specifically incorporated in this specification.

[0021] DESCRIPTION OF THE DRAWINGS

[0022] The following description of the figures of specific embodiments of the invention is merely exemplary in nature and is not intended to limit the present teachings, their application or uses.

[0023] Figure 1 illustrates the plant growth promoting effect of the bacterial strain of the application in two independent greenhouse experiments.

[0024] Figure 1A represents the graph illustrating the increased dry biomass per plant at 6 weeks after sowing of wheat plants obtained from seeds treated with a formulation comprising the bacterial strain Accession No. B / 00499 as deposited under the Budapest Treaty at the PCM (M2A1, proposed taxonomic designation Streptomyces niveus) compared to the dry biomass per plant at 6 weeks after sowing of wheat plants obtained from untreated seeds (mock).

[0025] In Figure IB the graph on the left side illustrates the increased dry biomass per plant at 6 weeks after sowing of wheat plants obtained from seeds treated with a formulation comprising the bacterial strain Accession No. B / 00499 as deposited under the Budapest Treaty at the PCM (M2A1, proposed taxonomic designation Streptomyces niveus) compared to the dry biomass per plant at 6 weeks after sowing of wheat plants obtained from untreated seeds (mock). The graph on the right side shows the increase in dry biomass of wheat plants treated as described above, relative to the mock treatment.

[0026] In Figure 2, the graphs on the left visualize the values of grain yield of winter wheat at a field location in Poland (Figure 2A), Germany (Figure 2B) and Belgium (Figure 2C) with 95% confidence intervals for treated seeds with a formulation comprising the bacterial strain Accession No. B / 00499 as deposited under the Budapest Treaty (M2A1) and untreated (mock) seeds, whereas the graphs on the right visualizes the values of the difference between treated and mock treated seeds in grain yield with its 95% confidence interval. The percentage indicates the difference in wheat grain yield expressed as a percentage of the mock treatment.

[0027] Figure 3 shows the dry biomass in mg per planter box with 95% confidence intervals at 6 weeks after sowing of wheat plants obtained from seeds treated with a formulation comprising M1F3, M2A1 or O2C5 (Figure 3A), or comprising M14F2, M26D9 or M15F3 (Figure 3B) compared to seeds treated with a mock formulation.

[0028] DETAILED DESCRIPTION OF THE INVENTION

[0029] As used herein, the singular forms "a", "an", and "the" include both singular and plural referents unless the context clearly dictates otherwise.

[0030] The terms "comprise", "comprising", "comprises" and "comprised of" as used herein are synonymous with "include", "including", "includes" or "contain", "containing", "contains", and are inclusive or open-ended and do not exclude additional, non-recited members, elements or method steps. The terms also encompass "consisting of" and "consisting essentially of".

[0031] The recitation of numerical ranges by endpoints includes all numbers and fractions subsumed within the respective ranges, as well as the recited endpoints. This applies to numerical ranges irrespective of whether they are introduced by the expression "from... to..." or the expression "between... and..." or another expression.

[0032] The terms "about" or "approximately" as used herein when referring to a measurable value such as a parameter, an amount, a temporal duration, and the like, are meant to encompass variations of and from the specified value, such as variations of + / -10% or less, preferably + / -5% or less, more preferably + / -1% or less, and still more preferably + / -0.1% or less of and from the specified value, insofar such variations are appropriate to perform in the disclosed invention. It is to be understood that the value to which the modifier "about" or "approximately" refers is itself also specifically, and preferably, disclosed.

[0033] Furthermore, the terms first, second, third and the like in the description and in the claims, are used for distinguishing between similar elements and not necessarily for describing a sequential or chronological order, unless specified. It is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments of the invention described herein are capable of operation in other sequences than described or illustrated herein. Whereas the term "one or more" or "at least one", such as one or more or at least one member(s) of a group of members, is clear perse, by means of further exemplification, the term encompasses inter alia a reference to any one of said members, or to any two or more of said members, such as, e.g., any 3, 4, 5, 6 or 7 etc. of said members, and up to all said members. In another example, "one or more" or "at least one" may refer to 1, 2, 3, 4, 5, 6, 7 or more.

[0034] The discussion of the background to the invention herein is included to explain the context of the invention. This is not to be taken as an admission that any of the material referred to was published, known, or part of the common general knowledge in any country as of the priority date of any of the claims. All documents cited in the present specification are hereby incorporated by reference in their entirety.

[0035] Throughout this disclosure, various publications, patents and published patent specifications may be referenced by an identifying citation. All documents cited in the present specification are hereby incorporated by reference in their entirety. In particular, the teachings or sections of such documents herein specifically referred to are incorporated by reference.

[0036] Unless otherwise defined, all terms used in disclosing the invention, including technical and scientific terms, have the meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. By means of further guidance, term definitions are included to better appreciate the teaching of the invention. When specific terms are defined in connection with a particular aspect of the invention or a particular embodiment of the invention, such connotation or meaning is meant to apply throughout this specification, i.e., also in the context of other aspects or embodiments of the invention, unless otherwise defined.

[0037] In the following passages, different aspects or embodiments of the invention are defined in more detail. Each aspect or embodiment so defined may be combined with any other aspect(s) or embodiment(s) unless clearly indicated to the contrary. In particular, any feature indicated as being preferred or advantageous may be combined with any other feature or features indicated as being preferred or advantageous.

[0038] Reference throughout this specification to "one embodiment", "an embodiment" means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. Thus, appearances of the phrases "in one embodiment" or "in an embodiment" in various places throughout this specification are not necessarily all referring to the same embodiment, but may. Furthermore, the particular features, structures or characteristics may be combined in any suitable manner, as would be apparent to a person skilled in the art from this disclosure, in one or more embodiments. Furthermore, while some embodiments described herein include some but not other features included in other embodiments, combinations of features of different embodiments are meant to be within the scope of the invention, and form different embodiments, as would be understood by those in the art. For example, in the appended claims, any of the claimed embodiments can be used in any combination.

[0039] By extensive experimental testing, the present inventors have found that certain bacterial strains exhibit plant growth promoting effects when administered to plants and hence that such strains can advantageously be used as biostimulants on plants. In particular, the bacterial strains provided an unexpected enhancement of biomass and / or yield, such as dry biomass and / or yield, etc., in tested plants.

[0040] Accordingly, an aspect of the invention relates to a method for improving a plant growth feature of a plant compared to an untreated plant, the method comprising administering bacteria of a bacterial strain which comprises a 16S polynucleotide having at least 99.80% sequence identity to SEQ ID NO: 1 to the plant, a part thereof, a seed for growing the plant, or a locus of the plant. For example, such method may be suitably practiced in the context of agriculture or horticulture. An "untreated" plant as used herein refers to a control plant, a reference plant or a mock plant and thus to a plant that was treated with or to which no administration was applied of the bacteria of current application. The skilled person is aware of how a scientifically sound mock situation should be set up. A "plant growth feature" as used herein refers to one or more traits of agronomic importance in plants.

[0041] In certain embodiments, said bacterial strain comprises a 16S polynucleotide having at least 99.80%, or at least 99.85%, or at least 99.90% sequence identity to SEQ ID NO: 1. In particular embodiments, said bacterial strain comprises a 16S polynucleotide having a 100.00% sequence identity to SEQ ID NO: 1 or a 100.00% sequence identity to a 16S polynucleotide of the bacterial strain that has been deposited under the Budapest Treaty at the Polish Collection of Microorganisms (PCM) on November 10, 2023 under Accession No. B / 00499. In a particular embodiment, the sequence identity is calculated over at least 98.0%, at least 98.5%, at least 99.0% or at least 99.5% of the full length of SEQ ID NO: 1. In a most particular embodiment, the sequence identity is calculated over the full length of SEQ ID NO: 1.

[0042] In a most particular embodiment, said bacterial strain is the Streptomyces strain as deposited under the BudapestTreaty at the PCM on November 10, 2023 under Accession No. B / 00499 or a functional homologue thereof. In certain embodiments, said functional homologue is a Streptomyces strain comprising a 16S polynucleotide having a 100.00% sequence identity to that of B / 00499, having at least 96.00% genomic sequence identity with B / 00499 and is still capable of improving a plant growth feature when administered to a plant, a part thereof, a seed for growing the plant or a locus of the plant compared to a control plant to which the functional homologue was not administered. In particular embodiments, said functional homologue is a Streptomyces strain: a) comprising a 16S polynucleotide having a 100.00% sequence identity to that of B / 00499; b) having at least 96.50%, at least 97.00%, at least 97.50%, at least 98.00, at least 98.25%, at least 98.50%, at least 98.75%, at least 99.00%, at least 99.25%, at least 99.50% or at least 99.75% genomic sequence identity with B / 00499; and c) is still capable of improving a plant growth feature when administered to a plant, a part thereof, a seed for growing the plant or a locus of the plant compared to a control plant to which the functional homologue was not administered.

[0043] "x% genomic sequence identity" as used herein is equivalent to saying "x% sequence identity on whole genome level". In a most particular embodiment, the differences in genetic sequence on whole genome level or onl6S rDNA level between the functional homologue and B / 00499 are because of silent mutations.

[0044] In one embodiment, "x% genomic sequence identity" is the same as an Average Nucleotide Identity (ANI) of x%. "Average Nucleotide Identity" also referred herein as ANI is a descriptor of genetic relatedness. This descriptor is based on a large number of genes (typically> 1000 genes in total), thereby increasing the robustness and resolution of extracted phylogenetic signals. The genomic sequence identity or %ANI can be determined by several methods well-known by the person skilled in the art. A non-limiting example is to first perform a whole-genome alignment between two genome sequences. To do so, the genomic DNA has to be extracted and quantified. To extract sufficient high-quality DNA for whole genome sequencing, many different methods including conventional procedures and the use of commercial kits, can be carried out. After that, whole genome sequencing can be performed with high-throughput DNA sequencing technology using benchtop instruments such as, but not limited to, 454 GS FLX Titanium / GS Junior (Roche), Genome Analyzer / HiSeq 2000 / MiSeq (Illumina), SOLiD / lon Torrent PGM (Life Technologies), or RS (Pacific Biosciences). The whole-genome alignment can then be done using bioinformatics tools like MUMmer, Mauve, or BLAST (Qi et al 2024 Front Microbiol 15). Next, the percent identity between the aligned genomic regions is calculated. This represents the overall genomic sequence identity between the two strains. Tools like MUMmer or BLAST can provide the percent identity statistic directly (Qi et al 2024 Front Microbiol 15). Alternatively, the number of identical nucleotides across the entire aligned genomes can be calculated and divided by the total number of aligned nucleotides to calculate the % genomic sequence identity. For example, if a whole-genome alignment between the deposited Streptomyces strains B / 00499 and another strain reveals that 96% of the nucleotides are identical between the two bacterial strains, then the percent genomic sequence identity or ANI is 96%. The BLAST calculation of ANI values, using the Blast algorithm, is called ANIb. ANI values can be calculated by using the NUCmer program in the MUMmer software package and are called ANIm.

[0045] Also provided is a method of treating a seed of a plant comprising inoculating the seed with bacteria of a bacterial strain which comprises a 16S polynucleotide having at least 99.80% sequence identity to SE ID NO: 1, such that the bacteria colonize a plant germinated from the inoculated seed and / or the soil or plant growth medium surrounding the growing plant, whereby the plant growth feature of the plant is improved compared to a plant germinated from a control or mock seed that was not treated with said bacteria. Said method thus encompasses different ways of bringing the seeds in close proximity or contact with the bacteria and include but is not limited to coating of the seeds with said bacteria, an incubation of the seeds in a formulation of said bacteria, an inoculation of the soil or plant growth medium with said bacteria wherein the seeds or plantlets will be sown or planted.

[0046] In certain embodiments, said bacterial strain comprises a 16S polynucleotide having at least 99.85%, or at least 99.90% sequence identity to SEQ ID NO: 1. In particular embodiments, said bacterial strain comprises a 16S polynucleotide having a 100.00% sequence identity to SEQ ID NO: 1 or a 100.00% sequence identity to a 16S polynucleotide of the bacterial strain that has been deposited under the Budapest Treaty at the Polish Collection of Microorganisms (PCM) on November 10, 2023 under Accession No. B / 00499.

[0047] In a most particular embodiment, said bacterial strain is the Streptomyces strain as deposited under the BudapestTreaty at the PCM on November 10, 2023 under Accession No. B / 00499 or a functional homologue thereof. In certain embodiments, said functional homologue is a Streptomyces strain comprising a 16S polynucleotide having a 100.00% sequence identity to that of B / 00499, having at least 96.00% genomic sequence identity with B / 00499 and is still capable of improving a plant growth feature when administered to a plant, a part thereof, a seed for growing the plant or a locus of the plant compared to a control plant to which the functional homologue was not administered.

[0048] In particular embodiments, said functional homologue is a Streptomyces strain: a) comprising a 16S polynucleotide having a 100.00% sequence identity to that of B / 00499; b) having at least 96.50%, at least 97.00%, at least 97.50%, at least 98.00, at least 98.25%, at least 98.50%, at least 98.75%, at least 99.00%, at least 99.25%, at least 99.50% or at least 99.75% genomic sequence identity with B / 00499; and c) is still capable of improving a plant growth feature when administered to a plant, a part thereof, a seed for growing the plant or a locus of the plant compared to a control plant to which the functional homologue was not administered.

[0049] A further aspect discloses a bacterial strain that comprises a 16S polynucleotide having at least 99.80%, more preferably at least 99.85%, even more preferably at least 99.90% sequence identity to SEQ ID NO: 1, or still more preferably 100.00% sequence identity to SEQ ID NO: 1. In a particular embodiment, the sequence identity is calculated over at least 98.0%, at least 98.5%, at least 99.0% or at least 99.5% of the full length of SEQ ID NO: 1. In a most particular embodiment, the sequence identity is calculated over the full length of SEQ ID NO: 1.

[0050] In another more particular embodiment, the bacterial strain of the application comprises a 16S rDNA sequence as depicted in SEQ ID NO: 1 or comprises a 16S rDNA sequence with maximally 3, 2 or one nucleotide(s) different from SEQ ID NO: 1. In a more particular embodiment, any of the bacterial species described herein is provided, wherein said bacterial species is capable of stimulating or improving a plant growth feature compared to a control situation in the absence of said bacterial species. A further aspect discloses a bacterial strain that is the bacterial strain as deposited under the Budapest Treaty at the PCM on November 10, 2023 under Accession No. B / 00499 or a functional homologue thereof. In a preferred embodiment, the bacterial strain is the bacterial strain as deposited under the Budapest Treaty at the PCM on November 10, 2023 under Accession No. B / 00499.

[0051] In certain embodiments, said functional homologue is a Streptomyces strain comprising a 16S polynucleotide having a 100.00% sequence identity to that of B / 00499, having at least 96.00% genomic sequence identity with B / 00499 and is still capable of improving a plant growth feature when administered to a plant, a part thereof, a seed for growing the plant or a locus of the plant compared to a control plant to which the functional homologue was not administered. In particular embodiments, said functional homologue is a Streptomyces strain: a) comprising a 16S polynucleotide having a 100.00% sequence identity to that of B / 00499; b) having at least 96.50%, at least 97.00%, at least 97.50%, at least 98.00, at least 98.25%, at least 98.50%, at least 98.75%, at least 99.00%, at least 99.25%, at least 99.50% or at least 99.75% genomic sequence identity with B / 00499; and c) is still capable of improving a plant growth feature when administered to a plant, a part thereof, a seed for growing the plant or a locus of the plant compared to a control plant to which the functional homologue was not administered.

[0052] Also provided is a bacterial population comprising one or more of the aforementioned strains, as well as an agricultural active composition comprising one or more of the aforementioned strains.

[0053] Further provided is a plant seed comprising or heterogeneously disposed on its surface at least 10CFU of the bacteria as provided herein.

[0054] A plant or part thereof treated with the bacteria disclosed herein or with a composition comprising the bacteria; or a plant or part thereof heterologously disposed with said bacteria, are also provided herein.

