Inhibitory compounds

Compounds that inhibit MutSβ activity offer a therapeutic approach to address the somatic expansion of repeat sequences, potentially slowing or stopping the progression of repeat expansion diseases.

WO2025133610A1PCT designated stage expired Publication Date: 2025-06-26LOQUS23 THERAPEUTICS LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/GB2024/053165
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-21
Filing Date
2024-12-19
Publication Date
2025-06-26

AI Technical Summary

Technical Problem

There is an ongoing need for compounds that can inhibit MutSβ activity, which is implicated in the somatic expansion of expanded simple nucleotide repeats and associated with various repeat expansion diseases.

Method used

The development of specific compounds or their pharmaceutically acceptable salts, hydrates, or solvates that selectively inhibit MutSβ activity, either alone or in combination with other therapeutic agents, to treat diseases related to MutSβ activity.

Benefits of technology

Inhibiting MutSβ activity with these compounds has the potential to slow or stop the somatic expansion of repeat sequences, thereby mitigating the progression of repeat expansion diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure GB2024053165_26062025_PF_FP_ABST
    Figure GB2024053165_26062025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates at least in part to certain compounds of formulae (I) and (X) that function as inhibitors of Mutsp. The present invention also relates to processes for the preparation of these compounds, to pharmaceutical compositions comprising them, and to their use in the treatment of diseases or conditions in which Mutsp activity is implicated, such as, for example, repeat expansion diseases or disorders, as well as to increase the efficiency of genome editing.
Need to check novelty before this filing date? Find Prior Art

Description

INHIBITORY COMPOUNDS FIELD OF THE INVENTION

[0001] The present invention relates to certain compounds that function as inhibitors of MutSβ. The present invention also relates to processes for the preparation of these compounds, to pharmaceutical compositions comprising them, and to their use in the treatment of diseases or conditions in which MutSβ activity is implicated, such as, for example, diseases related to somatic expansion of expanded simple nucleotide repeats. BACKGROUND OF THE INVENTION

[0002] Mismatch repair (MMR) is a highly conserved DNA repair pathway that promotes genome stability in all organisms which recognises and repairs erroneous insertion, deletion or mis-incorporation of nucleotides that can arise during DNA replication, repair or recombination. MMR is thus one of the key pathways that participates in the cellular response to certain types of DNA damage. In addition to DNA damage response roles, MMR is employed during meiosis in eukaryotes and immunoglobulin maturation / diversification in mammals.

[0003] MMR predominantly corrects DNA base mismatches and insertion / deletion (indel) loops that can occasionally arise during normal DNA replication processes. Base pair mismatches occur when incorrect nucleotides (for example, in response to oxidative damage) are inserted into the newly synthesised DNA strand and escape the proofreading function of DNA polymerases. Indel loops commonly arise in the context of microsatellites which are highly polymorphic, short tandem repeat DNA sequences distributed throughout genomes. Typically, at microsatellites, especially in the context of longer repeats, the template and primer strands are prone to slippage (dissociation and reannealing) during replication; this can lead to the formation of loop structures and ultimately result in a discordant number of repeat units between the template and newly synthesised strand.

[0004] Mammalian MMR can be separated into four steps: (1) mismatch recognition mediated by MutS heterodimers; (2) recruitment of MutL heterodimers which connect the mismatch recognition signal to where the DNA strand scission begins in a strand-specific fashion; (3) excision of the errant, error-containing DNA strand and (4) re-synthesis of the excision gap using the remaining DNA strand as a template.

[0005] In humans, mismatch recognition by MutSα (comprised of MSH2 and MSH6 gene products) or MutSβ (comprised of MSH2 and MSH3 gene products) heterodimers initiate the MMR pathway. These obligate heterodimers differ in their substrate preferences but there are considerable overlaps between the substrates recognised and processed. MutSα recognizes base-base mismatches and some insertion-deletion mismatches with a preference for shorterindels (1-3 nucleotides), whereas MutSβ predominantly processes larger indels of 3+ nucleotides. MutSα also contributes to the recognition of certain types of DNA damage such as oxidised nucleotides and can participate in the checkpoint response to such lesions. Similarly, MutSβ may cooperate with the nucleotide excision repair machinery in the repair of interstrand cross-links. Furthermore, both heterodimers have been implicated in the production of certain genetic variants. MutSα participates in the somatic hypermutation phase of immunoglobulin gene affinity maturation, and MutSβ is required for the triplet repeat expansions that are responsible for a number of neurodegenerative diseases. Additionally, when MMR pathway signalling is abolished (termed deficient MMR or dMMR), this typically results in increased instability at these repetitive regions at multiple genome loci, a process termed microsatellite instability (MSI).

[0006] Binding of MutSα or MutSβ heterodimers to the mismatch results in the ATP- dependent recruitment of a MutL heterodimer (either MutLα comprising MLH1 and PMS2 gene products, MutLβ comprising MLH1 and PMS1 or MutLγ comprising MLH1 or MLH3 gene products) to form a ternary complex. This ternary complex forms interactions with additional proteins including proliferating cell nuclear antigen (PCNA) and exonuclease 1 (EXO1) which enable successful completion of MMR sequelae.

[0007] Short tandem repeats (STR) represent one of the most abundant class of variations in human genomes, are polymorphic by nature and become highly unstable in a length dependent fashion. The expansion of repeat length above a threshold is a well-established feature of more than 50 hereditary human disorders mainly affecting the nervous system, with many likely remaining to be identified due to improvements in detection by sequencing-based methods. Coding repeat expansion diseases include but are not limited to brachydactyly and cleidocranial dysplasia (BCCD); blepharophimosis, ptosis and epicanthus inversus (BPES); cleidocranial dysplasia (CCD); congenital central hypoventilation syndrome (CCHS); dentatorubropallidoluysian atrophy (DRPLA); early infantile epileptic encephalopathy type 1 (EIEE1); Huntington’s disease (HD); Huntington disease-like 2 (HDL2); hand-foot-genital syndrome (HFGS); holoprosencephaly type 5 (HPE5); mental retardation with isolated growth hormone deficiency (MRGH); oculopharyngeal muscular dystrophy (OPMD); spinobulbar muscular atrophy (SBMA); spinocerebellar ataxias type 1, 2, 3, 6, 7, 17, (SCA1, SCA2, SCA3, SCA6, SCA7, SCA17); synpolydactyly (SPD); X-linked mental retardation and abnormal genitalia (XLAG); X-linked mental retardation with or without growth hormone deficiency (XLMR, XLMRGHD). Non-coding repeat expansion diseases include but are not limited to benign adult familial myoclonic epilepsy (BAFME); Baratela-Scott syndrome (BSS); cerebellar ataxia, neuropathy and vestibular areflexia syndrome (CANVAS); myotonic dystrophy type 1 (DM1); myotonic dystrophy type 2 (DM2); progressive myoclonus epilepsy type 1 or Unverricht-Lundborg diseae (EPM1); familial adult myoclonic epilepsy (FAME); Fuch’sendothelial corneal dystrophy type 3 (FECD3); fragile XE syndrome (FRAXE); Friedreich ataxia (FRDA); frontotemporal dementia / amyotrophic lateral sclerosis (FTD / ALS); fragile X- associated premature ovarian infertility (FXPOI); fragile X syndrome (FXS); fragile X- associated tremor ataxia syndrome (FXTAS); global development delay, progressive ataxia and elevated glutamine (GDPAG); neuronal intranuclear inclusion disease (NIID); oculopharyngodistal myopathy type 1 (OPDM1); oculopharyngodistal myopathy type 2 (OPDM2); oculopharyngeal myopathy with leukoencephalopathy type 1 (OPML1), spinocerebellar ataxias types 8, 10, 12, 27B, 31, 36, 37 (SCA8, SCA10, SCA12, SCA27B, SCA31, SCA36, SCA37); X-linked dystonia parkinsonism (XDP).

[0008] Repeat expansion diseases can be dominant (e.g. Huntington’s disease) or recessive (e.g. Friedreich’s ataxia) and have the common feature of inheritance of an expansion of a normally polymorphic repeat in the disease-associated gene above a defined threshold. The number of repeats required to pass this threshold varies for each disease, although exonic repeats generally have lower thresholds than intronic repeats. Coding or exonic repeat diseases generally lead to a toxic gain of function of the resulting protein gene product, whereas non-coding intronic repeats generally lead to reduced expression of the protein gene product. In both cases this leads to dysfunction and death in vulnerable cell types, eventually resulting in clinical signs and symptoms. In addition to inheritance of an expanded allele there is now strong evidence that these repeat expansions are unstable and expand further during the lifespan of the individual. This expansion happens at the individual cell level (i.e. somatic expansion) and the extent of expansion in a given cell type / tissue typically correlates tightly with how vulnerable it is to degeneration during the course of the disease. The faster the expansion in mutation carriers, the greater the impact on disease measures such as age-of- onset, progression and severity.

[0009] The term “somatic instability” describes the fact that a repetitive sequence (e.g. a trinucleotide repeat tract such as CAG for huntingtin) is unstable at an individual cell level (i.e. somatic). The instability can lead to expansion or contraction of the repeat sequence. It is now widely accepted that the somatic expansion of a CAG repeat sequence in HTT in brain cells is the first step in the molecular pathogenesis of Huntington’s disease, followed by a second process that leads to cell dysfunction once a CAG repeat threshold has been achieved. Somatic CAG repeat expansion is a repeat length-, time- and cell-type dependent. The pathogenic repeat threshold in brain is longer than 40 CAG, as measured in blood, and is currently unknown. Therefore, it is the rate of somatic CAG repeat expansion that drives the age of onset and rate of progression of the disease. Slowing or stopping somatic instability could significantly mitigate disease progression, and provide a much sought after disease- modifying therapy.

[0010] For at least a subset of these repeat expansion diseases, MMR proteins are modifiersof repeat expansions and clinical profile. Strong genetic and mechanistic data indicate that MutSβ (gene products of MSH2 and MSH3) drives somatic expansion of these repeats. Reduction in MutSβ expression or function, for example by point mutations to ablate its ATPase function, block somatic expansion. Thus, methods of arresting, or reversing, somatic repeat expansions is hypothesised to be an effective therapeutic approach to slow or stop repeat disease progression.

[0011] While MMR is essential for maintaining the integrity of the genome, it can also act as a barrier to efficient genome editing.

[0012] More recently, multiple labs have shown that reduction or inhibition of MMR significantly enhanced the efficiency of prime editing (PE) while abating the frequency of unintended indels. PE was established in the Liu lab and utilises three components: (i) Cas9 nickase to nick the non-target strand; (ii) prime editing single guide RNA (pegRNA) to bind the target strand and (iii) a reverse transcriptase to reverse transcribe from the 3’ end of the non- target strand according to the information provided by the pegRNA. PE is a precise and versatile genome editing technique that enables all types of base conversions and small fragment deletion or insertion in the genome. One challenge with PE is it has a much lower efficiency than other types of Cas9-derived editing approaches because endogenous MMR processes often revert the sequence back to the original sequence. Accordingly, increasing the efficiency of PE, together with reducing indels, through the use of MutSα and / or MutSβ inhibitor treatment ex vivo and / or in vivo may enhance the potential for clinical translation and therapeutic use of prime editors.

[0013] Other genome editing techniques aiming to introduce specific changes in the DNA sequence by providing a template that serves as a repair template could benefit from inhibiting MMR. As MMR can recognize and repair mismatches between the template and the target DNA, leading to the removal or correction of the desired edits, MutSα and / or MutSβ inhibitors could prevent the rejection of the edit and increase editing efficiency. The use of a template is a crucial aspect of certain gene editing techniques, such as homology-directed repair (HDR). HDR relies on the introduction of an exogenous DNA template that serves as a repair template to guide the desired genetic modifications.

[0014] Some HDR-based gene editing methods that commonly utilize a template include CRISPR-Cas9, ZFN (Zinc Finger Nucleases) and TALENs (Transcription Activator-Like Effector Nucleases). In these approaches, nucleases introduce double-strand breaks (DSBs) at specific target sites in the genome. These DSBs can then be repaired using an exogenous DNA template as a guide for HDR, enabling precise insertion, deletion, or replacement of genetic material. Nuclease-free editing methods utilising ssODN (single-stranded oligonucledotides) as a template for desired edit were also shown to benefit from lowering activity of MMR factors and has been used to create mouse strains.

[0015] Therefore, there is an on-going need for compounds that function as inhibitors of MutSβ.

[0016] The present invention was devised with the foregoing in mind. SUMMARY OF THE INVENTION

[0017] According to a first aspect of the present invention, there is provided a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein.

[0018] According to a further aspect of the present invention, there is provided a pharmaceutical composition comprising a compound as defined herein, or a pharmaceutically acceptable salt, hydrate or solvate thereof, in admixture with a pharmaceutically acceptable diluent or carrier.

[0019] According to a further aspect of the present invention, there is provided a method of inhibiting MutSβ activity in vitro, ex vivo or in vivo, said method comprising contacting a cell with an effective amount of a compound or a pharmaceutically acceptable salt, hydrate or solvate thereof as defined herein. Suitably, the method comprises the selective inhibition of MutSβ activity in vitro, ex vivo or in vivo.

[0020] According to a further aspect of the present invention, there is provided a method of inhibiting somatic expansion of expanded simple nucleotide repeats in vitro, ex vivo or in vivo (e.g. in treating a repeat expansion disease or disorder), said method comprising contacting a cell with an effective amount of a compound or a pharmaceutically acceptable salt, hydrate or solvate thereof as defined herein. Suitably, the somatic expansion is associated with MutSβ activity.

[0021] According to a further aspect of the present invention, there is provided a method of treating a disease or disorder in which MutSβ activity is implicated (e.g. a repeat expansion disease or disorder) in a patient in need of such treatment, said method comprising administering to said patient a therapeutically effective amount of a compound or a pharmaceutically acceptable salt, hydrate or solvate thereof as defined herein, or a pharmaceutical composition as defined herein.

[0022] According to a further aspect of the present invention, there is provided a method of treating a repeat expansion disease or disorder in a patient in need of such treatment, said method comprising administering to said patient a therapeutically effective amount of a compound or a pharmaceutically acceptable salt, hydrate or solvate thereof as defined herein, or a pharmaceutical composition as defined herein.

[0023] According to a further aspect of the present invention, there is provided a method of treating a triplet repeat disease or disorder in a patient in need of such treatment, said method comprising administering to said patient a therapeutically effective amount of a compound or a pharmaceutically acceptable salt, hydrate or solvate thereof as defined herein, or apharmaceutical composition as defined herein.

[0024] According to a further aspect of the present invention, there is provided a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, or a pharmaceutical composition as defined herein, for use in therapy.

[0025] According to a further aspect of the present invention, there is provided a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein for use in the inhibition of MutSβ activity, e.g. in cellular systems. The inhibition may be the selective inhibition of MutSβ activity.

[0026] According to a further aspect of the present invention, there is provided a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein for use in inhibiting somatic expansion of expanded simple nucleotide repeats, e.g. in the treatment of a repeat expansion disease or disorder.

[0027] According to a further aspect of the present invention, there is provided a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein for use in the treatment of a disease or condition in which MutSβ activity is implicated (e.g. a repeat expansion disease or disorder).

[0028] According to a further aspect of the present invention, there is provided a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, or a pharmaceutical composition as defined herein for use in the treatment of a repeat expansion disease or disorder.

[0029] According to a further aspect of the present invention, there is provided a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, or a pharmaceutical composition as defined herein for use in the treatment of a triplet repeat disease or disorder.

[0030] According to a further aspect of the present invention, there is provided a use of a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein in the manufacture of a medicament for the inhibition of MutSβ activity, e.g. in cellular systems.

[0031] According to a further aspect of the present invention, there is provided a use of a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein in the manufacture of a medicament for inhibiting somatic expansion of expanded simple nucleotide repeats, e.g. in treating a repeat expansion disease or disorder.

[0032] According to a further aspect of the present invention, there is provided a use of a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein in the manufacture of a medicament for the treatment of a disease or condition in which MutSβ activity is implicated (e.g. a repeat expansion disease or disorder).

[0033] According to a further aspect of the present invention, there is provide the use of a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein in the manufacture of a medicament for the treatment of a repeat expansion disease ordisorder.

[0034] According to a further aspect of the present invention, there is provide the use of a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein in the manufacture of a medicament for the treatment of a triplet repeat disease or disorder.

[0035] Suitably, the repeat expansion disease or disorder may be selected from benign adult familial myoclonic epilepsy (BAFME); brachydactyly and cleidocranial dysplasia (BCCD); blepharophimosis, ptosis and epicanthus inversus (BPES); Baratela-Scott syndrome (BSS); cerebellar ataxia, neuropathy and vestibular areflexia syndrome (CANVAS); congenital central hypoventilation syndrome (CCHS); dentatorubropallidoluysian atrophy (DRPLA); early infantile epileptic encephalopathy type 1 (EIEE1); familial adult myoclonic epilepsy (FAME); Fuch’s endothelial corneal dystrophy type 3 (FECD3); fragile XE syndrome (FRAXE); Friedreich ataxia (FRDA) frontotemporal dementia / amyotrophic lateral sclerosis (FTD / ALS); fragile X-associated premature ovarian infertility (FXPOI); fragile X syndrome (FXS); fragile X- associated tremor ataxia syndrome (FXTAS); global development delay, progressive ataxia and elevated glutamine (GDPAG); Huntington’s disease (HD); Huntington disease-like 2 (HDL2); hand-foot-genital syndrome (HFGS); holoprosencephaly type 5 (HPE5); mental retardation with isolated growth hormone deficiency (MRGH); myotonic dystrophy type 1 (DM1); myotonic dystrophy type 2 (DM2); progressive myoclonus epilepsy type 1 or Unverricht-Lundborg diseae (EPM1); neuronal intranuclear inclusion disease (NIID); oculopharyngodistal myopathy type 1 (OPDM1); oculopharyngodistal myopathy type 2 (OPDM2); oculopharyngeal myopathy with leukoencephalopathy type 1 (OPML1); spinobulbar muscular atrophy (SBMA); spinocerebellar ataxias (e.g. type 1, 2, 3, 6, 7, 8, 10, 12, 17, 27B, 31, 36 or 37 (SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA10, SCA12, SCA17, SCA27B SCA31, SCA36, SCA37)); synpolydactyly (SPD); X-linked dystonia parkinsonism (XDP); X- linked mental retardation and abnormal genitalia (XLAG); or X-linked mental retardation with or without growth hormone deficiency (XLMR, XLMRGHD).

[0036] Suitably, the repeat expansion disease or disorder may be a triplet repeat disease or disorder. The triplet repeat disease or disorder may be selected from dentatorubropallidoluysian atrophy (DRPLA); Fuch’s endothelial corneal dystrophy type 3 (FECD3); fragile XE syndrome (FRAXE); Friedreich ataxia (FRDA); fragile X-associated premature ovarian infertility (FXPOI); fragile X syndrome (FXS); fragile X-associated tremor ataxia syndrome (FXTAS); Huntington’s disease (HD); Huntington disease-like 2 (HDL2); myotonic dystrophy type 1 (DM1); neuronal intranuclear inclusion disease (NIID; )spinobulbar muscular atrophy (SBMA); spinocerebellar ataxias type 1, 2, 3, 6, 7, 8, 17 or 27B (SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA17 or SCA27B); or X-linked dystonia parkinsonism (XDP). More suitably, the triplet repeat disease or disorder is Huntington’s disease (HD).

[0037] According to a further aspect of the present invention, there is provided a method ofincreasing the efficiency of a gene editing technique, the method comprising conducting the gene editing technique in the presence of a compound as defined herein, or a pharmaceutically acceptable salt, hydrate or solvate thereof.

[0038] According to a further aspect of the present invention, there is provided a method of prime editing, the method comprising contacting a cell with: (1) a Cas9 nickase to nick a non- target strand; (2) a prime editing single guide RNA (pegRNA) to bind the target strand; (3) a reverse transcriptase to reverse transcribe from the 3’ end of the non-target strand according to the information provided by the pegRNA; and (4) a compound as defined herein, or a pharmaceutically acceptable salt, hydrate or solvate thereof.

[0039] In the method of prime editing described herein, the step of “contacting a cell” suitably comprises contacting a target gene or DNA in a cell.

[0040] According to a further aspect of the present invention, there is provided the use of a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein for gene editing in vitro, ex vivo or in vivo.

[0041] According to a further aspect of the present invention, there is provided a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein for use in gene editing in vitro, ex vivo or in vivo.

[0042] Suitably, the gene editing technique referred to herein is any suitable gene editing technique in which host cell mis-match repair (MMR) factors are known to decrease the efficiency of the gene editing. Several available tools for gene editing use enzymes acting on DNA called nucleases and exploit intrinsic DNA repair pathways such as homology-directed repair (HDR), non-homologous end joining (NHEJ) which are both associated with double strand breaks (DSB)s. Specific examples of such DSB nucleases include ZFN (zinc finger nucleases), TALENs (Transcription activator like effector nucleases), CRISPR-Cas9 or CRISPR-Cas12 nucleases and Fanzor (an eukaryotic CRISPR-like RNA guided nucleases related to prokaryotic OMEGA system nucleases). Other forms of gene editing technology do not induce DSBs and use engineered or inactivated nucleases to either cut only a single strand of DNA. Specific examples of gene editing technologies that do not leverage DSBs include base editing (fusion of catalytically dead dCas9 enzymes to DNA deaminases which enable single nucleotide substitutions) and prime editing (fusion of a Cas9 nickase to a reverse transcriptase) and its related technology PASTE (programmable addition via site-specific targeting elements which leverages prime editing to insert AttB sites and then facilitate serine integrase proteins to insert larger sequences). Indeed, all editing methods using a single- stranded oligonucleotide (ssODN) as a template should benefit from MMR inhibition.

[0043] The gene editing technique may be a HDR-based gene editing method, e.g. CRISPR- Cas9, ZFN and TALENs.

[0044] According to a further aspect of the present invention, there is provided a process forpreparing a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein.

[0045] According to a further aspect of the present invention, there is provided a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, obtainable by, or obtained by, or directly obtained by a process of preparing a compound as defined herein.

[0046] According to a further aspect of the present invention, there are provided novel intermediates as defined herein which are suitable for use in any one of the synthetic methods set out herein.

[0047] Features, including optional, suitable, and preferred features in relation to one aspect of the invention may also be features, including optional, suitable and preferred features in relation to any other aspect of the invention. DETAILED DESCRIPTION OF THE INVENTION Definitions

[0048] Unless otherwise stated, the following terms used in the specification and claims have the following meanings set out below.

[0049] It is to be appreciated that references to “treating” or “treatment” include prophylaxis as well as the alleviation of established symptoms of a condition. “Treating” or “treatment” of a state, disorder or condition therefore includes: (1) preventing or delaying the appearance of clinical symptoms of the state, disorder or condition developing in a human that may be afflicted with or predisposed to the state, disorder or condition but does not yet experience or display clinical or subclinical symptoms of the state, disorder or condition, (2) inhibiting the state, disorder or condition, i.e., arresting, reducing or delaying the development of the disease or a relapse thereof (in case of maintenance treatment) or at least one clinical or subclinical symptom thereof, or (3) relieving or attenuating the disease, i.e., causing regression of the state, disorder or condition or at least one of its clinical or subclinical symptoms.

[0050] A “therapeutically effective amount” means the amount of a compound that, when administered to a mammal for treating a disease, is sufficient to effect such treatment for the disease. The "therapeutically effective amount" will vary depending on the compound, the disease and its severity and the age, weight, etc., of the mammal to be treated.

[0051] In this specification, “simple nucleotide repeats” (also known as microsatellites or short tandem repeat sequences) are known in the art and are short tandemly repeated DNA sequences comprising a repetitive unit of from 1–6 base pairs, where the motifs are repeated >5 times.

[0052] The term “prime editing” refers to programmable editing of a target DNA using a prime editor complexed with a pegRNA to incorporate an intended nucleotide edit into the targetDNA through target-primed DNA synthesis. A target polynucleotide, e.g., a target gene of prime editing may comprise a double stranded DNA molecule having two complementary strands: a first strand that may be referred to as a “target strand” or a “non-edit strand,” and a second strand that may be referred to as a “non-target strand,” or an “edit strand”.

[0053] In this specification the term “alkyl” includes both straight and branched chain alkyl groups. References to individual alkyl groups such as “propyl” are specific for the straight chain version only and references to individual branched chain alkyl groups such as “isopropyl” are specific for the branched chain version only. For Example, “(1-6C)alkyl” includes (1- 4C)alkyl, (1-3C)alkyl, methyl, ethyl, n-propyl, isopropyl, n-butyl, sec-butyl, and t-butyl, as well as pentyl and hexyl isomers. A similar convention applies to other radicals, for example “phenyl(1-6C)alkyl” includes phenyl(1-4C)alkyl, benzyl, 1-phenylethyl and 2-phenylethyl etc.

[0054] The term "(m-nC)" or "(m-nC) group" used alone or as a prefix, refers to any group having m to n carbon atoms.

[0055] An “alkylene,” “alkenylene,” or “alkynylene” group is an alkyl, alkenyl, or alkynyl group that is positioned between and serves to connect two other chemical groups. Thus, “(1- 6C)alkylene” means a linear saturated divalent hydrocarbon radical of one to six carbon atoms or a branched saturated divalent hydrocarbon radical of three to six carbon atoms, for example, methylene, ethylene, propylene, 2-methylpropylene, pentylene, and the like.

[0056] “(2-6C)alkenylene” means a linear divalent hydrocarbon radical of two to six carbon atoms or a branched divalent hydrocarbon radical of three to six carbon atoms, containing at least one double bond, for example, as in ethenylene, 2,4-pentadienylene, and the like.

[0057] “(2-6C)alkynylene” means a linear divalent hydrocarbon radical of two to six carbon atoms or a branched divalent hydrocarbon radical of three to six carbon atoms, containing at least one triple bond, for example, as in ethynylene, propynylene, and butynylene and the like.

[0058] “(3-8C)cycloalkyl” means a hydrocarbon ring containing from 3 to 8 carbon atoms, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl or bicyclo[2.2.1]heptyl.

[0059] “(3-8C)cycloalkenyl” means a hydrocarbon ring containing at least one double bond, for example, cyclobutenyl, cyclopentenyl, cyclohexenyl or cycloheptenyl, such as 3- cyclohexen-1-yl, or cyclooctenyl.

[0060] “(3-8C)cycloalkyl-(1-6C)alkyl” means a (3-8C)cycloalkyl group covalently attached to a (1-6C)alkylene group, both of which are defined herein.

[0061] The term “halo” or “halogeno” refers to fluoro, chloro, bromo and iodo.

[0062] The term “heterocyclyl”, “heterocyclic” or “heterocycle” means a non-aromatic saturated or partially saturated monocyclic, fused, bridged, or spiro bicyclic heterocyclic ringsystem(s). Monocyclic heterocyclic rings contain from about 3 to 12 (suitably from 3 to 7) ring atoms, with from 1 to 5 (suitably 1, 2 or 3) heteroatoms selected from nitrogen, oxygen or sulfur in the ring. Bicyclic heterocycles contain from 7 to 17 member atoms, suitably 7 to 12 member atoms, in the ring. Bicyclic heterocyclic(s) rings may be fused, spiro, or bridged ring systems. Examples of heterocyclic groups include cyclic ethers such as oxiranyl, oxetanyl, tetrahydrofuranyl, dioxanyl, and substituted cyclic ethers. Heterocycles containing nitrogen include, for example, azetidinyl, pyrrolidinyl, piperidinyl, piperazinyl, tetrahydrotriazinyl, tetrahydropyrazolyl, and the like. Typical sulfur containing heterocycles include tetrahydrothienyl, dihydro-1,3-dithiol, tetrahydro-2H-thiopyran, and hexahydrothiepine. Other heterocycles include dihydrooxathiolyl, tetrahydrooxazolyl, tetrahydro-oxadiazolyl, tetrahydrodioxazolyl, tetrahydrooxathiazolyl, hexahydrotriazinyl, tetrahydrooxazinyl, morpholinyl, thiomorpholinyl, tetrahydropyrimidinyl, dioxolinyl, octahydrobenzofuranyl, octahydrobenzimidazolyl, and octahydrobenzothiazolyl. For heterocycles containing sulfur, the oxidized sulfur heterocycles containing SO or SO2 groups are also included. Examples include the sulfoxide and sulfone forms of tetrahydrothienyl and thiomorpholinyl such as tetrahydrothiene 1,1-dioxide and thiomorpholinyl 1,1-dioxide. A suitable value for a heterocyclyl group which bears 1 or 2 oxo (=O) or thioxo (=S) substituents is, for example, 2- oxopyrrolidinyl, 2-thioxopyrrolidinyl, 2-oxoimidazolidinyl, 2-thioxoimidazolidinyl, 2- oxopiperidinyl, 2,5-dioxopyrrolidinyl, 2,5-dioxoimidazolidinyl or 2,6-dioxopiperidinyl. Particular heterocyclyl groups are saturated monocyclic 3 to 7 membered heterocyclyls containing 1, 2 or 3 heteroatoms selected from nitrogen, oxygen or sulfur, for example azetidinyl, tetrahydrofuranyl, tetrahydropyranyl, pyrrolidinyl, morpholinyl, tetrahydrothienyl, tetrahydrothienyl 1,1-dioxide, thiomorpholinyl, thiomorpholinyl 1,1-dioxide, piperidinyl, homopiperidinyl, piperazinyl or homopiperazinyl. As the skilled person would appreciate, any heterocycle may be linked to another group via any suitable atom, such as via a carbon or nitrogen atom. However, reference herein to piperidino or morpholino refers to a piperidin-1- yl or morpholin-4-yl ring that is linked via the ring nitrogen.

[0063] By “bridged ring systems” it is meant ring systems in which two rings share more than two atoms, see for example Advanced Organic Chemistry, by Jerry March, 4thEdition, Wiley Interscience, pages 131-133, 1992. Examples of bridged heterocyclyl ring systems include, aza-bicyclo[2.2.1]heptane, 2-oxa-5-azabicyclo[2.2.1]heptane, aza-bicyclo[2.2.2]octane, aza- bicyclo[3.2.1]octane and quinuclidine.

[0064] By “carbocycle” or a “carbocyclic ring”, we mean a saturated or partially saturated ring formed exclusively from carbon atoms. For example, the term “carbocyclic ring” encompasses cycloalkyl or cycloalkenyl ring systems.

[0065] By “spiro bicyclic ring systems” we mean that the two ring systems share one commonspiro carbon atom, i.e. the heterocyclic ring is linked to a further carbocyclic or heterocyclic ring through a single common spiro carbon atom. Examples of spiro ring systems include 6- azaspiro[3.4]octane, 2-oxa-6-azaspiro[3.4]octane, 2-azaspiro[3.3]heptanes, 2-oxa-6- azaspiro[3.3]heptanes, 7-oxa-2-azaspiro[3.5]nonane, 6-oxa-2-azaspiro[3.4]octane, 2-oxa-7- azaspiro[3.5]nonane and 2-oxa-6-azaspiro[3.5]nonane.

[0066] “Heterocyclyl(1-6C)alkyl” means a heterocyclyl group covalently attached to a (1- 6C)alkylene group, both of which are defined herein.

[0067] The term “heteroaryl” or “heteroaromatic” means an aromatic mono-, bi-, or polycyclic ring incorporating one or more (for example 1-4, particularly 1, 2 or 3) heteroatoms selected from nitrogen, oxygen or sulfur. The term heteroaryl includes both monovalent species and divalent species. Examples of heteroaryl groups are monocyclic and bicyclic groups containing from five to twelve ring members, and more usually from five to ten ring members. The heteroaryl group can be, for example, a 5- or 6-membered monocyclic ring or a 9- or 10- membered bicyclic ring, for example a bicyclic structure formed from fused five and six membered rings or two fused six membered rings. Each ring may contain up to about four heteroatoms typically selected from nitrogen, sulfur and oxygen. Typically, the heteroaryl ring will contain up to 3 heteroatoms, more usually up to 2, for example a single heteroatom. In one embodiment, the heteroaryl ring contains at least one ring nitrogen atom. The nitrogen atoms in the heteroaryl rings can be basic, as in the case of an imidazole or pyridine, or essentially non-basic as in the case of an indole or pyrrole nitrogen. In general, the number of basic nitrogen atoms present in the heteroaryl group, including any amino group substituents of the ring, will be less than five.

[0068] Examples of heteroaryl include furyl, pyrrolyl, thienyl, oxazolyl, isoxazolyl, imidazolyl, pyrazolyl, thiazolyl, isothiazolyl, oxadiazolyl, thiadiazolyl, triazolyl, tetrazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, 1,3,5-triazenyl, benzofuranyl, indolyl, isoindolyl, benzothienyl, benzoxazolyl, benzimidazolyl, benzothiazolyl, benzothiazolyl, indazolyl, purinyl, benzofurazanyl, quinolyl, isoquinolyl, quinazolinyl, quinoxalinyl, cinnolinyl, pteridinyl, naphthyridinyl, carbazolyl, phenazinyl, benzisoquinolinyl, pyridopyrazinyl, thieno[2,3b]-furanyl-, 2H-furo[3,2b]-pyranyl-, 5H-pyrido[2,3-d]-ooxazinyl-, 1H-pyrazolo[4,3-d]-oxazolyl, 4H-imidazo[4,5d]thiazolyl, pyrazino[2,3d]pyridazinyl, -imidazo[2,1b]thiazolyl, -imidazo[1,2b][1,2,4]-triazinyl. “Heteroaryl” also covers partially aromatic bi- or polycyclic ring systems wherein at least one ring is an aromatic ring and one or more of the other ring(s) is a nonaromatic, saturated or partially saturated ring, provided at least one ring contains one or more heteroatoms selected from nitrogen, oxygen or -sulfur-. Examples of partially aromatic heteroaryl groups include for example, tetrahydroisoquinolinyl, tetrahydroquinolinyl, 2-oxo-1,2,3,4-tetrahydroquinolinyl,dihydrobenzthienyl, dihydrobenzfuranyl, 2,3-dihydro-benzo[1,4]dioxinyl, benzo[1,3]dioxolyl, 2,2-dioxo-1,3-dihydro-2-benzothienyl, 4,5,6,7-tetrahydrobenzofuranyl, indolinyl, 1,2,3,4-tetrahydro-1,8-naphthyridinyl, 1,2,3,4-tetrahydropyrido[2,3-b]pyrazinyl, 3,4-dihydro-2H-pyrido[3,2-b][1,4]oxazinyl and 6,8-dihydro-5H-[1,2,4]triazolo[4,3-a]pyrazinyl.

[0069] Examples of five membered heteroaryl groups include but are not limited to pyrrolyl, furanyl, thienyl, imidazolyl, furazanyl, oxazolyl, oxadiazolyl, oxatriazolyl, isoxazolyl, thiazolyl, isothiazolyl, pyrazolyl, triazolyl and tetrazolyl groups.

[0070] Examples of six membered heteroaryl groups include but are not limited to pyridyl, pyrazinyl, pyridazinyl, pyrimidinyl and triazinyl.

[0071] A bicyclic heteroaryl group may be, for example, a group selected from: a benzene ring fused to a 5- or 6-membered ring containing 1, 2 or 3 ring heteroatoms; a pyridine ring fused to a 5- or 6-membered ring containing 1, 2 or 3 ring heteroatoms; a pyrimidine ring fused to a 5- or 6-membered ring containing 1 or 2 ring heteroatoms; a pyrrole ring fused to a 5- or 6-membered ring containing 1, 2 or 3 ring heteroatoms; a pyrazole ring fused to a 5- or 6-membered ring containing 1 or 2 ring heteroatoms; a pyrazine ring fused to a 5- or 6-membered ring containing 1 or 2 ring heteroatoms; an imidazole ring fused to a 5- or 6-membered ring containing 1 or 2 ring heteroatoms; an oxazole ring fused to a 5- or 6-membered ring containing 1 or 2 ring heteroatoms; an isoxazole ring fused to a 5- or 6-membered ring containing 1 or 2 ring heteroatoms; a thiazole ring fused to a 5- or 6-membered ring containing 1 or 2 ring heteroatoms; an isothiazole ring fused to a 5- or 6-membered ring containing 1 or 2 ring heteroatoms; a thiophene ring fused to a 5- or 6-membered ring containing 1, 2 or 3 ring heteroatoms; a furan ring fused to a 5- or 6-membered ring containing 1, 2 or 3 ring heteroatoms; a cyclohexyl ring fused to a 5- or 6-membered heteroaromatic ring containing 1, 2 or 3 ring heteroatoms; and a cyclopentyl ring fused to a 5- or 6-membered heteroaromatic ring containing 1, 2 or 3 ring heteroatoms.

[0072] Particular examples of bicyclic heteroaryl groups containing a six membered ring fused to a five membered ring include but are not limited to benzfuranyl, benzthiophenyl, benzimidazolyl, benzoxazolyl, benzisoxazolyl, benzthiazolyl, benzisothiazolyl, isobenzofuranyl, indolyl, isoindolyl, indolizinyl, indolinyl, isoindolinyl, purinyl (e.g., adeninyl, guaninyl), indazolyl, benzodioxolyl and pyrazolopyridinyl groups.

[0073] Particular examples of bicyclic heteroaryl groups containing two fused six membered rings include but are not limited to quinolinyl, isoquinolinyl, chromanyl, thiochromanyl, chromenyl, isochromenyl, chromanyl, isochromanyl, benzodioxanyl, quinolizinyl, benzoxazinyl, benzodiazinyl, pyridopyridinyl, quinoxalinyl, quinazolinyl, cinnolinyl, phthalazinyl, naphthyridinyl and pteridinyl groups.

[0074] “Heteroaryl(1-6C)alkyl” means a heteroaryl group covalently attached to a (1- 6C)alkylene group, both of which are defined herein. Examples of heteroaralkyl groups include pyridin-3-ylmethyl, 3-(benzofuran-2-yl)propyl, and the like.

[0075] The term “aryl” means a cyclic or polycyclic aromatic ring having from 5 to 12 carbon atoms. The term aryl includes both monovalent species and divalent species. Examples of aryl groups include, but are not limited to, phenyl, biphenyl, naphthyl and the like. In particular embodiment, an aryl is phenyl.

[0076] The term “aryl(1-6C)alkyl” means an aryl group covalently attached to a (1-6C)alkylene group, both of which are defined herein. Examples of aryl-(1-6C)alkyl groups include benzyl, phenylethyl, and the like.

