Functional nucleic acid molecule capable of increasing BDNF production

Abstract

The invention relates to a functional nucleic acid molecule capable of increasing BDNF production and applications thereof in therapy and recombinant BDNF production. The functional nucleic acid molecule of the invention is an RNA or DNA molecule comprising a binding domain (BD), which comprises at least one antisense nucleotide sequence which is antisense with respect to a target nucleotide sequence which is present in the BDNF encoding RNA, and an effector domain (ED), which comprises at least one regulatory SINEB2 nucleotide sequence capable of increasing BDNF translation or a functional fragment thereof.

Description

[0001] Functional nucleic acid molecule capable of increasing BDNF production

[0002] The present invention relates to a functional nucleic acid molecule with the ability to increase protein translation, specifically the translation of the Brain-Derived Neurotrophic Factor (BDNF), resulting in increased synthesis efficiency.

[0003] Background of the invention

[0004] Recombinant BDNF is used in the differentiation of human pluripotent stem cells (hPSCs) derived from patients suffering from genetic diseases, to obtain progenitor cells having the same mutated genes as the patients and therefore usefully usable as cell systems for in vitro screening of libraries of chemical compounds as potential drugs. From hPSCs it is also possible to obtain progenitor cells which, like differentiated adult cells, are usefully used in transplantation for repair and replacement purposes.

[0005] BDNF is also considered to be a potential tissue repair agent, so BDNF is also formulated for topical applications in solid matrices or in the form of a gel or in carriers consisting of porous capsules or controlled-release nanoparticles that can also be used for systemic, intratissue and intranasal applications.

[0006] The production of recombinant BDNF is therefore functional to the pharmaceutical industry interested in screening potential drugs, as well as to the biotechnology industry for producing therapies based on BDNF as a drug, and to companies producing reagents for basic research.

[0007] However, due to intrinsic pharmacokinetic limitations, BDNF cannot be used as such in therapeutic strategies for neurological diseases, as it is unable to cross the blood-brain barrier and has a short half-life. For these reasons, as an alternative to direct administration, therapies proposed for central and peripheral nervous system diseases are usually gene or cell therapies.

[0008] A further problem is that, so far, BDNF production through the recombinant route has been rather disappointing in yeast (Nishizawa, M., et al., Biologically active human and mouse nerve growth factors secreted by the yeast Saccharomyces cerevisiae. AppL Microbiol. BiotechnolA993 , 38, 624-630; Bums ML, et al. Pro-region engineering for improved yeast display and secretion of brain derived neurotrophic factor. Biotechnol J. 2016 Mar;l l(3):425-36), as well as in Escherichia coli (Fukuzono, S., et al., Production of biologically active mature brain-derived neurotrophic factor in Escherichia coli. Biosci. Biotechnol. Biochem. 1995, 59, 1727-1731; Hoshino, K., et al., Production of brain-derived neurotrophic factor in Escherichia coli by coexpression of Dsb proteins. Biosci. Biotechnol. Biochem. 2002, 66, 344-350), and in insect cells (Negro A, et al., Production and characterization of recombinant rat brain-derived neurotrophic factor and neurotrophin-3 from insect cells. J Neurochem. 1994 Feb; 62(2): 471-8). The accumulation of the recombinant protein in inclusion bodies in E. coli and the lack of a post-translational apparatus cause the folding of the recombinant protein to be only partial and therefore its biological activity to be limited (Philo, J., et al., Refolding of brain-derived neurotrophic factor from guanidine hydrochloride: Kinetic trapping in a collapsed form which is incompetent for dimerization. Biochemistry 1993, 32, 10812-10818). In insect and yeast cells, the post-translational apparatus, although present, does not allow adequate glycosylation. Mammalian cells are capable of making the post-translational modifications necessary for the acquisition of the quaternary structure and hence of the biological activity, but expression and purification yields in these systems have so far been extremely low.

[0009] Another problem is that BDNF requires proteolytic cleavage to generate the mature form from the precursor. Proteolytic cleavage usually takes place in the endoplasmic reticulum, in the cistemae of the Golgi apparatus, or in secretory vesicles. However, the organelles of the secretory pathways are completely absent in bacteria and some proteases are not present or are completely different in yeast and insect cells.