[0055] As used herein, the term "bacterium", "bacteria", or "bacterial" refers in general to any prokaryotic organism, and may refer to an organism from either Kingdom Eubacteria (Bacteria), Kingdom Archaebacteria (Archaea), or both. In some cases, bacterial genera have been reassigned due to various reasons (such as, but not limited to, the evolving field of whole genome sequencing), and it is understood that such nomenclature reassignments are within the scope of any claimed genus.

[0056] As used herein, "bacterial strain" (which may be abridged to "strain" where the context makes clear that a bacterial strain is meant) refers to any of the prokaryotic microorganism belonging to the same class of species, including the species. The term "strain" as a basic operational unit of microbial taxonomy, such as bacterial taxonomy, is frequently used to denote a population made up of the descendants of a single isolation in pure culture, usually made up of a succession of cultures ultimately derived from an initial single colony. Where a species encompasses two or more distinct isolates, the term "strain" may be used to refer to an isolate or group of isolates that can be distinguished from other isolates of the same genus and species by phenotypic characteristics or genotypic characteristics or both.

[0057] In a further or particular embodiment, the bacteria of current application are not genetically engineered. In the practice of the present invention, the strain may be deemed as "isolated" or "purified". The terms "isolated" or "purified" with reference to a particular component generally denote that such component exists in separation from - for example, has been separated from or prepared and / or maintained in separation from - one or more other components of its natural environment. The terms do not necessarily reflect the extent to which the component has been purified. Hence, the phrases "isolated bacterial strain" or "purified bacterial strain" may be seen as referring to a strain that has been removed from its natural milieu. In particular, the terms refer to substantially no other strains than the desired strain, which is thus substantially free of other contaminants, which can include microbial contaminants. Further, the terms may denote that the strain has been separated from materials with which it is normally found in nature. A strain heterologously disposed to other strains, or with compounds or materials with which it is not normally found in nature, is encompassed by the phrases "isolated bacterial strain" or "purified bacterial strain".

[0058] In certain embodiments, the purified bacterial strains as taught herein may be denoted as endophytes. An "endophyte" is an organism capable of living on a plant element (e.g., rhizoplane or phyllosphere) or within a plant element (e.g., endosphere) or on a surface in close physical proximity with a plant element (e.g., the rhizosphere or on a seed). Endophytes can occupy the intracellular or extracellular spaces of plant tissue, including but not limited to leaves, stems, flowers, fruits, seeds, or roots. An endophyte can be, for example, a bacterial or fungal organism, and can confer a beneficial property to the host plant such as an increase in yield, biomass, resistance, and / or fitness. An endophyte can be a bacterium or a fungus. As used herein, the term "microbe" or "strain" is sometimes used to describe an endophyte. As used herein, the microbes or strains as described herein can be labelled as endophytes.

[0059] Endophytes may favorably impact one or more traits of agronomic interest in plants. By means of an example and without limitation, a plant heterologously disposed with one or more endophyte microorganism, or a plant grown from a plant part or seed treated with or heterologously disposed with one or more endophyte microorganism, such as an endophytic bacterial or fungal strain, may exhibit a trait of agronomic interest, such as a trait selected from the group consisting of: disease resistance, drought tolerance, heat tolerance, cold tolerance, salinity tolerance, metal tolerance, herbicide tolerance, chemical tolerance, improved water use efficiency, improved phosphorus solubilization, improved phosphorus mobilization, improved nitrogen utilization, improved nitrogen fixation, pest resistance, herbivore resistance, pathogen resistance, increase in yield, increase in yield under water-limited conditions, health enhancement, vigor improvement, growth improvement, improved plant emergence, photosynthetic capability improvement, nutrition enhancement, altered protein content, altered oil content, increase in biomass, increase in number of tillers per plant, increase in shoot length, increase in root length, improved root architecture, increase in seed weight, altered seed carbohydrate composition, altered seed oil composition, increase in radical length, delayed senescence, stay-green, altered seed protein composition, increase in dry weight of mature plant reproductive elements, increase in fresh weight of mature plant reproductive elements, increase in number of mature plant reproductive elements per plant, increase in chlorophyll content, reduced number of wilted leaves per plant, reduced number of severely wilted leaves per plant, increase in number of non-wilted leaves per plant, improved plant visual appearance, and combinations thereof.

[0060] As used herein, a microorganism, such as a bacterial or fungal strain, such as an endophytic bacterial or fungal strain, is considered to have conferred an improved agricultural trait whether or not the improved trait arose from the plant, the strain, or the concerted action between the plant and the strain. Therefore, for example, where an improved agronomic trait results at least in part from the production of a beneficial hormone or chemical, for the purposes of the present specification the strain will be considered to have conferred the improved agronomic trait upon the plant as compared to a plant, plant part or seed that has not been treated with or heterologously disposed with said strain, whether the beneficial hormone or chemical is produced by the plant or by the strain.

[0061] Particularly envisaged herein is the administration of live bacteria and / or microorganisms. The term "live" as used herein is synonymous with "viable" and refers to any living intact state of a microorganism, such as active growth or dormancy, from which state it can multiply and / or reproduce itself in a medium capable of supporting the growth of the microorganism. Typically, substantially all bacteria or microorganisms comprised by populations or compositions intended herein may be live or viable. For example, at least 50%, preferably at least 60%, more preferably at least 75%, still more preferably at least 90%, such as at least 95%, 96%, 97%, 98%, 99% or 100% of the bacteria or microorganisms in the population or composition may be viable, such as capable of forming colonies when plated on a suitable solid medium.

[0062] The term "16S polynucleotide", or synonymous terms such as "16S nucleotide sequence" or "16S", refer to the nucleic acid sequence, such as in particular the DNA sequence, of the 16S ribosomal RNA (rRNA) of a bacterium. 16S rDNA gene sequencing is a well-established method for studying phylogeny and taxonomy of bacteria. A full length 16S nucleic acid sequence is approximately 1500 nucleotides in length. In certain embodiments, the bacterial strain may comprise a single copy of the 16S rDNA gene. In certain embodiments, the bacterial strain may comprise more than one copy of the 16S rDNA gene, such as two, three or more (multicopy) copies of the 16S rDNA gene. In such embodiments where two or more 16S rDNA gene copies are found in the bacterial strain, at least one of these 16S rDNA gene copies complies with the sequence identity requirements specified in the present application, preferably two or more and preferably all of the 16S rDNA gene copies (each independently) comply with the stated sequence identity requirements. By means of an example and without limitation, where a bacterial strain comprises three 16S rDNA gene copies, at least one, preferably at least two, and more preferably all three 16S rDNA gene copies will, each independently, display the respective sequence identity value as disclosed herein, and may in certain preferred embodiments be identical. Conveniently, the 16S rDNA sequence can be determined by sequencing (e.g., Sanger sequencing) the 16S gene sequence(s) in the chromosomal DNA, which may be amplified (e.g., PCR amplified) using suitable amplification primers, such as in particular the Forward primer 27F: AGAGTTTGATCCTGGCTCAG (SEQ ID NO: 2) and Reverse primer 1492R: GGTTACCTTGTTACGACTT (SEQ ID NO: 3).

[0063] The terms "identity", "sequence identity" or "identical" in the context of nucleotide sequences may be used interchangeably herein, and refer to the extent that nucleic acid sequences are identical on a nucleotide-by-nucleotide basis, over a window of comparison. The percentage of sequence identity may be calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity. The percent identity value may, but need not, be rounded to the nearest tenth. For example, 98.11, 98.12, 98.13, and 98.14 may be rounded down to 98.1, while 98.15, 98.16, 98.17, 98.18, and 98.19 may be rounded up to 98.2.

[0064] Sequence identity between nucleic acids as envisaged herein may be determined using suitable algorithms for performing sequence alignments and determination of sequence identity as know per se. Exemplary but non-limiting algorithms include those based on the Basic Local Alignment Search Tool (BLAST) originally described by Altschul et al. 1990 (J Mol Biol 215: 403-10), such as the "Blast 2 sequences" tool described by Tatusova and Madden 1999 (FEMS Microbiol Lett 174: 247- 250), or the "blastn suite-2sequences" sequence alignment algorithm described by Zhang et al. 2000 (J Comput Biol 2000, vol. 7(1-2), 203-14), now incorporated into the BLAST program suite available at ncbi.nlm.nih.gov. The skilled person can implement such algorithms and set the requisite parameters. By means of an example and without limitation, parameters for the BLASTN program may be as follows: cost to open a gap = 0, cost to extend a gap = 2.5, reward for a match = 1, penalty for a mismatch = -2, Expect value = 0.05, word size = 28, Low Complexity Filter = Yes. There are further algorithms known in the art that can be used to measure nucleotide sequence identity. Nucleotide sequence identity can be measured by a local or global alignment, preferably implementing an optimal local or optimal global alignment algorithm. For example, a global alignment may be generated using an implementation of the Needleman-Wunsch algorithm (Needleman & Wunsch. Journal of Molecular Biology 1970, vol. 48(3), 443-53). For example, a local alignment (which does not consider the entirety of the sequence but tries to find the longest subsequence that confirms to a given matching criteria) may be generated using an implementation of the Smith-Waterman algorithm (Smith & Waterman Journal of Molecular Biology 1981, vol. 147(1), 195-197). Optimal global alignments using the Needleman-Wunsch algorithm and optimal local alignments using the Smith-Waterman algorithm are implemented in USEARCH (https: / / www.drive5.com / usearch / ), for example USEARCH version 11.0.667.

[0065] A gap is a region of an alignment wherein a sequence does not align to a position in the other sequence of the alignment. In global alignments, terminal gaps are discarded before identity is calculated. For both local and global alignments, internal gaps are counted as differences. A terminal gap is a region beginning at the end of a sequence in an alignment wherein the nucleotide in the terminal position of that sequence does not correspond to a nucleotide position in the other sequence of the alignment and extending for all contiguous positions in that sequence wherein the nucleotides of that sequence do not correspond to a nucleotide position in the other sequence of the alignment.

[0066] Sequence identity as envisaged herein in particular denotes overall sequence identity, i.e., sequence identity calculated from optimally aligning the whole sequences of the to-be-compared 16S rDNA genes. In other words, the nucleic acid sequences to be aligned are the complete 16S rDNA genes, and the window of comparison corresponds to the whole region of optimal alignment between these complete 16S sequences, i.e., to the alignment length. Hence, in an example, a query 16S rDNA gene sequence, such as the sequence set forth in SEQ. ID NO: 1, is optimally aligned with another 16S rDNA gene sequence (in case of a global alignment any terminal gaps are disregarded; in case of a local alignment the region of alignment will be expressed as the region between a given 5' and a given 3' position in the query sequence), and the percentage sequence identity is calculated over a window of comparison which corresponds to the whole region of alignment, counting internal gaps as differences.

[0067] In certain embodiments, bacterial strains as envisaged herein preferably comprise a 16S polynucleotide the length of which is between 90% and 110% (1370-1674 nucleotides), more preferably between 95% and 105% (1446-1598 nucleotides) of the length of the 16S region polynucleotide shown in SEQ ID NO: 1. These 16S sequences can be subjected to pairwise sequence comparisons with SEQ ID NO: 1.

[0068] When two complete 16S region sequences in a pairwise sequence comparison are optimally aligned, for example by a local alignment algorithm such as BLAST, it is particularly envisaged that the alignment length is at least 90% of the length of the shorter one of the two 16S sequences, preferably at least about 91%, 92%, 93%, 94%, more preferably at least about 95%, or at least about 96%, 97%, 98%, 99% or 100% of the length of the shorter one of the two 16S sequences, and the window of comparison corresponds to the whole alignment length.

[0069] Preferably, the region of alignment, for example the region of alignment provided by a local alignment algorithm such as BLAST, will comprise at least 90% of the length of SEQ ID NO: 1, more preferably at least about 91%, 92%, 93%, 94%, even more preferably at least about 95%, or at least about 96%, 97%, 98%, 99% or 100% of the length of SEQ ID NO: 1. Preferably, for comparisons with SEQ ID NO: 1, the region of alignment, for example the region of alignment provided by a local alignment algorithm such as BLAST, will comprise at least 1370 contiguous (the term contiguous in this context does not exclude the presence of internal gaps in the alignment) nucleotides of SEQ ID NO: 1, more preferably at least 1380 contiguous nucleotides, or at least 1390 contiguous nucleotides, or at least 1400 contiguous nucleotides, such as at least 1410, at least 1420, at least 1430, or at least 1440 contiguous nucleotides of SEQ ID NO: 1. Particularly preferably, the region of alignment will comprise at least 1446, or in increasing order of preference, at least 1450, at least 1460, at least 1470, at least 1480, at least 1490, or at least 1500, or at least 1510, or at least 1520, or all 1522 contiguous nucleotides of SEQ ID NO: 1.

[0070] In certain preferred embodiments, the bacterial strain as disclosed in current application comprises a 16S polynucleotide having at least 99.80% sequence identity to SEQ ID NO: 1, preferably comprising a 16S polynucleotide having at least 99.85%, or at least 99.90% sequence identity to SEQ ID NO: 1. In certain still more preferred embodiments, the bacterial strain comprises a 16S polynucleotide having 100.00% sequence identity to SEQ ID NO: 1 or having 100.00% sequence identity to a 16S polynucleotide of the Streptomyces strain as deposited under the Budapest Treaty at the PCM on November 10, 2023 under Accession No. B / 00499.

[0071] In certain still more preferred embodiments, the bacterial strain comprises a 16S polynucleotide as set forth in SEQ ID NO: 1 or comprises a 16S polynucleotide of the Streptomyces strain as deposited under the Budapest Treaty at the PCM on November 10, 2023 under Accession No. B / 00499. In certain particularly preferred embodiments, the bacterial strain comprises a 16S polynucleotide which, when aligned over a region of alignment comprising at least 1446 contiguous nucleotides of SEQ ID NO: 1 or of the 16S polynucleotide of the Streptomyces strain as deposited under the Budapest Treaty at the PCM on November 10, 2023 under Accession No. B / 00499, or in increasing order of preference, over a region of alignment comprising at least 1450, at least 1460, at least 1470, at least 1480, at least 1490, at least 1500, at least 1510, at least 1520, or all 1522 contiguous nucleotides of SEQ ID NO: 1 or of the 16S polynucleotide of the Streptomyces strain as deposited under the Budapest Treaty at the PCM on November 10, 2023 under Accession No. B / 00499, will display in increasing order of preference no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, no more than 1, and most preferably no nucleotide mismatches and internal gaps with SEQ ID NO: 1 or with the 16S polynucleotide of the Streptomyces strain as deposited under the Budapest Treaty at the PCM on November 10, 2023 under Accession No. B / 00499. The mismatch or internal gap in this context refers to a single nucleotide mismatch or a gap that involves or spans a single nucleotide.

[0072] In certain embodiments, the bacterial strain as disclosed in current application is a Streptomyces niveus strain. The term "Streptomyces niveus" encompass bacteria known under this taxonomical designation in the art. Streptomyces niveus bacteria have been described as aerobe, mesophilic bacteria, isolated from soil.

[0073] Exemplary strains of Streptomyces niveus may be as annotated under U.S. government's National Center for Biotechnology Information (NCBI) Taxonomy ID: 193462 (http: / / www.ncbi.nlm.nih.gov / Taxonomy).

[0074] In certain embodiments, the bacterial strain as disclosed in current application is the Streptomyces niveus strain MED-B-M2A1.

[0075] In certain embodiments, the bacterial strain as envisaged herein is the strain deposited under the Budapest Treaty at the PCM on November 10, 2023 under Accession No. B / 00499 or a functional homologue thereof.