[0077] This specification also makes use of several composite terms to describe groups comprising more than one functionality. Such terms will be understood by a person skilled in the art. For example heterocyclyl(m-nC)alkyl comprises (m-nC)alkyl substituted by heterocyclyl.

[0078] The term "optionally substituted" refers to either groups, structures, or molecules that are substituted and those that are not substituted. The term “wherein a / any CH, CH2, CH3 group or heteroatom (i.e. NH) within a R1group is optionally substituted” suitably means that (any) one of the hydrogen radicals of the R1group is substituted by a relevant stipulated group.

[0079] Where optional substituents are chosen from “one or more” groups it is to be understood that this definition includes all substituents being chosen from one of the specified groups or the substituents being chosen from two or more of the specified groups.

[0080] The phrase “compound of the invention” means those compounds which are disclosed herein, both generically and specifically. Compounds of the invention

[0081] In a first aspect, the present invention relates to compounds, or pharmaceutically acceptable salts, hydrates or solvates thereof, having the structural formula (I) shown below:wherein: R1and R2are each independently selected from hydrogen, (1-6C)alkyl, -[CH2]n-(3- 6C)cycloalkyl, -[CH2]n-aryl, -[CH2]n-heterocyclyl, or -[CH2]n-heteroaryl, wherein: integer n is 0, 1, 2, 3 or 4; and any alkyl, cycloalkyl, aryl, heteroaryl or heterocyclyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, amino, (1-3C)alkyl, (1-3C)alkoxy, (1-3C)haloalkyl, (1- 3C)haloalkoxy, (1-3C)alkylamino or di-[(1-3C)alkyl]amino; or R1and R2are linked such that, together with the nitrogen atom to which they are attached, they form a 4-7-membered heterocyclic ring which optionally comprises one or two additional heteroatoms selected from N, O or S; and wherein the heterocyclic ring is optionally substituted by one or more substituents independently selected from halo, cyano, (1-6C)alkyl, -[CH2]p-(3- 6C)cycloalkyl, -[CH2]p-heterocyclyl, -[CH2]p-aryl or -[CH2]p-heteroaryl; wherein: integer p is 0, 1, 2, 3, 4, 5 or 6; and any alkyl, cycloalkyl, aryl, heteroaryl or heterocyclyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, amino, (1- 3C)alkyl, (1-3C)alkoxy, (1-3C)haloalkyl, (1-3C)haloalkoxy, (1-3C)alkylamino or di-[(1-3C)alkyl]amino; Rn is selected from hydrogen, (1-3C)alkyl, -[CH2]q-(3-5C)cycloalkyl, wherein: q is 0, 1 or 2; and an alkyl is optionally substituted by hydroxy, (1-2C)alkoxy or NRn1Rn2, and a cycloalkyl group is optionally substituted by (1-2C)alkyl, hydroxy, (1-2C)alkoxyor NRn1Rn2; wherein Rn1and Rn2are each independently selected from hydrogen or (1-2C)alkyl R3is selected from hydrogen or a group: -LB-XB-QBwherein: LBis absent or (1-2C)alkylene; XBis absent or is selected from the group consisting of -O-, -C(O)-, -C(O)-O-, -O-C(O)-, -C(O)-N(R100c)-, -N(R100c)-C(O)-, -NR100c-, -N(R100c)-C(O)-O- or -O- C(O)-N(R100c)-, wherein R100cand R100dare each independently selected from hydrogen or (1-2C)alkyl; and QBis selected from the group consisting of hydrogen, (1-6C)alkyl, -[CH2]r-(3- 6C)cycloalkyl, -[CH2]r-[4-7-membered heterocyclyl], -[CH2]r-phenyl or -[CH2]r- [5- or 6-membered heteroaryl]; wherein: integer r is 0, 1 or 2; and any alkyl, cycloalkyl, aryl, heteroaryl or heterocyclyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, (1-3C)alkyl, (1-3C)alkoxy, (1- 3C)haloalkyl, (1-3C)haloalkoxy, -[CH2]s-NRqa1Rqa2where Rqa1 andRqa2are each independently selected from hydrogen or (1-2C)alkyl; and integer s is 0, 1 or 2; integer a is 0, 1, 2 or 3; R4and R5are each independently selected from hydrogen or methyl, or R4and R5are linked to form a -CH2-CH2- group; or, if a is 1, R3and R4are linked such that, together with the carbon atoms to which they are attached, they form a fused 5-6 membered carbocycle or 5-6 membered heterocyclyl, wherein the fused 5-6membered carbocycle or 5-6 membered heterocyclyl is optionally substituted by one or more substituents independently selected from halo, (1-2C)alkyl, (1-2C)haloalkyl, (1-2C)alkoxy or (1-2C)haloalkoxy; and R5is selected from hydrogen or methyl; X is absent or is selected from -O-, -C(O)-, -S(O)0-2-, -C(O)-N(R100e)-, -N(R100e)-C(O)- or -NR100e-, wherein R100eis selected from hydrogen or methyl; Q is selected from phenyl, naphthyl or heteroaryl, wherein Q is optionally substituted by one or more substituents RQ, wherein each RQis independently selected from: halo,hydroxy, cyano, (1-6C)alkyl, (1-6C)alkoxy, (1-6C)haloalkyl, (1-6C)haloalkoxy, -[CH2]t- NRq1Rq2where Rq1and Rq2are each independently selected from hydrogen or (1- 2C)alkyl and integer t is 0, 1 or 2.

[0082] In another aspect, the present invention relates to compounds, or pharmaceutically acceptable salts, hydrates or solvates thereof, having the structural formula (I) or (X) shown below:wherein: R1and R2are each independently selected from hydrogen, (1-6C)alkyl, -[CH2]n-(3- 6C)cycloalkyl, -[CH2]n-aryl, -[CH2]n-heterocyclyl, or -[CH2]n-heteroaryl, wherein: integer n is 0, 1, 2, 3 or 4; andany alkyl, cycloalkyl, aryl, heteroaryl or heterocyclyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, amino, (1-3C)alkyl, (1-3C)alkoxy, (1-3C)haloalkyl, (1- 3C)haloalkoxy, (1-3C)alkylamino or di-[(1-3C)alkyl]amino; or R1and R2are linked such that, together with the nitrogen atom to which they are attached, they form a 4-7-membered heterocyclic ring which optionally comprises one or two additional heteroatoms selected from N, O or S; and wherein the heterocyclic ring is optionally substituted by one or more substituents independently selected from halo, cyano, (1-6C)alkyl, -[CH2]p-(3- 6C)cycloalkyl, -[CH2]p-heterocyclyl, -[CH2]p-aryl or -[CH2]p-heteroaryl; wherein: integer p is 0, 1, 2, 3, 4, 5 or 6; and any alkyl, cycloalkyl, aryl, heteroaryl or heterocyclyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, amino, (1- 3C)alkyl, (1-3C)alkoxy, (1-3C)haloalkyl, (1-3C)haloalkoxy, (1-3C)alkylamino or di-[(1-3C)alkyl]amino; Rn is selected from hydrogen, (1-3C)alkyl, -[CH2]q-(3-5C)cycloalkyl, wherein: q is 0, 1 or 2; and an alkyl is optionally substituted by hydroxy, (1-2C)alkoxy or NRn1Rn2, and a cycloalkyl group is optionally substituted by (1-2C)alkyl, hydroxy, (1-2C)alkoxy or NRn1Rn2; wherein Rn1 and Rn2 are each independently selected from hydrogen or (1-2C)alkyl R3is selected from hydrogen, halo or a group: -LB-XB-QBwherein: LBis absent or (1-2C)alkylene; XBis absent or is selected from the group consisting of -O-, -C(O)-, -C(O)-O-, -O-C(O)-, -C(O)-N(R100c)-, -N(R100c)-C(O)-, -NR100c-, -N(R100c)-C(O)-O- or -O- C(O)-N(R100c)-, wherein R100cand R100dare each independently selected from hydrogen or (1-2C)alkyl; and QBis selected from the group consisting of hydrogen, (1-6C)alkyl, -[CH2]r-(3- 6C)cycloalkyl, -[CH2]r-[4-7-membered heterocyclyl], -[CH2]r-phenyl or -[CH2]r- [5- or 6-membered heteroaryl]; wherein: integer r is 0, 1 or 2; andany alkyl, cycloalkyl, aryl, heteroaryl or heterocyclyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, (1-3C)alkyl, (1-3C)alkoxy, (1- 3C)haloalkyl, (1-3C)haloalkoxy, -[CH2]s-NRqa1Rqa2where Rqa1and Rqa2are each independently selected from hydrogen or (1-2C)alkyl; and integer s is 0, 1 or 2; integer a is 0, 1, 2 or 3; R4and R5are each independently selected from hydrogen, hydroxy or methyl, or R4and R5are linked to form a -CH2-CH2- group; or, if a is 1, R3and R4are linked such that, together with the carbon atoms to which they are attached, they form a fused 5-6 membered carbocycle or 5-6 membered heterocyclyl, wherein the fused 5-6membered carbocycle or 5-6 membered heterocyclyl is optionally substituted by one or more substituents independently selected from halo, (1-2C)alkyl, (1-2C)haloalkyl, (1-2C)alkoxy or (1-2C)haloalkoxy; and R5is selected from hydrogen or methyl; Ring B is a fused partially saturated 5-6 membered carbocyclic ring which may be optionally substituted by one or more substituents independently selected from halo, (1-2C)alkyl, (1-2C)haloalkyl, (1-2C)alkoxy or (1-2C)haloalkoxy; X is absent or is selected from -O-, -C(O)-, -S(O)0-2-, -C(O)-N(R100e)-, -N(R100e)-C(O)- or -NR100e-, wherein R100eis selected from hydrogen or methyl; Q is selected from phenyl, naphthyl or heteroaryl, wherein Q is optionally substituted by one or more substituents RQ, wherein each RQ is independently selected from: halo, hydroxy, cyano, (1-6C)alkyl, (1-6C)alkoxy, (1-6C)haloalkyl, (1-6C)haloalkoxy, -[CH2]t- NRq1Rq2 where Rq1 and Rq2 are each independently selected from hydrogen or (1- 2C)alkyl and integer t is 0, 1 or 2.

[0083] In a preferred embodiment, the compounds have the structural formula (I), defined herein.

[0084] Particular compounds of the invention include, for example, compounds of the formula I or (X), or pharmaceutically acceptable salts, hydrates and / or solvates thereof, wherein, unless otherwise stated, each of R1, R2, Rn, R3, R4, R5, a, X, Q, Ring B and any associated sub groups, have any of the meanings defined hereinbefore or in any of paragraphs (1) to (37) hereinafter:- (1) R1is selected from hydrogen, (1-6C)alkyl, -[CH2]n-(3-6C)cycloalkyl, -[CH2]n-phenyl, - [CH2]n-[4-7 membered heterocyclyl], or -[CH2]n-[5-6 membered heteroaryl];wherein: integer n is 0, 1, 2 or 3; and any alkyl, cycloalkyl, aryl, heteroaryl or heterocyclyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, amino, (1-2C)alkyl, (1-2C)alkoxy, (1-2C)haloalkyl, (1- 2C)haloalkoxy, (1-2C)alkylamino or di-[(1-2C)alkyl]amino; and R2is hydrogen or (1-4C)alkyl; or R1and R2are linked such that, together with the nitrogen atom to which they are attached, they form a 4-7-membered heterocyclic ring which optionally comprises one or two additional heteroatoms selected from N, O or S, and wherein the heterocyclic ring is optionally substituted by one or more substituents independently selected from halo, cyano, (1-6C)alkyl, -[CH2]p-(3-6C)cycloalkyl, -[CH2]p-[4-7 membered heterocyclyl], -[CH2]p-phenyl or -[CH2]p-[5-6 membered heteroaryl]; wherein integer p is 0, 1, 2, 3 or 4; and any alkyl, cycloalkyl, aryl, heteroaryl or heterocyclyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, amino, (1-2C)alkyl, (1-2C)alkoxy, (1-2C)haloalkyl, (1- 2C)haloalkoxy, (1-2C)alkylamino or di-[(1-2C)alkyl]amino. (2) R1is selected from hydrogen, (1-6C)alkyl, -[CH2]n-(3-6C)cycloalkyl, -[CH2]n-phenyl, - [CH2]n-[4-7 membered N-linked heterocyclyl], or -[CH2]n-[5-6 membered heteroaryl]; wherein: integer n is 0, 1 or 2; and any alkyl, cycloalkyl, phenyl, heteroaryl or heterocyclyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, amino, (1-2C)alkyl, (1-2C)alkoxy, (1-2C)haloalkyl, (1- 2C)haloalkoxy, (1-2C)alkylamino or di-[(1-2C)alkyl]amino; with the proviso that n is not 0 if R1is -[CH2]n-[4-7 membered N-linked heterocyclyl; and R2is hydrogen or (1-2C)alkyl; or R1and R2are linked such that, together with the nitrogen atom to which they are attached, they form a 4-7-membered heterocyclic ring which optionally comprises one or two additional heteroatoms selected from N, O or S, and wherein the heterocyclic ring is optionally substituted by one or more substituents independently selected from halo, cyano or (1-4C)alkyl, wherein the alkyl is optionally further substituted with oneor more substituents independently selected from: halo, hydroxy, cyano, amino, (1- 2C)alkoxy, (1-2C)haloalkoxy, (1-2C)alkylamino or di-[(1-2C)alkyl]amino. (3) R1is selected from hydrogen, (1-6C)alkyl, -[CH2]n-(3-6C)cycloalkyl or -[CH2]n-phenyl; wherein: integer n is 0, 1 or 2; and any alkyl, cycloalkyl or phenyl group is optionally further substituted with one or more substituents selected from: halo, hydroxy, cyano, amino, (1-2C)alkyl, (1-2C)alkoxy, (1-2C)haloalkyl, (1-2C)haloalkoxy, (1-2C)alkylamino or di-[(1- 2C)alkyl]amino; and R2is hydrogen or (1-2C)alkyl; or R1and R2are linked such that, together with the nitrogen atom to which they are attached, they form a 4-7-membered heterocyclic ring which optionally comprises one or two additional heteroatoms selected from N, O or S, and wherein the heterocyclic ring is optionally substituted by one or more substituents independently selected from halo, cyano or (1-4C)alkyl, wherein the alkyl is optionally further substituted with one or more substituents independently selected from halo, hydroxy, cyano, amino, (1- 2C)alkoxy, (1-2C)haloalkoxy, (1-2C)alkylamino or di-[(1-2C)alkyl]amino. (4) R1is selected from hydrogen, (1-6C)alkyl, -[CH2]n-(3-6C)cycloalkyl or -[CH2]n-phenyl; wherein: integer n is 0, 1 or 2; and any alkyl, cycloalkyl or phenyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, amino, (1-2C)alkyl, (1-2C)alkoxy, (1-2C)haloalkyl, (1-2C)haloalkoxy, methylamino or dimethylamino; and R2is hydrogen or methyl; or R1and R2are linked such that, together with the nitrogen atom to which they are attached, they form a 4-7-membered heterocyclic ring which optionally comprises one or two additional heteroatoms selected from N or O, and wherein the heterocyclic ring is optionally substituted by one or more substituents independently selected from methyl, halo, cyano, hydroxy or methoxy. (5) R1is selected from hydrogen, (1-6C)alkyl, -[CH2]n-(3-6C)cycloalkyl, phenyl or benzyl; wherein:integer n is 0 or 1; and any alkyl, cycloalkyl or phenyl group is optionally further substituted with one or more substituents independently selected from: halo, cyano, methyl, hydroxy, methoxy or dimethylamino; and R2is hydrogen or methyl; or R1and R2are linked such that, together with the nitrogen atom to which they are attached, they form a 4-6 membered heterocyclic ring which optionally comprises one or two additional heteroatoms selected from N or O, and wherein the heterocyclic ring is optionally substituted by one or more substituents independently selected from methyl or halo. (5a) R1is selected from (1-4C)alkyl optionally substituted with one or more substituents independently selected from: halo, cyano, hydroxy, methoxy or dimethylamino; and R2is hydrogen or methyl; or R1and R2are linked such that, together with the nitrogen atom to which they are attached, they form a 5-6-membered heterocyclic ring which optionally comprises one additional heteroatom selected from N or O (e.g. morpholinyl or piperizinyl), and wherein the heterocyclic ring is optionally substituted by one or more substituents independently selected from methyl or halo. (6) Rn is selected from hydrogen, (1-3C)alkyl, -[CH2]q-(3-5C)cycloalkyl, wherein: q is 0 or 1; and an alkyl is optionally substituted by hydroxy, methoxy, NH2or NMe2, and a cycloalkyl group is optionally substituted by methyl, hydroxy, methoxy, NH2or NMe2. (7) Rn is selected from hydrogen or (1-3C)alkyl optionally substituted by hydroxy, methoxy, NH2or NMe2. (8) Rn is selected from hydrogen or methyl. (9) R3is selected from hydrogen, halo or a group: -LB-XB-QBwherein: LBis absent or (1-2C)alkylene; XBis absent or is selected from the group consisting of -O-, -C(O)-, -C(O)-O-, -O-C(O)-, -C(O)-N(R100c)-, -N(R100c)-C(O)-, -NR100c-, -N(R100c)-C(O)-O- or -O-C(O)-N(R100c)-, wherein R100cand R100dare each independently selected from hydrogen or methyl; and QBis selected from the group consisting of hydrogen, (1-6C)alkyl, -[CH2]r-(3- 6C)cycloalkyl, -[CH2]r-[4-7-membered heterocyclyl], -[CH2]r-phenyl or -[CH2]r- [5- or 6-membered heteroaryl]; wherein: integer r is 0 or 1; and any alkyl, cycloalkyl, phenyl, heteroaryl or heterocyclyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, (1-3C)alkyl, (1- 3C)alkoxy, (1-3C)haloalkyl, (1-3C)haloalkoxy or NRqa1Rqa2where Rqa1 and Rqa2are each independently selected from hydrogen or methyl. (10) R3is selected from hydrogen, halo or a group: -LB-XB-QBwherein: LBis absent or (1-2C)alkylene; XBis absent or is selected from the group consisting of -O-, -C(O)-, -O-C(O)-, - C(O)-N(R100c)-, -N(R100c)-C(O)-, -NR100c- or -O-C(O)-N(R100c)-, wherein R100cand R100dare each independently selected from hydrogen or methyl; and QBis selected from the group consisting of hydrogen, (1-6C)alkyl, -[CH2]r-(3- 6C)cycloalkyl, -[CH2]r-[5-6-membered heterocyclyl], -[CH2]r-phenyl or -[CH2]r- [5- or 6-membered heteroaryl]; wherein: integer r is 0 or 1; and any alkyl, cycloalkyl, phenyl, heteroaryl or heterocyclyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, (1-2C)alkyl, (1- 2C)alkoxy, (1-2C)haloalkyl, (1-2C)haloalkoxy or NRqa1Rqa2where Rqa1and Rqa2are each independently selected from hydrogen or methyl. (11) R3is selected from hydrogen, halo or a group: -LB-XB-QBwherein:LBis absent or (1-2C)alkylene; XBis absent or is selected from the group consisting of -O-, -C(O)-, -NR100c- or -O-C(O)-N(R100c)-, wherein R100cand R100dare each independently selected from hydrogen or methyl; and QBis selected from the group consisting of hydrogen, (1-6C)alkyl, -[CH2]r-(3- 6C)cycloalkyl, -[CH2]r-[5-6-membered heterocyclyl] or -[CH2]r-phenyl], Wherein integer r is 0 or 1; and any alkyl, cycloalkyl or phenyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, (1- 2C)alkyl, (1-2C)alkoxy, (1-2C)haloalkyl, (1-2C)haloalkoxy or NRqa1Rqa2where Rqa1 and Rqa2are each independently selected from hydrogen or methyl. (12) R3is selected from R3is selected from hydrogen, halo or a group: -XB-QBwherein: XBis absent or is selected from the group consisting of -O-, -C(O)-, -O-C(O)-, - NR100c- or -O-C(O)-N(R100c)-, wherein R100cand R100dare each independently selected from hydrogen or methyl; and QBis selected from the group consisting of hydrogen, (1-6C)alkyl, -[CH2]r-(3- 6C)cycloalkyl, -[CH2]r-[5-6-membered heterocyclyl], or -[CH2]r-phenyl], wherein integer r is 0 or 1; and any alkyl, cycloalkyl or heterocyclyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, (1-2C)alkyl, (1-2C)alkoxy, (1-2C)haloalkyl, (1-2C)haloalkoxy or NRqa1Rqa2where Rqa1 and Rqa2are each independently selected from hydrogen or methyl. (13) R3is selected from hydrogen, halo or a group: -XB-QBwherein: XBis absent or is selected from the group consisting of -O- or -NR100c- wherein R100cis selected from hydrogen or methyl; andQBis selected from the group consisting of (1-6C)alkyl, (3-6C)cycloalkyl or phenyl, wherein any alkyl, cycloalkyl or phenyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, methyl, or methoxy. (14) R3is selected from halo (e.g. fluoro or chloro), (1-4C)alkyl, (1-4C)alkoxy, (1- 4C)haloalkyl, (1-4C)haloalkoxy, (3-6C)cycloalkyl or phenyl. (15) R3is selected from halo (e.g. chloro), (1-3C)alkyl, CF3or cyclopropyl. (16) R3is methyl. (17) Each occurrence of R4and R5is each independently selected from hydrogen, hydroxy or methyl (preferably hydrogen or methyl). (18) Each occurrence of R4and R5is hydrogen. (19) integer a is 0, 1 or 2. (20) X is absent or is selected from -O-, -S(O)0-2- or -NR100e-, wherein R100eis selected from hydrogen or methyl. (21) X is absent or is -O-. (22) Q is selected from phenyl, naphthyl or heteroaryl, wherein Q is optionally substituted by one or more substituents RQ, wherein each RQ is independently selected from: halo, hydroxy, cyano, (1-4C)alkyl, (1-4C)alkoxy, (1-4C)haloalkyl or (1-4C)haloalkoxy. (23) Q is selected from phenyl, naphthyl or 5- or 6-membered heteroaryl, wherein Q is optionally substituted by one or more substituents RQ, wherein each RQ is independently selected from: halo, hydroxy, cyano, (1-3C)alkyl, (1-3C)alkoxy, (1- 3C)haloalkyl or (1-3C)haloalkoxy. (24) Q is selected from phenyl, naphthyl or 5- or 6-membered heteroaryl, wherein Q is optionally substituted by one or more substituents RQ, wherein each RQ is independently selected from: halo (e.g. fluoro, chloro or bromo), (1-2C)alkyl, methoxy or trifluoromethyl. (25) Q is selected from phenyl or naphthyl, wherein Q is optionally substituted by one or more substituents RQ, wherein each RQis independently selected from halo (e.g. fluoro, chloro or bromo) or (1-2C)alkyl. (26) when a is 1, then R3and R4are linked such that, together with the carbon atoms to which they are attached, they form a fused 5-6 membered carbocycle or 5-6 membered heterocyclyl, wherein the fused 5-6 membered carbocycle or 5-6 membered heterocyclyl is optionally substituted by one or more substituents independently selected from halo, methyl, halomethyl, methoxy or halomethoxy; and R5is selected from hydrogen or methyl.(27) when a is 1, then R3and R4are linked such that, together with the carbon atoms to which they are attached, they form a fused 6-membered carbocycle or 6-membered heterocyclyl, wherein the fused 6-membered carbocycle or 6-membered heterocyclyl is optionally substituted by one or more substituents independently selected from halo, methyl, halomethyl, methoxy or halomethoxy; and R5is selected from hydrogen or methyl. (28) when a is 1, then R3and R4are linked such that, together with the carbon atoms to which they are attached, they form a fused 6-membered carbocycle which is optionally substituted by one or more substituents independently selected from halo, methyl or fluoromethyl (e.g. CH2F, CHF2or CF3); and R5is hydrogen. (29) Q is selected from phenyl or pyridyl, wherein Q is optionally substituted by one or more substituents RQ, wherein each RQ is independently selected from: halo, hydroxy, cyano, (1-3C)alkyl, (1-3C)alkoxy, (1-3C)haloalkyl or (1-3C)haloalkoxy. (30) Q is selected from phenyl or pyridyl, wherein Q is optionally substituted by one, two or three substituents RQ, wherein each RQ is independently selected from halo (e.g. fluoro, chloro or bromo) or (1-2C)alkyl. (31) Q is phenyl, wherein Q is optionally substituted by one or more substituents RQ, wherein each RQ is independently selected from halo (e.g. fluoro or chloro) or (1- 2C)alkyl. (32) Q is a group with the formula:wherein: RQis as defined in any one of paragraphs (29 to (31); and and qa is selected from 0, 1, 2 or 3. (33) Q is a group with the formula: ;wherein:RQ1is selected from hydrogen or fluoro; and RQ2is selected from hydrogen or chloro. (34) Q is a group with the formula: ;wherein: RQ1is selected from hydrogen or fluoro. (35) Ring B is a fused partially saturated 5-6 membered carbocyclic ring which is optionally substituted by one or more substituents independently selected from halo, methyl, halomethyl, methoxy or halomethoxy. (36) Ring B is is a fused partially saturated 5-6 membered carbocyclic ring which is optionally substituted by one or more substituents independently selected from halo, methyl, halomethyl, methoxy, fluromethyl or fluoromethoxy. (37) Ring B is is a fused partially saturated 6-membered carbocyclic ring which is optionally substituted by one or more substituents independently selected from halo, methyl or fluoromethyl (e.g. CH2F, CHF2or CF3).

[0085] Suitably, a heteroaryl or heterocyclyl group as defined herein is a monocyclic heteroaryl or mono, bicyclic or bridged heterocyclyl group comprising one, two or three heteroatoms selected from N, O or S.

[0086] Suitably, a heteroaryl is a 5- or 6-membered heteroaryl ring comprising one, two or three heteroatoms selected from N, O or S.

[0087] Suitably, a heterocyclyl group is a 4-, 5-, 6-, 7-, 8- or 9-membered heterocyclyl ring comprising one, two or three heteroatoms selected from N, O or S. Most suitably, a heterocyclyl group is a 5-, 6- or 7-membered monocyclic or bicyclic ring comprising one, two or three heteroatoms selected from N, O or S [e.g. morpholinyl (e.g.4-morpholinyl), pyridinyl, piperazinyl, homopiperazinyl or pyrrolidinonyl].

[0088] Suitably, an aryl group is phenyl.

[0089] Suitably, R1and R2are as defined in any one of paragraphs (1) to (5) above. More suitably, R1and R2are as defined in any one of paragraphs (3) to (5) above. Most suitably, R1and R2are as defined in paragraph (5) above.

[0090] Suitably, R1and R2are as defined in any one of paragraphs (1) to (5) or (5a) above. More suitably, R1and R2are as defined in any one of paragraphs (3) to (5) or (5a) above. Most suitably, R1and R2are as defined in paragraph (5) or (5a) above.

[0091] Suitably, Rnis as defined in any one of paragraphs (6) to (8) above. More suitably, Rn is as defined in paragraph (7) or (8) above. Most suitably, Rn is as defined in paragraph (8) above.

[0092] Suitably, R3is as defined in any one of paragraphs (9) to (16) above. More suitably, R3is as defined in any one of paragraphs (12) to (16) above. Most suitably, R3is as defined in paragraph (15) or (16) above.

[0093] Suitably R4and R5are as defined in paragraph (17) or (18) above. Most suitably, R4and R5are as defined in paragraph (18) above.

[0094] Suitably, integer a is as defined in paragraph (19) above.

[0095] Suitably, if a is 1, then R3, R4and R5are as defined in any one of paragraphs (26) to (28). More suitably, if a is 1, then R3, R4and R5are as defined in paragraph (27) or (28). Most suitably, if a is 1, then R3, R4and R5are as defined in paragraph (28).

[0096] Suitably X is as defined in paragraph (20) or (21) above. Most suitably, X is as defined in paragraph (21) above.

[0097] Suitably, Q is as defined in any one of paragraphs (22) to (25) or (29) to (34) above. More suitably Q is as defined in paragraph (24), (25), (31), (32), (33) or (34) above. Most suitably, Q is as defined in paragraph (25) or (34) above.

[0098] Suitably, Q is as defined in any one of paragraphs (22) to (25) above. More suitably Q is as defined in paragraph (24) or (25) above. Most suitably, Q is as defined in paragraph (25) above.

[0099] Suitably, Q is as defined in any one of paragraphs (29) to (34) above. More suitably Q is as defined in paragraph (31), (32), (33) or (34) above. Most suitably, Q is as defined in paragraph (33) or (34) above.

[0100] In certain embodiments, if Q is phenyl or 6-membered heteroaryl, then it is optionally substituted at the meta and / or para position by one or more substituents RQ, wherein each RQis as defined in any one of paragraphs (22) to (25).

[0101] In certain embodiments, if Q is phenyl or 6-membered heteroaryl, then it is optionally substituted at the meta and / or para position by one or more substituents RQ, wherein each RQis as defined in any one of paragraphs (29) to (31).

[0102] In certain embodiments, Q is phenyl, which is optionally substituted at the meta and / or para position by one or more substituents RQ, wherein each RQis as defined in any one of paragraphs (29) to (31).

[0103] Suitably, Ring B is as defined in any one of paragraphs (35) to (37). Most suitably, Ring B is as defined in paragraph (37).

[0104] In certain embodiments, if Q is phenyl or 6-membered heteroaryl, then it is optionally substituted at the meta and / or para position by one or more substituents RQ, wherein each RQis independently selected from: halo (e.g. fluoro, chloro or bromo), (1-4C)alkyl, methoxy or trifluoromethyl.

[0105] In certain embodiments, if Q is phenyl or 6-membered heteroaryl, then it is optionally substituted at the meta and / or para position by one or more substituents RQ, wherein each RQ is independently selected from: halo (e.g. fluoro, chloro or bromo), (1-4C)alkyl, methoxy or trifluoromethyl.

[0106] In certain embodiments, if Q is phenyl or 6-membered heteroaryl, then it is optionally substituted at the meta and / or para position by one or more substituents RQ, wherein each RQ is independently selected from fluoro or chloro.

[0107] In a particular embodiment, X is absent, thus the compounds have the structural formula (II) (a sub-definition of formula (I)) shown below:wherein R1, R2, Rn, R3, R4, R5, a and Q are as defined herein, or a pharmaceutically acceptable salt thereof.

[0108] In an embodiment of the compounds of formula (II): R1and R2are as defined in any one of paragraphs (1) to (5) above; Rnis as defined in any one of paragraphs (6) to (8) above; R3is as defined in any one of paragraphs (9) to (16) above;R4and R5are as defined in paragraph (17) or (18) above; integer a is selected from 1, 2 or 3; and Q is as defined in any one of paragraphs (22) to (25) above.

[0109] In an embodiment of the compounds of formula (II): R1and R2are as defined in any one of paragraphs (3) to (5) above; Rnis as defined in paragraph (7) or (8) above; R3is as defined in any one of paragraphs (12) to (16) above; R4and R5are as defined in paragraph (17) or (18) above; integer a is selected from 1, 2 or 3; and Q is as defined in paragraph (24) or (25) above.

[0110] In an embodiment of the compounds of formula (II): R1and R2are as defined in paragraph (5) above; Rn is as defined in paragraph (8) above; R4and R5are as defined in paragraph (18) above; R3is as defined in paragraph (15) or (16) above; integer a is selected from 1 or 2; and Q is as defined in paragraph (25) above.

[0111] In a particular embodiment, X is absent, a is 1, and R4and R5are hydrogen, thus the compounds have the structural formula (III) (a sub-definition of formula (I)) shown below:wherein R1, R2, Rn, R3and Q are as defined herein, or a pharmaceutically acceptable salt thereof.

[0112] In an embodiment of the compounds of formula (III): R1and R2are as defined in any one of paragraphs (1) to (5) above; Rnis as defined in any one of paragraphs (6) to (8) above; R3is as defined in any one of paragraphs (9) to (16) above; and Q is as defined in any one of paragraphs (22) to (25) above.

[0113] In an embodiment of the compounds of formula (III): R1and R2are as defined in any one of paragraphs (3) to (5) above; Rn is as defined in paragraph (7) or (8) above; R3is as defined in any one of paragraphs (12) to (16) above; and Q is as defined in paragraph (24) or (25) above.

[0114] In an embodiment of the compounds of formula (III): R1and R2are as defined in paragraph (5) above; Rn is as defined in paragraph (8) above; R3is as defined in paragraph (15) or (16) above; and Q is as defined in paragraph (25) above.

[0115] In a particular embodiment, X is absent, a is 1, and R4and R5are hydrogen, and Q is phenyl, thus the compounds have the structural formula (IV) (a sub-definition of formula (I)) shown below:wherein R1, R2, Rn, R3, a and RQare as defined herein, and qa is selected from 0, 1, 2 or 3, or a pharmaceutically acceptable salt thereof.

[0116] In an embodiment of the compounds of formula (IV): R1and R2are as defined in any one of paragraphs (1) to (5) above; Rnis as defined in any one of paragraphs (6) to (8) above; R3is as defined in any one of paragraphs (9) to (16) above; qa is selected from 0, 1, 2 or 3; and each occurrence of RQis independently as defined in any one of paragraphs (22) to (25) above.

[0117] In an embodiment of the compounds of formula (IV): R1and R2are as defined in any one of paragraphs (3) to (5) above; Rn is as defined in paragraph (7) or (8) above; R3is as defined in any one of paragraphs (12) to (16) above qa is selected from 1 or 2; and each occurrence of RQ is independently is as defined in paragraph (24) or (25) above.

[0118] In an embodiment of the compounds of formula (IV): R1and R2are as defined in paragraph (5) above; Rn is as defined in paragraph (8) above; R3is as defined in paragraph (15) or (16) above; qa is selected from 1 or 2; and each occurrence of RQ is independently as defined in paragraph (25) above.

[0119] In a particular embodiment, a is 1, R3and R4are linked such that, together with the carbon atoms to which they are attached, they form a fused 5-6 membered carbocycle or 5-6 membered heterocyclyl, thus the compounds have the structural formula (V) (a sub-definition of formula (I)) shown below:wherein R1, R2, Rn, R5, X and Q are as defined herein; and Ring A is a 5-6 membered fused carbocyclic or 5-6 membered heterocycle, which is optionally substituted by one or more substituents independently selected from halo, (1- 2C)alkyl, (1-2C)haloalkyl, (1-2C)alkoxy or (1-2C)haloalkoxy; or a pharmaceutically acceptable salt thereof.

[0120] In an embodiment of the compounds of formula (V): R1and R2are as defined in any one of paragraphs (1) to (5) above; Rnis as defined in any one of paragraphs (6) to (8) above; Ring A is a 5-6 membered fused 5-6 membered carbocycle or 5-6 membered heterocycle, which is optionally substituted by one or more substituents as defined in any one of paragraphs (26) to (28); R5is selected from hydrogen or methyl; X is as defined in paragraph (20) or (21) above; Q is as defined in any one of paragraphs (22) to (25) above.

[0121] In an embodiment of the compounds of formula (V): R1and R2are as defined in any one of paragraphs (3) to (5) above; Rnis as defined in paragraph (7) or (8) above; Ring A is a fused 6-membered carbocycle or 6-membered heterocycle, which is optionally substituted by one or more substituents as defined paragraph (27) or (28); R5is selected from hydrogen or methyl; X is as defined in paragraph (20) or (21) above; and Q is as defined in paragraph (24) or (25) above.

[0122] In an embodiment of the compounds of formula (V): R1and R2are as defined in paragraph (5) above; Rnis as defined in paragraph (8) above; Ring A is a 6-membered carbocycle, which is optionally substituted by one or more substituents as defined in paragraph (27) or (28); R5is hydrogen; X is as defined in paragraph (21) above; and Q is as defined in paragraph (25) above.

[0123] Suitably, Ring A is a fused ring with a structure selected from:;wherein: RNA is selected from hydrogen or methyl; R5, X and Q may take any of the definitions herein; and nn is an integer selected from 0, 1, 2 or 3; pp is an integer selected from 0, 1 or 2; rr is an integer selected from 0, 1 or 2; each occurrence of RA is independently selected from halo, (1-2C)alkyl, (1- 2C)haloalkyl, (1-2C)alkoxy or (1-2C)haloalkoxy.

[0124] Suitably: RNA is selected from hydrogen or methyl; R5, X and Q may take any of the definitions herein; and nn is an integer selected from 0, 1 or 2; pp is an integer selected from 0 or 1; rr is an integer selected from 0 or 1; each occurrence of RA is independently selected from halo, methyl, halomethyl, methoxy, halomethyl or halomethoxy.

[0125] Suitably: RNA is selected from hydrogen or methyl; R5, X and Q may take any of the definitions herein; and nn is an integer selected from 0 or 1; pp is an integer selected from 0 or 1; rr is an integer selected from 0 or 1;RA, if present, is independently selected from halo, methyl or fluoromethyl (e.g. CH2F, CHF2or CF3).

[0126] In a particular embodiment, a is 1, R3and R4are linked such that, together with the carbon atoms to which they are attached, they form a 6-membered carbocycle, thus the compounds have the structural formula (VI), (VIa) or (VIb) (sub-definitions of formula (I)) shown below: n Q Xwherein R1, R2, Rn, R5, X and Q are as defined herein; and nn is an integer selected from 0, 1, 2 or 3; each occurrence of RAis independently selected from halo, (1-2C)alkyl, (1- 2C)haloalkyl, (1-2C)alkoxy or (1-2C)haloalkoxy; or a pharmaceutically acceptable salt thereof.

[0127] Suitably, nn is an integer selected from 0, 1 or 2. More suitably, nn is 0 or 1. Most suitably nn is 0.

[0128] Suitably, each occurrence of RAis independently selected from halo, methyl, halomethyl, methoxy, halomethyl or halomethoxy; and R5is selected from hydrogen or methyl. More suitably, each occurrence of RAis independently selected from halo, methyl or fluoromethyl (e.g. CH2F, CHF2or CF3).

[0129] In an embodiment of the compounds of formula (VI), (VIa) or (VIb): R1and R2are as defined in any one of paragraphs (1) to (5) or (5a) above; Rnis as defined in any one of paragraphs (6) to (8) above; nn is an integer selected from 0, 1 or 2; each occurrence of RAis independently selected from halo, methyl, halomethyl, methoxy, halomethyl or halomethoxy; R5is selected from hydrogen or methyl; X is as defined in paragraph (20) or (21) above; and Q is as defined in any one of paragraphs (22) to (25) above.