[0010] Regulatory sequences capable of increasing the efficiency of protein synthesis are described in the state of the art. For example, patent application WO2012 / 133947A describes SINEB2 sequences derived from long-non-coding RNAs of the SINE class and their combination with specificity-determining sequences that are antisense to a target sequence in the RNA encoding the protein the synthesis efficiency of which is desired to be increased. However, WO2012 / 133947A neither describes nor suggests that BDNF may be a target protein to which the described method can be effectively applied, or for identifying specificitydetermining sequences that may be related to increased synthesis efficiency.

[0011] The remaining state of the art regarding BDNF production does not provide any indication of this either. In fact, US 5235043 concerns the recombinant production of neurotrophic factors of the human NGF / BDNF family in the E. coli bacterium, while IT 102020000032423 describes a method for simplifying the in vitro production and purification of recombinant human BDNF in its mature form, by combining the expression, in the same eukaryotic cell, of the gene encoding for human proBDNF and the gene encoding for a specific protease capable of generating the mature form through proteolytic cleavage at the natural cleavage site of proBDNF.

[0012] Therefore, there is a clear need to provide alternative and more effective methodologies to increase the efficiency of BDNF protein synthesis in eukaryotic cells and more specifically mammalian cells.

[0013] There is also a need to provide a methodology which allows endogenous BDNF production to be increased in specific neuronal and glial cell populations.

[0014] Summary of the invention

[0015] These and other needs are now met by the present invention, which in a first aspect relates to a functional nucleic acid molecule as defined in the appended claim 1. The functional nucleic acid molecule of the present invention is capable of increasing BDNF translation and causing an increase in BDNF synthesis in eukaryotic cells, more specifically in mammalian cells.

[0016] In a second aspect, the invention relates to an expression vector comprising a functional nucleic acid molecule of the invention and a host cell including the above-mentioned expression vector, the host cell preferably being a eukaryotic cell, even more preferably a mammalian cell. This aspect of the invention also includes a method for increasing the brain-derived neurotrophic factor (BDNF) synthesis efficiency, comprising the step (a) of allowing a functional nucleic acid molecule according to the invention or an expression vector comprising it to coexist with an RNA encoding for BDNF. By way of illustration and not limitation, the term “to coexist” refers to the transformation, transfection or transduction of the functional nucleic acid molecule or expression vector of the invention within a host cell, according to known per se methodologies which the person skilled in the art is perfectly capable of implementing. In addition, the above-mentioned method for increasing BDNF synthesis efficiency can be implemented within the context of a method for BDNF production through the recombinant route. Recombinant protein production in host cells, preferably eukaryotic host cells, even more preferably mammalian host cells, is known per se to the person skilled in the art.

[0017] In a third aspect, the invention relates to the use of the functional nucleic acid molecule of the invention, or the expression vector or host cell comprising it, as a medicament. In particular, the functional nucleic acid molecule of the invention, or the expression vector or host cell comprising it, is used in the therapeutic treatment of a disease selected from the group consisting of neurodegenerative diseases, neuropsychiatric diseases (e.g., major depressive disorder, schizophrenia, post-traumatic stress disorder), congenital developmental defects, spinal cord lesions, peripheral motor and sensory axon lesions, skin lesions, gum lesions, and dental pulp lesions. The functional nucleic acid molecule of the invention, or the expression vector or host cell comprising it, is also included for use as a neuroprotector against neuronal damage caused by beta-amyloid (AP) oligomers.

[0018] For these therapeutic applications, the functional nucleic acid molecule of the invention, or the expression vector or host cell comprising it, is provided in the form of a pharmaceutical composition including, in addition to the active ingredient, suitable pharmaceutically acceptable diluents, carriers and / or excipients. This pharmaceutical composition is also included within the scope of the invention.

[0019] Detailed description of the invention The functional nucleic acid molecule of the invention is an RNA or DNA molecule comprising two functional domains, namely:

[0020] - a target-binding domain (BD), comprising at least one antisense nucleotide sequence which is antisense with respect to a target nucleotide sequence of the BDNF- encoding RNA, and

[0021] - an effector domain (ED), comprising at least one regulatory SINEB2 nucleotide sequence capable of increasing the translation of the BDNF protein, or comprising a functionally active fragment of a regulatory SINEB2 nucleotide sequence.

[0022] The use of the two domains mentioned above in a single nucleic acid molecule, which, by binding to a target nucleotide sequence of the BDNF-encoding RNA, is able to increase the translation thereof, advantageously allows the efficiency of BDNF protein synthesis in eukaryotic cells to be increased.