[0076] The term "functional homologue" means a bacterial strain directly or indirectly obtained by genetic modification (such as by spontaneous mutagenesis or evolution, random induced mutagenesis or by targeted genetic modification) of the respective referenced strain and retaining at least some extent of the activity of the referenced strain on the plant growth feature of interest, such as ability to or activity in increasing the biomass, number of tillers, height, root abundance, and / or yield of the plant, preferably retaining at least 10%, such as at least 20%, at least 30%, or at least 40%, preferably at least 50%, such as at least 60%, at least 70%, or at least 80%, more preferably at least 90%, such as 100%, or even greater than 100% of the activity of the referenced strain on the plant growth feature of interest. The genetic modification of a functional mutant can be achieved through any means, such as, but not limited to, repeated culturing, chemical mutagens, ionizing radiation, transposon-based mutagenesis, or via conjugation, transduction, or transformation using the referenced strains as either the recipient or donor of genetic material. In certain embodiments, the 16S rDNA gene sequence of the functional homologue remains identical to the 16S rDNA gene sequence of the referenced strain. Hence, the functional homologue may preferably comprise the 16S rDNA gene sequence as shown in SEQ. ID NO: 1. In certain embodiments, the functional homologue comprises at most 10, such as in increasing order of preference, at most 9, 8, 7, 6, 5, 4, 3, 2, or at most 1 chromosomal loci (such as genes) whose nucleic acid sequence differs from (has been modified compared to) the sequence of the corresponding loci in the referenced strain, and / or the functional homologue comprises at most 10, such as in increasing order of preference, at most 9, 8, 7, 6, 5, 4, 3, 2, or at most 1 gene of the functional homologue carries a non-synonymous mutation not present in the reference strain. Hence, also disclosed is a method of genetically modifying the bacterial strain as envisaged herein, such as by mutagenesis, for example random or directed mutagenesis, and / or by transgenesis, for example by the introduction of one or more transgenes thereto, whereby a functional homologue of the referenced strain is obtained.

[0077] In certain embodiments, the bacteria as described in the present specification may be administered to the plant, the part thereof, the seed for growing the plant, or the locus of the plant in conjunction with one or more additional plant-beneficial microorganism. As used throughout the present specification, the term "microorganism" or "microbe" refers to any strain, any species or taxon of microorganism, including, but not limited to, archaea, bacteria, microalgae, fungi (including mold and yeast species), mycoplasmas, microspores, nanobacteria, oomycetes, and protozoa. In some embodiments, a microbe or microorganism is a bacterial strain. In some embodiments, a microbe or microorganism is a fungal strain. In some embodiments, a microbe or microorganism is an endophyte, for example a bacterial or fungal endophyte, which is capable of living within a plant. In some embodiments, a microbe or microorganism encompasses individual cells (e.g., unicellular microorganisms) or more than one cell (e.g., multi-cellular microorganism).

[0078] Diverse plant-associated microorganisms can positively impact plant health and physiology in a variety of ways. In particular, plant-beneficial microorganisms, when administered to a plant, plant part, a seed for growing a plant, or a locus of a plant may improve one or more traits of agronomic importance in a plant, such as one or more plant growth features. Where the improved trait can be quantified, any extent of an improvement is contemplated. For example, a plant-beneficial microorganism may provide an improved trait of agronomic importance in a plant that is of at least 3%, between 3% and 5%, at least 5%, between 5% and 10%, least 10%, between 10% and 15%, for example at least 15%, between 15% and 20%, at least 20%, between 20% and 30%, at least 30%, between 30% and 40%, at least 40%, between 40% and 50%, at least 50%, between 50% and 60%, at least 60%, between 60% and 75%, at least 75%, between 75% and 100%, at least 100%, between 100% and 150%, at least 150%, between 150% and 200%, at least 200%, between 200% and 300%, at least 300% or more, when compared with a reference or control plant grown under the same conditions. By means of an illustration, a plant-beneficial microorganism may be capable of increasing nutrient uptake and / or nutrient use efficiency of a treated plant as compared to a control plant, increasing the nitrogen fixating capacities or phosphorus uptake of a treated plant as compared to a control plant, increasing the amount of biomass of a treated plant as compared to a control plant, increasing the number of tillers per plant of a treated plant as compared to control plant, increasing growth and / or yield of a treated plant as compared to a control plant, and / or helping a treated plant overcome stress conditions, such as nutrient stress, compared to a control plant; and the like. Further traits of agronomic importance that can be improved by plant-beneficial microorganisms may include disease resistance, drought tolerance, heat tolerance, cold tolerance, salinity tolerance, metal tolerance, herbicide tolerance, chemical tolerance, improved water use efficiency, improved phosphorus solubilization, improved phosphorus mobilization, improved nitrogen utilization, improved nitrogen fixation, pest resistance, herbivore resistance, pathogen resistance, increase in yield, increase in yield under water-limited conditions, health enhancement, vigor improvement, growth improvement, improved plant emergence, photosynthetic capability improvement, nutrition enhancement, altered protein content, altered oil content, increase in biomass, increase in number of tillers per plant, increase in shoot length, increase in root length, improved root architecture, increase in seed weight, altered seed carbohydrate composition, altered seed oil composition, increase in radical length, delayed senescence, stay-green, altered seed protein composition, increase in dry weight of mature plant reproductive elements, increase in fresh weight of mature plant reproductive elements, increase in number of mature plant reproductive elements per plant, increase in chlorophyll content, reduced number of wilted leaves per plant, reduced number of severely wilted leaves per plant, increase in number of non-wilted leaves per plant, and / or improved plant visual appearance, and the like.

[0079] By means of an illustration and without limitation, plant-beneficial microorganisms may include mycorrhizal fungi, including endomycorrhizal fungi and ectomycorrhizal fungi, such as fungi belonging to the divisions Basidiomycota, Ascomycota, and Zygomycota, bacteria of the family Rhizobiaceae, bacteria of the genera Frankia, Azotobacter, Azospirillum, Acetobacter, Azoarcus, Burkholderia, Herbaspirillum, Pseudomonas (e.g., Pseudomonas fluorescens, P. putida, P. gladioli), Bacillus (Bacillus subtilis, B. cereus, B. circulans), further bacteria such as Serratia marcescens, Flavobacterium spp., Alcaligenes sp., Agrobacterium radiobacter, Streptomyces tendae, Streptomyces marokkonesis, Stenotrophomonas rhizophila, and others. In certain embodiments, the plant-beneficial microorganisms are selected from those disclosed in W02018060519, W02020161351, WO2020161352, WO2023170281, and WO2023126460, WO2023126461, WO2024133878 and WO2024133902.

[0080] In certain embodiments, the one or more additional plant-beneficial microorganism may be selected to improve the efficacy of the bacterial strain or strains as taught herein, in particular efficacy in improving the plant growth feature acted on by the bacterial strain. Hence, also provided is a method of improving the efficacy of the bacterial strain or strains as taught herein, comprising the selection of an additional plant-beneficial microorganism, whereby co-administration of the additional plant-beneficial microorganism with the bacterial strain or strains to a plant, plant part, or seed improves the plant growth feature. In such embodiments, the administration of the plant- beneficial microorganism alone may but need not lead to an improvement in a plant trait.

[0081] Also provided is a composition comprising the bacterial strain of current application. This is equivalent as saying that the composition comprises an inoculum of the bacterial strain of the application. As used herein, the term "inoculum" is intended to mean any form of bacterial cells, or spores, which is capable of propagating on or in a substrate when the conditions of temperature, moisture, etc., are favourable for bacterial growth. A "spore" generally refers to a microorganism in its dormant, protected state. In another embodiment, a composition is provided comprising the bacterial strain of current application further comprising a cryoprotectant and / or growth medium appropriate for Streptomyces species, more particularly Streptomyces niveus species. A "cryoprotectant" as used herein protects the bacteria by preventing the damaging effects of water crystals when cells are frozen, more particularly at -60°C, or -70°C or -80°C or in liquid nitrogen. Non-limiting examples of a cryoprotectant is glycerol and trehalose. In another embodiment, a composition is provided comprising the bacterial strain herein disclosed wherein the bacterial strain is lyophilized, freeze dried or in the form selected from dried cells, dehydrated cells, devitalized cells, inactivated cells, frozen cells or cells in artificial suspension or in a dry powder. In one embodiment, the composition can further comprise a preservative. The term "composition" generally refers to a thing composed of two or more components, and more specifically denotes a combination or mixture of two or more materials, such as elements, molecules, substances, and / or microorganisms, as well as reaction products and decomposition products formed from the materials of the composition. The term may be interchangeably used with the terms "formulation" or "preparation".

[0082] In another aspect of the application a culture of the bacterial strain of current application is provided. The term "culture" as used herein refers to a population of microorganisms that are propagated on or in media of various kinds. In one embodiment, said culture is an enriched culture of the bacterial strain of current application. This is equivalent as saying that a culture of microorganisms, more particularly a bacterial culture, is provided, wherein said culture is enriched with the bacterial strain of current application (e.g. Streptomyces strain B / 00499) and wherein "enriched" means that the total microbial (or more particularly the total bacterial) population of said culture contains more than 50%, more than 60%, more than 70%, more than 80%, more than 90%, or more than 95% of the bacterial strain of current application. In one embodiment, said percentage is determined by the number or CFUs of the bacterial strain in view of all microorganisms or bacterial cells present in the culture. In another embodiment, said percentage is determined by the biomass of the bacterial strain in view of all microorganisms or bacterial cells present in the culture.

[0083] In another embodiment, a biologically pure culture of the bacterial strain of current application is provided. As used herein, "biologically pure" refers to a culture which contains substantially no other microorganisms than the desired species and thus a culture wherein virtually all of the cells present are of the selected species. In practice, a culture is defined biologically pure if the culture contains at least more than 96%, at least more than 97%, at least more than 98% or at least more than 99% of the bacterial strain of current application. When a biologically pure culture contains 100% of the desired microorganism a monoculture is reached. A monoculture thus only contains cells of the selected species and is the most extreme form of a biologically pure culture. In one embodiment, said percentage is determined by the number or CFUs of the bacterial strain.

[0084] In yet another embodiment, the culture of the bacterial strain of the application comprises at least 1%, at least 5%, at least 10%, at least 25%, at least 50%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95% living bacterial strain of the application.

[0085] In certain embodiments, the bacteria can be comprised in or be part of an agricultural active composition. Hence, the methods may entail administering or applying such an agricultural active composition to the plant, the part thereof (e.g., roots), the seed for growing the plant, or the locus of the plant (e.g., to soil or plant growth medium surrounding the plant).

[0086] Agricultural active compositions typically comprise one or more agriculturally active ingredients and one or more agriculturally acceptable carrier or auxiliary. The terms "active ingredient" or "active component" can be used interchangeably and broadly refer to a material, such as an element, molecule, substance, and / or microorganism, which, when provided in an effective amount, achieves a desired outcome, such as achieves one or more effects on one or more traits of agronomic importance in plants. Typically, an active ingredient as intended herein may achieve such outcome(s) through interacting with and / or modulating the plant, part thereof, a seed for growing the plant, or the locus of the plant. The terms "agriculturally acceptable" or "agriculturally compatible" are consistent with the art and mean not deleterious to the recipient plant, such as not producing, having or causing any adverse effects when applied to a plant or to an organ, part or element of the plant, or adverse effects to the plant grown from that plant organ, part or element. The agriculturally active formulations may comprise materials which facilitate or enhance the stability, viability, storage, and / or administration of the bacterial strain(s) and / or plant- beneficial microorganism(s) as disclosed herein, and / or the colonization of the plant thereby.

[0087] Agricultural active compositions as typically used herein may be liquid, semi-solid, or solid, and may include solutions or dispersions. Non-limiting examples of the agricultural active compositions as taught herein may be soluble powders, soluble granules, wettable granules, tablet formulations, dry flowables, aqueous flowables, wettable dispersible granules, oil dispersions, suspension concentrates, dispersible concentrates, emulsifiable concentrates, aqueous suspensions, fertilizer granules, sprayables, and the like.

[0088] In certain embodiments, the agricultural active composition is a seed treatment formulation. Seed treatments have grown in popularity and have significantly advanced since their first realization. Seed treatment formulations usually contain multiple ingredients and / or high loading levels of for example a biological. Seed treatment formulations mostly contain a dyestuff to dye the treated seed, thus preventing its use as food. In addition, seed treatment formulations are often further modified to improve adhesion to seeds and to meet the requirements of the different ways of application. Some formulations are applied directly to the seed, other are first diluted with water, whereas aqueous sprays for seed treatment are much more concentrated than sprays for field application. Importantly, seed treatments must not reduce the quality of the seed or be detrimental to germination. Instead, in case of a biological, they should provide optimal conditions for the biological to demonstrate its plant-growth promoting properties. In other certain embodiments, the agricultural active composition is a sprayable formulation.

[0089] The skilled person knows that there are various formulation types available as solid or liquid formulations. In the past, most seed treatments were powders for application in dry state (DS) that were simply dry mixed with the seeds or powders that first were to be dispersed at high concentration in water before application as a slurry to the seed before planting (i.e. water dispersible powder for slurry seed treatment (WS) or wettable powder (WP)). Another more recent solid formulation type is the water dispersible granules for seed treatment (WG or WDG). The latter formulation consists of granules that are to be applied after disintegration and dispersion in water, thereby overcoming the dustiness of WS formulations.

[0090] Emulsifiable concentrate (EC) formulations are one of the most common liquid formulation types worldwide. EC formulations combine an active ingredient dissolved in a solvent with emulsifiers. When EC formulations are diluted with water they form a spontaneous emulsion, with emulsion droplets in the size range of 0.1 to 1.0 pm. The spontaneous emulsion can be achieved by selecting one or more surfactants based upon their ability to emulsify the solvent system, including the active ingredient, into water. It is by means of balancing the water soluble and oil soluble surfactant components at the water / solvent interface that a physically stable emulsion is formed. When sprayed, the dilute emulsion gives a uniform and accurate application of active ingredient on the plant or seeds.

[0091] Concentrated aqueous emulsion (EW) formulations can be considered as a safer and more environmentally friendly alternative to emulsifiable concentrates (EC). In an EW the continuous phase is water (as opposed to an organic solvent for ECs) which offers the benefit of lower phytotoxicity, no flashpoint concern, ease of handling, and a lower environmental impact. EW formulations are physically stabilized by specifically identified polymeric surfactants incorporated at an appropriate level. The emulsion has already been established in the formulation and is only diluted further before use.

[0092] Suspension concentrates (SC) formulations, also known as "flowables" (F), consist of a solid active ingredient dispersed in water. SCs have grown in popularity due to benefits such as the absence of dust, ease of use, and effectiveness when compared to other formulation types such as ECs and wettable powder (WP). To formulate a stable SC, the solid particles of the active ingredient must remain insoluble and suspended under all temperature conditions.

[0093] Flowable concentrates for seed treatment (FS) formulations are a modification of suspension concentrates (SC) with supplemental additives for adhesion to the seed surface and colourants as safety markers to indicate that a seed has been treated with a product. The active ingredients are typically mixed with a polymer or copolymer and fillers such as talc, graphite, aluminium or calcium salts. FS formulations are now the most popular type of seed treatment because they are concentrated formulations that can be directly applied on the seed or after dilution and are safer to apply as they are water based.

[0094] Microemulsion (ME) formulations are water-based formulations with a very small emulsified droplet size; this makes the formulation transparent. They are thermodynamically stable over a wide temperature range due to this very fine droplet size, usually between 0.01 and 0.05 pm. Therefore in contrast to other emulsion systems, where the oil droplets can slowly coalesce causing phase separation, in ME formulations this does not occur.

[0095] Suspoemulsion (SE) formulations are used to combine two active ingredients with very different physical properties into one formulation. They are a combination of suspension concentrate (SC) and concentrated aqueous emulsion (EW) technologies. The advantages are that it is possible to formulate multiple active ingredients together, broadening the spectrum of activity and eliminating the disadvantage of (tank-mix) incompatibility.

[0096] An oil dispersion (OD) formulation is a solid active ingredient dispersed in oil. The oil can vary from paraffinic to aromatic solvent types and vegetable oil or methylated seed oils. Ideally the active ingredient is uniformly suspended in the oil phase. ODs are an excellent delivery system for water sensitive active ingredients such as sulfonylureas. However, ODs have extended to other active ingredients due to their better spray retention, spreading and foliar uptake as the carrier oil often acts as an adjuvant.