[0130] In an embodiment of the compounds of formula (VI), (VIa) or (VIb):R1and R2are as defined in any one of paragraphs (3) to (5) or (5a) above; Rnis as defined in paragraph (7) or (8) above; nn is an integer selected from 0, 1 or 2; each occurrence of RAis independently selected from halo, methyl, halomethyl, methoxy, halomethyl or halomethoxy; R5is selected from hydrogen or methyl; X is as defined in paragraph (20) or (21) above; and Q is as defined in paragraph (24) or (25) above.

[0131] In an embodiment of the compounds of formula (VI), (VIa) or (VIb): R1and R2are as defined in paragraph (5) or (5a) above; Rn is as defined in paragraph (8) above; nn is an integer selected from 0 or 1; RA is selected from halo, methyl or fluoromethyl (e.g. CH2F, CHF2or CF3); R5is hydrogen; X is as defined in paragraph (21) above; and Q is as defined in paragraph (25) above.

[0132] In an embodiment of the compounds of formula (VI), (VIa) or (VIb): R1and R2are as defined in paragraph (5) or (5a) above; Rn is as defined in paragraph (8) above; nn is 0; R5is hydrogen; X is as defined in paragraph (21) above; and Q is as defined in paragraph (25) above.

[0133] In a particular embodiment, the compounds have the structural formula (VII), (VIIa) or (VIIb) (sub-definitions of formula (I)) shown below:Q Q Qwherein R1, R2, Rn, X and Q are as defined herein.

[0134] In an embodiment of the compounds of formula (VII), (VIIa) or (VIIb): Q is as defined in paragraph (33) or (34); and R1, R2and Rn are as defined herein.

[0135] In an embodiment of the compounds of formula (VII), (VIIa) or (VIIb): R1and R2are as defined in any one of paragraphs (1) to (5) or (5a) above; Rnis as defined in any one of paragraphs (6) to (8) above; and Q is as defined in paragraph (33) or (34) above.

[0136] In an embodiment of the compounds of formula (VII), (VIIa) or (VIIb): R1and R2are as defined in any one of paragraphs (1) to (5) or (5a) above; Rnis as defined in any one of paragraphs (6) to (8) above; X is as defined in paragraph (20) or (21) above; and Q is as defined in any one of paragraphs (22) to (25) or (31) to (34) above.

[0137] In an embodiment of the compounds of formula (VII), (VIIa) or (VIIb): R1and R2are as defined in any one of paragraphs (1) to (5) or (5a) above; Rn is as defined in any one of paragraphs (6) to (8) above; X is as defined in paragraph (20) or (21) above; and Q is as defined in any one of paragraphs (31) to (34) above.

[0138] In an embodiment of the compounds of formula (VII), (VIIa) or (VIIb): R1and R2are as defined in any one of paragraphs (3) to (5) or (5a) above; Rn is as defined in paragraph (7) or (8) above; Q is as defined in paragraph (24) or (25) above.

[0139] In an embodiment of the compounds of formula (VII), (VIIa) or (VIIb): R1and R2are as defined in paragraph (5) or (5a) above; Rn is as defined in paragraph (8) above; X is as defined in paragraph (21) above; and Q is as defined in paragraph (25), (32), (33) or (34) above.

[0140] In an embodiment of the compounds of formula (VII), (VIIa) or (VIIb): R1and R2are as defined in paragraph (5) or (5a) above; X is as defined in paragraph (21) above; and Q is as defined in paragraph (25), (32), (33) or (34) above.

[0141] In an embodiment of the compounds of formula (VII), (VIIa) or (VIIb): R1and R2are as defined in paragraph (5) or (5a) above; X is as defined in paragraph (21) above; andQ is as defined in paragraph (32), (33) or (34) above.

[0142] In a particular embodiment, Ring B is a fused partially saturated 6-membered carbocycle, and the compound of the invention has a structural formula (XI) (a sub-definition of formula (X)) shown below:wherein R1, R2, Rn, X and Q are as defined herein; and mm is an integer selected from 0, 1 or 2; each occurrence of RAis independently as defined herein; or a pharmaceutically acceptable salt thereof.

[0143] Suitably, in the compounds of formula (XI), each occurrence of RAis selected from halo, (1-2C)alkyl, (1-2C)haloalkyl, (1-2C)alkoxy or (1-2C)haloalkoxy.

[0144] Suitably, mm is an integer selected from 0 or 1. Most suitably mm is 0.

[0145] In an embodiment of the compounds of formula (XI): R1and R2are as defined in any one of paragraphs (1) to (5) or (5a) above; Rnis as defined in any one of paragraphs (6) to (8) above; mm is an integer selected from 0 or 1; each occurrence of RAis independently selected from halo, methyl, halomethyl, methoxy, halomethyl or halomethoxy; X is as defined in paragraph (20) or (21) above; and Q is as defined in any one of paragraphs (22) to (25) or (29) to (34) above.

[0146] In an embodiment of the compounds of formula (XI): R1and R2are as defined in any one of paragraphs (3) to (5) or (5a) above;Rnis as defined in paragraph (7) or (8) above; mm is an integer selected from 0 or 1; each occurrence of RAis independently selected from halo, methyl, halomethyl, methoxy, halomethyl or halomethoxy; X is as defined in paragraph (20) or (21) above; and Q is as defined in paragraph (24) or (25) or (31) to (34) above.

[0147] In an embodiment of the compounds of formula (XI): R1and R2are as defined in paragraph (5) or (5a) above; Rn is as defined in paragraph (8) above; mm is an integer selected from 0 or 1; RA is selected from halo, methyl or fluoromethyl (e.g. CH2F, CHF2or CF3); X is as defined in paragraph (21) above; and Q is as defined in paragraph (25), (32), (33) or (34) above.

[0148] In an embodiment of the compounds of formula (XI): R1and R2are as defined in paragraph (5) or (5a) above; Rn is as defined in paragraph (8) above; mm is 0; R5is hydrogen; X is as defined in paragraph (21) above; and Q is as defined in paragraph (25), (32), (33) or (34) above.

[0149] In a particular embodiment, Ring B is a fused partially saturated 6-membered carbocycle, thus, the compound of the invention has a structural formula (XII) (a sub-definition of formula (X)) shown below:Qwherein R1, R2, Rnand Q are as defined herein; or a pharmaceutically acceptable salt thereof.

[0150] In an embodiment of the compounds of formula (XII): Q is as defined in paragraph (33) or (34); and R1, R2and Rnare as defined herein.

[0151] In an embodiment of the compounds of formula (XII): R1and R2are as defined in any one of paragraphs (1) to (5) or (5a) above; Rnis as defined in any one of paragraphs (6) to (8) above; Q is as defined in paragraph (33) or (34).

[0152] In an embodiment of the compounds of formula (XII): R1and R2are as defined in any one of paragraphs (1) to (5) or (5a) above; Rn is as defined in any one of paragraphs (6) to (8) above; Q is as defined in any one of paragraphs (22) to (25) or (29) to (34) above.

[0153] In an embodiment of the compounds of formula (XII): R1and R2are as defined in any one of paragraphs (1) to (5) or (5a) above; Rn is as defined in any one of paragraphs (6) to (8) above; Q is as defined in any one of paragraphs (29) to (34) above.

[0154] In an embodiment of the compounds of formula (XII): R1and R2are as defined in any one of paragraphs (3) to (5) or (5a) above; Rn is as defined in paragraph (7) or (8) above;Q is as defined in paragraph (25) or (31) to (34) above.

[0155] In an embodiment of the compounds of formula (XII): R1and R2are as defined in paragraph (5) or (5a) above; Rnis as defined in paragraph (8) above; Q is as defined in paragraph (25), (32), (33) or (34) above.

[0156] In an embodiment of the compounds of formula (XII): R1and R2are as defined in paragraph (5) or (5a) above; Rn is as defined in paragraph (8) above; Q is as defined in paragraph (25), (32), (33) or (34) above.

[0157] Particular compounds of the present invention include any of the compounds described in the example section of the present application, or a pharmaceutically acceptable pharmaceutically acceptable salt, hydrate or solvate thereof, and, in particular, any of the following: 2-((5-(3-bromobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((4-methyl-5-(2-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3,4-dichlorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(2-chlorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((4-ethyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chlorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((4-methyl-5-(3-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-fluorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(4-chlorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((4-methyl-5-(4-(trifluoromethyl)benzyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(4-isopropylbenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chloro-2-fluorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chloro-5-fluorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(5-chloro-2-fluorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chloro-4-fluorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chlorobenzyl)-4-methylthiazol-2-yl)(methyl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chlorobenzyl)-4-methylthiazol-2-yl)(ethyl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3,4-dichlorobenzyl)-4-methylthiazol-2-yl)(methyl)amino)-2-oxoethyl methylsulfamate; 2-((4-methyl-5-(naphthalen-2-ylmethyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate;2-((5-(3,4-difluorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(4-methoxybenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((4-cyclopropyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((4-isopropyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(4-chlorophenethyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((4-methyl-5-(4-(trifluoromethyl)benzyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((4-methyl-5-(naphthalen-1-ylmethyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(4-fluorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl dimethylsulfamate; 2-((4-methyl-5-(3-(trifluoromethyl)benzyl)thiazol-2-yl)amino)-2-oxoethyl dimethylsulfamate; 2-((5-(2-fluorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl dimethylsulfamate; 2-((5-benzyl-4-methylthiazol-2-yl)amino)-2-oxoethyl dimethylsulfamate; 2-((4-methyl-5-phenethylthiazol-2-yl)amino)-2-oxoethyl dimethylsulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl sulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl ethylsulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl isobutylsulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl isopropylsulfamate; 2-((5-(3-chlorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl ethylsulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl cyclopropylsulfamate; 2-((5-(3-chlorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl (2-methoxyethyl)sulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl propylsulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl tert-butylsulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl benzylsulfamate; 2-((5-(3-chlorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl (2-fluoroethyl)sulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl morpholine-4-sulfonate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl dimethylsulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl 3-fluoroazetidine-1-sulfonate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl azetidine-1-sulfonate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl pyrrolidine-1-sulfonate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl ethyl(methyl)sulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl (2- methoxyethyl)(methyl)sulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl benzyl(methyl)sulfamate; 2-((5-(3-chlorobenzyl)-4-(((1-methylpiperidin-4-yl)oxy)methyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((4-(hydroxymethyl)-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chlorobenzyl)-4-(((methylcarbamoyl)oxy)methyl)thiazol-2-yl)amino)-2-oxoethylmethylsulfamate; 2-((5-(3-chlorobenzyl)-4-(morpholinomethyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(2-(3-chlorophenyl)propan-2-yl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chlorobenzyl)-4-formylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((7-(3-chlorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; or 2-((5-(3-chlorophenoxy)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate.

[0158] Further compounds of the present invention, or a pharmaceutically acceptable pharmaceutically acceptable salt, hydrate or solvate thereof, include any of the following: 2-((7-(4-fluorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl (2- (dimethylamino)ethyl)(methyl)sulfamate; (S)-2-((7-(3,4-difluorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl (2- (dimethylamino)ethyl)sulfamate; 2-((7-(3,4-difluorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl (2- (dimethylamino)ethyl)sulfamate; 2-oxo-2-((7-(pyridin-4-yl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)ethyl ethylsulfamate; 2-oxo-2-((7-(pyridin-2-yl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)ethyl ethylsulfamate; (S)-2-((7-(3-chlorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl 4- methylpiperazine-1-sulfonate; (R)-2-((7-(3-chlorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl 4- methylpiperazine-1-sulfonate; (S)-2-((7-(4-fluorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl (2- (dimethylamino)ethyl)sulfamate; (R)-2-((7-(4-fluorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl (2- (dimethylamino)ethyl)sulfamate; 2-((7-(3-chlorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl 4- methylpiperazine-1-sulfonate; 2-((7-(4-fluorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl (2- (dimethylamino)ethyl)sulfamate; (S)-2-((7-(3-chloro-4-fluorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl (2-(dimethylamino)ethyl)sulfamate; (R)-2-((7-(3-chloro-4-fluorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl (2-(dimethylamino)ethyl)sulfamate; 2-((7-(3-chloro-4-fluorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl (2- (dimethylamino)ethyl)sulfamate;(S)-2-((7-(3-chloro-4-fluorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl ethylsulfamate; (R)-2-((7-(3-chloro-4-fluorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl ethylsulfamate; (S)-2-((7-(3-chloro-4-fluorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; (R)-2-((7-(3-chloro-4-fluorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((7-(3-chloro-4-fluorophenyl)-4,5-dihydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl ethylsulfamate; 2-((7-(3-chloro-4-fluorophenyl)-4,5-dihydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((7-(3-chloro-4-fluorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl ethylsulfamate; 2-((7-(3-chloro-4-fluorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; (S)-2-((7-(3-chlorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; (R)-2-((7-(3-chlorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((7-(3-chlorophenyl)-4,5-dihydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((4-chloro-5-(3-chloro-4-fluorobenzyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-((3-chloro-4-fluorophenyl)(hydroxy)methyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chloro-4-fluorobenzyl)-4-methylthiazol-2-yl)(2-methoxyethyl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chlorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl (2- (dimethylamino)ethyl)sulfamate; 2-((5-(3-chlorobenzyl)-4-(hydroxymethyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chlorophenoxy)-4-methylthiazol-2-yl)amino)-2-oxoethyl (2- (dimethylamino)ethyl)(methyl)sulfamate; 2-((5-(3-chloro-4-fluorophenoxy)-4-methylthiazol-2-yl)amino)-2-oxoethyl (2- (dimethylamino)ethyl)sulfamate; 2-((5-(3-chlorophenoxy)-4-methylthiazol-2-yl)amino)-2-oxoethyl 4-methylpiperazine-1- sulfonate; 2-((5-(3-chlorophenoxy)-4-methylthiazol-2-yl)amino)-2-oxoethyl (2- (dimethylamino)ethyl)sulfamate;2-((5-(3-chloro-5-fluorophenoxy)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chloro-2-fluorophenoxy)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(4-cyanophenoxy)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(5-chloro-2-fluorophenoxy)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((4-methyl-5-(3-(trifluoromethyl)phenoxy)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chlorophenoxy)-4-methylthiazol-2-yl)amino)-2-oxoethyl isopropylsulfamate; 2-((5-(4-methoxyphenoxy)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(4-fluorophenoxy)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(4-chlorophenoxy)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((4-methyl-5-(3-(trifluoromethoxy)phenoxy)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chlorophenoxy)-4-methylthiazol-2-yl)(methyl)amino)-2-oxoethyl ethylsulfamate; 2-((5-(3-chlorophenoxy)-4-methylthiazol-2-yl)amino)-2-oxoethyl ethylsulfamate; 2-((5-(3-chloro-4-fluorophenoxy)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((7-(3-chloro-4-fluorophenyl)-6,7-dihydro-5H-pyrano[2,3-d]thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((6-(3-chlorophenyl)-5,6-dihydro-4H-cyclopenta[d]thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((7-(3-chloro-4-fluorophenyl)-5-methyl-4,5,6,7-tetrahydrothiazolo[4,5-c]pyridin-2-yl)amino)- 2-oxoethyl methylsulfamate; 2-((7-(3-chloro-4-fluorophenyl)-4,5,6,7-tetrahydrothiazolo[4,5-c]pyridin-2-yl)amino)-2- oxoethyl methylsulfamate; 2-((7-(3-chloro-4-fluorophenyl)-6,7-dihydro-4H-pyrano[3,4-d]thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; or 2-((4-(3-chloro-4-fluorophenyl)-6,7-dihydro-4H-pyrano[4,3-d]thiazol-2-yl)amino)-2-oxoethyl methylsulfamate.

[0159] The various functional groups and substituents making up the compounds of the formula (I) are typically chosen such that the molecular weight of the compound of the formula (I) does not exceed 1000. More usually, the molecular weight of the compound will be less than 900, for example less than 800, or less than 750, or less than 700, or less than 650. More preferably, the molecular weight is less than 600 and, for example, is 550 or less.

[0160] A suitable pharmaceutically acceptable salt of a compound of the invention is, for example, an acidaddition salt of a compound of the invention which is sufficiently basic, for example, an acidaddition salt with, for example, an inorganic or organic acid, for example hydrochloric, hydrobromic, sulfuric, phosphoric, trifluoroacetic, formic, citric methane sulfonate or maleic acid. In addition, a suitable pharmaceutically acceptable salt of a compound of the invention which is sufficiently acidic is an alkali metal salt, for example a sodium or potassiumsalt, an alkaline earth metal salt, for example a calcium or magnesium salt, an ammonium salt or a salt with an organic base which affords a pharmaceutically acceptable cation, for example a salt with methylamine, dimethylamine, trimethylamine, piperidine, morpholine or tris(2hydroxyethyl)amine.

[0161] Compounds that have the same molecular formula but differ in the nature or sequence of bonding of their atoms or the arrangement of their atoms in space are termed “isomers”. Isomers that differ in the arrangement of their atoms in space are termed “stereoisomers”. Stereoisomers that are not mirror images of one another are termed “diastereomers” and those that are nonsuperimposable mirror images of each other are termed “enantiomers”. When a compound has an asymmetric center-, for example, it is bonded to four different groups, a pair of enantiomers is possible. An enantiomer can be characterized by the absolute configuration of its asymmetric center and is described by the R and S sequencing rules of Cahn and Prelog, or by the manner in which the molecule rotates the plane of polarized light and designated as dextrorotatory or -levorotatory- (i.e., as (+) or (-)-isomers respectively). A chiral compound can exist as either individual enantiomer or as a mixture thereof. A mixture containing equal proportions of the enantiomers is called a “racemic mixture”.

[0162] The compounds of this invention may possess one or more asymmetric centers; such compounds can therefore be produced as individual (R) or (S)stereoisomers or as mixtures thereof. Unless indicated otherwise, the description or naming of a particular compound in the specification and claims is intended to include both individual enantiomers and mixtures, racemic or otherwise, thereof. The methods for the determination of stereochemistry and the separation of stereoisomers are wellknown in the art (see discussion in Chapter 4 of “Advanced Organic Chemistry”, 4th edition J. March, John Wiley and Sons, New York, 2001), for example by synthesis from optically active starting materials or by resolution of a racemic form. Some of the compounds of the invention may have geometric isomeric centres (E and Z isomers). It is to be understood that the present invention encompasses all optical, diastereoisomers and geometric isomers and mixtures thereof that possess activity against MutSβ.

[0163] The present invention also encompasses compounds of the invention as defined herein which comprise one or more isotopic substitutions. For Example, H may be in any isotopic form, including1H,2H(D), and3H (T); C may be in any isotopic form, including12C,13C, and14C; and O may be in any isotopic form, including16O and18O; and the like.

[0164] It is also to be understood that certain compounds of the formula (I) may exist in solvated as well as unsolvated forms such as, for example, hydrated forms. It is to beunderstood that the invention encompasses all such solvated forms that possess activity against MutSβ.

[0165] It is also to be understood that certain compounds of the formula I may exhibit polymorphism, and that the invention encompasses all such forms that possess activity against MutSβ.

[0166] Compounds of the formula I may exist in a number of different tautomeric forms and references to compounds of the formula I include all such forms. For the avoidance of doubt, where a compound can exist in one of several tautomeric forms, and only one is specifically described or shown, all others are nevertheless embraced by formula I. Examples of tautomeric forms include keto-, enol-, and enolate-forms, as in, for example, the following tautomeric pairs: keto / enol (illustrated below), imine / enamine, amide / imino alcohol, amidine / amidine, nitroso / oxime, thioketone / enethiol, and nitro / aci-nitro. H O OH H+ O- Cketo enol enolate

[0167] Compounds of the formula I containing an amine function may also form N-oxides. A reference herein to a compound of the formula I that contains an amine function also includes the N-oxide. Where a compound contains several amine functions, one or more than one nitrogen atom may be oxidised to form an N-oxide. Particular Examples of N-oxides are the N-oxides of a tertiary amine or a nitrogen atom of a nitrogen-containing heterocycle. N- Oxides can be formed by treatment of the corresponding amine with an oxidizing agent such as hydrogen peroxide or a per-acid (e.g. a peroxycarboxylic acid), see for example Advanced Organic Chemistry, by Jerry March, 4th Edition, Wiley Interscience, pages. More particularly, N-oxides can be made by the procedure of L. W. Deady (Syn. Comm.1977, 7, 509-514) in which the amine compound is reacted with m-chloroperoxybenzoic acid (mCPBA), for example, in an inert solvent such as dichloromethane.

[0168] The compounds of formula (I) may be administered in the form of a prodrug which is broken down in the human or animal body to release a compound of the invention. A pro-drug may be used to alter the physical properties and / or the pharmacokinetic properties of a compound of the invention. A pro-drug can be formed when the compound of the invention contains a suitable group or substituent to which a property-modifying group can be attached. Examples of pro-drugs include in vivo cleavable ester derivatives that may be formed at a carboxy group or a hydroxy group in a compound of the formula (I) and in-vivo cleavable amide derivatives that may be formed at a carboxy group or an amino group in a compound of the formula (I).

[0169] Accordingly, the present invention includes those compounds of the formula (I) as defined hereinbefore when made available by organic synthesis and when made available within the human or animal body by way of cleavage of a pro-drug thereof. Accordingly, the present invention includes those compounds of the formula I that are produced by organic synthetic means and also such compounds that are produced in the human or animal body by way of metabolism of a precursor compound, that is a compound of the formula (I) may be a synthetically-produced compound or a metabolically-produced compound.

[0170] A suitable pharmaceutically acceptable pro-drug of a compound of the formula (I) is one that is based on reasonable medical judgement as being suitable for administration to the human or animal body without undesirable pharmacological activities and without undue toxicity.

[0171] Various forms of pro-drug have been described, for example in the following documents :- a) Methods in Enzymology, Vol.42, p.309-396, edited by K. Widder, et al. (Academic Press, 1985); b) Design of Pro-drugs, edited by H. Bundgaard, (Elsevier, 1985); c) A Textbook of Drug Design and Development, edited by Krogsgaard-Larsen and H. Bundgaard, Chapter 5 “Design and Application of Pro-drugs”, by H. Bundgaard p.113-191 (1991); d) H. Bundgaard, Advanced Drug Delivery Reviews, 8, 1-38 (1992); e) H. Bundgaard, et al., Journal of Pharmaceutical Sciences, 77, 285 (1988); f) N. Kakeya, et al., Chem. Pharm. Bull., 32, 692 (1984); g) T. Higuchi and V. Stella, “Pro-Drugs as Novel Delivery Systems”, A.C.S. Symposium Series, Volume 14; and h) E. Roche (editor), “Bioreversible Carriers in Drug Design”, Pergamon Press, 1987.

[0172] A suitable pharmaceutically acceptable pro-drug of a compound of the formula I that possesses a carboxy group is, for example, an in vivo cleavable ester thereof. An in vivo cleavable ester of a compound of the formula I containing a carboxy group is, for example, a pharmaceutically acceptable ester which is cleaved in the human or animal body to produce the parent acid. Suitable pharmaceutically acceptable esters for carboxy include C1-6alkyl esters such as methyl, ethyl and tert-butyl, C1-6alkoxymethyl esters such as methoxymethyl esters, C1-6alkanoyloxymethyl esters such as pivaloyloxymethyl esters, 3-phthalidyl esters, C3-8cycloalkylcarbonyloxy- C1-6alkyl esters such ascyclopentylcarbonyloxymethyl and 1-cyclohexylcarbonyloxyethyl esters, 2-oxo-1,3-dioxolenylmethyl esters such as 5-methyl-2-oxo-1,3-dioxolen-4-ylmethyl esters and C1-6alkoxycarbonyloxy- C1-6alkyl esters such as methoxycarbonyloxymethyl and 1- methoxycarbonyloxyethyl esters.

[0173] A suitable pharmaceutically acceptable pro-drug of a compound of the Formula (I) that possesses a hydroxy group is, for example, an in vivo cleavable ester or ether thereof. An in vivo cleavable ester or ether of a compound of the formula I containing a hydroxy group is, for example, a pharmaceutically acceptable ester or ether which is cleaved in the human or animal body to produce the parent hydroxy compound. Suitable pharmaceutically acceptable ester forming groups for a hydroxy group include inorganic esters such as phosphate esters (including phosphoramidic cyclic esters). Further suitable pharmaceutically acceptable ester forming groups for a hydroxy group include C1-10alkanoyl groups such as acetyl, benzoyl, phenylacetyl and substituted benzoyl and phenylacetyl groups, C1- 10alkoxycarbonyl groups such as ethoxycarbonyl, N,N –(C1-6)2carbamoyl, 2- dialkylaminoacetyl and 2-carboxyacetyl groups. Examples of ring substituents on the phenylacetyl and benzoyl groups include aminomethyl, N-alkylaminomethyl, N,N- dialkylaminomethyl, morpholinomethyl, piperazin-1-ylmethyl and 4-(C1-4alkyl)piperazin-1- ylmethyl. Suitable pharmaceutically acceptable ether forming groups for a hydroxy group include a-acyloxyalkyl groups such as acetoxymethyl and pivaloyloxymethyl groups.

[0174] A suitable pharmaceutically acceptable pro-drug of a compound of the formula (I) that possesses a carboxy group is, for example, an in vivo cleavable amide thereof, for example an amide formed with an amine such as ammonia, a C1-4alkylamine such as methylamine, a (C1-4alkyl)2amine such as dimethylamine, N-ethyl-N-methylamine or diethylamine, a C1- 4alkoxy- C2-4alkylamine such as 2-methoxyethylamine, a phenyl-C1-4alkylamine such as benzylamine and amino acids such as glycine or an ester thereof.

[0175] A suitable pharmaceutically acceptable pro-drug of a compound of the formula I that possesses an amino group is, for example, an in vivo cleavable amide derivative thereof. Suitable pharmaceutically acceptable amides from an amino group include, for example an amide formed with C1-10alkanoyl groups such as an acetyl, benzoyl, phenylacetyl and substituted benzoyl and phenylacetyl groups. Examples of ring substituents on the phenylacetyl and benzoyl groups include aminomethyl, N-alkylaminomethyl, N,N- dialkylaminomethyl, morpholinomethyl, piperazin-1-ylmethyl and 4-(C1-4alkyl)piperazin-1-ylmethyl.

[0176] The in vivo effects of a compound of the formula (I) may be exerted in part by one or more metabolites that are formed within the human or animal body after administration of acompound of the formula (I). As stated hereinbefore, the in vivo effects of a compound of the formula (I) may also be exerted by way of metabolism of a precursor compound (a pro- drug.Though the present invention may relate to any compound or particular group of compounds defined herein by way of optional, preferred or suitable features or otherwise in terms of particular embodiments, the present invention may also relate to any compound or particular group of compounds that specifically excludes said optional, preferred or suitable features or particular embodiments.

[0177] Suitably, the present invention excludes any individual compounds not possessing the biological activity defined herein. Synthesis

[0178] The compounds of the present invention can be prepared by any suitable technique known in the art. Particular processes for the preparation of the compounds of the invention are described in the Example section below.

[0179] In the description of the synthetic methods described herein and in any referenced synthetic methods that are used to prepare the starting materials, it is to be understood that all proposed reaction conditions, including choice of solvent, reaction atmosphere, reaction temperature, duration of the experiment and workup procedures, can be selected by a person skilled in the art.

[0180] It is understood by one skilled in the art of organic synthesis that the functionality present on various portions of the molecule must be compatible with the reagents and reaction conditions utilised.

[0181] It will be appreciated that during the synthesis of the compounds of the invention in the processes defined herein, or during the synthesis of certain starting materials, it may be desirable to protect certain substituent groups to prevent their undesired reaction. The skilled chemist will appreciate when such protection is required, and how such protecting groups may be put in place, and later removed.

[0182] For examples of protecting groups see one of the many general texts on the subject, for example, ‘Protective Groups in Organic Synthesis’ by Theodora Green (publisher: John Wiley & Sons). Protecting groups may be removed by any convenient method described in the literature or known to the skilled chemist as appropriate for the removal of the protecting group in question, such methods being chosen so as to effect removal of the protecting group with the minimum disturbance of groups elsewhere in the molecule.

[0183] Thus, if reactants include, for example, groups such as amino, carboxy or hydroxy it may be desirable to protect the group in some of the reactions mentioned herein.

[0184] By way of example, a suitable protecting group for an amino or alkylamino group is, for example, an acyl group, for example an alkanoyl group such as acetyl, an alkoxycarbonyl group, for example a methoxycarbonyl, ethoxycarbonyl or tbutoxycarbonyl group, an arylmethoxycarbonyl group, for example benzyloxycarbonyl, or an aroyl group, for example benzoyl. The deprotection conditions for the above protecting groups necessarily vary with the choice of protecting group. Thus, for example, an acyl group such as an alkanoyl or alkoxycarbonyl group or an aroyl group may be removed by, for example, hydrolysis with a suitable base such as an alkali metal hydroxide, for example lithium or sodium hydroxide. Alternatively an acyl group such as a tertbutoxycarbonyl group may be removed, for example, by treatment with a suitable acid as hydrochloric, sulfuric or phosphoric acid or trifluoroacetic acid and an arylmethoxycarbonyl group such as a benzyloxycarbonyl group may be removed, for example, by hydrogenation over a catalyst such as palladiumoncarbon, or by treatment with a Lewis acid for example boron tris(trifluoroacetate). A suitable alternative protecting group for a primary amino group is, for example, a phthaloyl group which may be removed by treatment with an alkylamine, for example dimethylaminopropylamine, or with hydrazine.

[0185] A suitable protecting group for a hydroxy group is, for example, an acyl group, for example an alkanoyl group such as acetyl, an aroyl group, for example benzoyl, or an arylmethyl group, for example benzyl. The deprotection conditions for the above protecting groups will necessarily vary with the choice of protecting group. Thus, for example, an acyl group such as an alkanoyl or an aroyl group may be removed, for example, by hydrolysis with a suitable base such as an alkali metal hydroxide, for example lithium, sodium hydroxide or ammonia. Alternatively, an arylmethyl group such as a benzyl group may be removed, for example, by hydrogenation over a catalyst such as palladiumoncarbon.

[0186] A suitable protecting group for a carboxy group is, for example, an esterifying group, for example a methyl or an ethyl group which may be removed, for example, by hydrolysis with a base such as sodium hydroxide, or for example a tbutyl group which may be removed, for example, by treatment with an acid, for example an organic acid such as trifluoroacetic acid, or for example a benzyl group which may be removed, for example, by hydrogenation over a catalyst such as palladiumoncarbon.

[0187] Resins may also be used as a protecting group.

[0188] The methodology employed to synthesise a compound of formula (I) and (X) will vary depending on the nature of R1, R2, R3, R4, R5, Rn, X, Q, Ring B and any substituentgroups associated therewith. Suitable processes for their preparation are described further in the accompanying Examples.

[0189] Once a compound of formula (I) has been synthesised by any one of the processes defined herein, the processes may then further comprise one or more of the additional steps of: (i) removing any protecting groups present; (ii) converting the compound formula (I) into another compound of formula (I); (iii) forming a pharmaceutically acceptable salt, hydrate or solvate of the compound of formula I; and / or (iv) forming a prodrug of the compound of formula I.

[0190] An example of (ii) above is when a compound of formula (I) is synthesised and then one or more of the groups of R1, R2, R3, R4, R5, Rn, X and Q may be further reacted to change the nature of the group and provide an alternative compound of formula (I).

[0191] Once a compound of formula (X) has been synthesised by any one of the processes defined herein, the processes may then further comprise one or more of the additional steps of: (i) removing any protecting groups present; (ii) converting the compound formula (X) into another compound of formula (X); (iii) forming a pharmaceutically acceptable salt, hydrate or solvate of the compound of formula (X); and / or (iv) forming a prodrug of the compound of formula I.

[0192] An example of (ii) above is when a compound of formula (X) is synthesised and then one or more of the groups of R1, R2, R3, R4, Rn, X, Q and Ring B may be further reacted to change the nature of the group and provide an alternative compound of formula (X).

[0193] The resultant compounds of formula (I) or (X) can be isolated and purified using techniques well known in the art. Biological Activity

[0194] The biological assay described in the example sectionmay be used to measure the pharmacological effects of the compounds of the present invention.

[0195] Although the pharmacological properties of the compounds of formula I vary with structural change, as expected, the compounds of the invention were found to be active in the assay described in the Biological Examples.

[0196] In general, in terms of MutSβ inhibitory activity, preferred compounds of the invention demonstrate an IC50of 10 µM or less in the assay described in Biological Example A, with more preferred compounds of the invention demonstrating an IC50of 1 µM or less and the most preferred compounds of the invention demonstrating an IC50of 0.5 µM or less.

[0197] In general, in terms of activity, preferred compounds of the invention demonstrate a minimum effective concentration of 1 µM or less in the assay described in Biological Example B, with more preferred compounds of the invention demonstrating a minimum effective concentration of 0.5 µM or less and the most preferred compounds of the invention demonstrating a minimum effective concentration of 0.1 µM or less. Pharmaceutical Compositions

[0198] According to a further aspect of the invention there is provided a pharmaceutical composition which comprises a compound of the invention as defined hereinbefore, or a pharmaceutically acceptable salt, hydrate or solvate thereof, in association with a pharmaceutically acceptable diluent or carrier.

[0199] The compositions of the invention may be in a form suitable for oral use (for example as tablets, lozenges, hard or soft capsules, aqueous or oily suspensions, emulsions, dispersible powders or granules, syrups or elixirs), for topical use (for example as creams, ointments, gels, or aqueous or oily solutions or suspensions), for administration by inhalation (for example as a finely divided powder or a liquid aerosol), for administration by insufflation (for example as a finely divided powder) or for parenteral administration (for example as a sterile aqueous or oily solution for intravenous, subcutaneous, intramuscular, intraperitoneal or intramuscular dosing or as a suppository for rectal dosing).

[0200] The compositions of the invention may be obtained by conventional procedures using conventional pharmaceutical excipients, well known in the art. Thus, compositions intended for oral use may contain, for example, one or more colouring, sweetening, flavouring and / or preservative agents.

[0201] An effective amount of a compound of the present invention for use in therapy is an amount sufficient to treat or prevent a proliferative condition referred to herein, slow its progression and / or reduce the symptoms associated with the condition.

[0202] The amount of active ingredient that is combined with one or more excipients to produce a single dosage form will necessarily vary depending upon the individual treated and the particular route of administration. For Example, a formulation intended for oral administration to humans will generally contain, for example, from 0.5 mg to 0.5 g of active agent (more suitably from 0.5 to 100 mg, for example from 1 to 30 mg) compounded with an appropriate and convenient amount of excipients which may vary from about 5 to about 98 percent by weight of the total composition.

[0203] The size of the dose for therapeutic or prophylactic purposes of a compound of the formula I will naturally vary according to the nature and severity of the conditions, the age and sex of the animal or patient and the route of administration, according to well-known principles of medicine.

[0204] In using a compound of the invention for therapeutic or prophylactic purposes it will generally be administered so that a daily dose in the range, for example, 0.1 mg / kg to 75 mg / kg body weight is received, given if required in divided doses. In general lower doses will be administered when a parenteral route is employed. Thus, for example, for intravenous or intraperitoneal administration, a dose in the range, for example, 0.1 mg / kg to 30 mg / kg body weight will generally be used. Similarly, for administration by inhalation, a dose in the range, for example, 0.05 mg / kg to 25 mg / kg body weight will be used. Oral administration may also be suitable, particularly in tablet form. Typically, unit dosage forms will contain about 0.5 mg to 0.5 g of a compound of this invention. Therapeutic Uses and Applications

[0205] According to a further aspect of the present invention, there is provided a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, or a pharmaceutical composition as defined herein, for use in therapy.

[0206] According to a further aspect of the present invention, there is provided a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, or a pharmaceutical composition as defined herein, for use in the treatment of any of the diseases discussed herein.

[0207] The present invention provides compounds that function as MutSβ inhibitors. Thus, the compounds of the invention can be used to inhibit somatic expansion of simple nucleotide repeats associated with MutSβ activity. The compounds of the present invention therefore have particular application in treating, preventing, or delaying the onset of a repeat expansion disease or disorder in a subject.

[0208] MutSβ activity is implicated in the somatic instability of expanded simple nucleotide repeats, which leads to further expansion. The inhibition of MutSβ activity may therefore allow the treatment of diseases related to somatic expansion of expanded simple nucleotide repeats, such as repeat expansion diseases or disorders. Thus, by virtue of their activity against MutSβ, the compounds of the present invention may be used as an agent to inhibit somatic expansion in the treatment, prevention, or delaying of the onset of repeat expansion diseases or disorders.

[0209] In the present invention, it will be understood that reference to inhibition of somatic expansion encompasses reducing or preventing somatic instability of expandedsimple nucleotide repeats, and also encompasses the slowing or stopping of somatic expansion of expanded simple nucleotide repeats.

[0210] According to a further aspect of the present invention, there is provided a method of inhibiting MutSβ activity in vitro, ex vivo or in vivo, said method comprising contacting a cell with an effective amount of a compound or a pharmaceutically acceptable salt, hydrate or solvate thereof as defined herein. Suitably, the method comprises the selective inhibition of MutSβ activity in vitro, ex vivo or in vivo.

[0211] According to a further aspect of the present invention, there is provided a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein for use in the inhibition of MutSβ activity, e.g. in cellular systems. The inhibition may be the selective inhibition of MutSβ activity.

[0212] According to a further aspect of the present invention, there is provided a use of a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein in the manufacture of a medicament for the inhibition of MutSβ activity, e.g. in cellular systems.

[0213] According to a further aspect of the present invention, there is provided a method of inhibiting somatic expansion of expanded simple nucleotide repeats, said method comprising administering to said subject a therapeutically effective amount of a compound or a pharmaceutically acceptable salt, hydrate or solvate thereof as defined herein, or a pharmaceutical composition as defined herein. The method may be performed in a subject or in a cellular assay system.

[0214] According to a further aspect of the present invention, there is provided a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, or a pharmaceutical composition as defined herein for use in inhibiting somatic expansion of expanded simple nucleotide repeats in a subject (e.g. in the treatment of a repeat expansion disease or disorder).

[0215] According to a further aspect of the present invention, there is provide thed use of a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein in the manufacture of a medicament for inhibiting somatic expansion of expanded simple nucleotide repeats in a subject (e.g. in the treatment of a repeat expansion disease or disorder).

[0216] According to a further aspect of the present invention, there is provided the use of a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof in inhibiting somatic expansion of expanded simple nucleotide repeats in a cellular assay system.

[0217] According to a further aspect of the present invention, there is provided a method of treating a disease or condition in which MutSβ activity is implicated in a patient in need of such treatment, said method comprising administering to said patient a therapeutically effective amount of a compound or a pharmaceutically acceptable salt, hydrate or solvate thereof asdefined herein, or a pharmaceutical composition as defined herein.