[0023] The antisense nucleotide sequence of the binding domain (BD) determines the specificity of the functional nucleic acid molecule of the invention, as it is capable of recognizing and complementarily pairing with a target nucleotide sequence of a human BDNF transcript. This antisense nucleotide sequence of the binding domain comprises a nucleotide sequence selected from SEQ ID NO: 1 or SEQ ID NO:2. It is preferable for the antisense nucleotide sequence of the binding domain to be between 26 and 60 nucleotides in length, preferably between 26 and 50 nucleotides in length; for example, the length of the antisense sequence of the binding domain is 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59 or 60 nucleotides.

[0024] SEQ ID NO: 1 was designed to anneal to a target sequence that is common to all human BDNF transcripts.

[0025] SEQ ID NO:2 was designed to anneal to a target sequence that is specific to BDNF transcript variant 2 (NM_012513.4), which is not expressed in non-neuronal tissues.

[0026] The above-mentioned SEQ ID NO: 1 and SEQ ID NO:2 sequences were designed based on rat BDNF transcripts, but since their target sequences are highly conserved among species, particularly among humans, rats and mice, it follows that they are also able to bind to human transcripts.

[0027] Regulatory SINEB2 nucleotide sequences are known per se in the state of the art, e.g., from WO2012 / 133947A, which also provides specific examples (see Table on pages 69-74 of WO2012 / 133947, incorporated herein by reference).

[0028] The term “regulatory SINEB2 nucleotide sequence” includes both SINEB2 sequences in the forward orientation relative to the 5' to 3' orientation of the functional nucleic acid molecule of the invention, and SINEB2 sequences in the reverse orientation relative to the 5' to 3' orientation of the functional nucleic acid molecule of the invention.

[0029] The term "functionally active fragment of a SINEB2 regulatory sequence" refers to a portion of a regulatory SINEB2 nucleotide sequence that retains its effectiveness in increasing BDNF translation. This term also includes sequences that are mutated in one or more nucleotides compared to wild-type sequences, but which retain their effectiveness in increasing BDNF translation. The term is intended to include both SINEB2 fragments in the forward orientation relative to the 5' to 3' orientation of the functional nucleic acid molecule of the invention, and SINEB2 fragments in the reverse orientation relative to the 5' to 3' orientation of the functional nucleic acid molecule of the invention.

[0030] As mentioned above, SINEB2 regulatory sequences are illustrated and exemplified in WO2012 / 133947A. In this respect, particular reference is made to sequences from SEQ ID NO: 1 to SEQ ID NO:51 of WO 2012 / 133947, which are illustrated in the Sequence Listing herein with the numbering from SEQ ID NO:3 to SEQ ID NO:53.

[0031] According to preferred embodiments of the present invention, the at least one regulatory SINEB2 nucleotide sequence of the effector domain is selected from the group consisting of sequences having at least 75%, preferably at least 90%, more preferably at least 95%, even more preferably 100% homology to a sequence selected from the group consisting of sequences from SEQ ID NO:3 to SEQ ID NO:53 of the Sequence Listing herein and their corresponding DNA versions, where Us are replaced by Ts. SEQ ID N0:3 (the reverse SINE B2 element in AS Uchll) and SEQ ID N0:4 (the 77- nucleotide variant of the reverse SINEB2 element in AS Uchll which includes nucleotides 44 to 120) are particularly preferred.

[0032] Other reverse SINEB2 elements and functionally active fragments of reverse SINEB2 elements are SEQ ID NO:5 to SEQ ID NO:53. Experimental data showing the protein translation enhancing effectiveness of these sequences are not explicitly shown in the present patent application but are illustrated in a previous patent application in the name of the same applicant. Sequences from SEQ ID NO:5 to SEQ ID NO:53 can therefore be used as regulatory sequences in molecules according to the present invention.

[0033] Sequences SEQ ID NO:5 to SEQ ID NO:8, SEQ ID NO: 10 to SEQ ID NO: 13, SEQ ID NO:20, SEQ ID NO:45 to SEQ ID NO:53 are functionally active fragments of the reverse SINEB2 transposable element derived from AS Uchll.

[0034] SEQ ID NO:9 is a full-length 183-nt reverse SINEB2 transposable element derived from AS Uchll.

[0035] Sequences SEQ ID NO: 14 to SEQ ID NO: 19, SEQ ID NO:21 to SEQ ID NO:22, SEQ ID NO:41 to SEQ ID NO:44 are functionally active fragments of the reverse SINEB2 transposable element derived from AS Uchll.

[0036] Sequences SEQ ID NO:23 to SEQ ID NO:27 and SEQ ID NO:30 to SEQ ID NO:40 are different SINEB2 transposable elements.