[0097] A (micro)capsule suspension (CS) formulation is a combination of an active ingredient encapsulated in polymer shell suspended in water with a dispersant and wetting agent. CS formulations remain one of the most advanced formulation types for agricultural active compositions worldwide. These are typically next generation formulations. When CS formulations are diluted with water they form a spontaneous suspension, with particles in the size range of 0.1 to 20 pm. When sprayed, the dilute emulsion gives a uniform and accurate application of active ingredient on to the crop or seeds. It is possible to use CS formulations to give controlled or delayed release of active ingredients as well as provide better protection against toxic active ingredients or prevent degradation of material. For special seed treatment applications gel formulations (GF) are also used. In certain embodiments, an agricultural active composition may be composed of components that are provided to an end user as a mixture, i.e., the composition components are already admixed. In certain embodiments, an agricultural active composition may be composed of components one or more of which are provided to an end user in a physically separated form (e.g., in separate containers or vials) from one or more other components of the composition, although typically as part of the same product package or dispensing device. By means of an example and without limitation, the agricultural active composition may comprise one or more components provided in one container, and one or more components provided in another container. Such arrangement allows the end user to admix the components of the agricultural active composition shortly before use. For example, the agricultural active composition may comprise the bacteria and optionally further plant beneficial microorganism(s) as taught herein provided in one container, and one or more auxiliaries provided in another container, to be admixed by the end user before use.

[0098] In certain embodiments, the agricultural active composition comprises one or more agriculturally acceptable auxiliary. The terms "auxiliary", "auxiliary agent", "additive", or "adjuvant" may be used interchangeably herein. The auxiliaries may be natural or synthetic organic or inorganic materials which facilitate the administration of actives to plants, plant parts, seeds, or plant growth loci. In certain embodiments, the auxiliaries may be one or more of as a solvent, a carrier, a surfactant, a sticker, an antifreeze agent, a thickener, a buffering agent, an antifoaming agent, an antioxidant, a preservative, an aroma, or a colorant. Suitable auxiliary agents and inert agents are known in the art and are commercially available. In general, the bacteria and optionally further plant-beneficial microorganism(s) can be combined with any solid, semi-solid or liquid additive customarily used for formulation purposes. A carrier is to be understood as meaning a natural or synthetic, organic or inorganic substance which is mixed or combined with the bacteria and optionally further plant- beneficial microorganism(s) for better applicability, in particular for application to plants or plant parts such as seeds. The carrier, which may be solid, semi-solid, or liquid, is generally inert and suitable for use in agriculture or horticulture. For instance, liquid carriers may include water, organic solvents, and mineral oils and vegetable oils. Suitable liquefied gaseous extenders or carriers are liquids which are gaseous at ambient temperature and under atmospheric pressure, for example aerosol propellants, such as butane, propane, nitrogen and carbon dioxide. A sticker is to be understood as meaning an additive or adjuvant to improve adhesive properties of the composition to the plant or part thereof. Suitable surfactants are emulsifiers, dispersants or wetting agents having ionic or nonionic properties, or mixtures of these surfactants. It is possible to use colorants such as inorganic pigments, for example iron oxide, titanium oxide, Prussian blue, and organic dyes, such as alizarin dyes, azo dyes and metal phthalocyanine dyes, and trace nutrients, such as salts of iron, manganese, boron, copper, cobalt, molybdenum and zinc. Stabilizers, such as low- 1 temperature stabilizers, preservatives, antioxidants, light stabilizers or other agents which improve chemical and / or physical stability may also be present.

[0099] In certain embodiments, the bacteria and optionally further plant-beneficial microorganism(s) may be administered in combination with one or more other non-active or active ingredients that are non-toxic thereto. Such other ingredients may be an oil, an emulsifier, a spreader, a cryoprotectant, a binder, a dispersant, a surfactant, a buffer, a tackifier, a stabilizer, a microbial stabilizer, a bactericide (e.g., effective against bacteria other than those administered), a fungicide, a complexing agent, a herbicide, a nematicide, an insecticide, a molluscicide, an algicide, a fertilizer, a micronutrient fertilizer material, a plant growth regulator, a rodenticide, a preservative, a polymer, a desiccant, a nutrient, an excipient, a wetting agent, a salt, or any combination thereof.

[0100] In certain embodiments, the bacteria and optionally further plant-beneficial microorganism(s) may be co-administered and / or co-formulated with further biologicals or agrochemicals that stimulate plant growth and / or yield. In certain embodiments, particular strains may be selected on the basis of their compatibility with commonly used biologicals or agrochemicals. Plants, particularly agricultural plants, can be treated with a vast array of biologicals or agrochemicals. In some cases, a particular strain may be selected to be compatible with biologicals or agrochemicals with complexing properties, to facilitate persistence of the strain in the plant. There also exist many complexing agents that do not penetrate the plant, at least at a concentration sufficient to interfere with the administered bacteria. Where a systemic complexing agent is used in the plant, compatibility of the strain to be inoculated with such agents may be an important variable to consider. In an embodiment, purified bacterial strains that are compatible with biologicals or agrochemicals can be used to inoculate plants, plant elements or growth media according to the methods described herein.

[0101] Bactericide-compatible strains can also be isolated by selection on liquid medium. The culture of strains can be plated on petri dishes without any forms of mutagenesis; alternatively, strains can be mutagenized using any means known in the art. For example, strain cultures can be exposed to UV light, gamma-irradiation, or chemical mutagens such as ethylmethanesulfonate (EMS), ethidium bromide (EtBr), dichlorvos (DDVP), methyl methane sulphonale (MMS), triethylphosphate (TEP), trimethylphosphate (TMP), nitrous acid, or DNA base analogs, prior to selection on bactericide comprising media. Alternatively or in addition, where the mechanism of action of a particular bactericide is known, the target gene can be specifically mutated (either by gene deletion, gene replacement, site-directed mutagenesis, etc.) to generate a strain that is resilient against that particular chemical. The above-described methods can be used to isolate strains that are compatible with both bacteriostatic and bactericidal compounds. The biological or agrochemical compatible strains generated can be detected in samples. For example, where a transgene was introduced to render the strain compatible with the biological (s) or agrochemical(s), the transgene can be used as a target gene for amplification and detection by PCR. In addition, where point mutations or deletions to a portion of a specific gene or a number of genes results in compatibility with the biological (s) or agrochemical(s), the unique point mutations can likewise be detected by PCR or other means known in the art. Such methods allow the detection of the strain even if it is no longer viable.

[0102] In certain embodiments, the agricultural active composition is a liquid composition. The agricultural active compositions may be a ready-to-use composition which can be administered or applied with a suitable apparatus, or the agricultural active composition may be a concentrate or a concentrated formulation which is to be diluted in a solvent, such as water or an aqueous solution or buffer prior to use. In certain further embodiments, the agricultural active composition is an aqueous composition. In certain embodiments, the agricultural active composition is a sprayable liquid or a concentrate. In certain embodiments, the agricultural active composition is a spray, a sprayable liquid or a dip.

[0103] The agricultural active compositions as intended herein can encompass an effective amount of the bacteria and optionally one or more further plant-beneficial microorganisms, i.e., an amount sufficient to elicit the desired outcome, such as one or more effects on one or more traits of agronomic importance in plants, such as an increase in the biomass of a plant, or yield of a plant, or both biomass and yield of a plant compared to an untreated or control plant, that is being sought by the user, in either a single or multiple doses, preferably in a single dose.

[0104] In certain embodiments, the agricultural active composition comprises the bacteria at a concentration of at least about 10 CFU / ml. In certain embodiments, the agricultural active composition comprises the bacteria at a concentration of at least about 102CFU / ml. As used herein, a "colony forming unit" or "CFU" refers to a measure of viable microorganisms in a sample. A CFU is an individual viable cell capable of forming on a solid medium a visible colony whose individual cells are derived by cell division from one parental cell. The phrases "CFU", "CFU / ml", and "CFU / g" also encompass the reference to "spores", "spores / ml" or "spores / g", respectively, in case the microorganism lends itself to being administered in the form of spores. In certain embodiments, the liquid composition comprises the bacteria at a concentration of at least about 102CFU / ml. In certain embodiments, the liquid composition comprises the bacteria at a concentration of at least about 103CFU / ml, at least about 104CFU / ml, at least about 105CFU / ml, at least about 106CFU / ml, at least about 107CFU / ml, at least about 108CFU / ml, at least about 109CFU / ml, at least about IO10CFU / ml, at least about 1011CFU / ml, or at least about 1012CFU / ml.

[0105] In certain embodiments, the liquid composition comprises the bacteria at a concentration of from 1 x 102CFU / ml to 1 x 1012CFU / ml, or from 1 x 103CFU / ml to 1 x 1011CFU / ml, or from 1 x 103CFU / ml to 1 x IO10CFU / ml, or from 1 x 104CFU / ml to 1 x IO10CFU / ml, or from 1 x 105CFU / ml to 1 x IO10CFU / ml, or from 1 x 106CFU / ml to 1 x IO10CFU / ml, or from 1 x 106CFU / ml to 1 x 109CFU / ml, or from 1 x 107CFU / ml to 1 x IO10CFU / ml, or from 1 x 107CFU / ml to 1 x 109CFU / ml, or from 1 x 108CFU / ml to 1 x IO10CFU / ml, or from 1 x 108CFU / ml to 1 x 109CFU / ml.

[0106] In certain embodiments, the agricultural active composition is a non-liquid composition. In certain preferred embodiments, the agricultural active composition may be a solid composition or a powdered composition. In certain preferred embodiments, the agricultural active composition is a powder. The term "powder" refers to a dry, bulk solid composed of many very fine particles that may flow freely when shaken or tilted.

[0107] In certain embodiments, the non-liquid composition, such as the powder, comprises the bacteria at an amount of at least about 102CFU / g. In certain embodiments, the non-liquid composition comprises the bacteria at an amount of at least about 102CFU / g. In certain embodiments, the non- liquid composition comprises the bacteria at an amount of at least about 103CFU / g, at least about 104CFU / g, at least about 105CFU / g, at least about 10sCFU / g, at least about 107CFU / g, at least about 108CFU / g, at least about 109CFU / g, at least about IO10CFU / g, at least about 1011CFU / g, or at least about 1012CFU / g.

[0108] In certain embodiments, the non-liquid composition comprises the bacteria at an amount of from 1 x 102CFU / g to 1 x 1012CFU / g, or from 1 x 103CFU / g to 1 x 1011CFU / g, or from 1 x 103CFU / g to 1 x IO10CFU / g, or from 1 x 104CFU / g to 1 x IO10CFU / g, or from 1 x 105CFU / g to 1 x IO10CFU / g, or from 1 x 106CFU / g to 1 x IO10CFU / g, or from 1 x 106CFU / g to 1 x 109CFU / g, or from 1 x 107CFU / g to 1 x IO10CFU / g, or from 1 x 107CFU / g to 1 x 109CFU / g, or from 1 x 108CFU / g to 1 x IO10CFU / g, or from 1 x 108CFU / g to 1 x 109CFU / g.

[0109] In certain embodiments, the agricultural active composition may comprise bacteria of two or more bacterial strains as described in the present specification. In certain embodiments, the agricultural active composition may comprise at least about 102CFU / ml or at least about 102CFU / g - such as the aforementioned more specific CFU / ml or CFU / g amount ranges - of bacteria of all the strains collectively or preferably of each of the strains individually and independently.

[0110] In certain embodiments, the agricultural active composition comprises the one or more optional further plant-beneficial microorganism, such as cells or spores of one or more plant-beneficial microorganism strain, at a concentration or an amount, collectively or each individually and independently, of at least about 102CFU / ml or 102CFU / g, at least about 103CFU / ml or CFU / g, at least about 104CFU / ml or CFU / g, at least about 105CFU / ml or CFU / g, at least about 106CFU / ml or CFU / g, at least about 107CFU / ml or CFU / g, at least about 108CFU / ml or CFU / g, at least about 109CFU / ml or CFU / g, or at least about IO10CFU / ml or CFU / g. More preferably, the agricultural active composition comprises the one or more optional further plant-beneficial microorganism, such as cells or spores of one or more plant-beneficial microorganism strain, at a concentration or an amount, collectively or each individually and independently, of between 103to IO10CFU / ml or CFU / g, between 104to IO10CFU / ml or CFU / g, between 105to IO10CFU / ml or CFU / g, between 10sto IO10CFU / ml or CFU / g, between 10sto 109CFU / ml or CFU / g, between 107to 109CFU / ml or CFU / g, or between 108to 109CFU / ml or CFU / g.

[0111] In certain embodiments, the bacteria may be comprised by and administered as part of a bacterial population. A bacterial population may comprise bacteria of one or more bacterial strains as described in the present specification, such as of two, three or more strains as described in the present specification.

[0112] More generally, a microbial population is provided comprising two or more (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25 or more than 25) purified microbial strains of which at least one is the bacterial strain of the application, and wherein the microbial strains may originate from different families of microorganisms, or different genera of microorganisms, or from the same genera but different species of microorganisms, wherein said microorganisms comprises bacteria, fungi and / or yeasts. The taxonomically different microbial strains can be obtained from the same cultivar of plant, different cultivars of the same plant, or different species of the same type of plant. The microbial strains can be obtained from the soil wherein the plant is grown. In an embodiment in which one or more, preferably two or more purified microbial strains are used, each of the microbial strains can have different properties or activities, e.g., produce different metabolites, produce different enzyme, confer different beneficial traits.

[0113] In certain embodiments, the microbial composition comprises bacteria of the one or more bacterial strains as described in the present specification, and optionally one or more additional bacterial strains. In other embodiments, the microbial composition comprises bacteria of the one or more bacterial strain as described in the present specification, and optionally one or more additional fungal strains. In yet other embodiments, the microbial composition comprises bacteria of the one or more bacterial strain as described in the present specification, and optionally one or more additional yeast strains.

[0114] Where the microbial composition comprises microorganisms of two or more microbial strains, they may in certain embodiments be included in the composition in unequal amounts or preferably in about equal amounts. By means of an example and without limitation, the microorganisms of each of the two or more microbial strains may, each independently, constitute at least about 1% by CFU of all viable microorganisms constituting the microbial composition, such as at least about 2%, at least about 5%, at least about 10%, preferably at least about 20%, such as at least about 30%, or at least about 40%, more preferably at least about 50%, such as at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or at least about 99% of all viable microorganisms constituting the microbial composition (where the sum of these amounts would exceed 100%, it shall be understood that the sum is capped at 100%).

[0115] In certain embodiments, the concentration or amount of each isolated microbial strain in the microbial composition may be at least about 102CFU / ml or CFU / g, at least about 103CFU / ml or CFU / g, at least about 104CFU / ml or CFU / g, at least about 105CFU / ml or CFU / g, at least about 106CFU / ml or CFU / g, at least about 107CFU / ml or CFU / g, at least about 108CFU / ml or CFU / g, at least about 109CFU / ml or CFU / g, or at least about IO10CFU / ml or CFU / g. More preferably, the concentration or amount of each isolated microbial strain in the microbial composition may be between 103to IO10CFU / ml or CFU / g, between 104to IO10CFU / ml or CFU / g, between 105to IO10CFU / ml or CFU / g, between 10sto IO10CFU / ml or CFU / g, between 10sto 109CFU / ml or CFU / g, between 107to 109CFU / ml or CFU / g, or between 108to 109CFU / ml or CFU / g.

[0116] Also provided in an aspect is a bacterial population, such as in accordance with the aforementioned explanations, comprising a bacterial strain that is the strain deposited under the Budapest Treaty at the PCM on November 10, 2023 under Accession No. B / 00499 or a functional homologue thereof, and optionally one or more other bacterial strains.

[0117] Also provided in an aspect is an agricultural active composition, such as in accordance with the aforementioned explanations, comprising a bacterial strain that is the strain deposited under the Budapest Treaty at the PCM on November 10, 2023 under Accession No. B / 00499 or a functional homologue thereof, and optionally, one or more other bacterial strains. Bacterial strains, combinations, populations, and compositions as discussed throughout the present specification can be employed in plants cultivation, in particular to facilitate an improvement or enhancement in the biomass, number of tillers, height, root abundance, and / or yield of plants.

[0118] Also provided is a kit comprising (i) any of the agricultural active compositions described above and herein, comprising any of the bacteria of the application; and (ii) a delivery system for applying said compositions to a plant or to a part thereof or to the plant growth medium and / or (iii) optionally instructions for using the compositions. According to certain embodiments, the instructions for using the compositions comprise instructions for the amounts and frequency of applying the agricultural active composition as to improve the yield and / or growth of a plant.