[0218] According to a further aspect of the present invention, there is provided a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein for use in the treatment of a disease or condition in which MutSβ activity is implicated.

[0219] According to a further aspect of the present invention, there is provided a use of a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein in the manufacture of a medicament for the treatment of a disease or condition in which MutSβ activity is implicated.

[0220] The disease or condition in which MutSβ activity is implicated may be a disease related to somatic expansion of expanded simple nucleotide repeats, such as a repeat expansion disease or disorder.

[0221] According to a further aspect of the present invention, there is provided a method of treating a repeat expansion disease or disorder in a patient, said method comprising administering to said patient a therapeutically effective amount of a compound or a pharmaceutically acceptable salt, hydrate or solvate thereof as defined herein, or a pharmaceutical composition as defined herein.

[0222] According to a further aspect of the present invention, there is provided a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, or a pharmaceutical composition as defined herein for use in the treatment of a repeat expansion disease or disorder.

[0223] According to a further aspect of the present invention, there is provided the use of a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein in the manufacture of a medicament for the treatment of a repeat expansion disease or disorder.

[0224] Repeat expansion diseases (REDs) are caused by pathogenic expansions of simple nucleotide repeats within coding and non-coding regions of different genes. Repeat expansion diseases include but are not limited to: benign adult familial myoclonic epilepsy (BAFME); brachydactyly and cleidocranial dysplasia (BCCD); blepharophimosis, ptosis and epicanthus inversus (BPES); Baratela-Scott syndrome (BSS); cerebellar ataxia, neuropathy and vestibular areflexia syndrome (CANVAS); congenital central hypoventilation syndrome (CCHS); dentatorubropallidoluysian atrophy (DRPLA); early infantile epileptic encephalopathy type 1 (EIEE1); familial adult myoclonic epilepsy (FAME); Fuch’s endothelial corneal dystrophy type 3 (FECD3); Dentatorubral pallidoluysian atrophy; fragile XE syndrome (FRAXE); Friedreich ataxia (FRDA) frontotemporal dementia / amyotrophic lateral sclerosis (FTD / ALS); fragile X-associated premature ovarian infertility (FXPOI); fragile X syndrome (FXS); fragile X-associated tremor ataxia syndrome (FXTAS); global development delay, progressive ataxia and elevated glutamine (GDPAG); Huntington’s disease (HD); Huntingtondisease-like 2 (HDL2); hand-foot-genital syndrome (HFGS); holoprosencephaly type 5 (HPE5); mental retardation with isolated growth hormone deficiency (MRGH); myotonic dystrophy type 1 (DM1); myotonic dystrophy type 2 (DM2); progressive myoclonus epilepsy type 1 or Unverricht-Lundborg diseae (EPM1); neuronal intranuclear inclusion disease (NIID); oculopharyngodistal myopathy type 1 (OPDM1); oculopharyngodistal myopathy type 2 (OPDM2); oculopharyngeal myopathy with leukoencephalopathy type 1 (OPML1); spinobulbar muscular atrophy (SBMA); spinocerebellar ataxias type 1, 2, 3, 6, 7, 8, 10, 12, 17, 27B, 31, 36 and 37 (SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA10, SCA12, SCA17, SCA27B, SCA31, SCA36, SCA37); synpolydactyly (SPD); X-linked dystonia parkinsonism (XDP); X-linked mental retardation and abnormal genitalia (XLAG); and X-linked mental retardation with or without growth hormone deficiency (XLMR, XLMRGHD).

[0225] The repeat expansion disease or disorder may be a coding repeat expansion disease, such as brachydactyly and cleidocranial dysplasia (BCCD); blepharophimosis, ptosis and epicanthus inversus (BPES); cleidocranial dysplasia (CCD); congenital central hypoventilation syndrome (CCHS); dentatorubropallidoluysian atrophy (DRPLA); early infantile epileptic encephalopathy type 1 (EIEE1); Huntington’s disease (HD); Huntington disease-like 2 (HDL2); hand-foot-genital syndrome (HFGS); holoprosencephaly type 5 (HPE5); mental retardation with isolated growth hormone deficiency (MRGH); oculopharyngeal muscular dystrophy (OPMD); spinobulbar muscular atrophy (SBMA); spinocerebellar ataxias type 1, 2, 3, 6, 7 or 17 (SCA1, SCA2, SCA3, SCA6, SCA7, SCA17); synpolydactyly (SPD); X-linked mental retardation and abnormal genitalia (XLAG); X-linked mental retardation with or without growth hormone deficiency (XLMR, XLMRGHD).

[0226] The repeat expansion disease or disorder may be a non-coding repeat expansion disease, such as: benign adult familial myoclonic epilepsy (BAFME); Baratela-Scott syndrome (BSS); cerebellar ataxia, neuropathy and vestibular areflexia syndrome (CANVAS); myotonic dystrophy type 1 (DM1); myotonic dystrophy type 2 (DM2); progressive myoclonus epilepsy type 1 or Unverricht-Lundborg diseae (EPM1); familial adult myoclonic epilepsy (FAME); Fuch’s endothelial corneal dystrophy type 3 (FECD3); fragile XE syndrome (FRAXE); Friedreich ataxia (FRDA) frontotemporal dementia / amyotrophic lateral sclerosis (FTD / ALS); fragile X-associated premature ovarian infertility (FXPOI); fragile X syndrome (FXS); fragile X- associated tremor ataxia syndrome (FXTAS); global development delay, progressive ataxia and elevated glutamine (GDPAG); neuronal intranuclear inclusion disease (NIID); oculopharyngodistal myopathy type 1 (OPDM1); oculopharyngodistal myopathy type 2 (OPDM2); oculopharyngeal myopathy with leukoencephalopathy type 1 (OPML1), spinocerebellar ataxias types 8, 10, 12, 27B, 31, 36 and 37 (SCA8, SCA10, SCA12, SCA27B, SCA31, SCA36 or SCA37); X-linked dystonia parkinsonism (XDP).

[0227] In certain embodiments, the repeat expansion disease or disorder is a triplet repeatdisease or disorder, such as dentatorubropallidoluysian atrophy (DRPLA); Fuch’s endothelial corneal dystrophy type 3 (FECD3); fragile XE syndrome (FRAXE); Friedreich ataxia (FRDA); fragile X-associated premature ovarian infertility (FXPOI); fragile X syndrome (FXS); fragile X- associated tremor ataxia syndrome (FXTAS); Huntington’s disease (HD); Huntington disease- like 2 (HDL2); myotonic dystrophy type 1 (DM1); neuronal intranuclear inclusion disease (NIID); spinobulbar muscular atrophy (SBMA); spinocerebellar ataxias type 1, 2, 3, 6, 7, 8, 17, (SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA17); or X-linked dystonia parkinsonism (XDP). Suitably, the triplet repeat disease or disorder is Huntington’s disease (HD).

[0228] According to a further aspect of the present invention, there is provided a method of treating a triplet repeat disease or disorder in a patient, said method comprising administering to said patient a therapeutically effective amount of a compound or a pharmaceutically acceptable salt, hydrate or solvate thereof as defined herein, or a pharmaceutical composition as defined herein.

[0229] According to a further aspect of the present invention, there is provided a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, or a pharmaceutical composition as defined herein for use in the treatment of a triplet repeat disease or disorder.

[0230] According to a further aspect of the present invention, there is provided the use of a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein in the manufacture of a medicament for the treatment of a triplet repeat disease or disorder.

[0231] According to a further aspect of the present invention, there is provided a method of treating Huntington’s disease in a patient, said method comprising administering to said patient a therapeutically effective amount of a compound or a pharmaceutically acceptable salt, hydrate or solvate thereof as defined herein, or a pharmaceutical composition as defined herein.

[0232] According to a further aspect of the present invention, there is provided a compound or a pharmaceutically acceptable salt, hydrate or solvate thereof as defined herein, or a pharmaceutical composition as defined herein, for use in the treatment of Huntington’s disease.

[0233] According to a further aspect of the present invention, there is provided the use of a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein in the manufacture of a medicament for the treatment of Huntington’s disease.

[0234] Suitably, the inhibition of somatic expansion of expanded simple nucleotide repeats allows the treatment of a repeat expansion disease or disorder in a subject who has already developed the disorder. The inhibition of somatic expansion of expanded simple nucleotide repeats may also be performed to prevent or slow the development of the disorder, for example in a patient who is carrying a disease allele for a repeat expansion disease or disorder. For example, the patient may have had a diagnostic test to say they are a repeatexpansion disease or disorder gene carrier (for example, a Huntington Disease gene carrier), but who have not yet exhibited any signs or symptoms.

[0235] According to a further aspect of the present invention, there is provided a method for the inhibition of somatic expansion of expanded simple nucleotide repeats in a subject carrying a disease allele for a repeat expansion disease or disorder, said method comprising administering to said subject a therapeutically effective amount of a compound or a pharmaceutically acceptable salt, hydrate or solvate thereof as defined herein, or a pharmaceutical composition as defined herein.

[0236] According to a further aspect of the present invention, there is provided a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, or a pharmaceutical composition as defined herein for use in the inhibition of somatic expansion of expanded simple nucleotide repeats in a subject carrying a disease allele for a repeat expansion disease or disorder.

[0237] According to a further aspect of the present invention, there is provided the use of a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein in the manufacture of a medicament for the inhibition of somatic expansion of expanded simple nucleotide repeats in a subject carrying a disease allele for a repeat expansion disease or disorder.

[0238] The patient or subject to be treated is suitably a mammal, and more suitably a human. Routes of Administration

[0239] The compounds of the invention or pharmaceutical compositions comprising these compounds may be administered to a subject by any convenient route of administration, whether systemically / peripherally or topically (i.e., at the site of desired action).

[0240] Routes of administration include, but are not limited to, oral (e.g, by ingestion); buccal; sublingual; transdermal (including, e.g., by a patch, plaster, etc.); transmucosal (including, e.g., by a patch, plaster, etc.); intranasal (e.g., by nasal spray); ocular (e.g., by eye drops); pulmonary (e.g., by inhalation or insufflation therapy using, e.g., via an aerosol, e.g., through the mouth or nose); rectal (e.g., by suppository or enema); vaginal (e.g., by pessary); parenteral, for example, by injection, including subcutaneous, intradermal, intramuscular, intravenous, intra-arterial, intracardiac, intrathecal, intraspinal, intracapsular, subcapsular, intraorbital, intraperitoneal, intratracheal, subcuticular, intraarticular, subarachnoid, and intrasternal; by implant of a depot or reservoir, for example, subcutaneously or intramuscularly. Gene Editing

[0241] The compounds of the present invention may also find use in gene editing applications. In particular, the compounds are potentially useful for increasing the efficiency of gene editing techniques, especially gene editing techniques that are susceptibe to reduced efficiency due to host cell MMR factors.

[0242] It will be appreciated that the gene editing techniques defined herein may be carried in vivo, ex vivo or in vitro.

[0243] According to a further aspect of the present invention, there is provided a method of increasing the efficiency of a gene editing technique, the method comprising conducting the gene editing technique in the presence of a compound as defined herein, or a pharmaceutically acceptable salt, hydrate or solvate thereof. The efficiency of the gene editing technique may be increased by reducing the error rate.

[0244] According to a further aspect of the present invention, there is also provided a method of reducing the error rate of a gene editing technique, the method comprising conducting the gene editing technique in the presence of a compound as defined herein, or a pharmaceutically acceptable salt, hydrate or solvate thereof.

[0245] Suitably, the gene editing technique referred to herein may be any suitable gene editing technique in which host cell mis-match repair (MMR) factors are known to decrease the efficiency of the gene editing. Suitable gene editing techniques include homology-directed repair (HDR), non-homologous end joining (NHEJ), ZFN (zinc finger nucleases), TALENs (Transcription activator like effector nucleases), CRISPR-Cas9 nucleases, CRISPR-Cas12 nucleases, base editing (fusion of catalytically dead dCas9 enzymes to DNA deaminases which enable single nucleotide substitutions), prime editing (fusion of a Cas9 nickase to a reverse transcriptase), PASTE (programmable addition via site-specific targeting elements which leverages prime editing to insert AttB sites and then facilitate serine integrase proteins to insert larger sequences), or any editing method using a single-stranded oligonucleotide (ssODN) as a template including nuclease-free editing methods.

[0246] According to a further aspect of the present invention, there is provided a method of prime editing, the method comprising contacting a cell with: (1) a Cas9 nickase to nick a non- target strand; (2) a prime editing single guide RNA (pegRNA) to bind the target strand; (3) a reverse transcriptase to reverse transcribe from the 3’ end of the non-target strand according to the information provided by the pegRNA; and (4) a compound as defined herein, or a pharmaceutically acceptable salt, hydrate or solvate thereof.

[0247] According to a further aspect of the present invention, there is provided the use of a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein for gene editing in vitro, ex vivo or in vivo.

[0248] According to a further aspect of the present invention, there is provided a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein for use in gene editing in vitro, ex vivo or in vivo.

[0249] According to a further aspect of the present invention, there is provided a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein, or a pharmaceutical composition as defined herein, for use in prime editing. According to a furtheraspect of the present invention, there is provided a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein, or a pharmaceutical composition as defined herein, for use in enhancing the efficiency of prime editing. Suitably, the compound of the invention or a pharmaceutically acceptable salt, hydrate or solvate thereof, is administered in combination with: (1) a Cas9 nickase to nick a non-target strand; (2) a prime editing single guide RNA (pegRNA) to bind the target strand; (3) a reverse transcriptase to reverse transcribe from the 3’ end of the non-target strand according to the information provided by the pegRNA.

[0250] According to a further aspect of the present invention, there is provided the use a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein, for prime editing. According to a further aspect of the present invention, there is provided the use of a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein, or a pharmaceutical composition as defined herein, for enhancing the efficiency of prime editing. Suitably, the compound of the invention or a pharmaceutically acceptable salt, hydrate or solvate thereof, is administered in combination with: (1) a Cas9 nickase to nick a non-target strand; (2) a prime editing single guide RNA (pegRNA) to bind the target strand; (3) a reverse transcriptase to reverse transcribe from the 3’ end of the non-target strand according to the information provided by the pegRNA.

[0251] According to a further aspect of the present invention, there is provided a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein for use as an agent to enhance the efficiency of prime editors.

[0252] According to a further aspect of the present invention, there is provided the use of a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein as an agent to enhance the efficiency of prime editors.

[0253] According to a further aspect of the present invention, there is provided a method to enhance the efficiency of prime editors, the method comprising contacting a cell with a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein, or a pharmaceutical composition as defined herein, and conducting the gene editing in the presence of said compound.

[0254] According to a further aspect of the present invention, there is provided a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein for use as an agent to reduce off-target editing (errors) in prime editing.

[0255] According to a further aspect of the present invention, there is provided the use of a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein as an agent to reduce off-target editing (errors) in prime editing. Suitably, the use is in cellular systems.

[0256] According to a further aspect of the present invention, there is provided a method toenhance efficiency and reduce off-target editing (errors) in gene editing (e.g. prime editing), the method comprising contacting a cell with a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein, or a pharmaceutical composition as defined herein, and conducting the gene editing in the presence of said compound.

[0257] According to a further aspect of the present invention, there is provided a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein for use as an agent to both enhance efficiency and reduce off-target editing (errors) in gene editing (e.g. prime editing).

[0258] According to a further aspect of the present invention, there is provided the use of a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein as an agent to both enhance efficiency and reduce off-target editing (errors) in gene editing (e.g. prime editing). Suitably, the use is in cellular systems.

[0259] According to a further aspect of the present invention, there is provided a method to enhance the efficiency of prime editor therapeutics in vivo or ex vivo (e.g. allogeneic editing of hematopoietic cells), the method comprising contacting a cell with a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein, or a pharmaceutical composition as defined herein, and conducting the gene editing in the presence of said compound.

[0260] According to a further aspect of the present invention, there is provided a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein for use as an agent to enhance the efficiency of prime editor therapeutics ex vivo (e.g. allogeneic editing of hematopoietic cells).

[0261] According to a further aspect of the present invention, there is provided the use of a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein as an agent to enhance the efficiency of prime editor therapeutics ex vivo (e.g. allogeneic editing of hematopoietic cells).

[0262] According to a further aspect of the present invention, there is provided a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein for use as an agent to enhance the efficiency of prime editor therapeutics in vivo.

[0263] In certain embodiments, the gene is in a cell, e.g. a mammalian cell, e.g. a human cell.

[0264] In certain embodiments, the cell is in a subject or patient, e.g. the subject is human.

[0265] In certain embodiments, the cell is present in vitro, ex vivo or in vivo.

[0266] In certain embodiments, the cell is in a cellular assay.

[0267] According to a further aspect of the present invention, there is provided the use of a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein as an agent to inhibit mismatch repair in vitro, ex vivo or in vivo, for example in cellularsystems.

[0268] According to a further aspect of the present invention, there is provided the use of a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein in testing an agent for the ability to inhibit ATP hydrolysis by MutSβ in the presence or absence of a suitable heteroduplex DNA substrate.

[0269] According to a further aspect of the present invention, there is provided the use of a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein, in testing an agent for the ability to inhibit ATP-dependent recruitment of MutLα or MutLβ or MutLγ by MutSβ. Combination Therapies

[0270] The present invention provides methods for the treatment of certain diseases or disorders through the inhibition of MutSβ with a compound as defined herein. The compounds as defined herein may be administered either as single agents or in combination with one or more additional agents.

[0271] The compounds as defined herein may be administered either as single agents or in combination with one or more disease modification therapies for Huntington’s Disease. Suitable disease modification therapies for Huntington’s disease include, but are not limited to RNA interference approaches (such as tominersen, WVE-03, AMT-130, BV-101, VO-659, SPK-miHTT), mis-splicing (PTC-518) and antibody therapeutics (INT-41, NI-302, C6-17, Vtx- 003).

[0272] The compounds as defined herein may be administered either as single agents or in combination with one or more Huntingtin lowering therapies. Huntingtin lowering therapies may include approaches such as RNAi, miRNA (such as AMT-130), antisense oligonucleotides (such as tominersen), and small-molecule splicing modulators (such as PTC- 518); and novel methods to clear the mHTT protein, such as proteolysis-targeting chimeras.

[0273] The present invention also provides methods for the treatment of repeat expansion diseases or disorders through the inhibition of MutSβ with a compound as defined herein. The compounds as defined herein may be administered either as single agents or in combination with one or more Huntingtin lowering therapies.

[0274] Thus, there is provided a combination comprising a compound or a pharmaceutically acceptable salt, hydrate or solvate thereof as defined herein, and one or more Huntingtin lowering therapies.

[0275] According to a further aspect of the present invention, there is provided a method of treating a repeat expansion disease or disorder in a patient, said method comprising administering to said patient a therapeutically effective amount of a compound or a pharmaceutically acceptable salt, hydrate or solvate thereof as defined herein, or a pharmaceutical composition as defined herein, and one or more Huntingtin lowering therapies.

[0276] According to a further aspect of the present invention, there is provided a compound or a pharmaceutically acceptable salt, hydrate or solvate thereof as defined herein, or a pharmaceutical composition as defined herein, for use in the treatment of a repeat expansion disease or disorder, wherein the compound or pharmaceutical composition is administered in combination with one or more Huntingtin lowering therapies.

[0277] According to a further aspect of the present invention, there is provided the use of a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein in the manufacture of a medicament for the treatment of a repeat expansion disease or disorder, wherein the compound or pharmaceutical composition is administered in combination with one or more Huntingtin lowering therapies.

[0278] The repeat expansion disease or disorder may be selected from any of those described herein, e.g. a triplet repeat disease or disorder.

[0279] Suitably, the triplet repeat disease or disorder is Huntington’s disease (HD).

[0280] Thus, there is provided a combination comprising a compound or a pharmaceutically acceptable salt, hydrate or solvate thereof as defined herein, and one or more disease modification therapies for Huntington’s Disease. Suitable disease modification therapies for Huntington’s disease include, but are not limited to RNA interference approaches (such as tominersen, WVE-03, AMT-130, BV-101, VO-659, SPK-miHTT), mis-splicing (PTC-518) and antibody therapeutics (INT-41, NI-302, C6-17, Vtx-003).

[0281] According to a further aspect of the present invention, there is provided a method of treating Huntington’s disease in a patient, said method comprising administering to said patient a therapeutically effective amount of a compound or a pharmaceutically acceptable salt, hydrate or solvate thereof as defined herein, or a pharmaceutical composition as defined herein, and one or more disease modification therapies for Huntington’s disease.

[0282] According to a further aspect of the present invention, there is provided a compound or a pharmaceutically acceptable salt, hydrate or solvate thereof as defined herein, or a pharmaceutical composition as defined herein, for use in the treatment of Huntington’s disease, wherein the compound or pharmaceutical composition is administered in combination with one or more disease modification therapies for Huntington’s disease.

[0283] According to a further aspect of the present invention, there is provided the use of a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein in the manufacture of a medicament for the treatment of Huntington’s disease, wherein the compound or pharmaceutical composition is administered in combination with one or more disease modification therapies for Huntington’s disease.

[0284] The compounds as defined herein may be administered either as single agents or in combination with one or more Huntingtin lowering therapies, particularly in the treatment of Huntington’s disease. Huntingtin lowering therapies may include approaches such as RNAi,miRNA (such as AMT-130), antisense oligonucleotides (such as tominersen), and small- molecule splicing modulators (such as PTC-518); and methods to clear the mHTT protein, such as proteolysis-targeting chimeras.

[0285] According to a further aspect of the present invention, there is provided a method of treating Huntington’s disease in a patient, said method comprising administering to said patient a therapeutically effective amount of a compound or a pharmaceutically acceptable salt, hydrate or solvate thereof as defined herein, or a pharmaceutical composition as defined herein, and one or more Huntingtin lowering therapies.

[0286] According to a further aspect of the present invention, there is provided a compound or a pharmaceutically acceptable salt, hydrate or solvate thereof as defined herein, or a pharmaceutical composition as defined herein, for use in the treatment of Huntington’s disease, wherein the compound or pharmaceutical composition is administered in combination with one or more Huntingtin lowering therapies.

[0287] According to a further aspect of the present invention, there is provided the use of a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, as defined herein in the manufacture of a medicament for the treatment of Huntington’s disease, wherein the compound or pharmaceutical composition is administered in combination with one or more Huntingtin lowering therapies.

[0288] Herein, where the term “combination” is used it is to be understood that this refers to simultaneous, separate or sequential administration. In one aspect of the invention “combination” refers to simultaneous administration. In another aspect of the invention “combination” refers to separate administration. In a further aspect of the invention “combination” refers to sequential administration. Where the administration is sequential or separate, the delay in administering the second component should not be such as to lose the beneficial effect of the combination.

[0289] According to a further aspect of the invention there is provided a pharmaceutical composition which comprises a compound of the invention, or a pharmaceutically acceptable salt, hydrate or solvate thereof, in combination with an anti-tumour agent (optionally selected from one listed herein above), in association with a pharmaceutically acceptable diluent or carrier. Description of the Drawing

[0290] Embodiments of the invention will be described, by way of example only, with reference to the accompanying drawings, which are described below: Figure 1 shows details of the Lo-Q assay described in Biological Example B.Numbered Paragraphs The following paragraphs are not claims, but serve to define particular aspects and embodiments of the present invention. Paragraph 1. A compound, or a pharmaceutically acceptable salt thereof, having the structural formula (I) shown below:wherein: R1and R2are each independently selected from hydrogen, (1-6C)alkyl, -[CH2]n-(3- 6C)cycloalkyl, -[CH2]n-aryl, -[CH2]n-heterocyclyl, or -[CH2]n-heteroaryl, wherein: integer n is 0, 1, 2, 3 or 4; and any alkyl, cycloalkyl, aryl, heteroaryl or heterocyclyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, amino, (1-3C)alkyl, (1-3C)alkoxy, (1-3C)haloalkyl, (1- 3C)haloalkoxy, (1-3C)alkylamino or di-[(1-3C)alkyl]amino; or R1and R2are linked such that, together with the nitrogen atom to which they are attached, they form a 4-7-membered heterocyclic ring which optionally comprises one or two additional heteroatoms selected from N, O or S; and wherein the heterocyclic ring is optionally substituted by one or more substituents independently selected from halo, cyano, (1-6C)alkyl, -[CH2]p-(3- 6C)cycloalkyl, -[CH2]p-heterocyclyl, -[CH2]p-aryl or -[CH2]p-heteroaryl; wherein: integer p is 0, 1, 2, 3, 4, 5 or 6; and any alkyl, cycloalkyl, aryl, heteroaryl or heterocyclyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, amino, (1-3C)alkyl, (1-3C)alkoxy, (1-3C)haloalkyl, (1-3C)haloalkoxy, (1-3C)alkylamino or di-[(1-3C)alkyl]amino; Rnis selected from hydrogen, (1-3C)alkyl, -[CH2]q-(3-5C)cycloalkyl, wherein: integer q is 0, 1 or 2; and an alkyl is optionally substituted by hydroxy, (1-2C)alkoxy or NRn1Rn2, and a cycloalkyl group is optionally substituted by (1-2C)alkyl, hydroxy, (1-2C)alkoxy or NRn1Rn2; wherein Rn1and Rn2are each independently selected from hydrogen or (1-2C)alkyl R3is selected from hydrogen or a group: -LB-XB-QBwherein: LBis absent or (1-2C)alkylene; XBis absent or is selected from the group consisting of -O-, -C(O)-, -C(O)-O-, -O-C(O)-, -C(O)-N(R100c)-, -N(R100c)-C(O)-, -NR100c-, -N(R100c)-C(O)-O- or -O- C(O)-N(R100c)-, wherein R100cand R100dare each independently selected from hydrogen or (1-2C)alkyl; and QBis selected from the group consisting of hydrogen, (1-6C)alkyl, -[CH2]r-(3- 6C)cycloalkyl, -[CH2]r-[4-7-membered heterocyclyl], -[CH2]r-phenyl or -[CH2]r- [5- or 6-membered heteroaryl]; wherein: integer r is 0, 1 or 2; and any alkyl, cycloalkyl, aryl, heteroaryl or heterocyclyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, (1-3C)alkyl, (1-3C)alkoxy, (1- 3C)haloalkyl, (1-3C)haloalkoxy, -[CH2]s-NRqa1Rqa2where Rqa1 and Rqa2are each independently selected from hydrogen or (1-2C)alkyl and integer s is 0, 1 or 2; integer a is 1, 2 or 3; R4and R5are each independently selected from hydrogen or methyl, or R4and R5are linked to form a -CH2-CH2- group; X is absent or is selected from -O-, -C(O)-, -S(O)0-2-, -C(O)-N(R100e)-, -N(R100e)-C(O)- or -NR100e-, wherein R100eis selected from hydrogen or methyl; Q is selected from phenyl, naphthyl or heteroaryl, wherein Q is optionally substituted by one or more substituents RQ, wherein each RQis independently selected from: halo,hydroxy, cyano, (1-6C)alkyl, (1-6C)alkoxy, (1-6C)haloalkyl, (1-6C)haloalkoxy, -[CH2]t- NRq1Rq2where Rq1and Rq2are each independently selected from hydrogen or (1- 2C)alkyl and integer t is 0, 1 or 2. Paragraph 2. A compound according to paragraph 1, or a pharmaceutically acceptable salt thereof, wherein R1is selected from hydrogen, (1-6C)alkyl, -[CH2]n-(3-6C)cycloalkyl, - [CH2]n-phenyl, -[CH2]n-[4-7 membered heterocyclyl], or -[CH2]n-[5-6 membered heteroaryl], wherein: integer n is 0, 1, 2 or 3; and any alkyl, cycloalkyl, aryl, heteroaryl or heterocyclyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, amino, (1-2C)alkyl, (1-2C)alkoxy, (1-2C)haloalkyl, (1- 2C)haloalkoxy, (1-2C)alkylamino or di-[(1-2C)alkyl]amino; and R2is hydrogen or (1-4C)alkyl; or R1and R2are linked such that, together with the nitrogen atom to which they are attached, they form a 4-7-membered heterocyclic ring which optionally comprises one or two additional heteroatoms selected from N, O or S, and wherein the heterocyclic ring is optionally substituted by one or more substituents independently selected from halo, cyano, (1-6C)alkyl, -[CH2]p-(3-6C)cycloalkyl, -[CH2]p-[4-7 membered heterocyclyl], -[CH2]p-phenyl or -[CH2]p-[5-6 membered heteroaryl]; wherein integer p is 0, 1, 2, 3 or 4; and any alkyl, cycloalkyl, aryl, heteroaryl or heterocyclyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, amino, (1-2C)alkyl, (1-2C)alkoxy, (1-2C)haloalkyl, (1- 2C)haloalkoxy, (1-2C)alkylamino or di-[(1-2C)alkyl]amino; optionally wherein R1is selected from hydrogen, (1-6C)alkyl, -[CH2]n-(3-6C)cycloalkyl, -[CH2]n- phenyl, -[CH2]n-[4-7 membered N-linked heterocyclyl], or -[CH2]n-[5-6 membered heteroaryl], wherein: integer n is 0, 1 or 2; and any alkyl, cycloalkyl, phenyl, heteroaryl or heterocyclyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, amino, (1-2C)alkyl, (1-2C)alkoxy, (1-2C)haloalkyl or (1- 2C)haloalkoxy;with the proviso that n is not 0 if R1is -[CH2]n-[4-7 membered N-linked heterocyclyl; and R2is hydrogen or (1-2C)alkyl; or R1and R2are linked such that, together with the nitrogen atom to which they are attached, they form a 4-7-membered heterocyclic ring which optionally comprises one or two additional heteroatoms selected from N, O or S, and wherein the heterocyclic ring is optionally substituted by one or more substituents independently selected from halo, cyano or (1-4C)alkyl, wherein the alkyl is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, amino, (1- 2C)alkoxy, (1-2C)haloalkoxy, (1-2C)alkylamino or di-[(1-2C)alkyl]amino; further optionally wherein R1is selected from hydrogen, (1-6C)alkyl, -[CH2]n-(3-6C)cycloalkyl or -[CH2]n-phenyl; wherein: integer n is 0, 1 or 2; and any alkyl, cycloalkyl or phenyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, amino, (1-2C)alkyl, (1-2C)alkoxy, (1-2C)haloalkyl or (1-2C)haloalkoxy; and R2is hydrogen or (1-2C)alkyl; or R1and R2are linked such that, together with the nitrogen atom to which they are attached, they form a 4-7-membered heterocyclic ring which optionally comprises one or two additional heteroatoms selected from N, O or S, and wherein the heterocyclic ring is optionally substituted by one or more substituents independently selected from halo, cyano or (1-4C)alkyl, wherein the alkyl is optionally further substituted with one or more substituents independently selected from halo, hydroxy, cyano, amino, (1- 2C)alkoxy, (1-2C)haloalkoxy, (1-2C)alkylamino or di-[(1-2C)alkyl]amino. Paragraph 3. A compound according to any one of the preceding paragraphs, or a pharmaceutically acceptable salt thereof, wherein R1is selected from hydrogen, (1- 6C)alkyl, -[CH2]n-(3-6C)cycloalkyl or -[CH2]n-phenyl; wherein: integer n is 0, 1 or 2; andany alkyl, cycloalkyl or phenyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, amino, (1-2C)alkyl, (1-2C)alkoxy, (1-2C)haloalkyl or (1-2C)haloalkoxy; and R2is hydrogen or methyl; or R1and R2are linked such that, together with the nitrogen atom to which they are attached, they form a 4-7-membered heterocyclic ring which optionally comprises one or two additional heteroatoms selected from N or O, and wherein the heterocyclic ring is optionally substituted by one or more substituents independently selected from halo, cyano, hydroxy or methoxy; optionally wherein R1is selected from hydrogen, (1-6C)alkyl, -[CH2]n-(3-6C)cycloalkyl, phenyl or benzyl; wherein: integer n is 0 or 1; and any alkyl, cycloalkyl or phenyl group is optionally further substituted with one or more substituents independently selected from: halo, cyano, hydroxy or methoxy; and R2is hydrogen or methyl; or R1and R2are linked such that, together with the nitrogen atom to which they are attached, they form a 4-7-membered heterocyclic ring which optionally comprises one or two additional heteroatoms selected from N or O, and wherein the heterocyclic ring is optionally substituted by one or more substituents independently selected from halo, cyano, hydroxy or methoxy. Paragraph 4. A compound according to any one of the preceding paragraphs, or a pharmaceutically acceptable salt thereof, wherein Rn is selected from hydrogen, (1- 3C)alkyl, -[CH2]q-(3-5C)cycloalkyl, wherein: q is 0 or 1; and (1-3C)alkyl is optionally substituted by hydroxy, methoxy, NH2or NMe2, and cycloalkyl group is optionally substituted by methyl, hydroxy, methoxy, NH2or NMe2; optionally wherein Rnis selected from hydrogen or (1-3C)alkyl optionally substituted by hydroxy, methoxy, NH2or NMe2; further optionally wherein Rnis selected from hydrogen or methyl; preferably methyl.Paragraph 5. A compound according to any one of the preceding paragraphs, or a pharmaceutically acceptable salt thereof, wherein R3is selected from hydrogen or a group: -LB-XB-QBwherein: LBis absent or (1-2C)alkylene; XBis absent or is selected from the group consisting of -O-, -C(O)-, -C(O)-O-, -O-C(O)-, -C(O)-N(R100c)-, -N(R100c)-C(O)-, -NR100c-, -N(R100c)-C(O)-O- or -O- C(O)-N(R100c)--, wherein R100cand R100dare each independently selected from hydrogen or methyl; and QBis selected from the group consisting of hydrogen, (1-6C)alkyl, -[CH2]r-(3- 6C)cycloalkyl, -[CH2]r-[4-7-membered heterocyclyl], -[CH2]r-phenyl or -[CH2]r- [5- or 6-membered heteroaryl]; wherein: integer r is 0 or 1; and any alkyl, cycloalkyl, phenyl, heteroaryl or heterocyclyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, (1-3C)alkyl, (1- 3C)alkoxy, (1-3C)haloalkyl, (1-3C)haloalkoxy or NRqa1Rqa2where Rqa1 and Rqa2are each independently selected from hydrogen or methyl; optionally wherein R3is selected from hydrogen or a group: -LB-XB-QBwherein: LBis absent or (1-2C)alkylene; XBis absent or is selected from the group consisting of -O-, -C(O)-, -O-C(O)-, - C(O)-N(R100c)-, -N(R100c)-C(O)-, -NR100c- or -O-C(O)-N(R100c)-, wherein R100cand R100dare each independently selected from hydrogen or methyl; and QBis selected from the group consisting of hydrogen, (1-6C)alkyl, -[CH2]r-(3- 6C)cycloalkyl, -[CH2]r-[5-6-membered heterocyclyl], -[CH2]r-phenyl or -[CH2]r- [5- or 6-membered heteroaryl]; wherein: integer r is 0 or 1; andany alkyl, cycloalkyl, phenyl, heteroaryl or heterocyclyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, (1-2C)alkyl, (1- 2C)alkoxy, (1-2C)haloalkyl, (1-2C)haloalkoxy or NRqa1Rqa2where Rqa1and Rqa2are each independently selected from hydrogen or methyl; further optionally wherein R3is selected from hydrogen or a group: -LB-XB-QBwherein: LBis absent or (1-2C)alkylene; XBis absent or is selected from the group consisting of -O-, -C(O)-, -O-C(O)-, - NR100c- or -O-C(O)-N(R100c)-, wherein R100cand R100dare each independently selected from hydrogen or methyl; and QBis selected from the group consisting of hydrogen, (1-6C)alkyl, -[CH2]r-(3- 6C)cycloalkyl, -[CH2]r-[5-6-membered heterocyclyl] or -[CH2]r-phenyl], wherein integer r is 0 or 1; and any alkyl, cycloalkyl or phenyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, (1- 2C)alkyl, (1-2C)alkoxy, (1-2C)haloalkyl, (1-2C)haloalkoxy or NRqa1Rqa2where Rqa1 and Rqa2are each independently selected from hydrogen or methyl; further optionally wherein R3is selected from hydrogen or a group: -LB-XB-QBwherein: XBis absent or is selected from the group consisting of -O-, -C(O)-, -NR100c- or -O-C(O)-N(R100c)-, wherein R100cand R100dare each independently selected from hydrogen or methyl; and QBis selected from the group consisting of hydrogen, (1-6C)alkyl, -[CH2]r-(3- 6C)cycloalkyl, -[CH2]r-[5-6-membered heterocyclyl], or -[CH2]r-phenyl], wherein integer r is 0 or 1; and any alkyl, cycloalkyl or heterocyclyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, (1-2C)alkyl, (1-2C)alkoxy, (1-2C)haloalkyl, (1-2C)haloalkoxy or NRqa1Rqa2where Rqa1and Rqa2are each independently selected from hydrogen or methyl.Paragraph 6. A compound according to any one of the preceding paragraphs, or a pharmaceutically acceptable salt thereof, wherein R3is selected from hydrogen or a group: -XB-QBwherein: XBis absent or is selected from the group consisting of -O- or -NR100c- wherein R100cis selected from hydrogen or methyl; and QBis selected from the group consisting of (1-6C)alkyl, (3-6C)cycloalkyl or phenyl, wherein any alkyl, cycloalkyl or phenyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, methyl, or methoxy; optionally wherein R3is selected from (1-4C)alkyl, (1-4C)alkoxy, (1-4C)haloalkyl, (1- 4C)haloalkoxy, (3-6C)cycloalkyl or phenyl; further optionally wherein R3is selected from (1-3C)alkyl, CF3or cyclopropyl; preferably R3is methyl. Paragraph 7. A compound according to any one of the preceding paragraphs, or a pharmaceutically acceptable salt thereof, wherein integer a is 0, 1 or 2; and / or each occurrence of R4and R5is each independently selected from hydrogen or methyl; optionally wherein each occurrence of R4and R5is hydrogen. Paragraph 8. A compound according to any one of paragraphs 1 to 4 wherein a is 1, and R3and R4are linked such that, together with the carbon atoms to which they are attached, they form a fused 5-6 membered carbocycle or 5-6 membered heterocyclyl, wherein the fused 5-6 membered carbocycle or 5-6 membered heterocyclyl is optionally substituted by one or more substituents independently selected from halo, methyl, halomethyl, methoxy, halomethyl or halomethoxy; and R5is selected from hydrogen or methyl; optionally wherein a is 1, and R3and R4are linked such that, together with the carbon atoms to which they are attached, they form a fused 6-membered carbocycle or 6-membered heterocyclyl, wherein the fused 6-membered carbocycle or 6-membered heterocyclyl is optionally substituted by one or more substituents independently selected from halo, methyl, halomethyl, methoxy or halomethoxy; and R5is selected from hydrogen or methyl; further optionally wherein a is 1, and R3and R4are linked such that, together with the carbon atoms to which they are attached, they form a fused 6-membered carbocyclewhich is optionally substituted by one or more substituents independently selected from halo, methyl or fluoromethyl (e.g. CH2F, CHF2or CF3); and R5is hydrogen. Paragraph 9. A compound according to any one of the preceding paragraphs, or a pharmaceutically acceptable salt thereof, wherein X is absent or is selected from -O-, - S(O)0-2- or -NR100e-, wherein R100eis selected from hydrogen or methyl; optionally wherein X is absent or is -O-. Paragraph 10. A compound according to any one of the preceding paragraphs, or a pharmaceutically acceptable salt thereof, wherein Q is selected from phenyl, naphthyl or 5- to 10 membered heteroaryl, wherein Q is optionally substituted by one or more substituents RQ, wherein each RQ is independently selected from: halo, hydroxy, cyano, (1-4C)alkyl, (1-4C)alkoxy, (1-4C)haloalkyl or (1-4C)haloalkoxy; optionally wherein Q is selected from phenyl, naphthyl or 5- or 6-membered heteroaryl, wherein Q is optionally substituted by one or more substituents RQ, wherein each RQ is independently selected from: halo, hydroxy, cyano, (1-3C)alkyl, (1-3C)alkoxy, (1- 3C)haloalkyl or (1-3C)haloalkoxy; further optionally wherein Q is selected from phenyl or naphthyl, wherein Q is optionally substituted by one or more substituents RQ, wherein each each RQ is independently selected from: halo (e.g. fluoro, chloro or bromo), (1-2C)alkyl, methoxy or trifluoromethyl; and / or if Q is phenyl or 6-membered heteroaryl, then it is optionally substituted at the meta and / or para position by one or more substituents RQ, wherein each RQ is independently as defined in any one of the preceding paragraphs. Paragraph 11. A compound according to any one of the preceding paragraphs, or a pharmaceutically acceptable salt thereof, wherein the compound has a structural formula (II), (III), (IV), (V), (VI) (VIa) or (VIb) shown below:wherein: R1, R2, Rn, R3, R4, R5, a, RQand Q are as defined in any one of the preceding paragraphs; qa is is selected from 0, 1, 2 or 3; Ring A is a 5-6 membered fused carbocyclic or 5-6 membered heterocycle, which is optionally substituted by one or more substituents independently selected from halo, (1- 2C)alkyl, (1-2C)haloalkyl, (1-2C)alkoxy or (1-2C)haloalkoxy; or a pharmaceutically acceptable salt thereof; nn is an integer selected from 0, 1, 2 or 3; and each occurrence of RA is independently selected from halo, (1-2C)alkyl, (1-2C)haloalkyl, (1-2C)alkoxy or (1-2C)haloalkoxy. Paragraph 12. A compound, or a pharmaceutically acceptable salt thereof, selected from any one of the following: 2-((5-(3-bromobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((4-methyl-5-(2-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3,4-dichlorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(2-chlorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((4-ethyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chlorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((4-methyl-5-(3-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate;2-((5-(3-fluorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(4-chlorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((4-methyl-5-(4-(trifluoromethyl)benzyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(4-isopropylbenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chloro-2-fluorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chloro-5-fluorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(5-chloro-2-fluorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chloro-4-fluorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chlorobenzyl)-4-methylthiazol-2-yl)(methyl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chlorobenzyl)-4-methylthiazol-2-yl)(ethyl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3,4-dichlorobenzyl)-4-methylthiazol-2-yl)(methyl)amino)-2-oxoethyl methylsulfamate; 2-((4-methyl-5-(naphthalen-2-ylmethyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3,4-difluorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(4-methoxybenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((4-cyclopropyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((4-isopropyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(4-chlorophenethyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((4-methyl-5-(4-(trifluoromethyl)benzyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((4-methyl-5-(naphthalen-1-ylmethyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(4-fluorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl dimethylsulfamate; 2-((4-methyl-5-(3-(trifluoromethyl)benzyl)thiazol-2-yl)amino)-2-oxoethyl dimethylsulfamate; 2-((5-(2-fluorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl dimethylsulfamate; 2-((5-benzyl-4-methylthiazol-2-yl)amino)-2-oxoethyl dimethylsulfamate; 2-((4-methyl-5-phenethylthiazol-2-yl)amino)-2-oxoethyl dimethylsulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl sulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl ethylsulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl isobutylsulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl isopropylsulfamate; 2-((5-(3-chlorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl ethylsulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl cyclopropylsulfamate; 2-((5-(3-chlorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl (2-methoxyethyl)sulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl propylsulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl tert-butylsulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl benzylsulfamate; 2-((5-(3-chlorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl (2-fluoroethyl)sulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl morpholine-4-sulfonate;2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl dimethylsulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl 3-fluoroazetidine-1-sulfonate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl azetidine-1-sulfonate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl pyrrolidine-1-sulfonate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl ethyl(methyl)sulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl (2- methoxyethyl)(methyl)sulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl benzyl(methyl)sulfamate; 2-((5-(3-chlorobenzyl)-4-(((1-methylpiperidin-4-yl)oxy)methyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((4-(hydroxymethyl)-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chlorobenzyl)-4-(((methylcarbamoyl)oxy)methyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chlorobenzyl)-4-(morpholinomethyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(2-(3-chlorophenyl)propan-2-yl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chlorobenzyl)-4-formylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((7-(3-chlorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; or 2-((5-(3-chlorophenoxy)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate. Paragraph 13. A pharmaceutical composition comprising a compound according to any one of paragraphs 1 to 12, or a pharmaceutically acceptable salt thereof, and one or more pharmaceutically acceptable excipients. Paragraph 14. A compound according to any one of paragraphs 1 to 12, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition according to paragraph 13: a. for use in therapy; b. for use in the inhibition of MutSβ activity, e.g. in cellular systems; c. for use in the treatment of a disease or disorder in which MutSβ activity is implicated; d. for use in the treatment of a repeat expansion disease or disorder; optionally wherein the repeat expansion disease or disorder is selected from benign adult familial myoclonic epilepsy (BAFME); brachydactyly and cleidocranial dysplasia (BCCD); blepharophimosis, ptosis and epicanthus inversus (BPES); Baratela-Scott syndrome (BSS); cerebellar ataxia, neuropathy and vestibular areflexia syndrome (CANVAS); congenital central hypoventilation syndrome (CCHS); dentatorubropallidoluysianatrophy (DRPLA); early infantile epileptic encephalopathy type 1 (EIEE1); familial adult myoclonic epilepsy (FAME); Fuch’s endothelial corneal dystrophy type 3 (FECD3); Dentatorubral pallidoluysian atrophy; fragile XE syndrome (FRAXE); Friedreich ataxia (FRDA) frontotemporal dementia / amyotrophic lateral sclerosis (FTD / ALS); fragile X- associated premature ovarian infertility (FXPOI); fragile X syndrome (FXS); fragile X- associated tremor ataxia syndrome (FXTAS); global development delay, progressive ataxia and elevated glutamine (GDPAG); Huntington’s disease (HD); Huntington disease-like 2 (HDL2); hand-foot-genital syndrome (HFGS); holoprosencephaly type 5 (HPE5); mental retardation with isolated growth hormone deficiency (MRGH); myotonic dystrophy type 1 (DM1); myotonic dystrophy type 2 (DM2); progressive myoclonus epilepsy type 1 or Unverricht-Lundborg diseae (EPM1); neuronal intranuclear inclusion disease (NIID); oculopharyngodistal myopathy type 1 (OPDM1); oculopharyngodistal myopathy type 2 (OPDM2); oculopharyngeal myopathy with leukoencephalopathy type 1 (OPML1); spinobulbar muscular atrophy (SBMA); spinocerebellar ataxias type 1, 2, 3, 6, 7, 8, 10, 12, 17, 31, 36 or 37 (SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA10, SCA12, SCA17, SCA31, SCA36, SCA37); synpolydactyly (SPD); X-linked dystonia parkinsonism (XDP); X-linked mental retardation and abnormal genitalia (XLAG); or X-linked mental retardation with or without growth hormone deficiency (XLMR, XLMRGHD). e. for use in the treatment of a triplet repeat disease or disorder, e.g. dentatorubropallidoluysian atrophy (DRPLA); Fuch’s endothelial corneal dystrophy type 3 (FECD3); fragile XE syndrome (FRAXE); Friedreich ataxia (FRDA); fragile X- associated premature ovarian infertility (FXPOI); fragile X syndrome (FXS); fragile X- associated tremor ataxia syndrome (FXTAS); Huntington’s disease (HD); Huntington disease-like 2 (HDL2); myotonic dystrophy type 1 (DM1); neuronal intranuclear inclusion disease (NIID); spinobulbar muscular atrophy (SBMA); spinocerebellar ataxias type 1, 2, 3, 6, 7, 8, 17 (SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA17); or X-linked dystonia parkinsonism (XDP); f. for use in the treatment of Huntington’s disease (HD); g. for use in inhibiting somatic expansion of expanded simple nucleotide repeats in a subject, e.g. in the treatment of a repeat expansion disease or disorder; h. for use in the inhibition of somatic expansion of expanded simple nucleotide repeats in a subject carrying a disease allele for a repeat expansion disease or disorder; i. for use in the treatment of Huntington’s disease, wherein the compound or pharmaceutical composition is administered in combination with one or more disease modification therapies, e.g. RNA interference approaches (such as tominersen,WVE-03, AMT-130, BV-101, VO-659 or SPK-miHTT), mis-splicing (such as PTC- 518) and antibody therapeutics (such as INT-41, NI-302, C6-17 or Vtx-003); j. for use in the treatment of Huntington’s disease, wherein the compound or pharmaceutical composition is administered in combination with one or more Huntingtin lowering therapies (such as RNAi, miRNA (such as AMT-130), antisense oligonucleotides (such as tominersen), and small-molecule splicing modulators (such as PTC-518); and novel methods to clear the mHTT protein, such as proteolysis- targeting chimeras); k. for use in gene editing in vitro, ex vivo or in vivo; optionally wherein the gene editing method is selected from CRISPR-Cas9, CRISPR-Cas12, Fanzor, ZFN (zinc finger nucleases), TALENs, base editors and prime editors; l. for use as an agent to enhance the efficiency of prime editors; m. for use as an agent to reduce off-target editing (errors) of prime editors in cellular systems; n. for use as an agent to both enhance efficiency and reduce error of prime editors in cellular systems; o. for use as an agent to enhance the efficiency of prime editor therapeutics ex vivo (e.g. allogeneic editing of hematopoietic cells); or p. for use as an agent to enhance the efficiency of prime editor therapeutics in vivo. Paragraph 15. The use of compound according to any one of paragraphs 1 to 12, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition according to paragraph 13: a. in inhibiting somatic expansion of expanded simple nucleotide repeats in a cellular assay system; b. as an agent to enhance the efficiency of prime editors in a cellular system; c. as an agent to reduce off-target editing (errors) of prime editors in cellular systems; d. as an agent to both enhance efficiency and reduce error of prime editors in cellular systems; e. as an agent to enhance the efficiency of prime editor therapeutics ex vivo (e.g. allogeneic editing of hematopoietic cells); f. as an agent to inhibit mismatch repair in vitro, ex vivo or in vivo; g. in testing an agent for the ability to inhibit ATP hydrolysis by MutSβ in the presence or absence of a suitable heteroduplex DNA substrate; or h. in testing an agent for the ability to inhibit ATP-dependent recruitment of MutLα or MutLβ or MutLγ by MutSβ.Paragraph 16. A method of increasing the efficiency of a gene editing technique or reducing the error rate of a gene editing technique, the method comprising conducting the gene editing technique in the presence of a compound according to any one of paragraphs 12, or a pharmaceutically acceptable salt thereof; optionally wherein the gene editing technique is a gene editing technique in which host cell mis-match repair (MMR) factors are known to decrease the efficiency of the gene editing, e.g.: homology-directed repair (HDR), non-homologous end joining (NHEJ), ZFN (zinc finger nucleases), TALENs (Transcription activator like effector nucleases), CRISPR-Cas9 nucleases, CRISPR-Cas12 nucleases, base editing (fusion of catalytically dead dCas9 enzymes to DNA deaminases which enable single nucleotide substitutions), prime editing (fusion of a Cas9 nickase to a reverse transcriptase), PASTE (programmable addition via site-specific targeting elements which leverages prime editing to insert AttB sites and then facilitate serine integrase proteins to insert larger sequences), or any editing method using a single-stranded oligonucleotide (ssODN) as a template including nuclease-free editing methods. Paragraph 17. A method of prime editing, the method comprising contacting a cell with: (1) a Cas9 nickase to nick a non-target strand; (2) a prime editing single guide RNA (pegRNA) to bind the target strand; (3) a reverse transcriptase to reverse transcribe from the 3’ end of the non-target strand according to the information provided by the pegRNA; and (4) a compound according to any one of paragraphs 1 to 12, or a pharmaceutically acceptable salt thereof. EXAMPLES General Scheme 1