[0037] Sequences SEQ ID NO:28 and SEQ ID NO:29 are sequences in which a SINEB2 transposable element has been inserted.

[0038] In the functional nucleic acid molecule of the present invention, the binding domain is preferably positioned between a 5 '-terminus of the molecule and the effector domain. In the functional nucleic acid molecule of the invention, the binding domain can be directly linked to the effector domain. Alternatively, there may be at least one linker sequence positioned between the binding domain and the effector domain. A linker sequence is a synthetic DNA or RNA sequence, generally varying in length between 10 and 20 nucleotides (i.e., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides), which acts as a spacer. A nonlimiting example of a linker sequence suitable for use in the context of the present invention is SEQ ID NO:54.

[0039] The functional nucleic acid molecule of the present invention is preferably a circular molecule. This conformation leads to a much more stable molecule that is more difficult to degrade within the cell and therefore remains active for a longer period of time.

[0040] Illustrated below are two particularly preferred embodiments of the nucleic acid molecule of the invention, designated “SINEUP-PAN” and “SINEUP-Exl”, respectively.

[0041] SINEUP-PAN

[0042] SINEUP-PAN is in the antisense orientation to all BDNF transcript variants. It includes, from 5' to 3', a binding domain comprising the antisense nucleotide sequence SEQ ID NO: 1, a linker sequence, and an effector domain comprising the regulatory SINEB2 nucleotide sequence SEQ ID NO:3. A preferred overall nucleotide sequence of SINEUP-PAN is SEQ ID NO:55.

[0043] SINEUP-PAN may also include a cloning site at the 5’ end (e.g., Xhol) and a cloning site at the 3’ end (e.g., Hindlll). Of course, the Xhol and Hindlll cloning sites may be replaced with any other suitable cloning site, the selection of which is well within the abilities of a person skilled in the art.

[0044] SINEUP-Exl

[0045] SINEUP-Exl is in the antisense orientation to BDNF transcript variant 2 (NM_012513.4).

[0046] It includes, from 5' to 3', a binding domain comprising the antisense nucleotide sequence SEQ ID N0:2, a linker sequence, and an effector domain comprising the regulatory SINEB2 nucleotide sequence SEQ ID NO:3. A preferred overall nucleotide sequence of SINEUP- Exl is SEQ ID NO:56.

[0047] SINEUP-Exl may also include a cloning site at the 5’ end (e.g., Xhol) and a cloning site at the 3’ end (e.g., Hindlll). Of course, the Xhol and Hindlll cloning sites may be replaced with any other suitable cloning site, the selection of which is well within the abilities of a person skilled in the art.

[0048] In the attached Sequence Listing, sequences from SEQ ID NO: 1 to SEQ ID NO:56 have been marked as RNA sequences but, as indicated above, the same sequences may alternatively be provided in their DNA version.

[0049] The functional nucleic acid molecule of the invention finds use in both industrial and therapeutic applications.

[0050] The industrial use is aimed at increasing recombinant production of mammalian BDNF from host cell lines expressing an ectopic BDNF gene. For this purpose, the functional nucleic acid molecule of the invention is inserted into a suitable vector, such as a plasmid or viral vector, which is transferred into and expressed in a eukaryotic cell line expressing the open reading frame (ORF) of the target gene encoding the recombinant mammalian BDNF protein, as described for example in Italian patent No 102020000032423. Non-limiting examples of suitable expression vectors include plasmids such as pCDNA3.1, pCI, pSI, pHYGRO, TurboCHO, and viral vectors such as adeno-associated viruses (AAVs), adenoviruses (ADVs), and lentiviruses (LVs). Non-limiting examples of eukaryotic host cell lines typically employed for the industrial production of recombinant proteins and which may be used in the context of the present invention include: mammalian cell lines (e.g. CHO, HeLa, COS, HEK293, myeloma cell lines, hybridoma cell lines, neuroblastoma cell lines), yeast strains (Saccharomyces cerevisiae, Pichia pastoris, Komagataella sp., Kluyveromyces laclis, Yarrowia lipolylica), insect cell lines (derived from Drosophila melanogasler, Antheraea eucalypti, Spodoptera frugiperda), cell lines derived from plants such as rice or tobacco. Recombinant mammalian BDNF proteins, particularly human BDNF, are produced for therapeutic, cosmetic, applications, and for biomedical and biotechnological research, including stem cell culture.