[0119] The terms "plant" or "plant element" as used herein encompasses whole plants, ancestors and progeny of the plants and plant parts, including seeds, shoots, stems, leaves, roots (including tubers), flowers, and tissues and organs. The terms "plant" or "plant element" also refer to plant cells, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen and microspores. Hence, when the term "plant" or "plant element" is used herein, the term is intended to encompass "a plant, part thereof, or plant cell". The term "plant cell" may encompass a non-propagating plant cell.

[0120] The phrases "part of a plant" or "plant part" as used herein refer to any one or more portions of a plant, such as to any one or more of the seeds, shoots, stems, leaves, roots (including tubers), flowers, and tissues and organs of a plant, such as for example meristematic tissue, ground tissue, vascular tissue, dermal tissue, etc. In addition, a "plant part" is intended to generically reference any part of a plant that is able to initiate other plants via either sexual or asexual reproduction of that plant, for example but not limited to: seed, seedling, root, shoot, cutting, scion, graft, stolon, bulb, tuber, corm, keikis, or bud.

[0121] In certain embodiments, the part of a plant may be any one or more of the seeds, shoots, stems, leaves, roots (including tubers), or flowers. In certain embodiments, the part of a plant may be the seeds. In certain embodiments, the part of a plant may be the shoots, stems, or leaves. In certain embodiments, the part of a plant may be the roots (including tubers). In certain embodiments, the part of a plant may be tissues or organs of a plant.

[0122] In certain embodiments, the seeds, shoots, stems, leaves, roots (including tubers), flowers, tissues or organs of the plant, when treated according to the methods as taught herein, may be attached to (e.g., growing on) the whole plant. In certain embodiments, the seeds, shoots, stems, leaves, roots (including tubers), flowers, tissues or organs of the plant, when treated according to the methods as taught herein, may be detached from (e.g., not growing on) the whole plant. For instance, seeds may be detached from (e.g., not growing on) the whole plant when treated according to the methods as taught herein.

[0123] In some embodiments, plants may include wild plants and domesticated varieties. In certain embodiments, plants and plant parts may be developed by any technique, including but not limited to directed evolution, selection, marker assisted selection, hybridization, outcrossing, backcrossing, in-breeding, polyploidization, reverse breeding, doubled haploids, induced mutation, other genetic or epigenetic modifications, and combinations thereof.

[0124] The phrases "locus of a plant" or "locus of growth of a plant" as used herein refers to an area in close proximity of a plant (including parts thereof such as a seed). It can be interchangeably be used to "location comprising a plant". For instance, the locus of a plant may be a circular area around the plant, e.g., around the stem of a plant or around a seed, such as a circular area having a diameter of at most 1 meter, for instance at most 50 centimeters (cm), at most 40 cm, at most 30 cm, at most 20 cm, at most 10 cm, or at most 5 cm, around the plant, e.g., around the stem of a plant or around a seed. The locus of growth may include the growth medium (e.g., soil, hydroponic medium, or hydroculture medium) for cultivating the plant.

[0125] The reference to plants includes any plants. In certain embodiments, the plants may be an angiosperm. Particularly preferred are agricultural plants. The terms "agricultural plants", "crops" or "plants of agronomic importance" as used herein include plants that are cultivated by humans for but not limited to food, feed, fiber, fuel, gardening, and / or industrial purposes.

[0126] In certain embodiments, the plant is a monocotyledon. The terms "monocotyledon" or "monocot" refer to flowering plants (angiosperms) whose seeds typically contain only one embryonic leaf or cotyledon.

[0127] In certain preferred embodiments, the plant is a cereal plant. The terms "cereal" or "cereal plant" refer to any grass cultivated for the edible components of its grain (caryopsis), composed of the endosperm, germ, and bran.

[0128] In certain preferred embodiments, the plant is selected from the group consisting of wheat, maize, barley, rice, millet, rye, triticale, sorghum, emmer, spelt, einkorn, teff, milo, and oats. In certain particularly preferred embodiments, the plant is wheat or maize. In certain particularly preferred embodiments, the plant is wheat (Triticum aestivum and related varieties). In further particularly preferred embodiments, the plant is maize (Zea mays and related varieties). In other embodiments, the plant is a dicotyledon. The terms "dicotyledon" or "dicot" refer to flowering plants (angiosperms) whose seeds typically contain two embryonic leaves or cotyledons.

[0129] In certain embodiments, the plant is a cucurbit, such as a cucumber plant.

[0130] In certain embodiments, the products and methods disclosed herein may be particularly useful for monocotyledonous and dicotyledonous plants including fodder or forage legumes, ornamental plants, food crops, trees or shrubs, such as plants selected from the list comprising or consisting of Acer spp., Actinidia spp., Abelmoschus spp., Agave sisalana, Agropyron spp., Agrostis stolonifera, Allium spp., Amaranthus spp., Ammophila arenaria, Ananas comosus, Annona spp., Apium graveolens, Arachis spp., Artocarpus spp., Asparagus officinalis, Avena spp. (e.g. Avena sativa, Avena fatua, Avena byzantina, Avena fatua var. sativa, Avena hybrida), Averrhoa carambola, Axonopus spp., Bambusa spp., Benincasa hispida, Bertholletia excelsea, Beta vulgaris, Brassica spp. (e.g. Brassica napus), Bouteloua spp., Brassica spp., Brassica rapa ssp. [canola, oilseed rape, turnip rape]), Cadaba farinosa, Camellia sinensis, Canna indica, Cannabis sativa, Capsicum spp., Carex elata, Carica papaya, Carissa macrocarpa, Carya spp., Carthamus tinctorius, Castanea spp., Ceiba pentandra, Cichorium endivia, Cinnamomum spp., Citrullus lanatus, Citrus spp., Cocos spp., Coffea spp., Coix spp., Colocasia esculenta, Cola spp., Corchorus sp., Coriandrum sativum, Corylus spp., Crataegus spp., Crocus sativus, Cucurbita spp., Cucumis spp., Cynara spp., Cynodon spp., Dactylis spp., Daucus carota, Desmodium spp., Dimocarpus longan, Dioscorea spp., Diospyros spp., Echinochloa spp., Elaeis spp. (e.g. Elaeis guineensis, Elaeis oleifera), Eleusine coracana, Eragrostis spp. (e.g. Eragrostis tef), Eremochloa spp., Erianthus spp., Eriobotrya japonica, Eucalyptus spp., Eugenia uniflora, Fagopyrum spp., Fagus spp., Festuca spp. (e.g. Festuca arundinacea), Ficus carica, Fortunella spp., Fragaria spp., Ginkgo biloba, Glycine spp. (e.g. Glycine max, Soja hispida or Soja max), Gossypium hirsutum, Helianthus spp. (e.g. Helianthus annuus), Hemerocallis fulva, Hibiscus spp., Hordeum spp. (e.g. Hordeum vulgare), Ipomoea batatas, Juglans spp., Lactuca spp. (e.g. Lactuca sativa), Lathyrus spp., Lens culinaris, Linum usitatissimum, Litchi chinensis, Lolium spp., Lotus spp., Luffa acutangula, Lupinus spp., Luzula sylvatica, Lycopersicon spp. (e.g. Lycopersicon esculentum, Lycopersicon lycopersicum, Lycopersicon pyriforme), Macrotyloma spp., Malus spp., Malpighia emarginata, Mammea americana, Mangifera indica, Manihot spp., Manilkara zapota, Medicago sativa, Melilotus spp., Mentha spp., Miscanthus sinensis, Momordica spp., Morus nigra, Musa spp., Nicotiana spp., Olea spp., Opuntia spp., Ornithopus spp., Oryza spp. (e.g. Oryza sativa, Oryza latifolia), Paspalum spp., Panicum spp. (e.g. Panicum miliaceum, Panicum virgatum), Passiflora edulis, Pastinaca sativa, Pennisetum spp., Persea spp., Petroselinum crispum, Phalaris arundinacea, Phaseolus spp., Phleum spp. (e.g. Phleum pretense), Phoenix spp., Phragmites australis, Physalis spp., Pinus spp., Pistacia vera, Pisum spp., Poa spp., Populus spp., Prosopis spp., Prunus spp., Psidium spp., Punica granatum, Pyrus communis, Quercus spp., Raphanus sativus, Rheum rhabarbarum, Ribes spp., Ricinus communis, Rubus spp., Saccharum spp., Salix sp., Sambucus spp., Secale spp. (e.g. Secale cereal), Sesamum spp., Sinapis sp., Solanum spp. (e.g. Solanum tuberosum, Solanum integrifolium, Solanum lycopersicum), Sorghum spp. (e.g. Sorghum bicolor), Spinacia spp., Stenotaphrum spp., Syzygium spp., Tagetes spp., Tamarindus indica, Theobroma cacao, Trifolium spp., Tripsacum dactyloides, Triticosecale rimpaui, Triticum spp. (e.g. Triticum aestivum, Triticum durum, Triticum turgidum, Triticum hybernum, Triticum macha, Triticum sativum, Triticum monococcum, Triticum vulgare), Topaeolum spp. (e.g. Tropaeolum minus, Tropaeolum majus), Vaccinium spp., Vicia spp., Vigna spp., Viola odorata, Vitis spp., Zea mays, Zizania palustris, Ziziphus spp., Zoysia spp., amongst others; including the progenies and hybrids between the above.

[0131] In certain preferred embodiments, the plant, more in particular the agricultural plant, as envisaged herein is wheat (Triticum aestivum and related varieties), rye (Secale cereale and related varieties), or barley (Hordeum vulgare and related varieties). In certain particularly preferred embodiments, the plant, more in particular the agricultural plant, as envisaged herein is wheat (Triticum aestivum and related varieties).

[0132] In certain other preferred embodiments, the plant, more in particular the agricultural plant, as envisaged herein belongs to Cucurbitaceae. In certain preferred embodiments, the plant may be Cucurbita spp., Citrullus spp., or Cucumis spp., such as particularly preferably cucumber (C. sativus and related varieties).

[0133] The plant may be a non-modified plant or a modified plant. As used herein, a plant may be "modified" when it comprises an artificially introduced genetic or epigenetic "modification". In some embodiments, the modification is introduced by a genome engineering technology. In some embodiments, the modification is introduced by a targeted nuclease. In some embodiments, targeted nucleases include, but are not limited to, transcription activator-like effector nuclease (TALEN), zinc finger nuclease (ZNF), clustered regulatory interspaced short palindromic repeats (CRISPR), CRISPR / Cas9, CRISPR / CPFL and combinations thereof. In some embodiments, the modification is an epigenetic modification. In some embodiments, the modification is introduced by treatment with a DNA methyltransferase inhibitor such as 5-azacytidine, or a histone deacetylase inhibitor such as 2-amino-7-methoxy-3H-phenoxazin-3-one. In some embodiments, the modification is introduced via tissue culture. In some embodiments, a modified plant may comprise a transgene. In certain embodiments, the plant may be a non-transgenic plant or a transgenic plant.

[0134] In certain preferred embodiments, the plant may be a non-transgenic plant or a transgenic plant. The terms "recombinant", "transgenic" or "transgene" as used herein, for example with regard to a plant, refer to those plants brought about by recombinant methods in which a nucleic acid sequence and / or genetic control sequence(s) which are operably linked to the nucleic acid sequence are not located in their natural genetic environment. The natural genetic environment is understood as meaning the natural genomic or chromosomal locus in the original plant. A naturally occurring nucleic acid sequence (e.g., a naturally occurring combination of the native promoter of a nucleic acid sequence, the corresponding native nucleic acid sequence encoding a protein, and the native transcription termination sequence of a nucleic acid sequence) becomes a recombinant nucleic acid when this nucleic acid is not integrated in the natural genetic environment but in a different genetic environment as a result of an isolation of said nucleic acid from its natural genetic environment and re-insertion at a different genetic environment.

[0135] In certain embodiments, the plant may be free of disease and / or pathogen pressure and / or pest organisms. The term "free of disease and / or pathogen pressure and / or pest organisms" as used herein refers to a situation that does not significantly inhibit plant growth and / or yield. "Significantly inhibiting" as used herein means a reduction of plant growth and / or plant yield of at least 50%, at least 20%, at least 10% or at least 5% compared to a control plant that is not affected by disease and / or pathogen pressure and / or pest organisms. "Pest organisms" as used herein refer to organisms that cause plant disease and / or negatively affect plant health by e.g. consumption of plant tissue. Non-limiting examples of pest organisms include fungi, oomycetes, bacteria, viruses, virus-like organisms, phytoplasmas, protozoa, insects, nematodes, parasitic plants, mites, gastropods and vertebrates. In other embodiments, the plant may be affected with disease and / or pathogen pressure and / or pest organisms.

[0136] The products, methods and uses as taught herein can provide for advantages in plants treated therewith relative to untreated plants. An "untreated plant" refers to a plant of the same species as (e.g., which is isogenic to or genetically identical to) and grown under substantially the same conditions as (e.g., for the same amount of time, in the same climate, and cultivated according to the same methods using the same materials, with biomass, yield and other characteristics being measured according to the same methods) a plant which has been administered the bacterial strain(s) (for reasons of brevity, the mention of bacterial strain(s) henceforth encompasses the one or more bacterial strain as envisaged herein, as well as microbial populations as disclosed herein, as well as the compositions comprising these, insofar the context does not indicate otherwise; these may also contain the optional further plant-beneficial microorganism(s)), except that the untreated plant has not been administered said bacterial strain(s) to the plant, a part thereof, a seed for growing the plant, or locus of the plant. The term may be used synonymously to "reference plant", "reference", "control plant", "control", "mock plant" or "mock", i.e. a plant genetically identical to and handled in substantially identical ways to a treated plant, with the exception of the treatment under investigation, and which thus offers a meaningful and informative control for detecting the effects of said treatment. A treated plant and a control or reference plant are thus exposed to substantially the same environmental conditions. By means of an example, two genetically identical maize plant embryos may be separated into two different groups, one receiving a treatment (such as administration of the bacterial strain(s)) and one control, e.g., reference, that does not receive such treatment. Any phenotypic differences between the two groups may thus be attributed solely to the treatment and not to any inherency of the plant's genetic makeup. In another example, two genetically identical wheat seeds may be treated with a composition, one that introduces a bacterial population and one that does not. Any phenotypic differences between the plants derived from (e.g., grown from or obtained from) those seeds may be attributed to the bacterial population.

[0137] The term "untreated seed" refers to a seed of the same species as (e.g., which is isogenic to or genetically identical to) and obtained under substantially the same conditions as (e.g., plants from which the seeds are obtained are grown for the same amount of time, in the same climate, and cultivated according to the same methods using the same materials, seeds are stored under the same conditions) a seed which has been administered the bacterial strain(s), except that the untreated seed has not been administered said bacterial strain(s). The term is synonymously to "reference seed", "control seed" or "mock seeds".

[0138] The term "plant growth feature" is intended to broadly encompass any feature that relates in some way to plant growth. The feature may relate to or be observable with respect to an individual plant or to a population of plants. Examples of such features include, without limitation, plant wet or dry biomass, plant height, plant size, emergence %, emergence date, canopy cover, flowering status, seed yield, grain yield, fruit yield, number of tillers per plant, shoot length, root length, root architecture, root abundance, seed weight, senescence, stay-green, number of mature plant reproductive elements per plant, visual appearance, etc. The reference to an improvement encompasses any qualitative or quantitative change or modification in a plant growth feature that is industrially beneficial, in particular in the context of agriculture. To the extent a plant growth feature is quantifiable, an improvement may be synonymous to an increase or a reduction in that quantity, depending on the nature of the plant growth feature. By means of an example and without limitation, an increase may be desired in quantifiable features such as plant wet or dry biomass, plant height, plant size, canopy cover, seed yield, grain yield, fruit yield, number of tillers per plant, root abundance, shoot length, root length, seed weight, etc.

[0139] In certain embodiments, the plant growth feature comprises or is biomass, height, number of tillers, root abundance, yield, or any combination thereof. In certain preferred embodiments, the plant growth feature is biomass, and in particular dry biomass, and / or yield of the plant.