[0291] To a solution of 10a (50 g, 437.95 mmol, 1 eq) in acetonitrile (500 mL) was added bromo-succinimide (85.74 g, 481.74 mmol, 1.1 eq) and acetic acid (50 mL). The mixture was stirred at 25°C for 12 h. LCMS showed the starting material was consumed and a new peak was detected. The residue was diluted with sodium bicarbonate (300 mL) and extracted with ethyl acetate 600 mL (200 mL x 3). The combined organic layers were washed with brine (200 mL), dried over sodium sulfate, filtered and concentrated under reduced pressure to give a crude oil. The crude product was purified by column chromatography (petroleum ether / ethyl acetate=3 / 1) to get 10b (5-bromo-4-methylthiazol-2-amine) (92 g, 87.05% yield) as a black oil. 1H NMR: (400 MHz, DMSO-d6) δ ppm 7.13 (br s, 2H), 2.03 (s, 3H) LCMS (ESI+): m / z: 193.0 Step 2: Procedure for preparation of 10c

[0292] To a solution of 2-benzyloxyacetic acid (32.99 g, 198.55 mmol, 28.39 mL, 1 eq) in dimethyl formamide (400 mL) was added 2-(3H-[1,2,3]triazolo[4,5-b]pyridin-3-yl)-1,1,3,3- tetramethyluronium hexafluorophosphate(V) (113.24 g, 297.83 mmol, 1.5 eq) and diisopropylethylamine (76.98 g, 595.66 mmol, 103.75 mL, 3 eq). The mixture was stirred at 20°C for 0.5 h. Then 10b (46 g, 238.26 mmol, 1.2 eq) was added to the reaction mixture. The mixture was stirred at 20°C for 1 h. LCMS showed the starting material was consumed and the desired product mass was detected. The residue was diluted with water (500 mL) andextracted with ethyl acetate (3 x 300 mL). The combined organic layers were washed with aqueous sodium chloride (500 mL), dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (petroleum ether / ethyl acetate=3 / 1) to get 10c (2-(benzyloxy)-N-(5-bromo-4-methylthiazol-2- yl)acetamide ) (37.4 g, 26.77% yield) as a yellow solid. 1H NMR (400 MHz, DMSO-d6) δ ppm 12.30 (br s, 1H), 7.41 - 7.27 (m, 5H), 4.58 (s, 2H), 4.25 (s, 2H), 2.23 (s, 3H) LCMS (ESI+): m / z: 341.1 Step 3: Procedure for preparation of 10d

[0293] To a solution of 10c (300 mg, 879.19 μmol, 1 eq) in tetrahydrofuran (6 mL) was added dropwise isopropyl magnesium chloride lithium chloride (1.3 M, 1.35 mL, 2 eq) at 0°C over 5 min. The mixture was stirred at this temperature for 25 min, and then 3-bromobenzaldehyde (650.66 mg, 3.52 mmol, 3 eq) in tetrahydrofuran (1 mL) was added to the reaction mixture dropwise at 0°C. The resulting mixture was stirred at 25°C for 1.5 h. LCMS showed the starting material was consumed and the desired product mass was detected. The reaction mixture was quenched with water (10 mL) and extracted with ethyl acetate (3 × 15 mL). The combined organic layers were washed with brine (2 × 15 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to give a residue. The residue was by column chromatography (petroleum ether / ethyl acetate = 1 / 10 to 1 / 9) to give 10d 2- (benzyloxy)-N-(5-((3-bromophenyl)(hydroxy)methyl)-4-methylthiazol-2-yl)acetamide) (250 mg, 63.56% yield) as a white solid. 1H NMR (400 MHz, METHANOL-d4) δ ppm 7.64 - 7.21 (m, 9H), 6.01 (s, 1H), 4.66 (s, 2H), 4.19 (s, 2H), 2.30 (s, 3H). LCMS (ESI+): m / z: 447.0 Step 4: Procedure for preparation of 10e

[0294] To a solution of 10d (250 mg, 558.85 μmol, 1 eq) in trifluoroacetic acid (2.5 mL) was added triethylsilane (259.93 mg, 2.24 mmol, 4 eq). The mixture was stirred at 25°C for 1 h. LCMS showed starting material was consumed and the desired mass was detected. The reaction mixture was diluted with water (10 mL) and extracted with ethyl acetate (3 × 15 mL). The combined organic layers were washed with brine (2 × 15 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to give 10e (2-(benzyloxy)- N-(5-(3-bromobenzyl)-4-methylthiazol-2-yl)acetamide) (200 mg, 90.48% yield) as a white solid.1H NMR (400 MHz, METHANOL-d4) δ ppm 7.47 - 7.10 (m, 9H), 4.67 (s, 2H), 4.22 (s, 2H), 4.06 (s, 2H), 2.29 (s, 3H) LCMS (ESI+): m / z: 431.0 Step 5: Procedure for preparation of 10f

[0295] To a solution of 10e (200 mg, 463.67 μmol, 1 eq) in dichloromethane (2 mL) was added boron trichloride (162.98 mg, 1.39 mmol, 180.89 μL, 3 eq). The mixture was stirred at -75°C for 2 h. LCMS showed the starting material was consumed and the desired mass was detected. The residue was poured into aqueous sodium bicarbonate to pH=7 and then diluted with water (10 mL) and extracted with dichloromethane (10 mL × 3). The combined organic layers were washed with brine (15 mL × 2), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to give 10f (N-(5-(3-bromobenzyl)-4-methylthiazol-2-yl)- 2-hydroxyacetamide) (150 mg, 94.81% yield) as a white solid.1H NMR (400 MHz, METHANOL-d4) δ ppm 7.42 - 7.33 (m, 3H), 7.20 (s, 1H), 4.19 (s, 2H), 4.04 (s, 2H), 2.27 (s, 3H) LCMS (ESI+): m / z: 340.8 Step 6: Procedure for preparation of compound 10.

[0296] To a solution of 10f (50 mg, 146.53 μmol, 1 eq) and N-methylsulfamoyl chloride (37.97 mg, 293.06 μmol, 2 eq) in dichloromethane (1 mL) was added N-isopropyl-N- methylpropan-2-amine (28.41 mg, 219.80 μmol, 1.5 eq). The mixture was stirred at 25°C for 1 h. LCMS showed starting material was consumed and the desired mass was detected. The reaction mixture was diluted with water (10 mL) and extracted with dichloromethane (3 x 10 mL ). The combined organic layers were washed with brine (2 x 15 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to give a residue. The residue was purified by reversed-phase HPLC (column: CD06-Waters Xbidge C18 150*40*10um; mobile phase: [water ( NH4HCO3)-ACN]; gradient: 35%-65% B over 10 min) to give the title compound (10) (2-((5-(3-bromobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate) (10.43 mg, purity 91.74%) as a white solid. 1H NMR (400 MHz, METHANOL-d4) δ ppm 7.42 - 7.33 (m, 2H), 7.25 - 7.17 (m, 2H), 4.74 (s, 2H), 4.04 (s, 2H), 2.74 (s, 3H), 2.27 (s, 3H) LCMS (ESI+): m / z: 398.1 General Scheme 2:Example 7-Step 1: Procedure for preparation of 7b O Cl7a 7b

[0297] To a solution of 7a (3 g, 26.3 mmol, 1.0 eq) in tetrahydrofuran (30 mL) was added isopropylmagnesium chloride-lithium chloride complex (1.3 M, 60.6 mL, 3.0 eq) dropwise at - 78℃ under N2protection. The reaction mixture was stirred for 0.5 h at -78°C, then a solution of 7f (5.0 g, 31.5 mmol, 1.2 eq) in tetrahydrofuran (10 mL) was added to the above solution at -78°C and the mixture was stirred at 20 °C for 5.5 h under a nitrogen atmosphere. The reaction mixture was quenched by the addition of water (50 mL) at 0°C, and extracted with ethyl acetate (3 × 100 mL). The combined organic layers were washed with brine (2 × 50 mL), dried over Na2SO4, filtered and the filtrate was concentrated under reduced pressure. The residue was purified by column chromatography (petroleum ether / ethyl acetate=1 / 0 to 0 / 1) to give 7b (2- amino-4-methylthiazol-5-yl)(3-chloro-4-fluorophenyl)methanol ) (1.5 g, yield 21%) as a white solid. 1H NMR: (400 MHz, DMSO-d6) δ ppm 7.47 (dd, J = 7.2, 2.0 Hz, 1 H), 7.26 - 7.39 (m, 2 H), 6.68 (s, 2 H), 6.02 (d, J = 3.6 Hz, 1 H), 5.82 (d, J = 3.6 Hz, 1 H), 2.10 (s, 3 H). LCMS (ESI+): m / z 273.1 (M+H)+Step 2: Procedure for preparation of 7c

[0298] To a solution of 7b (1.5 g, 5.50 mmol, 1.0 eq) in dichloromethane (7.5 mL) was added 2,2,2-trifluoroacetic acid (7.5 mL) and triethylsilane (4.39 mL, 27.5 mmol, 5.0 eq) at 0℃. The mixture was stirred at 25°C for 6 h. LCMS showed formation of the desired product mass. The reaction mixture was quenched by the addition of water (20 mL) at 0°C, adjusted to pH = 8.0 with sodium bicarbonate aqueous solution and extracted with ethyl acetate (3 × 30 mL). The combined organic layers were washed with brine (2 × 10 mL), dried over Na2SO4, filtered and the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (petroleum ether / ethyl acetate=1 / 0 to 1 / 1) to give 7c (5- (3-chloro-4-fluorobenzyl)-4-methylthiazol-2-amine) (1.2 g, yield 85%) as a yellow solid. 1H NMR: (400MHz DMSO-d6) δ ppm 7.24 - 7.45 (m, 2 H), 7.12 - 7.23 (m, 1 H), 6.80 (br s, 2 H), 3.86 (s, 2 H), 2.05 (s, 3 H). LCMS (ESI+): m / z 257.0 (M+H)+Step 3: Procedure for preparation of 7d

[0299] To a solution of 7g (323 mg, 1.95 mmol, 1.0 eq) in N,N-dimethylformamide (5 mL) was added 2-(3H-[1,2,3]triazolo[4,5-b]pyridin-3-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate(V) (1.11 g, 2.92 mmol, 1.5 eq), N-ethyl-N-isopropylpropan-2-amine (678 μL, 3.90 mmol, 2.0 eq) and 7c (0.5 g, 1.95 mmol, 1.0 eq). The mixture was stirred at 25°C for 6 h. The reaction mixture was then quenched by the addition of water (10 mL) at 20°C, and extracted with ethyl acetate (3 × 20 mL). The combined organic layers were washed with brine (2 × 10 mL), dried over Na2SO4, filtered and the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (petroleum ether / ethyl acetate=1 / 0 to 0 / 1) to give 7d (2-(benzyloxy)-N-(5-(3-chloro-4-fluorobenzyl)-4- methylthiazol-2-yl)acetamide)(0.5 mg, yield 63%) as a colorless oil. 1H NMR: (400 MHz, DMSO-d6) δ ppm 11.87 (br s, 1 H), 7.20 - 7.48 (m, 8 H), 4.56 (s, 2 H), 4.19 (s, 2 H), 4.04 (s, 2 H), 2.23 (s, 3 H). LCMS (ESI+): m / z 405.0 (M+H)+Step 4: Procedure for preparation of 7e

[0300] To a solution of 7d (300 mg, 741 μmol, 1.0 eq) in dichloromethane (3 mL) was added boron trichloride (1 M, 2.22 mL, 3.0 eq) at -78°C for 6 h. LCMS showed the desired product mass was detected. The reaction mixture was quenched by the addition of water (5 mL) at 0°C and adjusted to pH = 8.0 with sodium bicarbonate aqueous solution and extracted with ethyl acetate (3 × 10 mL). The combined organic layers were washed with brine (2 × 5 mL), dried over Na2SO4, filtered and the filtrate was concentrated under reduced pressure to give 7e (N-(5-(3-chloro-4-fluorobenzyl)-4-methylthiazol-2-yl)-2-hydroxyacetamide) (150 mg, yield 64%) as a colourless oil. 1H NMR (400 MHz, DMSO-d6) δ ppm 11.50 (s, 1 H), 7.43 (dd, J = 7.2, 1.2 Hz, 1 H), 7.31 - 7.38 (m, 1 H), 7.13 - 7.27 (m, 1 H), 5.46 (br t, J = 6.0 Hz, 1 H), 4.07 (br d, J = 6.0 Hz, 2 H), 4.03 (s, 2 H), 2.23 (s, 3 H) LCMS (ESI+): m / z 315.0 (M+H)+.Step 5: Procedure for preparation of compound 7

[0301] To a solution of 7e (100 mg, 318 μmol, 1.0 eq) in dichloromethane (1 mL) was added triethylamine (133 μL, 953 μmol, 3.0 eq) and 1e (82.3 mg, 635 μmol, 2.0 eq). The mixture was stirred at 20°C for 2 h. LCMS showed formation of the desired product mass. The reaction mixture was evaporated by nitrogen flow and purified by preparative-HPLC to give the title compound 7 (2-((5-(3-chloro-4-fluorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate) (23.75 mg, yield 18%) as a white solid. 1H NMR: (400 MHz, DMSO-d6) δ ppm 12.20 (s, 1 H), 7.91 (s, 1 H), 7.44 (dd, J = 7.2, 2.0 Hz, 1 H), 7.31 - 7.38 (m, 1 H), 7.19 - 7.27 (m, 1 H), 4.70 (s, 2 H), 4.04 (s, 2 H), 2.60 (s, 3 H), 2.24 (s, 3 H). LCMS (ESI+): m / z: 408.0 General Scheme 3:1a 1b

[0302] To a solution of 1a (200 mg, 516.94 μmol, 1 eq) in N-dimethylformamide (2 mL) was added methyl iodide (88.05 mg, 620.32 μmol, 38.62 μL, 1.2 eq) and cesium carbonate (252.64 mg, 775.41 μmol, 1.5 eq). The mixture was stirred at 25°C for 2 h. LCMS showed the starting material was consumed and the desired product mass was detected. The reaction mixture was poured into ice-water (25 mL) at 0°C, and extracted with ethyl acetate (3 × 10 mL). Thecombined organic layers were washed with brine (2 × 10 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to give a residue. The residue was by column chromatography (petroleum ether / ethyl acetate=1 / 1 to 1 / 2) to give 1b (2- (benzyloxy)-N-(5-(3-chlorobenzyl)-4-methylthiazol-2-yl)-N-methylacetamide) (400 mg, 38.60% yield) as a white solid. 1H NMR (400 MHz, CHLOROFORM-d) δ ppm 7.41 - 7.28 (m, 5H), 7.25 - 7.07 (m, 4H), 4.68 (s, 2H), 4.41 (s, 2H), 4.00 (s, 2H), 3.61 (s, 3H), 2.31 (s, 3H) LCMS (ESI+): m / z: 401.1 Step 2: Procedure for preparation of 1c

[0303] To a solution of 1b (100 mg, 249.43 μmol, 1 eq) in dichloromethane (1 mL) was added boron trichloride (87.68 mg, 748.28 μmol, 97.31 μL, 3 eq). The mixture was stirred at -75°C for 2 h. LCMS showed starting material was consumed and the desired product mass was detected. The residue was quenched by the addition of the water (2 Ml) and adjusted pH=7 with saturated sodium bicarbonate aqueous solution. and extracted with dichloromethane (3 x 2 mL). The combined organic layers were washed with brine (2 x 1 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to give a residue. The residue was purified by TLC (dichloromethane / ethyl acetate = 1 / 1) to give 1c N-(5-(3- chlorobenzyl)-4-methylthiazol-2-yl)-2-hydroxy-N-methylacetamide (110 mg, 35.47% yield) as a white solid. 1H NMR (400 MHz, METHANOL-d4) δ ppm 7.42 - 7.38 (m, 1H), 7.36 - 7.31 (m, 1H), 7.30 - 7.24 (m, 1H), 7.14 (br d, J = 7.6 Hz, 1H), 4.49 (s, 2H), 4.02 (s, 2H), 3.53 (s, 3H), 2.28 (s, 3H) LCMS (ESI+): m / z: 311.1 Step 3: Procedure for preparation of Compound 1

[0304] To a solution of 1c (50 mg, 160.88 μmol, 1 eq) and N-methylsulfamoyl chloride (41.69 mg, 321.75 μmol, 2 eq) in dichloromethane (1 mL) was added N-isopropyl-N-methylpropan-2- amine (31.18 mg, 234.56 μmol, 42.03 μL, 1.5 eq). The mixture was stirred at 25 °C for 1 h. LCMS showed starting material was consumed and the desired product mass was detected. The reaction mixture was diluted with water (2 mL) and extracted with ethyl acetate (3 × 1 mL). The combined organic layers were washed with brine (2 x 1 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to give a residue. The residue was purified by preparative HPLC to give the title compound 12-((5-(3-chlorobenzyl)- 4-methylthiazol-2-yl)(methyl)amino)-2-oxoethyl methylsulfamate (7.28 mg, 11.20% yield) as a white solid. 1H NMR (400 MHz, METHANOL-d4) δ ppm 7.31 - 7.13 (m, 4H), 5.06 (s, 2H), 4.05 (s, 2H), 3.60 (br s, 3H), 2.74 (s, 3H), 2.30 (s, 3H) LCMS (ESI+): m / z: 404.1 General scheme 4:Example 18-Step 1: Procedure for preparation of 18b

[0305] To a solution of 18a (9 g, 59.60 mmol, 1 eq) in ethanol (135 mL) was added thiourea (4.54 g, 59.60 mmol, 1 eq) at 25°C. The mixture was stirred at 78°C for 12 h. LCMS showed the starting material was consumed and the product mass was detected. The reaction mixture was concentrated under reduce pressure to give a residue. The residue was purified by column chromatography (petroleum ether / ethyl acetate = 1: 0 to 0: 1) to give 18b (4- ethylthiazol-2-amine) (5 g, 65% yield) as white solid. 1H NMR (400 MHz, DMSO-d6) δ ppm 6.76 (br s, 2H), 6.07 (s, 1H), 2.40 (q, J = 7.6 Hz, 2H), 1.11 (t, J = 7.6 Hz, 3H) LCMS (ESI+): m / z: 129.2 Step 2: Procedure for preparation of 18c

[0306] To a solution of 18b (5 g, 39.00 mmol, 1 eq) in CCl4 (75 mL) was added NBS (6.94 g, 39.00 mmol, 1 eq) at 25°C. The resulting mixture was stirred at 25°C for 12 h. LCMS showed the 18b was consumed and the product mass was detected. The reaction mixture was concentrated under reduce pressure to give a residue. The residue was purified by column chromatography (petroleum ether / ethyl acetate =1: 0 to 0: 1) to give 18c (5-bromo-4- ethylthiazol-2-amine) (500 mg, 6.19% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) δ ppm 7.11 (s, 2H), 2.39 (q, J = 7.6 Hz, 2H), 1.09 (t, J = 7.6 Hz, 3H) LCMS (ESI+): m / z: 206.8 Step 3: Procedure for preparation of 18d

[0307] To a solution of 18c (0.5 g, 2.41 mmol, 1 eq) in dichloromethane (7.5 mL) was added 2-benzyloxyacetyl chloride (579.47 mg, 2.9 mmol, 1.2 eq) and triethylamine (0.73 g, 7.24 mmol, 3 eq) at 0°C. The resulting mixture was stirred at 25°C for 12 h. TLC showed the 18c was consumed and new spot was detected. The residue was poured into water (10 mL). The aqueous phase was extracted with dichloromethane (2 x 10 mL). The combined organic phase was washed with brine (10 mL), dried with anhydrous Na2SO4, filtered and concentrated under reduced pressure to obtain a residue. The residue was purified by column chromatography (petroleum ether / ethyl acetate = 1: 1 to 0: 1) to give 18d (2-(benzyloxy)-N- (5-bromo-4-ethylthiazol-2-yl)acetamide) (300 mg, 35% yield) as a yellow solid. 1H NMR (400 MHz, DMSO-d6) δ ppm 12.36 (s, 1H), 7.39 - 7.30 (m, 5H), 4.58 (s, 2H), 4.25 (s, 2H), 2.59 (q, J = 7.6 Hz, 2H), 1.15 (t, J = 7.6 Hz, 3H) The following examples were also prepared in a similar fashion using Scheme 1. Mass +n time2-((4-methl-5-(4-oxoeth lThe following example was also prepared using Scheme 2. LC-MS +The following examples were also prepared using Scheme 3. LC-MS +General Scheme 5General Scheme 6 Example 4-Step 1: Procedure for preparation of compound 4

[0308] To a solution of 4a (0.03 g, 107.02 μmol, 1 eq) in N,N-dimethylformamide (0.5 mL) was added sodium hydride (42.80 mg, 1.07 mmol, 60% purity, 10 eq) at 0°C, after 30 min, N,N-dimethylsulfamoyl chloride (30.73 mg, 214.04 μmol, 22.99 μL, 2 eq) was added to the above mixture at 0°C. The reaction mixture was stirred at 0°C for 1.5 h. LCMS showed the desired product mass was detected. The reaction mixture was poured into ice water (6 mL) and extracted with ethyl acetate (2 x 2 mL). The combined organic layers were washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to give a residue. The residue was purified by preparative-TLC (petroleum ether: ethyl acetate=1 / 1, Rf=0.35) to give the title compound (4) 2-((5-(4-fluorobenzyl)-4-methylthiazol-2- yl)amino)-2-oxoethyl dimethylsulfamate (11.50 mg, 27.37% yield, 98.68% purity) as a yellow oil. 1H NMR (400 MHz, CHLOROFORM-d) δ ppm 7.16 (dd, J = 5.6, 8.4 Hz, 2H), 6.99 (t, J = 8.8 Hz, 2H), 4.76 (s, 2H), 4.00 (s, 2H), 2.99 (s, 6H), 2.30 (s, 3H) LCMS (ESI+): m / z: 388.0

[0309] The following examples were also prepared in a similar fashion using Scheme 5. LC-MS +2-((5-(34-

[0310] The following examples were also prepared using Scheme 6. LC-MS +General Scheme 7 Example 15-Step 1: Procedure for preparation of 15b

[0311] To a solution of 15a (5 g, 41.62 mmol, 4.91 mL, 1 eq) and pentane-2,4-dione (4.17 g, 41.62 mmol, 4.27 mL, 1 eq) in acetonitrile (50 mL) was added trimethylchlorosilane (22.61 g, 208.08 mmol, 26.41 mL, 5 eq) and sodium iodide (31.19 g, 208.08 mmol, 5 eq) at 0 °C. Then the mixture was stirred at 60 °C for 2 h. LCMS showed starting material was consumed and the desired product Ms was detected. The reaction mixture was quenched with the addition water (20 mL) at 0°C and extracted with ethyl acetate (3 × 30 mL). The combinedorganic layers were washed with brine (2 × 50 mL), dried over Na2SO4, filtered and the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel chromatography (petroleum ether : ethyl acetate =5: 1 ) to give 15b 3-(p- tolylmethyl)pentane-2,4-dione (5 g, 24.48 mmol, 11.76% yield) as a yellow oil. 1H NMR (400 MHz, CHLOROFORM-d) δ ppm 7.12 (s, 2H), 7.05 (br s, 2H), 4.00 (t, J = 7.6 Hz, 1H), 3.13 (br d, J = 7.6 Hz, 2H), 2.34 (s, 6H), 2.31 (s, 3H) LCMS (ESI+): m / z 203.0 (M-1) Step 2: Procedure for preparation of 15c

[0312] To a solution of 15b (3 g, 14.69 mmol, 1 eq) in toluene (30 mL) was added sodium carbonate / aluminium oxide (13.74 g, 66.09 mmol, 4.5 eq) and cupric bromide / aluminium oxide (11.47 g, 35.25 mmol, 2.4 eq). The mixture was stirred at 50 °C for 2 h. TLC showed starting material was consumed and a new spot was detected. The reaction mixture was quenched with the addition water (15 mL) at 0°C and extracted with ethyl acetate (3 × 20 mL). The combined organic layers were washed with brine (2 × 50 mL), dried over Na2SO4, filtered and the filtrate was concentrated under reduced pressure to give crude 15c (3-bromo-4-(p- tolyl)butan-2-one) (10 g, 8.47% yield) as a yellow oil, which was used directly for the next step. Step 3: Procedure for preparation of 15d

[0313] To a solution of 15c (10 g, 41.47 mmol, 1 eq) in ethanol (100 mL) was added thiourea (3.16 g, 41.47 mmol, 1 eq). The mixture was stirred at 80 °C for 2 h. LCMS showed starting material was consumed and the desired product Ms was detected. The reaction mixture was quenched with the addition water (15 mL) at 0°C and extracted with ethyl acetate (3 × 20 mL). The combined organic layers were washed with brine (2 × 50 mL), dried over Na2SO4, filtered and the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel chromatography (petroleum ether : ethyl acetate = 0: 1 ) to give 15d (4- methyl-5-(p-tolylmethyl) thiazol-2-amine) (3 g, 33.13% yield) as a black solid.1H NMR (400 MHz, DMSO-d6) δ ppm 7.06 (q, J = 8.0 Hz, 4H), 6.56 (s, 2H), 3.78 (s, 2H), 2.25 (s, 3H), 2.04 (s, 3H) LCMS (ESI+): m / z 219.2 (M+1)+Step 4: Procedure for preparation of 15e