[0051] The therapeutic use has the aim of increasing endogenous BDNF protein production. For this purpose, the functional nucleic acid molecule of the invention is inserted into a vector suitable for gene therapy, or into a cell line suitable for cell-based gene therapy, and these are directed to the target tissue. Non-limiting examples of gene therapy vectors that may be used in the context of the present invention include various viral vectors based on adenoviruses, adeno-associated viruses (AAVs), alphaviruses, flaviviruses, herpes simplex virus (HSV), measles virus, rhabdoviruses, retroviruses, lentiviruses, Newcastle disease virus (NDV), poxviruses, and picomaviruses.

[0052] For insertion into the recombinant expression vector or gene therapy vector, the functional nucleic acid molecule of the invention includes suitable restriction sites at the 5' end and at the 3' end. Non-limiting examples of restriction sites that may be present in the nucleic acid molecule of the invention are AccI, Apal, BamHI, BstXI, Bhel, Clal, EagI, EcoRI, EcoRV, Hindi, Hindlll, Kpnl, Nhel, Notl, Pmel, PstI, Sall, Smal, Spel, Xbal, Xhol.

[0053] As regards cell-based therapeutic applications, the functional nucleic acid molecule of the present invention, for example, may be used to increase BDNF expression in mesenchymal stem cells for transplantation in patients.

[0054] Non-limiting examples of diseases and disorders that can be treated with the functional nucleic acid molecule of the invention through gene- or cell-based therapies include neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), Huntington's disease, or congenital developmental defects such as Rett syndrome, Tourette syndrome, Angelmann syndrome, or spinal cord lesions, lesions of peripheral motor and sensory axons and dendrites, skin lesions, gum lesions, and dental pulp lesions.

[0055] An advantage associated with the use of the functional nucleic acid molecule of the invention in therapeutic strategies is specificity, i.e., that BDNF expression will be increased in cells that already possess the corresponding transcripts.

[0056] A further advantage associated with the use of the functional nucleic acid molecule of the invention in therapeutic strategies is that this molecule is capable of exerting a neuroprotective effect against neuronal damage caused by beta-amyloid (AP) oligomers which are known to be involved in the pathogenesis of Alzheimer’s disease.

[0057] For the above therapeutic applications, the functional nucleic acid molecule of the invention is formulated into a pharmaceutical preparation that includes, in addition to the active ingredient, suitable pharmaceutically acceptable diluents, carriers and / or excipients. The selection of the pharmaceutical form and the related excipients, carriers and / or diluents, as well as the administration route and the dose of the active ingredient, depend on several factors, including the disease to be treated and the characteristics of the patient, but this selection falls within the abilities of the skilled formulator and the physician.

[0058] Description of the figures

[0059] In the following experimental section, reference is made to the attached figures, in which:

[0060] Figure 1 refers to the strategy, specificity, and effectiveness of SINEUP in directing the upregulation of the BDNF protein. A-B. Structure of the rat BDNF gene with schematic representation of BDNF transcripts characterized by multiple alternative splicings of 5' and 3' UTR (grey boxes), a coding sequence (CDS), and two polyadenylation sites (poly A). B. Annealing sites of SINEUP -PAN and SINEUP -Ex 1 on BDNF transcripts used in the experiments. C-H. HEK293T cells were co-transfected with different plasmids to demonstrate the efficacy of SINEUP -PAN or SINEUP -Ex 1 on the indicated BDNF transcripts versus control (GFP). The plasmids were transfected at a 1 :3 ratio. Tubulin (55 kDa) is indicative of gel loading and is used for normalization in Western-blot analysis. Histograms quantify mean data from n=4 experiments. C. Effect of SINEUP -PAN on Exl- BDNF transcription versus control (GFP). ***p=0.0005. D. Effect of SINEUP-Exl on Exl- BDNF transcription. *p=0.0299. E-F. Effect of SINEUP -PAN on Ex2B-BDNF (E) and Ex2C-BDNF (F) transcripts, n = 3. G-H. Effect of SINEUP-Exl on Ex2B-BDNF (G) and Ex2C-BDNF (H) transcripts versus control (GFP). n = 3