[0140] As used herein, the "biomass" of a plant refers to the amount (e.g., as determined by mass or weight, e.g., measured in grams of air-dry or wet tissue) or quantity (numbers) of tissue produced from the plant. Unless specified otherwise, biomass comprises both aboveground biomass (i.e., aerial biomass, including but not limited to stem, leaves, fruits, and / or seeds) and / or belowground biomass (i.e., roots). The biomass refers to the biomass at a given time. The biomass of a plant that has been administered the bacterial strain(s) of current application can be measured according to known methods including weighing. Biomass may be given as weight per unit area. The term may also refer to all the plants or species in the community (community biomass). In certain embodiments, an increase in the biomass of a plant or part thereof may include an increase in the dry biomass, the wet biomass, the number of tillers, the height of the plant, the plant yield, the seed yield, the fruit yield, or a combination thereof.

[0141] In certain embodiments, the dry biomass of the plant may be measured according to the dry weight (DW) of the plant or part thereof in grams. The dry weight may be determined after drying the plant or part thereof until no residual water is left, e.g., after drying at 60°C for 1 week. In certain embodiments, the wet biomass of the plant may be measured according to the wet or fresh weight of the plant or part thereof in grams. The number of tillers may be determined by counting the tillers. The height of the plant may be determined by measuring the height.

[0142] As used herein the phrase "yield" or "plant yield" refers to the amount, mass or weight (e.g., as determined by weight or size) or quantity (numbers) of tissues or organs produced per plant, per growing area, and / or per growing season. The plant yield may be affected by various parameters including, but not limited to, plant biomass; plant vigor; growth rate; seed yield; seed or grain quantity; seed or grain quality; oil yield; content of oil, starch and / or protein in harvested organs (e.g., seeds or vegetative parts of the plant); number of flowers (florets) per panicle (expressed as a ratio of number of filled seeds over number of primary panicles); harvest index; number of plants grown per area; number and size of harvested organs per plant and per area; number of plants per growing area (density); number of harvested organs in field; total leaf area; carbon assimilation and carbon partitioning (the distribution / allocation of carbon within the plant); resistance to shade; number of harvestable organs (e.g. seeds), seeds per pod, weight per seed; and modified architecture.

[0143] As used herein the phrases "seed yield" or "grain yield" refer to the number or weight of the seeds per plant, seeds per pod, or per growing area or to the weight of a single seed. Hence seed yield can be affected by seed dimensions (e.g., length, width, perimeter, area and / or volume), number of (filled) seeds and seed filling rate. An increased seed yield per growing area could be obtained by increasing seed yield per plant, and / or by increasing number of plants grown on the same growing area.

[0144] The term "seed" (also referred to as "grain" or "kernel") as used herein refers to a small embryonic plant enclosed in a covering called the seed coat (usually with some stored food). The seed is the product of the ripened ovule of gymnosperm and angiosperm plants which occurs after fertilization and some growth within the mother plant. The terms "seed", "plant seed", or "seed for growing the plant" may be used interchangeably herein.

[0145] The one or more plant growth feature, such as biomass of a plant and / or the yield of a plant, that has been administered the bacterial strain(s) of current application can be measured at a timepoint that is between about 7 days to about 350 days, about 7 days to about 300 days, about 7 days to about 250 days, about 7 days to about 200 days, about 7 days to about 150 days, or about 10 days to about 100 days, such as about 15 days to about 75 days, about 20 days to about 60 days, or about 25 days to about 50 days following administration of said bacterial strain(s) to the plant. In certain embodiments, the biomass and / or yield of a plant, such as a cereal plant, that has been administered the bacterial strain(s) can be measured at the time that the plant is harvested to collect its grain or produce, i.e., at the time that the mature plant, such as a cereal plant, e.g., a wheat or maize plant, is gathered from a field. The biomass of a plant and / or the yield of a plant that has been administered the bacterial strain(s) of current application versus a reference plant not so treated would be measured at the same time point. The term "increase" as used herein is intended to be synonymous with terms such as "upregulate", "enhance", "stimulate", or "boost". An increase in the plant biomass, height, number of tillers, root abundance, and / or yield can be in the whole plant or in any part thereof such as aboveground (harvestable) parts, vegetative biomass, roots, fruits, or seeds. Any extent or degree of such increase is contemplated herein, in particular any agronomically meaningful increase. Typically, the term may in appropriate contexts, such as in experimental or agricultural contexts, denote a statistically significant increase relative to a reference. The skilled person is able to select such a reference, as also discussed elsewhere in this specification. For example, such increase may fall outside of error margins for the reference (as expressed, for example, by standard deviation or standard error, or by a predetermined multiple thereof, e.g., ±lxSD or ±2xSD, or ±lxSE or ±2xSE). Accordingly, while the respective improvements or increases may be observable at the level of individual plants, they are more usefully evaluated by comparing relevant population characteristics, such as average or median values of the respective traits, obtained using sample sizes of treated versus untreated plants that allow for statistically meaningful conclusions, such as for example shown in the Examples section. The term "statistically significant" or "statistically significantly" different is well known by the person skilled in the art. Statistical significance plays a pivotal role in statistical hypothesis testing. It is used to determine whether the null hypothesis should be rejected or retained. It states that the results are obtained because of chance and are not supporting a real change or difference between two data sets. The null hypothesis is the default assumption that what one is trying to prove did not happen. In contrast the alternative hypotheses states that the obtained results support the theory being investigated. For the null hypothesis to be rejected (and thus the alternative hypothesis to be accepted), an observed result has to be statistically significant, i.e. the observed p-value is less than the pre-specified significance level a. The p stands for probability and measures how likely it is that the null hypothesis is incorrectly rejected and thus that any observed difference between data sets is purely due to chance. In most cases the significance level a is set at 0.05.

[0146] In certain embodiments, the biomass, height, number of tillers, root abundance, and / or yield of a plant may each independently be increased by at least about 1% relative to (i.e., compared with) (i.e., the biomass of a plant may be at least about 1.01-fold) the biomass, height, number of tillers, root abundance, and / or yield of an untreated plant, such as preferably by at least about 2% (i.e., 1.02-fold), by at least about 3% (i.e., 1.03-fold), by at least about 5% (i.e., 1.05-fold), by at least about 10% (i.e., 1.10-fold), by at least about 15% (i.e., 1.15-fold), by at least about 20% (i.e., 1.20- fold), or more, such as by at least about 25% (i.e., 1.25-fold), by at least about 30% (i.e., 1.30-fold), by at least about 35% (i.e., 1.35-fold), by at least about 40% (i.e., 1.40-fold), by at least about 45% (i.e., 1.45-fold), by at least about 50% (i.e., 1.50-fold), or more. For example, the biomass, height, number of tillers, root abundance, and / or yield of a plant may be increased by between 2% and 5%, between 3% and 5%, between 5% and 10%, between 10% and 15%, between 15% and 20%, between 20% and 30%, between 30% and 40%, or between 40% and 50% relative to the biomass, height, number of tillers, root abundance, and / or yield of an untreated plant. Such enhanced biomass, height, number of tillers, root abundance, and / or yield may advantageously reduce or even abolish the need to treat the plants with agrochemicals such as fertilizers in the field and thereby advantageously leads to more sustainable agriculture. As said above, these percentages or fold increases may conveniently reflect the relationships between averages for the respective traits in the treated vs. untreated populations, as determined by evaluating representative population samples. In other or further embodiments, the biomass, height, number of tillers, root abundance, and / or yield of a plant may each independently be statistically significantly increased compared to that of a control plant.

[0147] In certain embodiments, the seed or grain yield of the plant may be increased, such as statistically significantly increased, or increased by the aforementioned percentages or fold change.

[0148] As set forth elsewhere in the specification, the bacterial strain(s) can thus be administered to the plant, a part of the plant, a seed for growing the plant, or locus of the plant in an amount effective to produce an improved plant growth feature, such as an increased biomass, height, number of tillers, root abundance, and / or yield in the plant compared to an untreated plant. Therefore, a method is provided of administering a bacterial strain or a functional homologue thereof to a plant, the method comprising administering the bacterial strain of current application or the functional homologue thereof to the plant, a part thereof, a seed for growing the plant or a location comprising the plant or seed, wherein the bacterial strain comprises a 16S polynucleotide having at least 99.80% sequence identity to the 16S polynucleotide of the Streptomyces strain as deposited under the Budapest Treaty at the PCM on November 10, 2023 under Accession No. B / 00499, and wherein the functional homologue of the bacterial strain has a 16S polynucleotide identical to that of said bacterial strain, has at least 96% genomic sequence identity with B / 00499. In a specific embodiment, said functional homologue is still capable of improving a plant growth feature when administered to a plant, a part thereof, a seed for growing the plant or a location comprising the plant or seed compared to a control plant to which the functional homologue was not administered. In certain embodiments, said bacterial strain comprises a 16S polynucleotide having at least 99.85%, or at least 99.90% sequence identity to SEQ ID NO: 1. In particular embodiments, said bacterial strain comprises a 16S polynucleotide having a 100.00% sequence identity to SEQ ID NO: 1 or a 100.00% sequence identity to a 16S polynucleotide of the bacterial strain as deposited under Accession No. B / 00499. In a most particular embodiment, said bacterial strain is the Streptomyces strain as deposited under the Budapest Treaty at the PCM on November 10, 2023 under Accession No. B / 00499. In certain embodiments, said functional homologue is a Streptomyces strain: a) comprising a 16S polynucleotide having a 100.00% sequence identity to that of B / 00499; and b) having at least 96.00%, at least 96.50%, at least 97.00%, at least 97.50%, at least 98.00, at least 98.25%, at least 98.50%, at least 98.75%, at least 99.00%, at least 99.25%, at least 99.50% or at least 99.75% genomic sequence identity with B / 00499.

[0149] The phrase "administering" generally refers to man- and / or machine-driven or effected disposing, applying, delivering, or providing of a recited object, such as the bacterial strain(s) of current application, to a recipient entity, such as the plant, a part thereof, a seed for growing the plant, or a location comprising the plant or seed. The bacterial strain(s) as taught herein may be administered by any known method wherein all or part of the plant is treated, such as by root, seed, or foliar inoculation. For example, the administration can be to the aerial portions of a plant, such as the leaves and stem, to the roots of the plant, to the seed of the plant prior to planting the seed in soil, or to the soil or plant growth medium surrounding the plant or plant seed. Application methods such as spraying, coating, covering, contacting, and / or immersion can be adopted. In certain embodiments, application may be to a surface, such as to the surface of growth medium (such as soil), plant, plant part, seeds, harvested crop, harvested seed crop, stored crops or crop parts. In certain embodiments, the administration may be to the plant, part thereof, or locus of the plant, present on the field. The terms "field" or "agricultural field" may be used interchangeably herein and refers to an area of land used for agricultural purposes such as cultivating crops, such as cultivating wheat plants or maize plants.

[0150] In certain embodiments, the bacterial strain(s) may be applied to the part of the plant, when forming part of the plant. For instance, they may be applied to the part of the plant, such as to the leaf, when the part of the plant, such as the leaf, is present on or attached to (e.g., is growing on) the plant. In certain embodiments, the bacterial strain(s) may be applied to any one or more of the seeds, shoots, stems, leaves, roots (including tubers), flowers, tissues, or organs of a plant. In certain embodiments, the bacterial strain(s) may be applied to (e.g., sprayed on) the whole of the aboveground part of the plant. Accordingly, in certain embodiments, the bacterial strain(s) may be applied to (e.g., sprayed on) any one or more of the shoots, stems, leaves, or flowers of the plant. Preferably, the bacterial strain(s) may be applied to (e.g., sprayed on) any one or more of the shoots, leaves, or flowers of the plant. In certain embodiments, the bacterial strain(s) may be applied to (e.g., sprayed on) the shoots of the plant.

[0151] In certain embodiments, the bacterial strain(s) may be administered to the locus of the plant or the location comprising the plant or seed, such as by inoculating the growth medium. Hence, in certain embodiments, the method comprises inoculating soil or a plant growth medium with the bacteria and growing the plant in said soil or medium.

[0152] The terms "growth medium" or "plant growth medium" as used herein refer to a substrate or medium for culturing plants. In certain embodiments, the plant may be grown in soil or in a growth medium, including soil-less culture. Growing media provide rooting environment for plants and are used in professional horticulture for fruity vegetables, pot plants, young plant production, tree nursery stock, cut flowers, bedding plants and soft fruits. Commonly known as "potting soil" or "substrate", growing media are also used in the hobby market. The range of growing media constituents used includes peat, coir pith, wood fibers, bark, composted materials, i.e. green waste, and bark. Mineral constituents like perlite, pumice, clay and vermiculite are also used. Growing media are often formulated from a blend of such raw materials, usually enriched with fertilizers, lime and sometimes biological additives in order to achieve the correct balance of physical, chemical and biological properties for the plants to be grown. Having the right growing media mix is as important for an optimal plant growth as water and fertilisers. In embodiments, the growth medium may be soil, green waste compost, peat (black and white), coco-coir, coco-fibres and cocochips, wood fibres, miscanthus, (composted) bark, perlite, clay and other biobased materials, a soilmimicking substrate such as mineral lava or basalt substrate, textile, or a soil-less substrate, such a stone wool. In certain embodiments, the grown medium may be sand, gravel, polysaccharide, mulch, peat moss, straw, logs, clay, or a combination thereof. In embodiments, the plant growth medium may also include a hydroculture system or an in vitro culture system. Hence, in certain embodiments, the plant growth medium is a hydroponic medium or a hydroculture medium. The skilled person understands that different types of growth media may be used for growing different types of plants. Inoculating a plant growth medium can be performed, by way of example using a liquid, or a solid product, such as a powder, a granule, a pellet and as a blend together with the fertilizer.

[0153] The term "soil-less culture" commonly denotes the cultivation of plants in systems without soil "in situ". The methods of growing plants without soil fall into two general categories. Liquid culture (true hydroponics), where the nutrient solution is recirculated after re-aeration and adjustment of the acidity and nutrient levels, like the nutrient film technique (NFT); and aggregate culture, where the nutrient solution is supplied to plants via an irrigation system through the growing medium, and excess fertigation solution is allowed to drain away or the fertigation solution is recirculated. Overview of the different soil-less culture systems is given inter alia by Olympics 1999 (Overview of soilless culture: advantages, constraints, and perspectives, Cahiers Options Mediterraneennes, n. 31, p. 307-324). Hydroculture, also encompassing hydroponics, is the growing of plants in a soil-less medium or an aquatic based environment, while in vitro culture system refers to the growing of plants or explants on or in a recipient with synthetic medium, in sterile conditions, in a controlled environment and in reduced space. In controlled environment agriculture, the recent development of state-of-the-art vertical farms allows maximizing plant growth in a resource use efficient way (water, CO2, fertilizer, energy). Plant factories with artificial lighting can tap into new markets inaccessible to open-field production and conventional greenhouses by locally producing leafy greens, herbs, medicinal plants, and transplants year-round for local consumption. Plant factories with artificial lighting utilize soilless culture methods. Soilless culture typically requires a plant growing medium that provides a proper physicochemical and biological environment for rooting and plant growth during the seedling stage. Explants refer to parts of a plant, from all the aerial part to isolated cells, as parts of leaves, of roots, seeds, bulbs, tubers, buds. The inoculation of the plant growth medium with the bacterial strain(s) may be performed before, during and / or after sowing or before, during and / or after the start of the plant growth cycle in case of hydroculture or in vitro culture. The inoculation can be performed once or multiple times during the plant growth cycle.

[0154] In certain embodiments, sprayable liquids may be applied by spraying the plant, part thereof, or locus of the plant by conventional spraying equipment as known in the art, such as airplanes, backpack sprayers, tractor mounted boom sprayers etc.

[0155] In certain embodiments, application of the bacterial strain(s) to the plant, part thereof, or locus of growth of the plant may be carried out directly or by action on their surroundings or habitat using customary treatment methods, for example by dipping, drenching, spraying, coating, atomizing, irrigating, evaporating, dusting, fogging, broadcasting, foaming, painting, spreading-on, watering (drenching) or drip irrigating. In embodiments, the method may comprise spraying, sprinkling, showering, spritzing, spreading in droplets, spattering; dispersing, diffusing, or douching the plant, part thereof, or locus of growth of the plant with the bacterial strain(s).