[0314] To a solution of 15d (100 mg, 458.05 μmol, 1 eq) in dichloromethane (0.5 mL) was added N-isopropyl-N-methylpropan-2-amine (118.40 mg, 916.10 μmol, 159.57 μL, 2 eq) and 2-chloro-2-oxoethyl acetate (75.05 mg, 549.66 μmol, 59.09 μL, 1.2 eq) at 25 °C. The mixture was stirred at 25 °C for 2 h. LCMS showed 15d was consumed and the desired product mass was detected. The residue was poured into water (3 mL). The aqueous phase was extracted with ethyl acetate (3 × 1 mL). The combined organic phase was washed with brine (5 mL), dried with anhydrous Na2SO4, filtered and concentrated to obtain a residue. The residue was purified by column chromatography (dichloromethane: ethyl acetate = 8 / 1 to 5 / 1) to give 15e 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl acetate (100 mg, 66.00% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) δ ppm 7.15 - 7.03 (m, 4H), 4.75 (s, 2H), 3.98 (s, 2H), 2.31 (d, J = 6.8 Hz, 6H), 2.17 (s, 3H) LCMS (ESI+): m / z 319.0 (M+H)+Step 5: Procedure for preparation of 15f

[0315] To a solution of 15e (80 mg, 251.26 μmol, 1 eq) in tetrahydrofuran (1 mL) was added aqueous lithium hydroxide solution (2 M, 0.8 mL). The mixture was stirred at 25 °C for 2 h. LCMS showed 15e was consumed and the desired product mass was detected. The mixture was concentrated under reduced pressure to remove the THF and then adjusted pH to 4 - 5 with 1M aqueous hydrochloric acid and extracted with ethyl acetate (3 × 1 mL). The combined organic phases were dried with anhydrous Na2SO4, filtered, and concentrated to give 15f (2- hydroxy-N-(4-methyl-5-(4-methylbenzyl)thiazol-2-yl) acetamide) (80 mg, purity 90%) as a light yellow solid, which was used directly for the next step.1H NMR (400 MHz, CHLOROFORM-d) δ ppm 7.06 - 6.97 (m, 4H), 4.24 (s, 2H), 3.89 (s, 2H), 2.23 (d, J = 11.6 Hz, 6H) LCMS (ESI+): m / z 277.0 (M+H)+Step 6: Procedure for preparation of compound 15

[0316] To a solution of 15f (40 mg, 144.74 μmol, 1 eq) and N-isopropyl-N-methylpropan-2- amine (28.06 mg, 217.11 μmol, 37.82 μL, 1.5 eq) in dichloromethane (0.4 mL) was added ethylsulfamoyl chloride (24.94 mg, 173.69 μmol, 1.2 eq) at 0°C. The reaction mixture was stirred at 25°C for 1 h. LCMS showed starting material was consumed and desired product Ms was detected. The reaction mixture was diluted with water (3 mL) and extracted with dichloromethane (3 x 1 mL). The combined organic layers were washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to give a residue. The residue was purified by preparative-HPLC (neutral, column: Daisogel SP ODS RPS 150 x 25mm x 5 μm; mobile phase: [water (NH4HCO3) -ACN];gradient:37%-67% B over 10 min) to give the title compound (15) 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl ethylsulfamate (28.80 mg, 50.20% yield, 96.75% purity) as a white solid. 1H NMR (400 MHz, CHLOROFORM-d) δ ppm 7.10 (s, 4H), 4.69 (s, 2H), 3.96 (s, 2H), 3.00 (q, J = 7.2 Hz, 2H), 2.24 (d, J = 11.6 Hz, 6H), 1.06 (t, J = 7.2 Hz, 3H) LCMS (ESI+): m / z 383.8 (M+H)+General Scheme 8Example 41-Step 1: Procedure for preparation of 41b

[0317] To a solution of sulfuryl chloride (2.28 g, 16.9 mmol, 1.0 eq) in dichloromethane (5 mL) was added 41a (1 g, 16.9 mmol, 1.0 eq) and triethylamine (1.71 g, 16.9 mmol, 1.0 eq) under a nitrogen atmosphere at -10°C. The mixture was stirred for about 1 h. The reaction was filtered and the filtrate was concentrated under nitrogen flow. The residue was triturated with tetrahydrofuran (10 mL) at 20 °C and then filtered. The filtrate was concentrated under reduced pressure to give crude 41b (propylsulfamoyl chloride) (1.2 g, 45% yield) as a colorless oil, which was used directly in the next step. 1H NMR: (400 MHz CHLOROFORM-d) δ ppm 3.02 (t, J = 7.2 Hz, 2 H), 1.54 - 1.66 (m, 2 H), 0.96 (t, J = 7.2 Hz, 3 H). Step 2: Procedure for preparation of compound 41

[0318] To a solution of 15f (50 mg, 180.9 μmol, 1.0 eq) in tetrahydrofuran (2 mL) was added N-propylsulfamoyl chloride 41b (85.55 mg, 542 μmol, 3.0 eq) and N-ethyl-N-isopropylpropan- 2-amine (70.1 mg, 542 μmol, 3.0 eq) in sequence under nitrogen. The mixture was stirred at 20°C for 1 h. LCMS showed the formation of the desired mass. The reaction mixture was filtered and the filtrate was concentrated under nitrogen flow. The residue was purified by preparative-HPLC (column: Daisogel SP ODS RPS 150*25mm*5um; mobile phase: [water (NH4HCO3)-ACN]; gradient:43%-73% B over 10 min) to get the title compound (41) 2-((4- methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl propylsulfamate (31.14 mg, yield 14.7%) as a white solid. 1H NMR: (400 MHz CHLOROFORM-d) δ ppm 7.10 (d, J = 2.4 Hz, 4 H), 4.73 (s, 2 H), 3.98 (s, 2 H), 3.18 (t, J = 7.2 Hz, 2 H), 2.32 (s, 3 H), 2.30 (s, 3 H), 1.63 (br d, J = 7.2 Hz, 2 H), 0.97 (t, J = 7.2 Hz, 3 H). LCMS (ESI+): m / z 398.1 (M+H)+General Scheme 9Example 9-Step 1: Procedure for preparation of compound 9

[0319] To a solution of 15f (100 mg, 361 μmol, 1.0 eq) in N,N-dimethylformamide (3 mL) was added sodium hydride (217 mg, 5.43 mmol, 60 wt%, 15 eq) at 0℃, then the mixture was stirred at 0℃ for 0.5 h. Morpholine-4-sulfonyl chloride (134 mg, 723μmol, 2 eq) was added to the above solution at 0℃, then the mixture was stirred at 20°C for 1.5 h. LCMS showed starting material was consumed and the desired product mass was detected. The reaction mixture was poured into ammonium chloride aqueous solution (5 mL) and extracted with ethyl acetate (3 × 5 mL). The combined organic layer was washed with brine (8 mL), dried over Na2SO4, filtered and the filtrate was concentrated under reduced pressure to afford a residue. The residue was purified by preparative-HPLC (neutral condition Instrument: Gilson 281 semi- preparative HPLC system Mobile phase: A: 10 mM NH4HCO3 in H2O; B: CAN Column: Daisogel SP ODS RPS 150 x 25 mm x 5 μm) to give the title compound 9 (2-((4-methyl-5-(4- methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl morpholine-4-sulfonate) (11.41 mg, yield 7%) as a white solid.1H NMR: (400 MHz DMSO-d6) δ ppm 7.11 (s, 4 H), 4.84 (s, 2 H), 3.96 (s, 2 H), 3.58 - 3.67 (m, 4 H), 3.20 - 3.24 (m, 4 H), 2.25 (d, J = 10.4 Hz, 6 H). LCMS (ESI+): m / z 423.7 (M-1)- General Scheme 10Example 41-Step 1: Procedure for preparation of 29b

[0320] To a solution of sulfuryl chloride (757.10 mg, 5.61 mmol, 560.82 μL, 1 eq) in dichloromethane (5 mL) was added 29a (500 mg, 5.61 mmol, 602.41 μL, 1 eq) at -10°C for 0.5 h. The mixture was stirred at 20 °C for 5.5 h. TLC (petroleum ether: ethyl acetate = 1: 1) indicated 29a was consumed and one new spot was formed. The residue was poured into the ice-water (10 mL). The aqueous phase was extracted with dichloromethane (3 x 5 mL). The combined organic phase was dried with anhydrous Na2SO4, filtered and concentrated to give 29b (2-methoxyethyl)(methyl)sulfamoyl chloride (100 mg, 9.50% yield) as a white solid, which was used for next step directly. 1H NMR: (400 MHz CHLOROFORM-d) δ ppm 3.62 - 3.54 (m, 2H), 3.44 (br s, 2H), 3.29 - 3.26 (m, 3H), 3.02 (s, 3H) Step 2: Procedure for preparation of compound 29

[0321] To a solution of 15f (98 mg, 1 eq) in N,N -dimethylformamide (1 mL) was added sodium hydride (141.83 mg, 10 eq) and 29b (100 mg, 1.5 eq) at 0°C. The mixture was stirred at 0°C for 1 h. LCMS showed 15f was consumed and one main peak with desired mass was detected. The residue was poured into the ice-water (3 mL). The aqueous phase was extracted with ethyl acetate (3 x 1 mL). The combined organic phase was washed with brine (5 mL), dried with anhydrous Na2SO4, filtered and concentrated to obtain a residue. The residue was purified by TLC (petroleum ether: ethyl acetate=1:1) to give the title compound (29) 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl (2- methoxyethyl)(methyl)sulfamate (10.70 mg, 6.99% yield) as a yellow oil. 1H NMR: (400 MHz CHLOROFORM-d) δ ppm 7.10 (s, 4H), 4.74 (s, 2H), 3.98 (s, 2H), 3.66 - 3.58 (m, 2H), 3.55 - 3.49 (m, 2H), 3.42 (s, 3H), 3.05 (s, 3H), 2.31 (d, J = 8.8 Hz, 6H) LCMS (ESI+): m / z 427.9 (M+H)+

[0322] The following examples were also prepared in a similar fashion using Scheme 7.LC-MS +

[0323] The following examples were also prepared using Scheme 8. LC-MS +2-((5-(3-

[0324] The following examples were also prepared using Scheme 9. LC-MS +

[0325] The following examples were also prepared in a similar fashion using Scheme 10. LC-MS +General Scheme 11

[0326] To a suspension of Mg (831 mg, 34.17 mmol, 1.5 eq) and iodine (289 mg, 1.14 mmol, 0.05 eq) in tetrahydrofuran (210 mL) was added a solution of 50a (5 g, 22.78 mmol, 1.0 eq) in tetrahydrofuran (35 mL), the reaction mixture was refluxed for 1 h, it was cooled to 20°C. TheGrignard reagent was added to a solution of diethyl oxalate (3.33 g, 22.78 mmol, 3.11 mL, 1.0 eq) in tetrahydrofuran (175 mL) dropwise at -10°C. The reaction mixture was stirred at 70°C for 1 h. TLC showed starting material was consumed and a new product was detected. The reaction mixture was quenched with 2 M hydrochloric acid (100 mL) before being extracted with ethyl acetate (100 mL). The organic phase was dried with anhydrous Na2SO4, filtered, the combined layers were concentrated to afford a residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 5 / 1) to give 50b ethyl 4-(3- chlorophenyl)-2-oxobutanoate (12 g, yield 31.27%) as a yellow oil.1H NMR (400 MHz, CHLOROFORM-d) δ ppm 7.25 - 7.15 (m, 3H), 7.10 (br d, J = 6.8 Hz, 1H), 4.32 (q, J = 7.1 Hz, 2H), 3.25 - 3.11 (m, 2H), 2.94 (t, J = 7.6 Hz, 2H), 1.37 (t, J = 7.2 Hz, 3H) Step 2: Procedure for preparation of 50c

[0327] To a solution of 50b (4 g, 16.62 mmol, 1 eq) in chloroform (16.8 mL) was added a solution of bromine (1.06 M, 15.68 mL, 1 eq) in carbon tetrachloride (48 mL). The reaction mixture was stirred at 20°C for 1 h. TLC showed the starting material was consumed and a new product was detected. The reaction mixture was diluted with saturated aqueous sodium thiosulfate (100 mL), extracted with ethyl acetate (3 × 20 mL) and the combined organic layers were dried over Na2SO4, filtered and concentrated in vacuo to get a residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 5 / 1) to afford 50c ethyl 3-bromo-4-(3-chlorophenyl)-2-oxobutanoate (12 g, yield 75.31%) as a yellow oil.1H NMR (400 MHz, CHLOROFORM-d) δ ppm 7.18 (d, J = 4.0 Hz, 3H), 7.10 - 7.04 (m, 1H), 5.16 (t, J = 7.5 Hz, 1H), 4.30 (q, J = 7.2 Hz, 2H), 3.43 (dd, J = 7.2, 14.4 Hz, 1H), 3.15 (dd, J = 7.6, 14.6 Hz, 1H), 1.32 (t, J = 7.2 Hz, 3H) Step 3: Procedure for preparation of 50d

[0328] To a solution of 50c (9 g, 28.16 mmol, 1 eq) in ethanol (180 mL) was added thiourea (2.14 g, 28.16 mmol, 1 eq). The reaction mixture was stirred at 80 °C for 1 h and was then concentrated in vacuo to a residue. This residue was triturated with methyl tert-butyl ether (100 mL) and filtered to get 50d ethyl 2-amino-5-(3-chlorobenzyl)thiazole-4-carboxylate (10.5 g, yield 98.72%, hydrobromide) as a white solid.1H NMR (400 MHz, DMSO-d6) δ ppm 9.32 - 7.53 (m, 1H), 7.47 - 7.28 (m, 3H), 7.25 (br d, J = 7.2 Hz, 1H), 4.37 (s, 2H), 4.29 (q, J = 7.2 Hz, 2H), 1.27 (t, J = 7.2 Hz, 3H) Step 4: Procedure for preparation of 50e

[0329] To a solution of 2-benzyloxyacetic acid (7.64 g, 45.99 mmol, 1.3 eq) in N,N- dimethylformamide (100 mL) was added 2-(3H-[1,2,3]triazolo[4,5-b]pyridin-3-yl)-1,1,3,3- tetramethyluronium hexafluorophosphate(V) (17.49 g, 45.99 mmol, 1.3 eq) and the reaction mixture was stirred at 20°C for 10 min. 50d (10.5 g, 35.38 mmol, 1 eq) and N-ethyl-N- isopropylpropan-2-amine (16.00 g, 123.83 mmol, 21.57 mL, 3.5 eq) was then added into the reaction. The reaction was stirred at 20°C for 1 h and was then diluted with water (500 mL) and extracted with ethyl acetate (3 × 100 mL). The combined organic layers were dried over Na2SO4, filtered and concentrated in vacuo to give a residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 3 / 1) to afford 50e ethyl 2-(2- (benzyloxy)acetamido)-5-(3-chlorobenzyl)thiazole-4-carboxylate (9.4 g, yield 59.71%) as a white solid.1H NMR (400 MHz, DMSO-d6) δ ppm 12.47 (br s, 1H), 7.42 - 7.19 (m, 9H), 4.56 (s, 2H), 4.50 (s, 2H), 4.28 (q, J = 7.2 Hz, 2H), 4.22 (s, 2H), 1.27 (t, J = 7.2 Hz, 3H) Step 5: Procedure for preparation of 50f

[0330] To a solution of 50e (9.4 g, 21.13 mmol, 1 eq) in tetrahydrofuran (50 mL) and ethanol (50 mL) was added a solution of potassium hydroxide (4.74 g, 84.51 mmol, 4 eq) in H2O (50 mL). The reaction mixture was stirred at 20°C for 12 h. The reaction mixture was then concentrated under reduced pressure to give a residue. This residue was diluted with water (100 mL), adjusted to pH=3 using 1 M hydrochloric acid and then extracted with ethyl acetate (3 × 20 mL). The combined organic layers were dried over Na2SO4,filtered and concentrated in vacuo to afford 50f 2-(2-(benzyloxy)acetamido)-5-(3-chlorobenzyl)thiazole-4-carboxylic acid (8.6 g, yield 97.65%) as a white solid. 1H NMR (400 MHz, DMSO-d6) δ ppm 13.87 - 12.46 (m, 1H), 12.34 (br s, 1H), 7.40 - 7.23 (m, 9H), 4.56 (s, 2H), 4.50 (s, 2H), 4.22 (s, 2H) Step 6: Procedure for preparation of 50g

[0331] To a solution of 50f (2.3 g, 5.52 mmol, 1 eq) in 1,2-dimethoxyethane (20 mL) was added 4-methylmorpholine (725 mg, 7.17 mmol, 789 μL, 1.3 eq) and isobutyl chloroformate (980 mg, 7.17 mmol, 938 μL, 1.3 eq) dropwise at -10°C. The reaction mixture was stirred at - 10°C for 0.5 h. The reaction mixture was then filtered to give a colourless solution, which was used in the next step without purification. Sodium borohydride (307.35 mg, 8.12 mmol, 1.5 eq) was added to the solution in 1,2 -dimethoxyethane (2 mL) at -10°C. The reaction mixture was stirred at -10°C for 0.5 hour, diluted with water (50 mL) and extracted with ethyl acetate(3 × 10 mL). The combined organic layers were dried over Na2SO4,filtered and concentrated to give a residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 3 / 1) to give 50g 2-(benzyloxy)-N-(5-(3-chlorobenzyl)-4- (hydroxymethyl)thiazol-2-yl)acetamide (1.3 g, yield 59.58%) as a white solid. 1H NMR (400 MHz, METHANOL-d4) δ ppm 7.42 - 7.13 (m, 9H), 4.66 (s, 2H), 4.59 (s, 2H), 4.17 (s, 2H), 4.13 (s, 2H) Step 7: Procedure for preparation of 50h

[0332] To a solution of 50g (1.3 g, 3.23 mmol, 1 eq) in dichloromethane (15 mL) was added phosphorus tribromide (960.75 mg, 3.55 mmol, 1.1 eq) at 0°C and the reaction mixture was stirred at 20°C for 3 h. The reaction mixture was diluted with water (20 mL), extracted with ethyl acetate (3 × 5 mL) and the combined organic layers were dried over Na2SO4,filtered and concentrated in vacuo to a residue. This residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 3 / 1) to give 50h 2-(benzyloxy)-N-(4-(bromomethyl)-5- (3-chlorobenzyl)thiazol-2-yl)acetamide (1.4 g, yield 93.15%) as a yellow solid. 1H NMR (400 MHz, CHLOROFORM-d) δ ppm 10.24 - 9.72 (m, 1H), 7.41 - 7.34 (m, 5H), 7.26 - 7.21 (m, 3H), 7.16 - 7.10 (m, 1H), 4.66 (s, 2H), 4.49 (s, 2H), 4.16 (s, 2H), 4.08 (s, 2H) Step 8: Procedure for preparation of 50i

[0333] To a solution of tert-butyl 4-hydroxypiperidine-1-carboxylate (324 mg, 1.61 mmol, 1.5 eq) in tetrahydrofuran (4 mL) was added sodium hydride (171.73 mg, 4.29 mmol, 60% purity, 4 eq), then a solution of 50h (500 mg, 1.07 mmol, 1 eq) in tetrahydrofuran (4 mL) was added dropwise at 0°C. The reaction was stirred at 20°C for 1 hr. The reaction was then diluted withwater (10 mL), extracted with ethyl acetate (3 × 3 mL), and the combined organic layers were dried over Na2SO4,filtered and concentrated to a residue. This residue was purified by Prep- HPLC(column: CD20-Waters Xbridge BEH C18 250*25*10 μm; mobile phase: [water( NH4HCO3)-ACN];gradient:60%-90% B over 10 min) to afford 50i tert-butyl 4-((2-(2- (benzyloxy)acetamido)-5-(3-chlorobenzyl)thiazol-4-yl)methoxy)piperidine-1-carboxylate (0.36 g, yield 57.22%) as a yellow solid. 1H NMR (400 MHz, DMSO-d6) δ ppm 12.01 (br s, 1H), 7.38 - 7.22 (m, 9H), 4.54 (d, J = 18.4 Hz, 4H), 4.21 - 4.13 (m, 4H), 3.57 (br dd, J = 4.4, 8.0 Hz, 3H), 3.06 - 2.96 (m, 2H), 1.78 (td, J = 3.2, 6.8 Hz, 2H), 1.38 (s, 9H), 1.36 - 1.30 (m, 2H) Step 9: Procedure for preparation of 50j Cl Cl NH

[0334] To a solution of 50i (0.36 g, 614.19 μmol, 1 eq) in dichloromethane (3 mL) was added boron trichloride (216 mg, 1.84 mmol, 239.61 μL, 3 eq) dropwise at -78°C. The reaction was stirred at -78°C for 2 h and then quenched using methanol (1 mL) and concentrated in vacuo to give a residue. This residue was purified by prep-HPLC (column: CD02-Waters Xbridge BEH C18150*25*10 μm mobile phase: [water(NH3 H2O)-ACN];gradient:28%-58% B over 10 min) to get 50j N-(5-(3-chlorobenzyl)-4-((piperidin-4-yloxy)methyl)thiazol-2-yl)-2- hydroxyacetamide (80 mg, yield 32.90%) as a white solid. 1H NMR (400 MHz, METHANOL-d4) δ ppm 7.44 - 7.09 (m, 4H), 4.55 (s, 2H), 4.10 (d, J = 16.0 Hz, 4H), 3.55 - 3.48 (m, 1H), 2.99 (td, J = 4.4, 12.8 Hz, 2H), 2.53 (ddd, J = 2.8, 10.0, 12.8 Hz, 2H), 1.94 - 1.87 (m, 2H), 1.52 - 1.41 (m, 2H) Step 10: Procedure for preparation of 50k

[0335] To a solution of 50j (40 mg, 101.03 μmol, 1 eq) and paraformaldehyde (40.00 mg, 1.33 mmol, 36.70 μL, 13.19 eq) in methanol (0.5 mL) was added triethylamine (15.34 mg, 151.55 μmol, 21.09 μL, 1.5 eq) at 20 °C. Acetic acid (9.10 mg, 151.55 μmol, 8.68 μL, 1.5 eq) was added to adjust the pH to 4, after which sodium cyanoborohydride (9.52 mg, 151.55 μmol, 1.5 eq) was added to the reaction. The solution was stirred at 20 °C for 3 hrs. and was then filtered. The filtrate was purified by prep-HPLC (column: Welch Ultimate C18150 x 25mm x 5 μm; mobile phase: [water (TFA)-ACN]; gradient:6%-36% B over 11 min) to get 50k (N-(5-(3- chlorobenzyl)-4-(((1-methylpiperidin-4-yl)oxy)methyl)thiazol-2-yl)-2-hydroxyacetamide) (45 mg, yield 54.33%) as a yellow solid. 1H NMR (400 MHz, CHLOROFORM-d) δ ppm 12.49 - 12.06 (m, 1H), 7.27 - 7.23 (m, 2H), 7.18 (s, 1H), 7.12 (br d, J = 6.8 Hz, 1H), 4.55 - 4.46 (m, 2H), 4.43 - 4.35 (m, 2H), 4.13 - 4.05 (m, 2H), 3.83 (br s, 1H), 3.53 - 3.45 (m, 1H), 3.29 (br d, J = 11.2 Hz, 2H), 3.14 - 3.00 (m, 2H), 2.73 (d, J = 4.4 Hz, 3H), 2.26 - 2.12 (m, 2H), 2.04 (br d, J = 15.6 Hz, 2H) Step 11: Procedure for preparation of Compound 50

[0336] To a solution of 50k (40 mg, 97.58 μmol, 1 eq) in N,N-dimethylformamide (0.5 mL) was added N-ethyl-N-isopropylpropan-2-amine (18.92 mg, 146.37 μmol, 25.49 μL, 1.5 eq), and N-methylsulfamoyl chloride (50.57 mg, 390.31 μmol, 4 eq) was added dropwise at 0 °C. The reaction was stirred at 20 °C for 1 before being filtered. The crude product was purified by prep-HPLC (column: CD04-Welch Ultimate C18 150 x 25 x 7 μm; mobile phase: [water(TFA)-ACN];gradient: 23%-43% B over 10 min) to give the title compound 502-((5-(3- chlorobenzyl)-4-(((1-methylpiperidin-4-yl)oxy)methyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate (10.56 mg, yield 20.60%) as a white solid. 1H NMR (400 MHz, DMSO-d6) δ ppm 12.45 - 12.19 (m, 1H), 9.38 - 9.15 (m, 1H), 7.93 (q, J = 4.4 Hz, 1H), 7.41 - 7.26 (m, 3H), 7.24 (br d, J = 7.6 Hz, 1H), 4.72 (s, 2H), 4.54 (br d, J = 5.2 Hz, 2H), 4.17 (br d, J = 12.0 Hz, 2H), 3.65 - 3.48 (m, 1H), 3.25 (br d, J = 12.0 Hz, 2H), 3.01 - 2.89 (m, 2H), 2.78 - 2.71 (m, 3H), 2.60 (d, J = 4.8 Hz, 3H), 2.20 - 2.12 (m, 1H), 1.99 (br d, J = 15.2 Hz, 1H), 1.83 - 1.72 (m, 1H), 1.60 - 1.46 (m, 1H) The following example was prepared using Scheme 11.LC-MS +General Scheme 12

[0337] To a solution of 51a (300 mg, 784.36 μmol, 1 eq) in dichloromethane ( 3 mL) was added boron trichloride (137.86 mg, 1.18 mmol, 153.00 μL, 1.5 eq) at -75°C. The mixture was stirred at -75°C for 2 h. The reaction soution was into poured into ice-water (10 mL) and the pH was adjusted to 8.0 with aqueous sodium bicarbonate solution and extracted with ethyl acetate (3 × 3 mL). The combined organic layers were washed with brine (2 mL), dried over sodium sulfate, filtered and the filtrate was concentrated under reduced pressure to give 51b 2-hydroxy-N-(4-(hydroxymethyl)-5-(4-methylbenzyl)thiazol-2-yl)acetamide (150 mg, 65 % yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) δ ppm 11.49 (s, 1H), 7.17 - 7.07 (m, 4H), 6.53 (s, 1H), 5.46 (t, J = 6.4 Hz, 1H), 5.05 (t, J = 5.6 Hz, 1H), 4.46 (d, J = 5.6 Hz, 2H), 4.06 (t, J = 3.0 Hz, 4H), 2.26 (s, 3H) Step 2: Procedure for preparation of compound 51

[0338] To a solution of 51b (50 mg, 171.03 μmol, 1 eq) in dichloromethane (0.5 mL) was added N-isopropyl-N-methylpropan-2-amine (44.21 mg, 342.05 μmol, 59.58 μL, 2 eq) and N- methylsulfamoyl chloride (33.24 mg, 256.54 μmol, 1.5 eq). The mixture was stirred at 20 °C for 2 h. and was then concentrated under reduced pressure to remove the solvent. The resulting residue was purified by prep-HPLC (neutral conditions) to afford the title compound 51 2-((4-(hydroxymethyl)-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate (4.02 mg, 6% yield) as a white solid. 1H NMR (400 MHz, CDCl3) δ ppm 7.10 (s, 4H), 4.76 (s, 2H), 4.65 (s, 2H), 4.05 (s, 2H), 2.90 (s, 3H), 2.32 (s, 3H)

[0339] The following example was prepared using Scheme 12. LC-MS +General Scheme 13Example 60-Step 1: Procedure for preparation of 60a

[0340] A mixture of 50g (0.5 g, 1.24 mmol, 1 eq), N-isopropyl-N-methylpropan-2-amine (481.17 mg, 3.72 mmol, 648.48 μL, 3 eq), carbonyldiimidazole (301.85 mg, 1.86 mmol, 1.5 eq) and N,N-dimethylpyridin-4-amine (75.81 mg, 620.51 μmol, 0.5 eq) in tetrahydrofuran (10 mL) was stirred at 25°C for 30 min. Then to this solution methanamine (2 M, 3.10 mL, 5 eq) was added. The reaction was stirred at 25°C for 1.5 h., diluted with water (30 mL) and extracted with ethyl acetate (10 mL x 3). The combined organic layers were washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate=2 / 3 to 1 / 1) to give 60a (2-(2-(benzyloxy)acetamido)-5-(3- chlorobenzyl)thiazol-4-yl)methyl methylcarbamate (0.3 g, yield 49.93%, purity 95%) as a white solid. 1H NMR (400 MHz, DMSO-d6) δ ppm 12.10 - 12.00 (m, 1H), 7.37 - 7.28 (m, 8H), 7.23 (br d, J = 7.6 Hz, 1H), 7.05 (br d, J = 4.4 Hz, 1H), 5.02 (s, 2H), 4.55 (s, 2H), 4.19 (d, J = 8.4 Hz, 4H), 2.57 (d, J = 4.8 Hz, 3H) Step 2: Procedure for preparation of 60b

[0341] To a solution of 60a (0.15 g, 326.13 μmol, 1 eq) in dichloromethane (3 mL) was added boron trichloride (114.64 mg, 978.38 μmol, 127.23 μL, 3 eq) at -78°C. The reaction was stirred at -78°C for 2 h. and was quenched by adding aqueous sodium bicarbonate solution (20 mL) and extracted with dichloromethane (6 mL x 3). The combined organic layers were washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to give a residue. This residue was used in the next step without purification. 60b (5-(3-chlorobenzyl)-2-(2-hydroxyacetamido)thiazol-4-yl)methyl methylcarbamate (0.1 g, 78.77% yield, 95% purity) was obtained as a white solid.1H NMR (400 MHz, DMSO-d6) δ ppm 11.78 - 11.67 (m, 1H), 7.39 - 7.19 (m, 5H), 7.09 - 7.02 (m, 1H), 5.01 (s, 2H), 4.17 (s, 2H), 4.07 (s, 2H), 2.57 (br d, J = 4.0 Hz, 3H) Step 3: Procedure for preparation of the compound 60

[0342] To a solution of 60b (0.1 g, 270.40 μmol, 1 eq) and N-isopropyl-N-methylpropan-2- amine (52.42 mg, 405.60 μmol, 70.65 μL, 1.5 eq) in dichloromethane (2 mL) was added N- methylsulfamoyl chloride (42.04 mg, 324.48 μmol, 1.2 eq) at 0 °C. The reaction mixture was stirred at 25 °C for 2 h. and was then diluted with water (10 mL) and extracted with dichloromethane (3 x 3 mL). The combined organic layers were washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (column: CD07-Daisogel SP-100-8-ODS-PK 150 x 25 x 10um; mobile phase: [water( NH4HCO3)-ACN]; gradient: 30%-60% B over 10 min) to give the title compound 602-((5-(3-chlorobenzyl)-4-(((methylcarbamoyl)oxy)methyl)thiazol-2- yl)amino)-2-oxoethyl methylsulfamate (23.42 mg, 18.36% yield, 98.11% purity) as a white solid. 1H NMR (400 MHz, DMSO-d6) δ ppm 7.37 - 7.26 (m, 3H), 7.22 (br d, J = 7.6 Hz, 1H), 7.06 (br d, J = 4.4 Hz, 1H), 5.03 (s, 2H), 4.71 (s, 2H), 4.18 (s, 2H), 2.62 - 2.54 (m, 6H)

[0343] The following example was prepared using Scheme 13. LC-MS +General Scheme 14

[0344] To a solution of 50g (0.32 g, 794.25 μmol, 1 eq) in dichloromethane (3 mL) was added manganese dioxide (691 mg, 7.94 mmol, 10 eq). The reaction mixture was stirred at 40 °C for 2 h. and was then filtered and concentrated to get 58a 2-(benzyloxy)-N-(5-(3-chlorobenzyl)- 4-formylthiazol-2-yl)acetamide (0.31 g, yield 97.36%) as a yellow solid. 1H NMR (400 MHz, DMSO-d6) δ ppm 12.39 (s, 1H), 10.04 (s, 1H), 7.44 - 7.25 (m, 9H), 4.56 (d, J = 3.6 Hz, 4H), 4.24 (s, 2H) Step 2: Procedure for preparation of 58b

[0345] To a solution of 58a (0.28 g, 698.47 μmol, 1 eq) in dichloromethane (3 mL) was added sodium triacetoxyborohydride (296 mg, 1.40 mmol, 2 eq) and morpholine (67 mg, 768.31 μmol, 67.61 μL, 1.1 eq). The reaction was stirred at 20°C for 2 h. and was then diluted with water (10 mL) and extracted with ethyl acetate (3 × 3 mL). The combined organic layers weredried over Na2SO4,filtered and concentrated in vacuo to give a residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 3 / 1) to get 58b 2- (benzyloxy)-N-(5-(3-chlorobenzyl)-4-(morpholinomethyl)thiazol-2-yl)acetamide (0.3 g, yield 91.00%) as a white solid. 1H NMR (400 MHz, DMSO-d6) δ ppm 10.77 - 10.58 (m, 1H), 7.43 - 7.23 (m, 9H), 4.57 (s, 2H), 4.40 (br s, 2H), 4.30 - 4.22 (m, 4H), 3.97 (br d, J = 12.4 Hz, 2H), 3.76 (br t, J = 11.6 Hz, 2H), 3.47 (br d, J = 10.4 Hz, 2H), 3.25 - 3.16 (m, 2H) Step 3: Procedure for preparation of 58c

[0346] To a solution of 58b (300 mg, 635.60 μmol, 1 eq) in dichloromethane (3 mL) was added boron trichloride (223.42 mg, 1.91 mmol, 247.97 μL, 3 eq) at -78°C. The reaction mixture was stirred at -78°C for 1 h. and was then quenched by adding methanol (5 mL). The resulting solution was concentrated in vacuo to get 58c (N-(5-(3-chlorobenzyl)-4- (morpholinomethyl)thiazol-2-yl)-2-hydroxyacetamide (240 mg, yield 98.88%) as a colourless oil. 1H NMR (400 MHz, DMSO-d6) δ ppm 11.43 - 11.00 (m, 1H), 7.46 - 7.27 (m, 6H), 4.38 (s, 2H), 4.30 (s, 2H), 4.11 (s, 2H), 3.90 - 3.74 (m, 4H), 3.50 - 3.43 (m, 2H), 3.21 (br s, 2H) Step 4: Procedure for preparation of the compound 58

[0347] To a solution of 58c (0.1 g, 261.86 μmol, 1 eq) in dichloromethane (1 mL) was added N,N-dimethylformamide (50.77 mg, 392.80 μmol, 68.42 μL, 1.5 eq) and N-methylsulfamoyl chloride (135.71 mg, 1.05 mmol, 4 eq) at 0°C. The solution was stirred at 20°C for 2 h. before being quenched with water (10 mL). The crude reaction was extracted with ethyl acetate (3 × 2 mL), dried over Na2SO4, filtered and concentrated in vacuo. The residue was purified by Prep-HPLC (column: CD07-Daisogel SP-100-8-ODS-PK 150x25x10 μm; mobile phase: [water (NH4HCO3)-ACN];gradient:34%-64% B over 10 min) to afford the title compound 58 2-((5-(3-chlorobenzyl)-4-(morpholinomethyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate (12.98 mg, yield 10.23%) as a white solid. 1H NMR (400 MHz, DMSO-d6) δ ppm 12.61 - 12.10 (m, 1H), 8.04 - 7.75 (m, 1H), 7.42 (s, 1H), 7.37 - 7.31 (m, 1H), 7.31 - 7.23 (m, 2H), 4.70 (s, 2H), 4.14 (s, 2H), 3.54 (br t, J = 4.4 Hz, 4H), 3.50 (s, 2H), 2.60 (s, 3H), 2.39 (br s, 4H)

[0348] The following example was prepared using Scheme 14. LC-MS +General Scheme 15

[0349] To a solution of 52a (1.7 g, 4.22 mmol, 1 eq) in dichloromethane (50 mL) was added manganese (IV) oxide (7.34 g, 84.39 mmol, 20 eq). The mixture was stirred at 25 °C for 4 h. after which the suspension was filtered and concentrated under reduced pressure to give 52b 2-(benzyloxy)-N-(5-(3-chlorobenzoyl)-4-methylthiazol-2-yl)acetamide (130 mg, 32.09% yield) as a colourless oil. 1H NMR (400 MHz, DMSO-d6) δ ppm 12.62 (br s, 1H), 7.80 - 7.64 (m, 3H), 7.63 - 7.55 (m, 1H), 7.42 - 7.27 (m, 5H), 4.59 (s, 2H), 4.30 (s, 2H), 2.43 (s, 3H). Step 2: Procedure for preparation of 52c

[0350] To a solution of titanium(IV) chloride (1.91 g, 9.98 mmol, 8 eq) in dichloromethane (10 mL) was added dimethylzinc (1 M, 8 eq) at -40°C, and then 52b (500 mg, 1.25 mmol, 1 eq) was added into the mixture. The reaction was stirred at -40°C for 3 h. after which it was poured into ice-water (20 mL) and extracted with dichloromethane (3 x 20 mL). The combined organic fractions were dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 1 / 1) to get 52c N-(5-(2-(3-chlorophenyl)propan-2-yl)-4-methylthiazol-2-yl)-2-hydroxyacetamide (130 mg, 32.09% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) δ ppm 11.45 (br s, 1H), 7.43 - 7.26 (m, 4H), 5.50 - 5.46 (m, 1H), 4.09 (d, J = 6.4 Hz, 2H), 1.72 (s, 3H), 1.67 (s, 6H). Step 3: Procedure for preparation of the compound 52

[0351] To a solution of 52c (60 mg, 184.71 μmol, 1 eq) in dichloromethane (1 mL) was added N-ethyl-N-isopropylpropan-2-amine (23.87 mg, 184.71 μmol, 1 eq) and N-methylsulfamoyl chloride (71.80 mg, 554.14 μmol, 3 eq). The reaction was stirred at 0 °C for 1 h., diluted with water (2 mL) and extracted with dichloromethane (3 x 2 mL). The combined organic layers were concentrated under reduced pressure to give a residue. The residue was purified by prep-HPLC (column: CD02-Waters Xbridge BEH C18 150 × 25 × 10 um; mobile phase: [water(NH3H2O)-ACN]; gradient:35%-65% B over 10 min) to give the title compound 522-((5- (2-(3-chlorophenyl)propan-2-yl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate (15.52 mg, 20.10% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) δ ppm 7.39 - 7.32 (m, 1H), 7.31 - 7.21 (m, 3H), 4.72 (s, 2H), 2.63 (s, 3H), 1.73 (s, 3H), 1.67 (s, 6H). The following example was prepared using Scheme 15. LC-MS +General Scheme 16Cl56-1 56-2