[0156] In certain embodiments, the bacteria of the one or more bacterial strain as taught herein may be applied to a locus where plants are or are to be grown, such as upon soil, such as upon a field or within a greenhouse, in an amount of from about 1 x 109CFU / hectare to about 1 x 1014CFU / ha, such as preferably about 1 x 106CFU / seed or about 4 x 1012CFU / hectare.

[0157] In certain embodiments, the application may be one-time (single) administration, repeated administration (i.e., more than one time administration) at the same or varying time intervals, or continuous administration. The bacterial strain(s) can be administered at any point in the life cycle of the plant (e.g., before or after germination). For example, administration can be to a plant's seed prior to planting the seed in soil and prior to germination. Alternatively, administration can be to the plant (e.g. a seedling), the seed of the plant, or the soil surrounding the plant after germination has occurred. Once treated with the bacterial strain(s), seeds can be planted in soil and cultivated using conventional methods for generating plant growth.

[0158] In certain embodiments, the bacterial strain(s) may be applied at a temperature (e.g., air temperature) in the range from -1°C to 30°C. In embodiments, the application may be at a temperature in the range from 0°C to 30°C, from 1°C to 30°C, from 5°C to 25°C, or from 10°C to 20°C.

[0159] In certain embodiments, the bacterial strain(s) may be applied to the part of the plant, when not forming part of the plant. For instance, they may be applied to the part of the plant, such as to a seed for growing the plant, when the part of the plant, such as the seed, is not present on or is detached from (e.g., is not growing on) the plant. For instance, they may be applied to seeds after they have been harvested from (e.g. mechanically or manually separated from) the plant. In certain embodiments, the method may comprise administering the bacterial strain(s) to a seed of the plant, e.g., prior to planting the seed or with the seed at planting. Hence, in certain embodiments, the method comprises administering the bacterial strain(s) to a seed of the plant. In certain embodiments, the bacterial strain(s) are administered to the seed of the plant prior to planting the seed, or with the seed at planting, or after planting the seed and before germination of the seed.

[0160] In certain embodiments, the purified bacterial strains are capable of colonizing plants. Successful colonization can be confirmed by detecting the presence of the strain within the plant. For example, after applying the strain to the plant parts, high titers of the strain can be detected in the roots and shoots of the plants that germinate from said plant parts such as seeds. Detecting the presence of the strain inside the plant can be accomplished by measuring the viability of the strain after surface sterilization of the plant element or the plant: strain colonization results in an internal localization of the strain, rendering it resistant to conditions of surface sterilization. The presence and quantity of strain can also be established using other means known in the art, for example, immunofluorescence microscopy using microbe-specific antibodies, or fluorescence in situ hybridization. Alternatively, specific nucleic acid probes recognizing conserved sequences from a strain can be employed to amplify a region, for example by quantitative PCR, and correlated to CFUs by means of a standard curve.

[0161] Hence, in certain embodiments, microorganisms such as bacteria are said to colonize a plant, plant part, root or seed, when they can exist in relationship with a plant or plant part during at least part of either the plant's or the microorganism's life cycle. In certain embodiments, microorganisms such as bacteria are said to colonize a plant when they can be stably detected within the plant or plant part over a period time, such as one or more days, weeks, months or years. The compositions and methods described herein may comprise one or a plurality of bacterial strains as taught herein and optionally one or more further plant-beneficial microorganism in amounts effective to colonize a plant.

[0162] In embodiments, the strains described herein may be capable of moving from one tissue type to another. For example, the detection and isolation of strains within the mature tissues of plants after treating the exterior of a plant part demonstrates their ability to move from the plant part into the vegetative tissues of a maturing plant. Therefore, in some embodiments, the population of bacterial strains is capable of moving from the plant element exterior into the vegetative tissues of a plant. In some embodiments, the strain that is disposed onto the plant element of a plant is capable, upon germination of the plant part into a vegetative state, of localizing to a different tissue of the plant. For example, strains can be capable of localizing to any one of the tissues in the plant, including: the root, adventitious root, seminal root, root hair, shoot, leaf, flower, ear, spike, spikelet, bud, tassel, meristem, pollen, pistil, ovaries, stamen, fruit, stolon, rhizome, nodule, tuber, trichome, guard cells, hydathode, petal, sepal, glume, rachis, vascular cambium, phloem, and xylem. In an embodiment, the strain is capable of localizing to the root and / or the root hair of the plant. In another embodiment, the strain is capable of localizing to the photosynthetic tissues, for example, leaves and shoots of the plant. In other cases, the strain is localized to the vascular tissues of the plant, for example, in the xylem and phloem. In still another embodiment, the strain is capable of localizing to the reproductive tissues (flower, pollen, pistil, ovaries, stamen, fruit, spike, spikelet) of the plant. In another embodiment, the strain is capable of localizing to the root, shoots, leaves and reproductive tissues of the plant. In still another embodiment, the strain colonizes a fruit or plant element tissue of the plant. In still another embodiment, the strain is able to colonize the plant such that it is present in the surface of the plant (i.e. its presence is detectably present on the plant exterior). In still other embodiments, the strain is capable of localizing to substantially all, or all, tissues of the plant. In some cases, strains are capable of replicating within the host plant and colonizing the plant.

[0163] In further embodiments, following administration of the bacterial strain(s), the plants are cultivated under conditions to promote plant growth and development. In other words, the present methods may further comprise cultivating the plant under conditions to promote plant growth and development.

[0164] In certain embodiments, the method comprises administering the bacterial strain(s) to a seed of the plant, a whole plant, or a seedling, and optionally cultivating the seed, whole plant, or seedling under conditions to promote plant growth and development. In certain embodiments, the method comprises administering the bacterial strain(s) to a seed of the plant, and optionally cultivating the seed under conditions to promote plant growth and development. Hence, in such latter embodiments, the plant is grown from a seed, in particular a seed planted in said soil or plant growth medium.

[0165] Cultivating the seed under conditions promoting plant growth and development, may but need not include growth to maturity and / or regeneration.

[0166] In certain embodiments, the method may comprise further propagating the plant treated with the bacterial strain(s). Accordingly, the invention provides a method for increasing biomass, number of tillers, height, root abundance, and / or yield of a plant grown from a seed compared to a plant grown from an untreated or control seed, the method comprising administering the bacterial strain(s) to the seed for growing the plant. The invention also provides the use of the bacterial strain(s) for increasing biomass, number of tillers, height, root abundance, and / or yield of a plant grown from a seed compared to a plant grown from a control seed. In preferred embodiments, the use of the bacterial strain(s) for increasing biomass and / or yield of a plant grown from a seed compared to a plant grown from a control seed is provided.

[0167] Also provided herein is a method of treating a seed of a plant comprising inoculating the seed with bacteria of one or more bacterial strain(s) as taught herein, such that the bacteria colonise a plant germinated from the inoculated seed and / or the soil or plant growth medium surrounding the growing plant, whereby a plant growth feature of the plant, such as the biomass, number of tillers, height, root abundance, and / or yield of the plant is improved compared to a plant germinated from a control seed. In certain embodiments, the seed is coated with the bacteria, incubated with the bacteria, or planted near the bacteria. In certain embodiments, the seed is further inoculated with one or more additional plant-beneficial microorganism as taught herein.

[0168] In certain embodiments, the bacteria of one or more bacterial strain as taught herein may be contacted with seeds in an amount of between about 2 x 107CFU / kg seeds to about 2 x 1012CFU / kg seed, such as preferrable 2 x IO10CFU / kg seeds.

[0169] In certain embodiments, the bacteria of one or more bacterial strain as taught herein may be coated on or present on or inoculated into seeds at a quantity of, on average, at least 10 CFU per seed, preferably at least 100 CFU per seed, more preferably at least 500 CFU per seed, and even more preferably at least 1000 CFU per seed, such as more preferably at least 1 x 104CFU per seed, or 1 x 105CFU per seed or 1 x 106CFU per seed, such as between 1 x 105and 1 x 107CFU per seed, preferably about 1 x 106CFU per seed. Certain embodiments thus provide a plant seed comprising at least 10 CFU preferably at least 100 CFU, more preferably at least 500 CFU, and even more preferably at least 1000 CFU, such as more preferably at least 1 x 104CFU, or 1 x 105CFU, or 1 x 106CFU, such as between 1 x 105and 1 x 107CFU, preferably about 1 x 106CFU, of the bacteria, such as the bacterial genera, species or strains, as taught herein (in case of two or more different bacterial genera, species, or strains, the CFU may refer to these collectively, or individually and independently). For example, the seed may be coated with the bacterial cells or the composition as taught herein.

[0170] In certain embodiments, the bacteria of one or more bacterial strain as taught herein can be cultured on a culture medium or can be adapted to culture on the culture medium. Said culture medium is sterile prior to being inoculated with the bacterial strain and comprises all nutrients for growth and maintenance of the strain on the culture medium. In addition, the culture medium can be in a solid, semi-solid or liquid form.

[0171] In certain embodiments, the bacteria of one or more bacterial strain as taught herein may thus be administered as a whole cell broth, comprising the bacteria as well as the medium in which the bacteria have been grown.

[0172] A further aspect provides a plant or part thereof treated with the bacterial strain(s). Also provided is a plant or part thereof heterologously disposed with the bacteria as taught herein. In certain embodiments, the plant part may be a seed, such as a seed coated with the bacteria or the composition. The plant or part thereof or a plant grown from said plant part can display increased biomass as compared to a control plant or part thereof.

[0173] Hence, also disclosed is a plant seed, preferably a crop plant seed (e.g., the seed of a wheat plant or maize plant), treated with, such as coated with, the bacterial strain(s), e.g., such that all or part of the seed has a coating or film comprising the bacteria. The plant grown from the treated seed can display increased biomass as compared to a plant grown from an untreated or control seed.

[0174] Further disclosed is a method comprising growing a plant from the seed as defined above and harvesting the plant or part of the plant, such as harvesting the seeds or grains of the plant.

[0175] Further provided is a plant grown from a plant or part thereof (e.g., seed) treated with the bacterial strain(s).

[0176] In an embodiment, bacteria of the one or more strain as taught herein may, collectively or preferably each of the strains individually and independently, be present in an amount of at least about 102CFU per treated plant or part thereof. In an embodiment, bacteria of the one or more strain as taught herein may, collectively or preferably each of the strains individually and independently, be present in an amount of at least about 102CFU per plant grown from the treated plant or part thereof such as from a treated seed.

[0177] Preferably, bacteria of the one or more strain as taught herein may, collectively or preferably each of the strains individually and independently, be present on the plant or part thereof in an amount effective to be detectable within a target tissue of the mature plant selected from a fruit, a seed, a leaf, or a root, or portion thereof. For example, in an amount of at least about 100 CFU, between 100 and 200 CFU, at least about 200 CFU, between 200 and 300 CFU, at least about 300 CFU, between 300 and 400 CFU, at least about 500 CFU, between 500 and 1,000 CFU, at least about 1,000 CFU, between 1,000 and 3,000 CFU, at least about 3,000 CFU, between 3,000 and 10,000 CFU, at least about 10,000 CFU, between 10,000 and 30,000 CFU, at least about 30,000 CFU, between 30,000 and 100,000 CFU, at least about 105CFU, between 105and 106CFU, at least about 106CFU or more in the mature plant.

[0178] In certain embodiments, the plant or part thereof, such as a seed, treated with (e.g. coated with) the bacteria as taught herein may be shelf-stable. The bacterial strain may be shelf-stable, where at least 0.01%, of the CFUs are viable after storage in desiccated form (i.e., moisture content of 30% or less) for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or greater than 10 weeks at 4°C or at room temperature. Optionally, a shelf-stable composition comprising the bacteria may be in a dry composition, a powder composition, or a lyophilized composition. In an embodiment, the composition may be formulated to provide stability for the strains. In an embodiment, the plant or part thereof, such as a seed, treated with (e.g. coated with) the bacteria may be substantially stable at temperatures between about -20°C and about 50°C for at least about 1, 2, 3, 4, 5, or 6 days, or 1, 2, 3 or 4 weeks, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 months, or one or more years. In another embodiment, the plant or part thereof, such as a seed, treated with (e.g. coated with) the bacteria may be substantially stable at temperatures between about 4°C and about 37°C for at least about 5, 10, 15, 20, 25, 30 or greater than 30 days. Preferably the plant or part thereof, such as a seed, treated with (e.g. coated with) the bacteria is substantially stable at temperatures between about 4°C and about 37°C for at least one year or greater than one year.

[0179] In certain embodiments, the plant or part thereof, such as a seed, treated with (e.g. coated with) the bacteria are confined within a suitable container, such as an object selected from the group consisting of: bottle, jar, ampule, package, vessel, bag, box, bin, envelope, carton, container, silo, shipping container, truck bed, and case.

[0180] In certain embodiments, the bacteria as taught herein are heterologous to the plant or plant part to be treated or administered with the same. A bacterium is considered heterologous to the plant, plant part, seed for growing the plant, or locus of the plant if the plant, plant part, seed for growing the plant, or locus of the plant that is untreated (e.g., a seed that is not treated with a bacterial strain described herein) does not contain detectable levels of the bacterium. A bacterium is considered "heterologously disposed" or "heterologous disposed" on the exterior surface of or within a plant or plant tissue when the bacterium is applied or disposed on the plant in a number that is not found on that plant before application of the bacterium. For example, a purified bacterial strain disposed on an exterior surface or within the seed can be an endophytic bacterium that may be associated with the mature plant, but is not found on the surface of or within the seed. As such, a bacterium is deemed heterologously disposed when applied on the plant that either does not naturally have the bacterium on its surface or within the particular tissue to which the bacterium is disposed, or does not naturally have the bacterium on its surface or within the particular tissue in the number that is being applied.

[0181] In certain embodiments, the strain is heterologous disposed, for example, on the surface of a reproductive element of a plant, in an amount effective to be detectable in the mature plant. In a particular embodiment, the strain is heterologous disposed in an amount effective to be detectable in an amount of at least about 100 CFU, between 100 and 200 CFU, at least about 200 CFU, between 200 and 300 CFU, at least about 300 CFU, between 300 and 400 CFU, at least about 500 CFU, between 500 and 1,000 CFU, at least about 1,000 CFU, between 1,000 and 3,000 CFU, at least about 3,000 CFU, between 3,000 and 10,000 CFU, at least about 10,000 CFU, between 10,000 and 30,000 CFU, at least about 30,000 CFU, between 30,000 and 100,000 CFU, at least about 100,000 CFU or more in the mature plant.

[0182] In a preferred embodiment, the bacteria are heterologously disposed to a plant, part thereof, seed for growing the plant, or locus of the plant in an amount effective to improve the plant growth feature, such as increase the biomass, number of tillers, height, root abundance, and / or yield of the treated plant relative to an untreated plant. In a preferred embodiment, the amount of the heterologous disposed strain to the plant, part thereof, seed for growing the plant, or locus of the plant is effective to maintain a critical population mass in the plant. In a further embodiment, the amount of the heterologous disposed strain to a seed for growing a plant is effective to maintain a critical population mass in the mature plant germinated from the seed. Hence, in certain embodiments, any of the bacterial strains, bacterial populations, or microbial active ingredients as contemplated herein may be heterologous disposed to the plant, plant part, or seed.

[0183] The above aspects and embodiments are further supported by the following non-limiting examples.