[0352] To a solution of 56-1 (150 mg, 372.31 μmol, 1 eq) in DCM (1.5 mL) was added Dess- Martin periodinane (236.87 mg, 558.46 μmol, 1.5 eq) at 0°C. The reaction was stirred at 20°C for 12 h. and was then poured into water and extracted with DCM (3 x 2 mL). The organic layer was washed with brine (3 x 2 mL) and dried over Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The crude product was purified by prep-TLC (PE: EA = 5: 1, Rf = 0.5) to give 56-2 (2-(benzyloxy)-N-(5-(3-chlorobenzyl)-4-formylthiazol-2- yl)acetamide) (80 mg, 53.60% yield) as a yellow solid. LCMS (ESI+): m / z: 401.0 Step 2: Procedure for preparation of 56-3

[0353] To a solution of 56-2 (80 mg, 199.56 μmol) in DCM (1 mL) was added dropwise BCl3 (1 M, 598.69 μL) at 0 °C. The reaction was stirred at 20°C for 2 h. and was quenched with MeOH (1 mL) at 0°C. The resulting solution was concentrated under reduced pressure at 40°C to give 56-3 (N-(5-(3-chlorobenzyl)-4-formylthiazol-2-yl)-2-hydroxyacetamide) (30 mg, 48.38% yield, LCMS (ESI+): m / z: 311.2) as a yellow solid that was used directly in the next step. Step 3: Procedure for preparation of 56

[0354] To a solution of 56-3 (30 mg, 96.54 μmol) and N-methylsulfamoyl chloride (15.01 mg, 115.85 μmol) in DCM (0.5 mL) was added TEA (29.31 mg, 289.62 μmol, 40.31 μL) at 0°C. The mixture was stirred at 20°C for 2 h, quenched with methanol and concentrated in vacuo. The residue was purified by Prep-HPLC (column: Waters Xbridge Prep OBD C18150 x 40 mm x 10 μm; mobile phase: [H2O (10 mM NH4HCO3)-ACN]; gradient: 25% - 55% B over 8.0 min) to give 56 (2-((5-(3-chlorobenzyl)-4-formylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate) (4.00 mg, purity 98.72%) as a white solid. 1H NMR (400 MHz, DMSO-d6) δ (ppm) 12.22 - 13.11 (m, 1H), 10.04 (s, 1H), 7.94 (br s, 1H), 7.38 - 7.42 (m, 1H), 7.30 - 7.38 (m, 2H), 7.26 - 7.30 (m, 1H), 4.75 (s, 2H), 4.56 (s, 2H), 2.60 (s, 3H)

[0355] The following example was prepared using Scheme 16. LC-MS +General Scheme 17:Example 61-Step 1: Procedure for preparation of 61b

[0356] To a solution of 61a (1 g, 5.18 mmol, 1 eq) and 3-chlorophenol (799.04 mg, 6.22 mmol, 656.03 μL) in acetone (10 mL) was added cesium carbonate (3.38 g, 10.36 mmol, 2 eq). The mixture was stirred at 55 °C for 2 h. LCMS showed the starting material was consumed and 63% of the desired product mass was detected. The reaction mixture was quenched with water (20 mL) at 0°C, and extracted with ethyl acetate 60 mL (3 x 20 mL). The combined organic layers were washed with brine (50 mL), dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (petroleum ether / ethyl acetate = 1 / 1) to give 61b (5-(3-chlorophenoxy)-4- methylthiazol-2-amine) (800 mg, yield 56.14%) was obtained as a white solid.1H NMR: (400 MHz, CHLOROFORM-d) δ ppm 7.16 - 7.04 (m, 1H), 6.96 - 6.80 (m, 2H), 6.74 (br dd, J = 1.2, 8.0 Hz, 1H), 2.06 (s, 3H) LCMS (ESI+): m / z: 241.1 Step 2: Procedure for preparation of 61c

[0357] To a solution of 61b (800 mg, 2.91 mmol, 1 eq) and 2-acetoxyacetic acid (515.11 mg, 4.36 mmol) in dimethylformamide (8 mL) was added diisopropylethylamine (563.77 mg, 4.36 mmol, 759.80 μL) and 2-(3H-[1,2,3]triazolo[4,5-b]pyridin-3-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate(V) (2.21 g, 5.82 mmol) at 15 °C. The mixture was stirred at 25 °C for 1 h. The reaction was then quenched by adding water (20 mL) at 0°C, and extracted with ethyl acetate (3 x 30 mL). The combined organic layers were washed with brine (20 mL), dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (petroleum ether / ethyl acetate = 1 / 1) to 61c 2-((5-(3- chlorophenoxy)-4-methylthiazol-2-yl)amino)-2-oxoethyl acetate (600 mg, yield 50.45%) was obtained as a white solid.1H NMR (400 MHz, METHANOL-d4) δ ppm 7.36 - 7.28 (m, 1H), 7.11 (dd, J = 1.2, 8.0 Hz, 1H), 7.01 (t, J = 2.0 Hz, 1H), 6.98 - 6.91 (m, 1H), 4.77 (s, 2H), 2.17 (s, 3H), 2.13 (br s, 3H) LCMS (ESI+): m / z: 341.0 Step 3: Procedure for preparation of 61d

[0358] To a solution of 61c (150 mg, 440.16 μmol) in tetrahydrofuran (2 mL) was added lithium hydroxide in water (1 M, 2 mL) and the reaction was stirred at 25 °C for 2 h. The reaction was then diluted with water (5 mL) at 0 °C and extracted with ethyl acetate 15 mL (3 x 5 mL). The combined organic layers were washed with brine (20 mL), dried over Na2SO4, filtered and concentrated under reduced pressure to give 61d N-(5-(3-chlorophenoxy)-4- methylthiazol-2-yl)-2-hydroxyacetamide (70 mg, yield 25.35%) as a white solid. This was used directly in the next step.1H NMR (400 MHz, METHANOL-d4) δ ppm 7.36 - 7.29 (m, 1H), 7.11 (dd, J = 1.1, 8.0 Hz, 1H), 7.01 (t, J = 2.0 Hz, 1H), 6.98 - 6.91 (m, 1H), 4.77 (s, 2H), 2.13 (br s, 3H) LCMS (ESI+): m / z: 299.1 Step 4: Procedure for preparation of compound 61

[0359] To a solution of 61d (70 mg, 200.84 μmol) and N-methylsulfamoyl chloride (78.07 mg, 602.52 μmol) in dimethylformamide (1 mL) was added diisopropylethylamine (77.87 mg, 104.95 μL) and the reaction was stirred at 20 °C for 1 h. The reaction was then quenched by adding ice-water (5 mL) and extracted with ethyl acetate (5 mL × 3). The combined organic layers were washed with brine (15 mL), dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (column: CD01-Phenomenex luna C18150 x 25 x 10 μm; mobile phase: [water(TFA)-ACN];gradient:41%- 71% B over 10 min) to give the title compound 612-((5-(3-chlorophenoxy)-4-methylthiazol-2- yl)amino)-2-oxoethyl methylsulfamate (37.30 mg, yield 15.25%) as a white solid. 1H NMR (400 MHz, METHANOL-d4) δ ppm 7.37 - 7.30 (m, 1H), 7.12 (dd, J = 0.8, 7.8 Hz, 1H), 7.04 - 7.00 (m, 1H), 6.96 (dd, J = 2.4, 8.4 Hz, 1H), 4.76 (s, 2H), 2.76 (s, 3H), 2.13 (s, 3H) LCMS (ESI+): m / z: 392.1

[0360] The following examples were prepared using Scheme 17. LC-MS +72 2-((5-(3-chloro-5- D 2462 410182 2-((5-(3- D 2647 4202General Scheme 18Example 62-Step 1: Procedure for preparation of 62b

[0361] To a solution of 62a (5 g, 19.33 mmol, 1 eq) and 2-(benzyloxy)acetic acid (3.42 g, 28.99 mmol, 1.5 eq) in dimethyl formamide (50 mL) was added 2-(3H-[1,2,3]triazolo[4,5- b]pyridin-3-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate(V) (14.70 g, 38.65 mmol, 1.5 eq) and diisopropylethylamine (3.75 g, 28.99 mmol, 5.05 mL, 3 eq). The reaction was stirred at 25 °C for 1 h. The solution was quenched by the addition of water (100 mL) at 0°C, and extracted with ethyl acetate (3 x 50 mL). The combined organic layers were washed with brine(150 mL), dried over Na2SO4, filtered and the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (petroleum ether / ethyl acetate = 3 / 1) to give 62b 2-(benzyloxy)-N-(7-oxo-4,5,6,7-tetrahydrobenzo[d]thiazol-2- yl)acetamide (3 g, yield 56.14%) as a white solid.1H NMR: (400 MHz, DMSO-d6) δ ppm 12.58 (br s, 1H), 7.41 - 7.27 (m, 5H), 4.60 (s, 2H), 4.30 (s, 2H), 2.86 (br t, J = 6.4 Hz, 2H), 2.69 (s, 2H), 2.08 (quin, J = 6.4 Hz, 2H). LCMS (ESI+): m / z: 317.1 Step 2: Procedure for preparation of 62c Cl Cl OH62b 62c

[0362] To a solution of 62b (3 g, 12.64 mmol, 1 eq) in tetrahydrofuran (30 mL) was added (3-chlorophenyl)magnesium bromide (1 M, 27.82 mL, 2.2 eq) under N2at -78 °C. The solution was stirred at -78 °C for 3 h. The reaction was then quenched by the addition of water (50 mL) at 0°C and extracted with ethyl acetate 90 mL (3 x 30 mL). The combined organic layers were washed with brine (90 mL), dried over Na2SO4, filtered and the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (petroleum ether / ethyl acetate = 2 / 1) to give 62c 2-(benzyloxy)-N-(7-(3- chlorophenyl)-7-hydroxy-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)acetamide (1.2 g, yield 50.45%) as a white solid1H NMR (400 MHz, DMSO-d6) δ ppm 11.95 (br s, 1H), 7.43 - 7.27 (m, 9H), 6.04 (s, 1H), 4.56 (s, 2H), 4.21 (s, 2H), 2.68 (br t, 2H), 2.00 (m, 3H), 1.77 - 1.65 (m, 1H). LCMS (ESI+): m / z: 429.1 Step 3: Procedure for preparation of 62d

[0363] To a solution of 62c (500 mg, 932.55 μmol, 1 eq) in acetonitrile (5 mL) was added sodium iodide (559.13 mg, 3.73 mmol, 4 eq) and trimethylsilane chloride (405.26 mg, 3.73 mmol, 473.43 μL, 4 eq) at 25°C . The solution was stirred at 50 °C for 1 h. The reaction was then quenched by the addition of water (10 mL) at 0°C and extracted with ethyl acetate 15 mL (3 x 5 mL ). The combined organic layers were washed with brine (15 mL), dried over Na2SO4, filtered and the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by column chromatography (petroleum ether / ethyl acetate = 1 / 1) to give 62d 2-(benzyloxy)-N-(7-(3-chlorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)acetamide (200 mg, yield 50.45%) as a white solid.1H NMR (400 MHz, METHANOL-d4) δ ppm 9.73 - 9.38 (br s, 1H), 7.31 - 7.28 (m, 3H), 7.25 (br s, 1H), 7.18 (s, 1H), 7.13 (s, 2H), 7.07 (s, 1H), 6.98 (br d, J = 6.0 Hz, 1H), 4.55 (s, 2H), 4.06 (s, 2H), 4.02 (br s, 1H), 2.20 - 2.07 (m, 2H), 1.96 - 1.84 (m, 2H), 1.73 (m, 2H). LCMS (ESI+): m / z: 413.1 Step 4: Procedure for preparation of compound 62e

[0364] To a solution of 62d (200 mg, 363.26 μmol, 1 eq) in dichloromethane (2 mL) was added boron trichloride (425.63 mg, 3.63 mmol, 10 eq) under N2and then the mixture was stirred at -78 °C for 1 h. The reaction mixture was quenched by the addition of water (5 mL) at 0°C and extracted with ethyl acetate 15 mL (3 x 5 mL). The combined organic layers were washed with brine (15 mL), dried over Na2SO4, filtered and the filtrate was concentrated under reduced pressure to give 62e N-(7-(3-chlorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)-2- hydroxyacetamide (100 mg, yield 85.28%) as a white solid. This was used directly in the nextstep. 1H NMR (400 MHz, METHANOL-d4) δ ppm 7.24 (br d, J = 9.6 Hz, 3H), 7.10 (br d, J = 6.4 Hz, 1H), 4.22 (br s, 2H), 4.11 (br s, 1H), 2.73 (br s, 2H), 2.19 (br s, 1H), 1.96 (br s, 1H), 1.79 (br s, 2H) LCMS (ESI+): m / z: 323.1 Step 5: Procedure for preparation of 62 Cl Cl62e62

[0365] To a solution of 62e (100 mg, 309.78 μmol, 1 eq) and N-methylsulfamoyl chloride (80.27 mg, 619.56 μmol, 2 eq) in dimethyl formamide (1 mL) was added diisopropylethylamine (80.07 mg, 619.56 μmol, 1.5 eq). The reaction was stirred at 0 °C for 2 h. The solution was then quenched by the addition of water (5 mL) at 0°C and extracted with ethyl acetate 15 mL (3 x 5 mL). The combined organic layers were washed with brine (15 mL), dried over Na2SO4, filtered and the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (column: CD01-Phenomenex luna C18150 x 25 x 10 μm; mobile phase: [water(FA)-ACN]; gradient:40%-70% B over 8 min) to give the title compound 62 2-((7-(3-chlorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl methylsulfamate (23.67 mg, yield 15.52%) as a white solid. 1H NMR (400 MHz, CHLOROFORM-d) δ ppm 7.26 - 7.20 (m, 2H), 7.16 (s, 1H), 7.07 (br d, J = 6.0 Hz, 1H), 5.79 - 5.53 (m, 1H), 4.77 (s, 2H), 4.11 (br s, 1H), 2.92 (s, 3H), 2.76 (br s, 2H), 2.28 - 2.21 (m, 1H), 2.05 - 1.97 (m, 1H), 1.88 - 1.80 (m, 2H). LCMS (ESI+): m / z: 416.1

[0366] The following examples were prepared using Scheme 18. LC-MS +2-((7-(3-The following compounds were also prepared in a similar fashion using Scheme 18. Exam le Structure Chemical name LC-MS LC-MS Mass +oxoethl 4-98 2-((7-(3-chloro-4- D 2123 4912106 2-((7-(3-chloro-4- D 2504 4342The following compounds were also prepared in a similar fashion using Scheme 18. LC-MS s d )+1 0 0113 2-((7-(3-chloro-4- E 1575 4350 1 0LCMS Method A: InstrumentLCMS Method B: ILCMS Method C: Method name 10-80CD 4MIN Poroshell HPH 15LCMS Method D: Instrument A ilent 1290 LC & A ilent 6125C MSDLCMS Method E:

[0367] 5_95AB_6min-220-254:LC / MS( The gradient was 5%B in 0.40min and 5-95% B in 2.60 min , hold on 95% B in 1.00min, and then 95-5%B in 0.01min, the flow rate was 1.0 ml / min. Mobile phase A was 0.04% Trifluoroacetic Acid in water, mobile phase B was 0.02% Trifluoroacetic Acid in acetonitrile. The column used for chromatography was a Halo C18, 3.0*30mm column (5um particles). Detection methods are diode array (DAD) detection .MS mode was positive electrospray ionization. MS range was 100-1000. LCMS Method F:

[0368] NEG5_95CD_6min-220-254-ELSD:LC / MS (The gradient was 5%B in 0.40min and 5-95% B at 0.40-3.40 min ,hold on 95% B for 0.45 min, and then 95-5%B in 0.01min, the flow rate was 0.8 ml / min. Mobile phase A was H2O+10 mM NH4HCO3, mobile phase B was Acetonitrile. The column used for chromatography was a Xbridge Shield RP182.1*50 mm column (5um particles). Detection methods are diode array (DAD) and evaporative light scattering (ELSD) detection as well as positive electrospray ionization (MS).) MS range was 100-1000. LCMS Method G: Instrument A ilent 1260 LC & A ilent 6125C MSDLCMS Method H: 5_95CD_6min-220-254-ELSD:LC / MS( The gradient was 5%B in 0.40min and 5-95% B at 0.40-3.40 min ,hold on 95% B for 0.45min, and then 95-5%B in 0.01min, the flow rate was 0.8 ml / min. Mobile phase A was H2O+10mM NH4HCO3, mobile phase B was Acetonitrile. The column used for chromatography was a Xbridge C18 2.1*50mm column (5um particles). Detection methods are diode array (DAD) and evaporative light scattering (ELSD) detection. MS mode was positive electrospray ionization. MS range was 100-1000.LCMS Method I: Method name WUXIAB00 )BIOLOGICAL EXAMPLES Biological Example A - MutSβ AssayTitle MutSβ ADP Glo Assa Protocol )Reagents MutSβ (supplied by AMRI) stored at -70°C ADP Glo Kinase Assay Kit (Promega: V9102) stored at -20°C ATP (supplied within the ADP Glo Kit) stored at -20°C 1M KCl (Sigma Aldrich: P9333) stored at 2-8°C 1 M HEPES pH 7.5 (Gibco: M15630-080) stored at 2-8°C 1M MgCl2 (Sigma Aldrich: M1028-100mL) stored at 2-8°C Tween-20 (Sigma Aldrich: P1379) (10% solution) stored at 2-8°C 500mM DTT (Sigma Aldrich: 10197777001) stored at -20°C CAG loop DNA for MutSβ (made in house) stored at -20°C MilliQ water stored at room temperature Buffer preparation (final conditions): Com onent Final ConcentrationReaction Mix for MutSβStandard Operating Procedure for MutSβ assay 1. Prepare the buffer fresh each day 2. Take the enzyme from the freezer, thaw in room temperature water and centrifuge at 13,000 rpm for 10 minutes at 2-8C, then make up enzyme and ATP stocks 3. Quality Control the multidrop head to a %CV of <2% 4. Add 3µL of 33.34nM MutSβ and 50.01nM CAG looped DNA solution (final concentrations) to each well in columns 1 and 3-23 of the plate 5. Pre-incubate the MutSβ and buffer mix for 10 minutes with the compounds 6. Wash the multidrop head through with MilliQ water (for at least 30 seconds) 7. Add 3µL of MutSβ Assay buffer (without enzyme) to columns 2 and 24 for the vehicle controls 8. Wash the multidrop head through with MilliQ water (for at least 30 seconds) 9. Add 2µL of 62.5µM ATP to each well of the whole plate, then wash with MilliQ water (for a minimum of 30 seconds) 10. Centrifuge plate for 1 minute at 1000 rpm 11. Incubate for 2 hours at room temperature 12. Add 5µL of ADP Glo reagent to each well of the whole plate and wash the multidrop head with MilliQ water (for a minimum of 30 seconds) 13. Incubate for 40 minutes at room temperature (minimum requirement) 14. Add 10µL of Kinase Detection Reagent to each well of the whole plate 15. Wash the multidrop head with MilliQ water more than 1 minute and then dry 16. Remove the head and put the cover back on for overnight storage 17. Incubate for 30 minutes at room temperature (minimum requirement) 18. Read on a microplate reader CAG Looped DNA sequence 5' TCATCGATCGCAGGCTTCAGATAGG 3' SEQ ID 1 3' GGTAGCTAGC CGAAGTCTATCTCC 5' SEQ ID 2Key:Biological Example B - LoQ Assay Data Materials and Methods

[0369] The cell line that was used in the assay below was generated as follows: Construct generation

[0370] The pcDNA™4 / TO vector contains two tetracycline operator 2 (TetO2) sites within the human cytomegalovirus immediate-early (CMV) promoter for tetracycline regulated expression of your gene of interest (Yao et al., 1998). The TetO2 sequences serve as binding sites for four Tet repressor molecules (comprising two Tet repressor homodimers) and confer tetracycline-responsiveness to the gene of interest. In the absence of tetracycline, expression of your gene of interest is repressed by the binding of Tet repressor homodimers to the TetO2 sequences. Addition of tetracycline to the cells de-represses the hybrid CMV / TetO2 promoter in pcDNA™4 / TO and allows expression of your gene of interest. The pcDNA™6 / TR regulatory plasmid is designed for use with the T-REx™ System for tetracycline-regulated expression of the gene of interest in mammalian cells. (www.lifetechnologies.com).

[0371] The expression sequence comprises exon 1 huntingtin with ~100 pure CAG repeats, a P2A self-cleaving peptide and a nanoluc sequence followed by a polyA signal. Full plasmid sequence is indicated (Seq ID NO:3). The plasmid contains sequences for ampicillin (bacterial propagation) and zeocin (mammalian cell lines) resistance.

[0372] Cell culture

[0373] The U-2 OS cell line (purchased from LGC standards, ATCC) is derived from a moderately differentiated sarcoma from the tibia of an adolescent female. Karyotyping has shown that although there are a lot of chromosomal abnormalities the tumour suppressor genes p53 and pRb are still fully functional in the U2OS cell line.

[0374] Routine culture of the adherent cells in non-PDL plastic ware in a humidified 37^C incubator with 5% CO2. Cells were maintained in McCoy’s 5A (modified) medium with GlutaMAX supplement (Life Technologies 3660-021) and tetracycline-free FBS (Clontech 631106). Maintenance medium for the clonal cell lines expressing Tet repressor and exon 1 HTT / nanoluc constructs were additionally supplemented with zeocin to 100 ug / ml and blasticidin to 1.25 ug / ml. Cells were passaged at 70-80% confluence once or twice a week, either to a split ratio or defined seeding density using DPBS and TrypLE express enzyme (1x, no phenol red, Life technologies 12604-039) was used to dissociate the cells. Cells were frozen with Cell Banker (AMSBIO 11891) or with medium plus 10% DMSO and stored in liquid nitrogen vapour phase. Compound treatment protocol

[0375] Stable, clonal cell lines (e.g. 1C6) are leveraged either identify potential druggable targets, and to assess the effectiveness of therapeutic compounds against a Huntington’sdisease, by way of quantifying CAG repeats expansion rates. Materials Cell culture • Trypan Blue Gibco™ (Cat# 15250061) • Nexcelom counting slides Nexcelom (Cat# SD100) • Penicillin-Streptomycin (P / S) (10,000 U / mL) Gibco™ (Cat# 15140122) • McCoys 5A (Modified) medium Gibco™ (Cat# 16600082) • Tet-System Approved FBS Gibco™ (Cat# A47362-01) • Zeocin® 100 mg / mL Invivogen (Cat# ant-zn- 05) • Blasticidin 10 mg / mL Invivogen (Cat# ant-bl-05) • Puromycin 10 mg / mL Invivogen (Cat# ant-pr-1) • 0.25% Trypsin EDTA Gibco™ (Cat# 15050065) • PBS -MgCl2-CaCl2Gibco™ (Cat# 10010023) • Freezing Medium Cryo-SFM Sigma Aldrich (Cat# C- 29912) Compound Treatment ^ Tetracycline Gibco™ (Cat# A39246) ^ Test compounds ^ DMSO Fisher (Cat# BP231-100) 2.3 DNA extraction ^ Quick-DNA™ 96 Kit™ 10 x 96 preparations Zymo (Cat# D3012) ^ Quick-DNA Microprep Plus Kit Zymo (Cat# D4074) ^ Β-mercaptoethanol MP (Cat# 190242) 2.4 Consumables ^ Centrifuge tubes ^ 50 mL falcon tubes ^ 96-well flat bottom microplates (sterile) ^ 96-well white opaque microplates ^ T75 culture flasks ^ Sterile 100 mL single use reservoirs ^ Cryovials ^ Foil Plate seals 2.5 Instrumentation ^ T4 Automated cell counter Nexcelom ^ GloMAX Explorer Promega®Method All work should be conducted under aseptic sterile technique, in a laminar flow hood. Cell Thawing, Passaging, and Freezing 3.1.1 Thawing: ^ Place a vial of the cell line U20S-IC6 (1-2x106cells / mL), produced as described above, in a water bath at 37°C for 30 s. Once thawed, quickly transfer the cells into a 15 mL falcon tube containing 9 mL of McCoys 5A media, supplemented with 10% Tet-free FBS. ^ Pellet the cells by centrifugation at 300 x g for 5 m and discard the supernatant. ^ Resuspend the cell pellet in 10 mL fresh media and transfer to a sterile T75 culture flask. ^ Inspect the culture after 24 h and maintain the cells below 80% confluency, typically passaging every 3-4 days. 3.1.2 Passaging: ^ To passage cells, aspirate the media and wash once with 2 mL PBS. ^ Aspirate the PBS and add 2 mL 0.25% Trypsin EDTA for 2 m at 37°C or until the cells detach. ^ Resuspend the detached cells with 8 mL McCoys 5A, 10% Tet-Free FBS (total volume 10 mL), and transfer to a 50 mL Falcon tube. ^ Centrifuge the cell suspension at 300 x g for 5 m to pellet the cells. ^ Aspirate the supernatant and resuspend the cell pellet in 10 mL McCoys 5A, 10% Tet-Free FBS. ^ Perform a ratio split (typical 2:10) by transferring 2 mL of the cell suspension to a fresh T75 flask and add 8 mL McCoys 5A, 10% Tet-Free FBS. ^ Return the passaged culture to the incubator at 37°C, 5% CO2. 3.1.3 Freezing: ^ Aspirate the media from a T75 flask of U20S-IC6 and wash once with 2 mL PBS. ^ Aspirate the PBS and add 2 mL 0.25% Trypsin EDTA for 2 m at 37°C or until the cells detach. ^ Resuspend the detached cells with 8 mL McCoys 5A, 10% Tet-Free FBS (total volume 10 mL), and transfer to a 50 mL Falcon tube. ^ Take a 60 µL sample of the cell suspension into a fresh 1.5 mL Eppendorf tube and add 20 µL Trypan Blue. Mix and transfer 20 µL of the solution to a clean cell counting slide to determine the cell count per mL and the overall viability. ^ Centrifuge the cell suspension at 300 x g for 5 m to pellet the cells. ^ Aspirate the supernatant and resuspend the cell pellet in sufficient CryoSFM media to achieve a cell count of 1-2 x 106cells / mL. Alternatively, complete media supplemented with 10% DMSO can be used for cryopreservation. ^ Aliquot the cell suspension in 1 mL volumes into labelled cryovials and transfer to a -80°C freezer in a Mr Frosty container.Lo-Q platform Assay for Candidate Compounds The Lo-Q platform has been optimised to run as a 2-week assay, following the standard processes detailed in the schematic in Figure 1A. Assay initiation - Cell seeding: ^ Cell seeding for Lo-Q platform assays should be initiated on Mondays (am) to ensure Tetracycline pulsing can be maintained every other day. ^ The Friday prior to initiating any Lo-Q platform assay ensure there are sufficient cells in culture to seed the required number of assay plates. If required, passage the cells, otherwise perform a media change to McCoys 5A, 10% Tet-free FBS, 1.25 µg / mL Blasticidin®, and 100 µg / mL Zeocin®. ^ On the Monday morning, aspirate the media from the required number of culture flasks containing U20S-IC6 cells and wash with 2 mL PBS. ^ Aspirate the PBS and add 2 mL 0.25% Trypsin EDTA. Incubate the plate at 37°C for ~2 m, or until >90% of the cells have detached. ^ Resuspend the detached cells with 8 mL McCoys 5A, 10% Tet-Free FBS (total volume 10 mL), and transfer to a 50 mL Falcon tube. ^ Take a 60 µL sample of the cell suspension into a fresh 1.5 mL Eppendorf tube and add 20 µL Trypan Blue. Mix and transfer 20 µL of the solution to a clean cell counting slide. Determine the cell count per mL and the overall viability. ^ Dilute a sufficient volume of the cell suspension in McCoys 5A, 10% Tet-Free FBS, to achieve a cell density of 5,000 cells / well at a volume of 200 µL per well of a 96- well plate (25,000 cells / mL). ^ Using sterile clear flat bottom 96-well plates, fill the top row (A1-12) with 200 µL PBS. These wells must be kept empty for subsequent downstream analysis processing purposes. ^ Next, transfer the diluted cell suspension to a sterile reservoir and using a 1250 µL multichannel integra, pipette 200 µL per well of the clear flat bottom 96-well plates (rows B-H). ^ Place the seeded 96-well plates in an incubator at 37°C, 5% CO2, for ~24 h. ^ At least 3 ‘day 0’ samples should be taken at this point. Using the leftover cells from the trypsinised T75 flasks, prepare 3 x 1.5 mL Eppendorf tubes containing a minimum of 3 x 105cells. ^ Centrifuge the tubes to pellet the cells and remove the supernatant. ^ Store the cell pellets at -80°C until ready to extract the DNA using a Quick-DNA Microprep Plus Kit from Zymo, according to the manufacturer’s instructions. Initial compound stocks preparation: ^ Approximately 24 h after cell seeding, reconstitute the test compounds in DMSO to a concentration of 30 mM. in this case compound example 10 was used having structure:^From this 30 mM stock, prepare ½ log serial dilutions in DMSO, typically a 5 point dilution series, (10 mM, 3 mM, 1 mM, 0.3 mM, and 0.1 mM). See table below for typical volumes for a 2-week experiment. Initial Compound Pre-treatment:

[0376] The test compounds are added to the cells approximately 24 h prior to the first Tetracycline pulse. This ensures that potential effects of slower acting compounds are not obscured by the quick de-repression of the CAG expansion by the additional of the Tetracycline. For each instance of Tetracycline pulsing, the test compounds are refreshed. ^ Using a fresh sterile 96-well plate, prepare an intermediate compound dilution of each of the 6 DMSO stocks created in section 3.2.2. ^ Create the intermediate stocks by diluting 2 µL of each DMSO stock in 18 µL McCoys 5A, 10% Tet-Free FBS. See Figure 1B. ^ Next, using the repeat dispense function of a 12.5 µL integra digital pipette, dispense 2 µL of each intermediate compound dilution or DMSO control into triplicate wells of the 96-well plates containing the U20S-IC6 cells seeded 24 h prior. See example plate layout in Figure 1C. ^ Return the treated 96-well plates to the incubator for ~24 h at 37°C, 5% CO2. Initial Tetracycline Pulse: ^ Approximately 24 h post initial compound pre-treatment, prepare the intermediate compound dilution plate again, in the same manner as for 3.2.3, and set the plate aside. ^ In the meantime, perform a media change on the 96-well plates pre-treated with test compound, replacing all media, except for the ‘no Tet’ control, with 198 µL McCoys 5A, 10% Tet-Free FBS, supplemented with 2 x Tetracycline (2 µg / mL). For the ‘no Tet’ control wells, replace the media with 198 µL McCoys 5A, 10% Tet-Free FBS. ^ Immediately after media change, re-add the intermediate test compound dilutions as previously described in 3.2.3 and return the plate to the incubator for ~48 h. Tetracycline Pulse & stable clone maintenance:

[0377] To ensure that the U20S-IC6 clonal cell line retains expression of the 2 stably transfected Lo-Q platform plasmid constructs, the cells must be exposed to the relevant section antibiotics for a 72 h period every 7 days of the assay.^ Approximately 48 h (Friday) after the initial Tetracycline pulse, perform another media change in the same manner as 3.2.4, but ensure all media is additionally supplemented with 1.25 µg / mL Blasticidin®, and 100 µg / mL Zeocin®. ^ After the media change, prepare and add the intermediate compound dilutions as before and return the plate to the incubator for ~72 h. Standard Lo-Q Platform Assay Process: ^ After the first week of the assay, the standard process should be followed is outlined in Figure 1D. Passaging Lo-Q Platform plates: ^ Cells should be passaged every Monday at a 1 / 8 dilution unless visual observation by light microscope reveals impeded proliferation, or cytotoxicity. ^ Prior to performing any cell passaging, prepare the intermediate compound dilution plate as per 3.2.4. Set the plate aside until required after passaging is complete. ^ Next, using a multi-channel 300 µL integra pipette, aspirate the media from each triplicate, using a custom multi aspirate and dispense function. Do not use the same pipette tips for different treatment condition triplicates. ^ Wash the cells once with 200 µL PBS. ^ Detach the cells by adding 25 µL of 0.25% Trypsin EDTA to each well and incubating for 2-3 m at 37°C. Ensure the >95% of the cells have detached before quenching with media. If necessary, tap the 4 sides of the plate gentle to detach persistent cells. ^ During trypsinisation prepare fresh 96-well plates for seeding. Add 175 µL of appropriate media to each well. Adjust this volume if the passage ratio has been altered due to the confluency of the condition in question. The ‘No Tet’ control and all other conditions should receive McCoys 5A, 10% Tet-Free FBS and McCoys 5A, 10% Tet-Free FBS, 2 x Tetracycline (2 µg / mL) respectively. Ensure the top row is filled with 200 µL PBS. ^ Quench the trypsinisation by adding 175 µL of appropriate media to the wells. ^ To perform the 1 / 8 ratio passage, using a multi-channel P300 pipette, gently mix the quenched cells and transfer 25 µL to the fresh 96-well plates prepared earlier. ^ Immediately add the intermediate dilutions of the test compounds to the newly passage plates as per 3.2.4 and return the plates to the incubator for 48 h at 37 °C, 5% CO2. NanoGlo®: ^ In the first instance of passaging the cells, a NanoGlo® assay can be performed with the leftover unused cells to determine successful Tetracycline activation and infer compound cytotoxicity. ^ Centrifuge the 96-well plates containing the unused cells that were quenched after trysinisation at 300 x g for 5 m. ^ Aspirate the media and add 50 µL fresh McCoys 5A, 10% Tet-free FBS. ^ To each well, add 50 µL NanoGlo® reagent and incubate in the dark for up to 10 m shaking. ^ Transfer the contents of each well to a solid white opaque 96-well plate and measure luminescence on a compatible plate reader (GloMax Explorer).Cell processing for DNA extraction: At the end of the assay period, the cells should be retained for DNA extraction. ^ Centrifuge the 96-well plates of cells at 300 x g for 5 m. ^ Aspirate the media and wash the cells once with PBS. ^ Seal the plate with a foil plate seal and store at -80°C until ready to extract the DNA using the Quick-DNA™ 96 Kit™ from Zymo, according to the manufacturer’s instructions. Candidate Compound treatment plan variation:

[0378] In some instances, the assay described above can be modified to achieve specific compound exposure times during treatment regimes. Compound pulsing for 2, 4, 8, and 24 h can be implemented under the existing assay format, with the following adjustments: ^ Each morning, test compounds are added in the presence of Tetracycline containing media for the desired time. ^ After which the media is removed, the wells washed 1 x with PBS, and 200 µL fresh McCoys 5A, 10% Tet-free FBS + Tetracycline is added. ^ The cells remain in this media until the following morning, when the wells are aspirated, and 200 µL fresh McCoys 5A, 10% Tet-free FBS + Tetracycline is added along with the test compounds. ^ For the 24 h compound pulse, cells will remain in constant contact with test compound and Tetracycline throughout the 2-week assay, with replenishment every morning. ^ Test compound pulse assays require treatments every day for the 2-week period, including the weekend. Therefore, during Friday, Saturday, and Sunday treatments, all media should be additionally supplemented with 1.25 µg / mL Blasticidin®, and 100 µg / mL Zeocin®. Results Minim m ff tiv n ntr ti nKey:SEQUENCES SEQ ID NO:1 5' TCATCGATCGCAGGCTTCAGATAGG 3' SEQ ID NO: 2 3' GGTAGCTAGC CGAAGTCTATCTCC 5' SEQ ID NO: 3 pcDNA4 / TO-100CAG (7160bp) Vector Key: CMV promoter (bold), TetO operator (underline), Exon 1 HTT with 100 CAG repeats (italics), P2A self-cleaving peptide (bold and underline), Nanoluc reporter protein (italics and underline), HSV TK PolyA (bold and italics) 5' GATGTACGGGCCAGATATACGCGTTGACATTGATTATTGACTAGTTATTAATAGTAAT CAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTA CGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAAT AATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGG TGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCA AGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCG CTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTT GACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTG GAACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACG CAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCTCCCTA TCAGTGATAGAGATCTCCCTATCAGTGATAGAGATCGTCGACGAGCTCGTTTAGTGA ACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACAC CGGGACCGATCCAGCCTCCGGACTCTAGCGTTTAAACTTAAGCTTACCATGGCGAC CCTGGAAAAGCTGATGAAGGCCTTCGAGTCCCTCAAGTCCTTCCAGCAGCAGCAGC AGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA GCAGCAGCAGCAGCAGCAACAGCCGCCACCGCCGCCGCCGCCGCCGCCGCCTCC TCAGCTTCCTCAGCCGCCGCCGCAGGCACAGCCGCTGCTGCCTCAGCCGCAGCCG CCCCCGCCGCCGCCCCCGCCGCCACCCGGCCCGGCTGTGGCTGAGGAGCCGCTG CACCGACCAGGTACCGGCAGCGGCGCCACAAACTTCTCTCTGCTAAAGCAAGCAG GTGATGTTGAAGAAAACCCCGGGCCTGGATCCATGGTCTTCACACTCGAAGATTTC GTTGGGGACTGGCGACAGACAGCCGGCTACAACCTGGACCAAGTCCTTGAACAGG GAGGTGTGTCCAGTTTGTTTCAGAATCTCGGGGTGTCCGTAACTCCGATCCAAAGGA TTGTCCTGAGCGGTGAAAATGGGCTGAAGATCGACATCCATGTCATCATCCCGTATG AAGGTCTGAGCGGCGACCAAATGGGCCAGATCGAAAAAATTTTTAAGGTGGTGTAC CCTGTGGATGATCATCACTTTAAGGTGATCCTGCACTATGGCACACTGGTAATCGAC GGGGTTACGCCGAACATGATCGACTATTTCGGACGGCCGTATGAAGGCATCGCCGT GTTCGACGGCAAAAAGATCACTGTAACAGGGACCCTGTGGAACGGCAACAAAATTAT CGACGAGCGCCTGATCAACCCCGACGGCTCCCTGCTGTTCCGAGTAACCATCAACG GAGTGACCGGCTGGCGGCTGTGCGAACGCATTCTGGCGTAAGAATTCCGGCAATAA AAAGACAGAATAAAACGCACGGTGTTGGGTCGTTTGTTCCGTTACATAACTTACGGT AAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGA CGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGT ATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGC CCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGA CCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCAT GGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGG GATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATC AACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTATCGATGCCACCATGGTGAGC AAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCG ACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTA CGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGC CCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGAC CACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGA GCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGT TCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGA GGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCT ATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCAC AACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCAT CGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCC CTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGAC CGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGGCTCGAGTCTAGAGG GCCCGTTTAAACCCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGT TGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCT TTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTG GGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGG CATGCTGGGGATGCGGTGGGCTCTATGGCTTCTGAGGCGGAAAGAACCAGCTGGG GCTCTAGGGGGTATCCCCACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGT GGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTT TCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAA ATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAA AACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTC GCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAA CAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTC GGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTAATTCTGT GGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGT ATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCC CCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCG CCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCC CCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCTGCCTCTGA GCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCT CCCGGGAGCTTGTATATCCATTTTCGGATCTGATCAGCACGTGTTGACAATTAATCAT CGGCATAGTATATCGGCATAGTATAATACGACAAGGTGAGGAACTAAACCATGGCCA AGTTGACCAGTGCCGTTCCGGTGCTCACCGCGCGCGACGTCGCCGGAGCGGTCGA GTTCTGGACCGACCGGCTCGGGTTCTCCCGGGACTTCGTGGAGGACGACTTCGCCGGTGTGGTCCGGGACGACGTGACCCTGTTCATCAGCGCGGTCCAGGACCAGGTGG TGCCGGACAACACCCTGGCCTGGGTGTGGGTGCGCGGCCTGGACGAGCTGTACGC CGAGTGGTCGGAGGTCGTGTCCACGAACTTCCGGGACGCCTCCGGGCCGGCCATG ACCGAGATCGGCGAGCAGCCGTGGGGGCGGGAGTTCGCCCTGCGCGACCCGGCC GGCAACTGCGTGCACTTCGTGGCCGAGGAGCAGGACTGACACGTGCTACGAGATTT CGATTCCACCGCCGCCTTCTATGAAAGGTTGGGCTTCGGAATCGTTTTCCGGGACG CCGGCTGGATGATCCTCCAGCGCGGGGATCTCATGCTGGAGTTCTTCGCCCACCCC AACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCAC AAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTAT CTTATCATGTCTGTATACCGTCGACCTCTAGCTAGAGCTTGGCGTAATCATGGTCAT AGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCG GAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTG CGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAA TGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTT CCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCT CACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAA CATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGG CGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTC AGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGC TCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTT CTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCG GTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGA CCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTT ATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCG GTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTAT TTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTT GATCCGGCAAACAAACCACCGCTGGTAGCGGTTTTTTTGTTTGCAAGCAGCAGATTA CGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACG CTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGA TCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATAT GAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCG ATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGA TACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGC TCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAG AAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGC TAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGG CATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGG TCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGC AGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGT GAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGC CCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATC ATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCC AGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCA GCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGG GCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTA TCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAA ATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCGACGGATCGGG AGATCTCCCGATCCCCTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAG TTAAGCCAGTATCTGCTCCCTGCTTGTGTGTTGGAGGTCGCTGAGTAGTGCGCGAG CAAAATTTAAGCTACAACAAGGCAAGGCTTGACCGACAATTGCATGAAGAATCTGCT TAGGGTTAGGCGTTTTGCGCTGCTTCGC 3'

Claims

CLAIMS 1. A compound, or a pharmaceutically acceptable salt thereof, having the structural formula (I) or (X) shown below:wherein: R1and R2are each independently selected from hydrogen, (1-6C)alkyl, -[CH2]n-(3- 6C)cycloalkyl, -[CH2]n-aryl, -[CH2]n-heterocyclyl, or -[CH2]n-heteroaryl, wherein: integer n is 0, 1, 2, 3 or 4; and any alkyl, cycloalkyl, aryl, heteroaryl or heterocyclyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, amino, (1-3C)alkyl, (1-3C)alkoxy, (1-3C)haloalkyl, (1- 3C)haloalkoxy, (1-3C)alkylamino or di-[(1-3C)alkyl]amino;or R1and R2are linked such that, together with the nitrogen atom to which they are attached, they form a 4-7-membered heterocyclic ring which optionally comprises one or two additional heteroatoms selected from N, O or S; and wherein the heterocyclic ring is optionally substituted by one or more substituents independently selected from halo, cyano, (1-6C)alkyl, -[CH2]p-(3- 6C)cycloalkyl, -[CH2]p-heterocyclyl, -[CH2]p-aryl or -[CH2]p-heteroaryl; wherein: integer p is 0, 1, 2, 3, 4, 5 or 6; and any alkyl, cycloalkyl, aryl, heteroaryl or heterocyclyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, amino, (1- 3C)alkyl, (1-3C)alkoxy, (1-3C)haloalkyl, (1-3C)haloalkoxy, (1-3C)alkylamino or di-[(1-3C)alkyl]amino; Rn is selected from hydrogen, (1-3C)alkyl, -[CH2]q-(3-5C)cycloalkyl, wherein: q is 0, 1 or 2; and an alkyl is optionally substituted by hydroxy, (1-2C)alkoxy or NRn1Rn2, and a cycloalkyl group is optionally substituted by (1-2C)alkyl, hydroxy, (1-2C)alkoxy or NRn1Rn2; wherein Rn1 and Rn2 are each independently selected from hydrogen or (1-2C)alkyl R3is selected from hydrogen, halo or a group: -LB-XB-QBwherein: LBis absent or (1-2C)alkylene; XBis absent or is selected from the group consisting of -O-, -C(O)-, -C(O)-O-, -O-C(O)-, -C(O)-N(R100c)-, -N(R100c)-C(O)-, -NR100c-, -N(R100c)-C(O)-O- or -O- C(O)-N(R100c)-, wherein R100cand R100dare each independently selected from hydrogen or (1-2C)alkyl; and QBis selected from the group consisting of hydrogen, (1-6C)alkyl, -[CH2]r-(3- 6C)cycloalkyl, -[CH2]r-[4-7-membered heterocyclyl], -[CH2]r-phenyl or -[CH2]r- [5- or 6-membered heteroaryl]; wherein: integer r is 0, 1 or 2; and any alkyl, cycloalkyl, aryl, heteroaryl or heterocyclyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, (1-3C)alkyl, (1-3C)alkoxy, (1- 3C)haloalkyl, (1-3C)haloalkoxy, -[CH2]s-NRqa1Rqa2where Rqa1and Rqa2are each independently selected from hydrogen or (1-2C)alkyl and integer s is 0, 1 or 2; integer a is 1, 2 or 3; R4and R5are each independently selected from hydrogen, hydroxy or methyl, or R4and R5are linked to form a -CH2-CH2- group; or, if a is 1, R3and R4are linked such that, together with the carbon atoms to which they are attached, they form a fused 5-6 membered carbocycle or 5-6 membered heterocyclyl, wherein the fused (5-6C)carbocyclyl or 5-6 membered heterocyclyl is optionally substituted by one or more substituents independently selected from halo, (1-2C)alkyl, (1-2C)haloalkyl, (1-2C)alkoxy or (1-2C)haloalkoxy; and R5is selected from hydrogen or methyl; Ring B is fused partially saturated 5-6 membered carbocyclic ring which is optionally substituted by one or more substituents independently selected from halo, (1-2C)alkyl, (1-2C)haloalkyl, (1-2C)alkoxy or (1-2C)haloalkoxy; X is absent or is selected from -O-, -C(O)-, -S(O)0-2-, -C(O)-N(R100e)-, -N(R100e)-C(O)- or -NR100e-, wherein R100eis selected from hydrogen or methyl; Q is selected from phenyl, naphthyl or heteroaryl, wherein Q is optionally substituted by one or more substituents RQ, wherein each RQ is independently selected from: halo, hydroxy, cyano, (1-6C)alkyl, (1-6C)alkoxy, (1-6C)haloalkyl, (1-6C)haloalkoxy, -[CH2]t- NRq1Rq2 where Rq1 and Rq2 are each independently selected from hydrogen or (1- 2C)alkyl and integer t is 0, 1 or 2.

2. A compound according to claim 1, or a pharmaceutically acceptable salt thereof, wherein R1is selected from hydrogen, (1-6C)alkyl, -[CH2]n-(3-6C)cycloalkyl, -[CH2]n-phenyl, - [CH2]n-[4-7 membered heterocyclyl], or -[CH2]n-[5-6 membered heteroaryl], wherein: integer n is 0, 1, 2 or 3; and any alkyl, cycloalkyl, aryl, heteroaryl or heterocyclyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, amino, (1-2C)alkyl, (1-2C)alkoxy, (1-2C)haloalkyl, (1- 2C)haloalkoxy, (1-2C)alkylamino or di-[(1-2C)alkyl]amino; and R2is hydrogen or (1-4C)alkyl; or R1and R2are linked such that, together with the nitrogen atom to which they are attached, they form a 4-7-membered heterocyclic ring which optionally comprises oneor two additional heteroatoms selected from N, O or S, and wherein the heterocyclic ring is optionally substituted by one or more substituents independently selected from halo, cyano, (1-6C)alkyl, -[CH2]p-(3-6C)cycloalkyl, -[CH2]p-[4-7 membered heterocyclyl], -[CH2]p-phenyl or -[CH2]p-[5-6 membered heteroaryl]; wherein integer p is 0, 1, 2, 3 or 4; and any alkyl, cycloalkyl, aryl, heteroaryl or heterocyclyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, amino, (1-2C)alkyl, (1-2C)alkoxy, (1-2C)haloalkyl, (1- 2C)haloalkoxy, (1-2C)alkylamino or di-[(1-2C)alkyl]amino; optionally wherein R1is selected from hydrogen, (1-6C)alkyl, -[CH2]n-(3-6C)cycloalkyl, -[CH2]n- phenyl, -[CH2]n-[4-7 membered N-linked heterocyclyl], or -[CH2]n-[5-6 membered heteroaryl], wherein: integer n is 0, 1 or 2; and any alkyl, cycloalkyl, phenyl, heteroaryl or heterocyclyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, amino, (1-2C)alkyl, (1-2C)alkoxy, (1-2C)haloalkyl, (1- 2C)haloalkoxy, (1-2C)alkylamino or di-[(1-2C)alkyl]amino; with the proviso that n is not 0 if R1is -[CH2]n-[4-7 membered N-linked heterocyclyl; and R2is hydrogen or (1-2C)alkyl; or R1and R2are linked such that, together with the nitrogen atom to which they are attached, they form a 4-7-membered heterocyclic ring which optionally comprises one or two additional heteroatoms selected from N, O or S, and wherein the heterocyclic ring is optionally substituted by one or more substituents independently selected from halo, cyano or (1-4C)alkyl, wherein the alkyl is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, amino, (1- 2C)alkoxy, (1-2C)haloalkoxy, (1-2C)alkylamino or di-[(1-2C)alkyl]amino; further optionally wherein R1is selected from hydrogen, (1-6C)alkyl, -[CH2]n-(3-6C)cycloalkyl or -[CH2]n-phenyl; wherein: integer n is 0, 1 or 2; and any alkyl, cycloalkyl or phenyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano,amino, (1-2C)alkyl, (1-2C)alkoxy, (1-2C)haloalkyl, (1-2C)haloalkoxy, (1- 2C)alkylamino or di-[(1-2C)alkyl]amino; and R2is hydrogen or (1-2C)alkyl; or R1and R2are linked such that, together with the nitrogen atom to which they are attached, they form a 4-7-membered heterocyclic ring which optionally comprises one or two additional heteroatoms selected from N, O or S, and wherein the heterocyclic ring is optionally substituted by one or more substituents independently selected from halo, cyano or (1-4C)alkyl, wherein the alkyl is optionally further substituted with one or more substituents independently selected from halo, hydroxy, cyano, amino, (1- 2C)alkoxy, (1-2C)haloalkoxy, (1-2C)alkylamino or di-[(1-2C)alkyl]amino.

3. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R1is selected from hydrogen, (1-6C)alkyl, -[CH2]n-(3- 6C)cycloalkyl or -[CH2]n-phenyl; wherein: integer n is 0, 1 or 2; and any alkyl, cycloalkyl or phenyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, amino, (1-2C)alkyl, (1-2C)alkoxy, (1-2C)haloalkyl,(1-2C)haloalkoxy, methylamino or dimethylamino; and R2is hydrogen or methyl; or R1and R2are linked such that, together with the nitrogen atom to which they are attached, they form a 4-7-membered heterocyclic ring which optionally comprises one or two additional heteroatoms selected from N or O, and wherein the heterocyclic ring is optionally substituted by one or more substituents independently selected from methyl, halo, cyano, hydroxy or methoxy; optionally wherein R1is selected from hydrogen, (1-6C)alkyl, -[CH2]n-(3-6C)cycloalkyl, phenyl or benzyl; wherein: integer n is 0 or 1; and any alkyl, cycloalkyl or phenyl group is optionally further substituted with one or more substituents independently selected from: halo, cyano, hydroxy, methoxy or dimethylamino; andR2is hydrogen or methyl; or R1and R2are linked such that, together with the nitrogen atom to which they are attached, they form a 4-7-membered heterocyclic ring which optionally comprises one or two additional heteroatoms selected from N or O, and wherein the heterocyclic ring is optionally substituted by one or more substituents independently selected from methyl, halo, cyano, hydroxy or methoxy; further optionally wherein R1is selected from (1-4C)alkyl optionally substituted with one or more substituents independently selected from: halo, cyano, hydroxy, methoxy or dimethylamino; and R2is hydrogen or methyl; or R1and R2are linked such that, together with the nitrogen atom to which they are attached, they form a 5-6-membered heterocyclic ring which optionally comprises one additional heteroatom selected from N or O (e.g. morpholinyl or piperizinyl), and wherein the heterocyclic ring is optionally substituted by one or more substituents independently selected from halo, cyano, hydroxy or methoxy.

4. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein Rn is selected from hydrogen, (1-3C)alkyl, -[CH2]q-(3- 5C)cycloalkyl, wherein: q is 0 or 1; and (1-3C)alkyl is optionally substituted by hydroxy, methoxy, NH2or NMe2, and cycloalkyl group is optionally substituted by methyl, hydroxy, methoxy, NH2or NMe2; optionally wherein Rn is selected from hydrogen or (1-3C)alkyl optionally substituted by hydroxy, methoxy, NH2or NMe2; further optionally wherein Rn is selected from hydrogen or methyl; preferably methyl.

5. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R3is selected from hydrogen, halo or a group: -LB-XB-QBwherein: LBis absent or (1-2C)alkylene;XBis absent or is selected from the group consisting of -O-, -C(O)-, -C(O)-O-, -O-C(O)-, -C(O)-N(R100c)-, -N(R100c)-C(O)-, -NR100c-, -N(R100c)-C(O)-O- or -O- C(O)-N(R100c)--, wherein R100cand R100dare each independently selected from hydrogen or methyl; and QBis selected from the group consisting of hydrogen, (1-6C)alkyl, -[CH2]r-(3- 6C)cycloalkyl, -[CH2]r-[4-7-membered heterocyclyl], -[CH2]r-phenyl or -[CH2]r- [5- or 6-membered heteroaryl]; wherein: integer r is 0 or 1; and any alkyl, cycloalkyl, phenyl, heteroaryl or heterocyclyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, (1-3C)alkyl, (1- 3C)alkoxy, (1-3C)haloalkyl, (1-3C)haloalkoxy or NRqa1Rqa2where Rqa1 and Rqa2are each independently selected from hydrogen or methyl; optionally wherein R3is selected from hydrogen or a group: -LB-XB-QBwherein: LBis absent or (1-2C)alkylene; XBis absent or is selected from the group consisting of -O-, -C(O)-, -O-C(O)-, - C(O)-N(R100c)-, -N(R100c)-C(O)-, -NR100c- or -O-C(O)-N(R100c)-, wherein R100cand R100dare each independently selected from hydrogen or methyl; and QBis selected from the group consisting of hydrogen, (1-6C)alkyl, -[CH2]r-(3- 6C)cycloalkyl, -[CH2]r-[5-6-membered heterocyclyl], -[CH2]r-phenyl or -[CH2]r- [5- or 6-membered heteroaryl]; wherein: integer r is 0 or 1; and any alkyl, cycloalkyl, phenyl, heteroaryl or heterocyclyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, (1-2C)alkyl, (1- 2C)alkoxy, (1-2C)haloalkyl, (1-2C)haloalkoxy or NRqa1Rqa2where Rqa1and Rqa2are each independently selected from hydrogen or methyl; further optionally wherein R3is selected from hydrogen, halo or a group: -LB-XB-QBwherein:LBis absent or (1-2C)alkylene; XBis absent or is selected from the group consisting of -O-, -C(O)-, -O-C(O)-, - NR100c- or -O-C(O)-N(R100c)-, wherein R100cand R100dare each independently selected from hydrogen or methyl; and QBis selected from the group consisting of hydrogen, (1-6C)alkyl, -[CH2]r-(3- 6C)cycloalkyl, -[CH2]r-[5-6-membered heterocyclyl] or -[CH2]r-phenyl], wherein integer r is 0 or 1; and any alkyl, cycloalkyl or phenyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, (1- 2C)alkyl, (1-2C)alkoxy, (1-2C)haloalkyl, (1-2C)haloalkoxy or NRqa1Rqa2where Rqa1 and Rqa2are each independently selected from hydrogen or methyl; further optionally wherein R3is selected from hydrogen, halo, or a group: -LB-XB-QBwherein: XBis absent or is selected from the group consisting of -O-, -C(O)-, -NR100c- or -O-C(O)-N(R100c)-, wherein R100cand R100dare each independently selected from hydrogen or methyl; and QBis selected from the group consisting of hydrogen, (1-6C)alkyl, -[CH2]r-(3- 6C)cycloalkyl, -[CH2]r-[5-6-membered heterocyclyl], or -[CH2]r-phenyl], wherein integer r is 0 or 1; and any alkyl, cycloalkyl or heterocyclyl group is optionally further substituted with one or more substituents independently selected from: halo, hydroxy, cyano, (1-2C)alkyl, (1-2C)alkoxy, (1-2C)haloalkyl, (1-2C)haloalkoxy or NRqa1Rqa2where Rqa1 and Rqa2are each independently selected from hydrogen or methyl.

6. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein R3is selected from hydrogen, halo or a group: -XB-QBwherein: XBis absent or is selected from the group consisting of -O- or -NR100c- wherein R100cis selected from hydrogen or methyl; and QBis selected from the group consisting of (1-6C)alkyl, (3-6C)cycloalkyl or phenyl, wherein any alkyl, cycloalkyl or phenyl group is optionally furthersubstituted with one or more substituents independently selected from: halo, hydroxy, cyano, methyl, or methoxy; optionally wherein R3is selected from halo (e.g. fluoro or chloro), (1-4C)alkyl, (1- 4C)alkoxy, (1-4C)haloalkyl, (1-4C)haloalkoxy, (3-6C)cycloalkyl or phenyl; further optionally wherein R3is selected from halo (e.g. chloro), (1-3C)alkyl, CF3or cyclopropyl; preferably R3is methyl.

7. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein integer a is 0, 1 or 2; and / or each occurrence of R4and R5is each independently selected from hydrogen or methyl; optionally wherein each occurrence of R4and R5is hydrogen.

8. A compound according to any one of claims 1 to 4, wherein a is 1, and R3and R4are linked such that, together with the carbon atoms to which they are attached, they form a fused 5-6 membered carbocycle or 5-6 membered heterocyclyl, wherein the fused 5-6 membered carbocycle or 5-6 membered heterocyclyl is optionally substituted by one or more substituents independently selected from halo, methyl, halomethyl, methoxy or halomethoxy; and R5is selected from hydrogen or methyl; optionally wherein a is 1, and R3and R4are linked such that, together with the carbon atoms to which they are attached, they form a fused 6-membered carbocycle or 6-membered heterocyclyl, wherein the fused 6-membered carbocycle or 6-membered heterocyclyl is optionally substituted by one or more substituents independently selected from halo, methyl, halomethyl, methoxy or halomethoxy; and R5is selected from hydrogen or methyl; further optionally wherein a is 1, and R3and R4are linked such that, together with the carbon atoms to which they are attached, they form a fused 6-membered carbocycle which is optionally substituted by one or more substituents independently selected from halo, methyl or fluoromethyl (e.g. CH2F, CHF2or CF3); and R5is hydrogen.

9. A compound according to any of claims 1 to 4, or a pharmaceutically acceptable salt thereof, wherein Ring B is a partially saturated 5-6 membered carbocyclic ring which is optionally substituted by one or more substituents independently selected from halo, methyl, halomethyl, methoxy or halomethoxy; optionally wherein Ring B is is a partially saturated 6-membered carbocyclic ring which is optionally substituted by one or more substituents independently selected from halo, methyl or fluoromethyl (e.g. CH2F, CHF2or CF3);10. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein X is absent or is selected from -O-, -S(O)0-2- or -NR100e-, wherein R100eis selected from hydrogen or methyl; optionally wherein X is absent or is - O-.

11. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein Q is selected from phenyl, naphthyl or 5- to 10 membered heteroaryl, wherein Q is optionally substituted by one or more substituents RQ, wherein each RQ is independently selected from: halo, hydroxy, cyano, (1-4C)alkyl, (1-4C)alkoxy, (1-4C)haloalkyl or (1-4C)haloalkoxy; optionally wherein Q is selected from phenyl, naphthyl or 5- or 6-membered heteroaryl, wherein Q is optionally substituted by one or more substituents RQ, wherein each RQ is independently selected from: halo, hydroxy, cyano, (1-3C)alkyl, (1-3C)alkoxy, (1- 3C)haloalkyl or (1-3C)haloalkoxy; further optionally wherein Q is selected from phenyl or naphthyl, wherein Q is optionally substituted by one or more substituents RQ, wherein each each RQ is independently selected from: halo (e.g. fluoro, chloro or bromo), (1-2C)alkyl, methoxy or trifluoromethyl; and / or if Q is phenyl or 6-membered heteroaryl, then it is optionally substituted at the meta and / or para position by one or more substituents RQ, wherein each RQ is independently as defined in any one of the preceding claims.

12. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein Q is selected from phenyl or pyridyl, wherein Q is optionally substituted by one, two or three substituents RQ, wherein each RQ is independently selected from halo (e.g. fluoro, chloro or bromo), (1-2C)alkyl, methoxy or trifluoromethyl; optionally wherein Q is optionally substituted by one or more substituents RQ, wherein each RQis independently selected from halo (e.g. fluoro or chloro) or (1-2C)alkyl; further optionally wherein Q is a group with the formula:;wherein: RQ1is selected from hydrogen or fluoro; RQ2is selected from hydrogen or chloro.

13. A compound according to any one of the preceding claims, or a pharmaceutically acceptable salt thereof, wherein the compound has a structural formula (II), (III), (IV), (V), (VI) (VIa) or (VIb) shown below:wherein:R1, R2, Rn, R3, R4, R5, a, RQand Q are as defined in any one of the preceding claims; qa is is selected from 0, 1, 2 or 3; Ring A is a 5-6 membered fused carbocyclic or 5-6 membered heterocycle, which is optionally substituted by one or more substituents independently selected from halo, (1- 2C)alkyl, (1-2C)haloalkyl, (1-2C)alkoxy or (1-2C)haloalkoxy; or a pharmaceutically acceptable salt thereof; nn is an integer selected from 0, 1, 2 or 3; mm is an integer selected from 0, 1 or 2; and each occurrence of RA is independently selected from halo, (1-2C)alkyl, (1-2C)haloalkyl, (1-2C)alkoxy or (1-2C)haloalkoxy.

14. A compound, or a pharmaceutically acceptable salt thereof, selected from any one of the following: 2-((5-(3-bromobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((4-methyl-5-(2-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3,4-dichlorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(2-chlorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((4-ethyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chlorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((4-methyl-5-(3-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-fluorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(4-chlorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((4-methyl-5-(4-(trifluoromethyl)benzyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(4-isopropylbenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chloro-2-fluorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chloro-5-fluorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(5-chloro-2-fluorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chloro-4-fluorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chlorobenzyl)-4-methylthiazol-2-yl)(methyl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chlorobenzyl)-4-methylthiazol-2-yl)(ethyl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3,4-dichlorobenzyl)-4-methylthiazol-2-yl)(methyl)amino)-2-oxoethyl methylsulfamate; 2-((4-methyl-5-(naphthalen-2-ylmethyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3,4-difluorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate;2-((5-(4-methoxybenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((4-cyclopropyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((4-isopropyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(4-chlorophenethyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((4-methyl-5-(4-(trifluoromethyl)benzyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((4-methyl-5-(naphthalen-1-ylmethyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(4-fluorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl dimethylsulfamate; 2-((4-methyl-5-(3-(trifluoromethyl)benzyl)thiazol-2-yl)amino)-2-oxoethyl dimethylsulfamate; 2-((5-(2-fluorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl dimethylsulfamate; 2-((5-benzyl-4-methylthiazol-2-yl)amino)-2-oxoethyl dimethylsulfamate; 2-((4-methyl-5-phenethylthiazol-2-yl)amino)-2-oxoethyl dimethylsulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl sulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl ethylsulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl isobutylsulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl isopropylsulfamate; 2-((5-(3-chlorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl ethylsulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl cyclopropylsulfamate; 2-((5-(3-chlorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl (2-methoxyethyl)sulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl propylsulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl tert-butylsulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl benzylsulfamate; 2-((5-(3-chlorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl (2-fluoroethyl)sulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl morpholine-4-sulfonate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl dimethylsulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl 3-fluoroazetidine-1-sulfonate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl azetidine-1-sulfonate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl pyrrolidine-1-sulfonate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl ethyl(methyl)sulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl (2- methoxyethyl)(methyl)sulfamate; 2-((4-methyl-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl benzyl(methyl)sulfamate; 2-((5-(3-chlorobenzyl)-4-(((1-methylpiperidin-4-yl)oxy)methyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((4-(hydroxymethyl)-5-(4-methylbenzyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chlorobenzyl)-4-(((methylcarbamoyl)oxy)methyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate;2-((5-(3-chlorobenzyl)-4-(morpholinomethyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(2-(3-chlorophenyl)propan-2-yl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chlorobenzyl)-4-formylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((7-(3-chlorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chlorophenoxy)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((7-(4-fluorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl (2- (dimethylamino)ethyl)(methyl)sulfamate; (S)-2-((7-(3,4-difluorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl (2- (dimethylamino)ethyl)sulfamate; 2-((7-(3,4-difluorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl (2- (dimethylamino)ethyl)sulfamate; 2-oxo-2-((7-(pyridin-4-yl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)ethyl ethylsulfamate; 2-oxo-2-((7-(pyridin-2-yl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)ethyl ethylsulfamate; (S)-2-((7-(3-chlorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl 4- methylpiperazine-1-sulfonate; (R)-2-((7-(3-chlorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl 4- methylpiperazine-1-sulfonate; (S)-2-((7-(4-fluorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl (2- (dimethylamino)ethyl)sulfamate; (R)-2-((7-(4-fluorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl (2- (dimethylamino)ethyl)sulfamate; 2-((7-(3-chlorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl 4- methylpiperazine-1-sulfonate; 2-((7-(4-fluorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl (2- (dimethylamino)ethyl)sulfamate; (S)-2-((7-(3-chloro-4-fluorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl (2-(dimethylamino)ethyl)sulfamate; (R)-2-((7-(3-chloro-4-fluorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl (2-(dimethylamino)ethyl)sulfamate; 2-((7-(3-chloro-4-fluorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl (2- (dimethylamino)ethyl)sulfamate; (S)-2-((7-(3-chloro-4-fluorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl ethylsulfamate; (R)-2-((7-(3-chloro-4-fluorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl ethylsulfamate;(S)-2-((7-(3-chloro-4-fluorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; (R)-2-((7-(3-chloro-4-fluorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((7-(3-chloro-4-fluorophenyl)-4,5-dihydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl ethylsulfamate; 2-((7-(3-chloro-4-fluorophenyl)-4,5-dihydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((7-(3-chloro-4-fluorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl ethylsulfamate; 2-((7-(3-chloro-4-fluorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; (S)-2-((7-(3-chlorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; (R)-2-((7-(3-chlorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((7-(3-chlorophenyl)-4,5-dihydrobenzo[d]thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((4-chloro-5-(3-chloro-4-fluorobenzyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-((3-chloro-4-fluorophenyl)(hydroxy)methyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chloro-4-fluorobenzyl)-4-methylthiazol-2-yl)(2-methoxyethyl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chlorobenzyl)-4-methylthiazol-2-yl)amino)-2-oxoethyl (2- (dimethylamino)ethyl)sulfamate; 2-((5-(3-chlorobenzyl)-4-(hydroxymethyl)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chlorophenoxy)-4-methylthiazol-2-yl)amino)-2-oxoethyl (2- (dimethylamino)ethyl)(methyl)sulfamate; 2-((5-(3-chloro-4-fluorophenoxy)-4-methylthiazol-2-yl)amino)-2-oxoethyl (2- (dimethylamino)ethyl)sulfamate; 2-((5-(3-chlorophenoxy)-4-methylthiazol-2-yl)amino)-2-oxoethyl 4-methylpiperazine-1- sulfonate; 2-((5-(3-chlorophenoxy)-4-methylthiazol-2-yl)amino)-2-oxoethyl (2- (dimethylamino)ethyl)sulfamate; 2-((5-(3-chloro-5-fluorophenoxy)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chloro-2-fluorophenoxy)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(4-cyanophenoxy)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(5-chloro-2-fluorophenoxy)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate;2-((4-methyl-5-(3-(trifluoromethyl)phenoxy)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chlorophenoxy)-4-methylthiazol-2-yl)amino)-2-oxoethyl isopropylsulfamate; 2-((5-(4-methoxyphenoxy)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(4-fluorophenoxy)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(4-chlorophenoxy)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((4-methyl-5-(3-(trifluoromethoxy)phenoxy)thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((5-(3-chlorophenoxy)-4-methylthiazol-2-yl)(methyl)amino)-2-oxoethyl ethylsulfamate; 2-((5-(3-chlorophenoxy)-4-methylthiazol-2-yl)amino)-2-oxoethyl ethylsulfamate; 2-((5-(3-chloro-4-fluorophenoxy)-4-methylthiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((7-(3-chloro-4-fluorophenyl)-6,7-dihydro-5H-pyrano[2,3-d]thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((6-(3-chlorophenyl)-5,6-dihydro-4H-cyclopenta[d]thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; 2-((7-(3-chloro-4-fluorophenyl)-5-methyl-4,5,6,7-tetrahydrothiazolo[4,5-c]pyridin-2-yl)amino)- 2-oxoethyl methylsulfamate; 2-((7-(3-chloro-4-fluorophenyl)-4,5,6,7-tetrahydrothiazolo[4,5-c]pyridin-2-yl)amino)-2- oxoethyl methylsulfamate; 2-((7-(3-chloro-4-fluorophenyl)-6,7-dihydro-4H-pyrano[3,4-d]thiazol-2-yl)amino)-2-oxoethyl methylsulfamate; or 2-((4-(3-chloro-4-fluorophenyl)-6,7-dihydro-4H-pyrano[4,3-d]thiazol-2-yl)amino)-2-oxoethyl methylsulfamate.

15. A pharmaceutical composition comprising a compound according to any one of claims 1 to 14, or a pharmaceutically acceptable salt thereof, and one or more pharmaceutically acceptable excipients.

16. A compound according to any one of claims 1 to 14, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition according to claim 15: a. for use in therapy; b. for use in the inhibition of MutSβ activity, e.g. in cellular systems; c. for use in the treatment of a disease or disorder in which MutSβ activity is implicated; d. for use in the treatment of a repeat expansion disease or disorder; optionally wherein the repeat expansion disease or disorder is selected from benign adult familial myoclonic epilepsy (BAFME); brachydactyly and cleidocranial dysplasia (BCCD); blepharophimosis, ptosis and epicanthus inversus (BPES); Baratela-Scott syndrome (BSS); cerebellar ataxia, neuropathy and vestibular areflexia syndrome (CANVAS);congenital central hypoventilation syndrome (CCHS); dentatorubropallidoluysian atrophy (DRPLA); early infantile epileptic encephalopathy type 1 (EIEE1); familial adult myoclonic epilepsy (FAME); Fuch’s endothelial corneal dystrophy type 3 (FECD3); Dentatorubral pallidoluysian atrophy; fragile XE syndrome (FRAXE); Friedreich ataxia (FRDA) frontotemporal dementia / amyotrophic lateral sclerosis (FTD / ALS); fragile X- associated premature ovarian infertility (FXPOI); fragile X syndrome (FXS); fragile X- associated tremor ataxia syndrome (FXTAS); global development delay, progressive ataxia and elevated glutamine (GDPAG); Huntington’s disease (HD); Huntington disease-like 2 (HDL2); hand-foot-genital syndrome (HFGS); holoprosencephaly type 5 (HPE5); mental retardation with isolated growth hormone deficiency (MRGH); myotonic dystrophy type 1 (DM1); myotonic dystrophy type 2 (DM2); progressive myoclonus epilepsy type 1 or Unverricht-Lundborg diseae (EPM1); neuronal intranuclear inclusion disease (NIID); oculopharyngodistal myopathy type 1 (OPDM1); oculopharyngodistal myopathy type 2 (OPDM2); oculopharyngeal myopathy with leukoencephalopathy type 1 (OPML1); spinobulbar muscular atrophy (SBMA); spinocerebellar ataxias type 1, 2, 3, 6, 7, 8, 10, 12, 17, 27B, 31, 36 or 37 (SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA10, SCA12, SCA17, SCA27B, SCA31, SCA36, SCA37); synpolydactyly (SPD); X-linked dystonia parkinsonism (XDP); X- linked mental retardation and abnormal genitalia (XLAG); or X-linked mental retardation with or without growth hormone deficiency (XLMR, XLMRGHD). e. for use in the treatment of a triplet repeat disease or disorder, e.g. dentatorubropallidoluysian atrophy (DRPLA); Fuch’s endothelial corneal dystrophy type 3 (FECD3); fragile XE syndrome (FRAXE); Friedreich ataxia (FRDA); fragile X- associated premature ovarian infertility (FXPOI); fragile X syndrome (FXS); fragile X- associated tremor ataxia syndrome (FXTAS); Huntington’s disease (HD); Huntington disease-like 2 (HDL2); myotonic dystrophy type 1 (DM1); neuronal intranuclear inclusion disease (NIID); spinobulbar muscular atrophy (SBMA); spinocerebellar ataxias type 1, 2, 3, 6, 7, 8, 17 or 27B (SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA17 or SCA27B); or X-linked dystonia parkinsonism (XDP); f. for use in the treatment of Huntington’s disease (HD); g. for use in inhibiting somatic expansion of expanded simple nucleotide repeats in a subject, e.g. in the treatment of a repeat expansion disease or disorder; h. for use in the inhibition of somatic expansion of expanded simple nucleotide repeats in a subject carrying a disease allele for a repeat expansion disease or disorder; i. for use in the treatment of Huntington’s disease, wherein the compound or pharmaceutical composition is administered in combination with one or more diseasemodification therapies, e.g. RNA interference approaches (such as tominersen, WVE-03, AMT-130, BV-101, VO-659 or SPK-miHTT), mis-splicing (such as PTC- 518) and antibody therapeutics (such as INT-41, NI-302, C6-17 or Vtx-003); j. for use in the treatment of Huntington’s disease, wherein the compound or pharmaceutical composition is administered in combination with one or more Huntingtin lowering therapies (such as RNAi, miRNA (such as AMT-130), antisense oligonucleotides (such as tominersen), and small-molecule splicing modulators (such as PTC-518); and novel methods to clear the mHTT protein, such as proteolysis- targeting chimeras); k. for use in gene editing in vitro, ex vivo or in vivo; optionally wherein the gene editing method is selected from CRISPR-Cas9, CRISPR-Cas12, Fanzor, ZFN (zinc finger nucleases), TALENs, base editors and prime editors; l. for use as an agent to enhance the efficiency of prime editors; m. for use as an agent to reduce off-target editing (errors) of prime editors in cellular systems; n. for use as an agent to both enhance efficiency and reduce error of prime editors in cellular systems; o. for use as an agent to enhance the efficiency of prime editor therapeutics ex vivo (e.g. allogeneic editing of hematopoietic cells); or p. for use as an agent to enhance the efficiency of prime editor therapeutics in vivo.

17. The use of compound according to any one of claims 1 to 12, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition according to claim 13: a. in inhibiting somatic expansion of expanded simple nucleotide repeats in a cellular assay system; b. as an agent to enhance the efficiency of prime editors in a cellular system; c. as an agent to reduce off-target editing (errors) of prime editors in cellular systems; d. as an agent to both enhance efficiency and reduce error of prime editors in cellular systems; e. as an agent to enhance the efficiency of prime editor therapeutics ex vivo (e.g. allogeneic editing of hematopoietic cells); f. as an agent to inhibit mismatch repair in vitro, ex vivo or in vivo; g. in testing an agent for the ability to inhibit ATP hydrolysis by MutSβ in the presence or absence of a suitable heteroduplex DNA substrate; or h. in testing an agent for the ability to inhibit ATP-dependent recruitment of MutLα or MutLβ or MutLγ by MutSβ.

18. A method of increasing the efficiency of a gene editing technique or reducing the error rate of a gene editing technique, the method comprising conducting the gene editing technique in the presence of a compound according to any one of claims 12, or a pharmaceutically acceptable salt thereof; optionally wherein the gene editing technique is a gene editing technique in which host cell mis-match repair (MMR) factors are known to decrease the efficiency of the gene editing, e.g.: homology-directed repair (HDR), non-homologous end joining (NHEJ), ZFN (zinc finger nucleases), TALENs (Transcription activator like effector nucleases), CRISPR-Cas9 nucleases, CRISPR-Cas12 nucleases, base editing (fusion of catalytically dead dCas9 enzymes to DNA deaminases which enable single nucleotide substitutions), prime editing (fusion of a Cas9 nickase to a reverse transcriptase), PASTE (programmable addition via site-specific targeting elements which leverages prime editing to insert AttB sites and then facilitate serine integrase proteins to insert larger sequences), or any editing method using a single-stranded oligonucleotide (ssODN) as a template including nuclease-free editing methods.

19. A method of prime editing, the method comprising contacting a cell with: (1) a Cas9 nickase to nick a non-target strand; (2) a prime editing single guide RNA (pegRNA) to bind the target strand; (3) a reverse transcriptase to reverse transcribe from the 3’ end of the non-target strand according to the information provided by the pegRNA; and (4) a compound according to any one of claims 1 to 14, or a pharmaceutically acceptable salt thereof.

Citation Information

Patent Citations

  • RAD51 inhibitors

    US20200291014A1

  • Chemotherapeutic for inducing an MSH2-dependent apoptotic pathway

    WO2009029206A1

  • Indolines as protac compounds

    WO2023094833A1