[0184] EXAMPLES

[0185] Example 1: Storage, cultivation, and formulation of fungi according to certain embodiments of the invention

[0186] The bacterial strain deposited under the Budapest Treaty at the Polish Collection of Microorganisms (PCM) on November 10, 2023 under Accession No. B / 00499 (with the following identification reference given to the deposited material by the depositor: MED-B-M2A1) (proposed taxonomic designation Streptomyces niveus) (henceforth referred to in the Examples as "the M2A1 strain", "the bacterial strain", or "the strain") was stored at -75°C in nutrient broth (Yeast extract 0.3% w / v, peptone 0.5% w / v, 0.5% w / v sodium chloride, in distilled water, pH 6.8 ± 0.2) amended with 25% v / v glycerol and was cultured on nutrient agar (composition as nutrient broth with 1.5% w / v agar) for at least three days at 28°C. Cell suspensions were prepared by harvesting cells which have been incubated from single colonies in nutrient broth between two and five days in a shaker at 28°C degrees. Harvesting was done through centrifugation at 5000 g for 5 minutes. Alternatively, the whole cell broth, comprising the bacteria as well as the medium in which the bacteria can be used for inoculation. Bacterial biomass was resuspended and resuspended in 15 ml of 1% carboxymethycelluose (w / v, dissolved in phosphate buffer) and added to 8.2 gram of wheat seeds for greenhouse (GH) testing (see Example 2).

[0187] Example 2: Increased dry biomass in wheat treated by a method according to embodiments of the invention

[0188] Per treatment, 5 x 24 wheat seeds were treated with a formulation containing the M2A1 bacterial strain. Five planter boxes were filled with potting soil mix and saturated with water. As a control, 10 x 24 wheat seeds were treated with a formulation without bacterial strain to compare (mock treatment). Seeds were sown in three rows of 8 seeds per planter box. Nutrients were added to the planter boxes at two and three weeks after sowing. After 6 weeks of growth, shoots were cut off, dried at 60°C for 1 week and dry biomass (in mg) was determined per planter box.

[0189] For all evaluated formulations, each containing the bacterial strain according to an embodiment of the invention, an increase in dry biomass was observed in reference to a formulation without bacterial strain. Figure 1 visualizes the estimates of different parameters with 95% confidence intervals for treated seeds and mock treated seeds. The dashed line in the graphs represents the mock treatment. Figure 1A represents the graph illustrating the increased dry biomass per planter box (+14.4%) at 6 weeks after sowing of wheat plants obtained from seeds treated with a formulation comprising the M2A1 bacterial strain with Accession No. B / 00499 as deposited under the Budapest Treaty at the PCM (proposed taxonomic designation Streptomyces niveus) compared to the dry biomass per planter box at 6 weeks after sowing of wheat plants obtained from untreated seeds (mock).

[0190] In Figure IB the graph on the left side illustrates the increased dry biomass per planter box (+9.4%) at 6 weeks after sowing of wheat plants obtained from seeds treated with a formulation comprising the M2A1 bacterial strain with Accession No. B / 00499 as deposited under the Budapest Treaty at the PCM (proposed taxonomic designation Streptomyces niveus) compared to the dry biomass per planter box at 6 weeks after sowing of wheat plants obtained from untreated seeds (mock).

[0191] Example 3: Increased grain yield in wheat plants grown in the field from wheat seeds treated by a method according to an embodiment of the invention

[0192] Per treatment, 1.5 kg winter wheat seeds were coated with a Water dispersible Granule (WG) formulation containing spores of the M2A1 bacterial strain, with Accession no. B-00499 (minimal 1E+08 to 1E+09 CFU / g) and a sticker solution (containing 1% methylcellulose). Per kg of seeds, 1 g of the WG formulated product was applied and 16 ml of the sticker solution.

[0193] Seeds were sown in 4 replicate plots (15 m2plot size) per field location using standard agricultural practices. Sowing density was 400 seeds per m2. Sowing was done around mid of October and harvest around half of July. Fertilization was calculated based on soil analysis. 50 kg of phosphorus (P2O5) and 50 kg of potassium (K2O) fertilizers were applied at sowing time. Nitrogen fertilizer was applied at two moments: 35 kg ha1at tillering stage and 55 kg ha1at plant heading. Harvest was done with the Delta plot combine (Wintersteiger AG, Ried, Austria) and seed yield (grain yield) (kg / ha) was calculated based on the grain yield harvested at each individual plot and considering a seed moisture of 15%. Grain yield was compared with a mock treatment. Mock treated seeds were seeds coated with the same formulation and colorant but without the M2A1 bacterial strain. The results of the wheat plants grown from wheat seeds coated with a formulation containing the M2A1 strain are visualized in Figure 2.

[0194] Figure 2A visualizes the value in grain yield of winter wheat measured at a location in Poland in the season 2020-2021 with an 80 % N fertilizer regime. The graph on the left visualizes the values of winter wheat grain yield with 95% confidence intervals for treated seeds and untreated seeds, whereas the graph on the right visualizes the values of the difference between treated and untreated seeds in grain yield with its 95% confidence interval. Wheat treated with a formulation comprising spores of the M2A1 bacterial strain and colorant showed an increased yield of 16.4 % compared to the mock treated seeds.

[0195] Figure 2B visualizes the value in grain yield of winter wheat measured at a location in Germany in the season 2021-2022 with a 70 % N fertilizer regime. The graph on the left visualizes the values of winter wheat grain yield with 95% confidence intervals for treated seeds and untreated seeds, whereas the graph on the right visualizes the values of the difference between treated and untreated seeds in grain yield with its 95% confidence interval. Wheat treated with a formulation comprising spores of the M2A1 bacterial strain and colorant showed an increased yield of 2 % compared to the mock treated seeds.

[0196] Figure 2C visualizes the value in grain yield of winter wheat measured at a location in Belgium in the season 2022-2023 with a 100 % N fertilizer regime. The graph on the left visualizes the values of winter wheat grain yield with 95% confidence intervals for treated seeds and untreated seeds, whereas the graph on the right visualizes the values of the difference between treated and untreated seeds in grain yield with its 95% confidence interval. Wheat treated with a WG formulation comprising spores of the M2A1 bacterial strain and colorant showed an increased yield of 6.8 % compared to the mock treated seeds.

[0197] Example 4. Plant growth promoting effect is not an inherent property of Streptomyces species.

[0198] To investigate whether the observed plant growth promoting effect of M2A1 is a general property of Streptomyces strains, five additional phylogenetically related strains were tested. More particularly, proprietary strains M1F3, M14F2, M26D9 and M15F3 comprising a 16S rDNA sequence as depicted in respectively SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8, and the publicly available Streptomyces strain DSM21069 (internal code O2C5) comprising a 16S rDNA sequence as depicted in SEQ ID NO: 5. In a first experiment, strains M2A1, M1F3 and DSM21069 were tested next to a mock control according to the methods described in Example 2. In a second experiment, strains M14F2, M26D9 and M15F3 were tested next to a mock control. Strains M1F3 and M15F3 both comprise a 16S rDNA sequence having 99.67% identity to SEQ ID NO: 1. When wheat plants were treated with M1F3 or M15F3 no significant plant growth promoting effect could be observed compared to the mock control (Figure 3A-B). Strains M14F2 and M26D9 both comprise a 16S rDNA sequence having 99.46% identity to SEQ ID NO: 1 and are neither able to induce a significant plant growth promoting effect (Figure 3B). The 16S rDNA sequence from strain DSM21069 showed the closest identity to that of M2A1, i.e. 99.73%, but DSM21069 is not able to promote plant growth as was seen for M2A1 (Figure 3A). Hence, among the six phylogenetically related Streptomyces species tested herein, only M2A1 was able to induce a plant growth promoting effect, more precisely in this experiment, a statistically significant increase (p=0.035) in dry biomass of 9% compared to the mock control (Figure 3A).

[0199] In Figure 3A the graph illustrates the increased dry biomass (mg) per planter box (+9%) at 6 weeks after sowing of wheat plants obtained from seeds treated with a formulation comprising the M2A1 bacterial strain with Accession No. B / 00499 as deposited under the Budapest Treaty at the PCM (proposed taxonomic designation Streptomyces niveus) compared to the dry biomass (mg) per planter box at 6 weeks after sowing of wheat plants obtained from untreated seeds (mock) or treated with a formulation comprising the Streptomyces strains M1F3 or O2C5 (DSM21069).

[0200] In Figure 3B the graph illustrates the measured dry biomass (mg) per planter box at 6 weeks after sowing of wheat plants obtained from seeds treated with a formulation comprising the Streptomyces strains M14F2, M26D9 or M15F3 compared to the dry biomass (mg) per planter box at 6 weeks after sowing of wheat plants obtained from untreated seeds (mock). DEPOSIT OF BIOLOGICAL MATERIAL

[0201] The purified bacterial strain as taught herein is deposited under the terms of the Budapest Treaty, as follows: strain MED-B-M2A1 deposited under Accession No. B / 00499

[0202] Table 1 summarizes the requisite indications relating to the deposited microorganism referred to throughout this specification. The abbreviation "PCM" refers to the Polish Collection of Microorganisms (PCM), address: Institute of Immunology and Experimental Therapy, Polish Academy of Sciences, Ul. Weigla 12, 53-114 Wroclaw, Poland.

[0203] Table 1

[0204] SEQUENCE LISTING

[0205] Throughout the description and examples, reference is made to the following sequences listed in Table 2:

[0206] SEQ ID NO: 1: Nucleotide sequence of 16S polynucleotide from strain with Accession No. B / 00499 (M2A1 strain).

[0207] SEQ ID NO: 2: Nucleotide sequence of forward primer 27F

[0208] SEQ ID NO: 3: Nucleotide sequence of reverse primer 1492R

[0209] SEQ ID NO: 4: Nucleotide sequence of 16S polynucleotide from the M1F3 strain.

[0210] SEQ ID NO: 5: Nucleotide sequence of 16S polynucleotide from the DSM21069 (internal code O2C5) strain. SEQ ID NO: 6: Nucleotide sequence of 16S polynucleotide from the M 14F2 strain.

[0211] SEQ ID NO: 7: Nucleotide sequence of 16S polynucleotide from the M26D9 strain.

[0212] SEQ ID NO: 8: Nucleotide sequence of 16S polynucleotide from the M 15F3 strain. Table 2

Claims

CLAIMS1. A method for improving a plant growth feature of a plant compared to a control plant, the method comprising administering bacteria of a bacterial strain which comprises a 16S polynucleotide having at least 99.80% sequence identity to SEQ ID NO: 1 to the plant, a part thereof, a seed for growing the plant or a locus of the plant.

2. The method according to claim 1, wherein the bacterial strain comprises a 16S polynucleotide having 100.00% sequence identity to SEQ ID NO: 1 or having 100.00% sequence identity to a 16S polynucleotide of the Streptomyces strain as deposited under the Budapest Treaty at the Polish Collection of Microorganisms (PCM) on November 10, 2023 under Accession No. B / 00499.

3. The method according to claim 1 or 2, wherein the bacterial strain is the Streptomyces strain as deposited under Budapest Treaty at the PCM on November 10, 2023 under Accession No. B / 00499 or a functional homologue thereof.

4. The method according to claim 3, wherein the functional homologue thereof is a Streptomyces strain comprising a 16S polynucleotide having a 100% sequence identity to that of B / 00499, having at least 96% genomic sequence identity with B / 00499 and is still capable of improving a plant growth feature when administered to a plant, a part thereof, a seed for growing the plant or a locus of the plant compared to a control plant to which the functional homologue was not administered.

5. The method according to any one of claims 1 to 4, wherein the plant growth feature is selected from the list consisting of dry biomass, wet biomass, belowground biomass, aboveground biomass, number of tillers, plant height and grain yield.

6. The method according to any one of claims 1 to 5, wherein any one or more of the following features apply:(A) the bacteria are administered in conjunction with one or more additional plant-beneficial microorganism;(B) the bacteria are administered in an agricultural active composition, such as wherein:- the composition further comprises one or more agriculturally acceptable auxiliaries, such as a solvent, a carrier, a surfactant, a sticker, an antifreeze agent, a thickener, a buffering agent, an antifoaming agent, an antioxidant, a preservative, an aroma, a colorant, or a combination thereof; and / or- the composition is a liquid composition comprising the bacteria at a concentration of at least about 102CFU / ml, or- the composition is a non-liquid composition comprising the bacteria at an amount of at least about 102CFU / g;(C) the bacteria, optionally in an agricultural composition, are administered to a seed of a plant, a whole plant, or a seedling, such as to a seed prior to planting the seed, or with the seed at planting, or after planting the seed and before germination of the seed; and the method optionally comprises a further step of cultivating the seed, whole plant, or seedling under conditions to promote plant growth and development;(D) the bacteria, optionally in an agricultural composition, are administered to a soil or a plant growth medium, such as a hydroponic or hydroculture medium; and the method optionally comprises a further step of growing a plant, a seedling or a seed in said medium;(E) the plant growth feature comprises dry biomass and / or grain yield, preferably wherein the plant growth feature is statistically significantly increased or increased by at least about 3%, preferably by at least about 5%, such as by at least about 10% or by at least about 15%, more preferably by at least about 20% compared to a control situation.

7. A method of treating a seed of a plant comprising inoculating the seed with bacteria of the bacterial strain as defined in any one of claims 1 to 5, and optionally in conjunction with one or more additional plant-beneficial microorganisms, such that the bacteria colonize a plant germinated from the inoculated seed, whereby the biomass and / or yield of the plant is increased compared to a plant germinated from a control seed not inoculated with bacteria of the bacterial strain as defined in any one of claims 1 to 5, optionally wherein the seed is coated with the bacteria, incubated with the bacteria, or planted near the bacteria.

8. A bacterial strain for improving plant growth and / or yield, wherein said bacterial strain comprises a 16S polynucleotide having at least 99.80% sequence identity to SEQ ID NO: 1.

9. The bacterial strain of claim 8, wherein the bacterial strain comprises a 16S polynucleotide having 100.00% sequence identity to SEQ ID NO: 1 or having 100.00% sequence identity to a 16S polynucleotide of the Streptomyces strain as deposited under the Budapest Treaty at the Polish Collection of Microorganisms (PCM) on November 10, 2023 under Accession No. B / 00499.10.A bacterial strain as deposited under the Budapest Treaty at the PCM on November 10, 2023 under Accession No. B / 00499 or a functional homologue thereof, wherein said functional homologue is a Streptomyces strain comprising a 16S polynucleotide having a 100.00% sequence identity to that of B / 00499, having at least 96.00% genomic sequence identity with B / 00499 andstill capable of improving plant growth and / or yield when administered to a plant, a part thereof, a seed for growing the plant or a locus of the plant compared to a control plant to which the functional homologue was not administered.

11. A composition comprising the bacterial strain according to any of claims 8-10, wherein the bacterial strain is lyophilized, freeze-dried or in a form selected from dried cells, dehydrated cells, devitalized cells, inactivated cells, frozen cells or cells in artificial suspension or in a dry powder.

12. An agricultural active composition comprising the bacterial strain of any one of claims 8 to 10, optionally, wherein:- the composition further comprises one or more agriculturally acceptable auxiliaries, such as a solvent, a carrier, a surfactant, a sticker, an antifreeze agent, a thickener, a buffering agent, an antifoaming agent, an antioxidant, a preservative, an aroma, a colorant, or a combination thereof;- the composition is a liquid composition, such as an aqueous composition, such as a sprayable liquid or a concentrate, preferably wherein the composition comprises the bacteria at a concentration of at least about 102CFU / ml; or- the composition is a non-liquid composition, such as a powder, preferably wherein the composition comprises the bacteria at an amount of at least about 102CFU / g.

13. Use of the bacterial strain according to any of claims 8-10 or of the composition according to claim 11 or of the agricultural active composition according to claim 12 for improving at least one plant growth feature selected from the list consisting of aboveground biomass, belowground biomass, number of tillers, plant height and seed yield compared to a reference situation.

14. A synthetic composition comprising a plant element and the bacterial strain of any one of claims 8 to 10.

15. The synthetic composition according to claim 14, wherein the plant element is a plant seed and wherein said plant seed comprising at least 10 CFU of the bacteria as defined in any one of claims 8 to 10 on its surface.

16. The method according to any one of claims 1 to 7, the use according to claim 13 or the synthetic composition according to any of claims 14 or 15, wherein the plant is a monocotyledon, preferably wherein the plant is a cereal, more preferably wherein the plant is selected fromthe group consisting of wheat, maize, barley, rice, millet, rye, triticale, sorghum, emmer, spelt, einkorn, teff, milo, and oats, even more preferably wherein the plant is wheat or maize.

Images