[0061] Figure 2 refers to the effectiveness of SINEUP in regulating the expression of endogenous BDNF protein in hippocampal neurons. A. Hippocampal neurons transfected with GFP alone (pEGFP-Nl), or co-transfected with GFP 1 :3 and SINEUP panBDNF, or SineUP Ex 1 BDNF on DIV3, and stained on DIV6 by immunofluorescence with anti-BDNF antibody (Ab, aBDNF, secondary Ab = Alexa568). Calibration bar = 25 pm. B. Example of a GFP- transfected neuron on which three Regions Of Interest (ROIs) were drawn on the soma (1), the apical dendrite (2), or a small extracellular region to determine the background level (3). C. Quantification of anti-BDNF immunofluorescence intensity recorded on N=12 neurons for each condition. The histograms show the effect of SINEUP -PAN or SINEUP -Ex 1 on endogenous BDNF versus control (GFP). D. Qualitative and quantitative Western blot analysis of endogenous pro-BDNF level in SH-SY5Y human neuroblastoma cells. SINEUP panBDNF significantly increased the level of pro-BDNF (p<0.05; n=4) compared to GFP (control), whereas SineUP ExlBDNF did not induce significant changes. Statistical analysis is one-way ANOVA with multiple correction (Dunnett) ** = p<0.01; *** = p<0.001.

[0062] Figure 3 refers to the effects of SINEUPs on the differentiation of rat hippocampal neurons at different in vitro times. A. Representative images of rat hippocampal neurons on DIV12 in culture after transfection with the GFP control plasmid, SINEUP -PAN or SINEUP-Exl. Scale bar: 50 pm. B. Mean TDL (TDL / NeuN) measured in rat hippocampus cultures on the indicated days in vitro (DIV) under control conditions (GFP) or after transfection on DIV3 with SINEUP -PAN or SINEUP-Exl and tested on DIV4, 6, 9, 12 as indicated. Data are expressed as % of the ratio between TDL and the total number of NeuN-positive neurons versus control (taken as 100%) **p=0 008. C. Mean dendritic endpoints measured in rat hippocampal cultures on the indicated days in vitro (DIV) under control conditions (GFP) or after transfection with SINEUP -PAN or SINEUP-Exl, as indicated. Data are expressed as % of the ratio between the endpoints and the total number of NeuN-positive neurons versus control (taken as 100%). N=2, *p=0.046.

[0063] Figure 4 refers to the effects of SINEUP-PAN and SINEUP-Exl on cell survival on DIV12. SINEUPs were transfected on DIV3. Neuronal density was expressed as a percentage of the ratio between NeuN-immunopositive neurons and the total number of cells (Hoechst) versus control (100%). Statistics were performed considering 30-40 microscopy fields per condition, from two independent neuronal cultures, corresponding to n=500-1000 neurons. Statistical analysis was performed with the Shapiro-Wilk normality test, the Kruskal-Wallis test, or the one-way ANOVA.

[0064] Figure 5 refers to the effect of SINEUPs on treatment with AP25-35 in hippocampal neurons in culture. A. The total dendritic length (TDL) measured on Map2 immunofluorescence signal is significantly reduced after treatment with AP25-35 (10 pM, 24hrs) compared to control transfected cultures (GFP). *p=0.0153. B-E. Effects of SINEUPs on rat hippocampal neurons treated with AP25-35. Neuronal parameters quantified in Ap25-35-treated neurons after transfection of an unrelated plasmid (GFP) or after transfection of SINEUP-PAN or SINEUP-Exl, as indicated. Data are normalized to the total number of neurons (NeuN) and are expressed as a % of control. N=3 independent experiments, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. B. Mean total dendritic length (TDL) measured in rat hippocampal cultures under control conditions (GFP) or after transfection with SINEUP- PAN or SINEUP-Exl, as indicated. B. Dendritic endpoints measured in rat hippocampal cultures under control conditions (GFP) or after transfection with SINEUP-PAN (p=0.0188) 0 SINEUP-Exl, as indicated. D. Apical dendrite diameters were assessed for -100 neurons / condition. Data for SINEUP-PAN (p<0.0001) or SINEUP-Exl (p<0.0001) are expressed as mean % and normalized to the control condition (GFP without Ap stimulation = 100%). E. The size of the soma was assessed for -100 neurons / condition. Data for SINEUP-PAN (p<0.0001) or SINEUP-Exl are expressed as mean % and normalized to the control.

[0065] Figure 6 shows that the expression of SINEUPs protects against Ap-induced cytoskeleton degeneration. A. Representative fluorescence microscopy images of cultured hippocampal neurons under control conditions (GFP), after incubation with AP25-35, or transfected with SINEUPs. Map2 signal was used to define the area with the highest fluorescence intensity (threshold area). The same threshold was applied to all microscopy images. Scale bar: 50 pM. B. The histograms quantify Map2 fluorescence in untreated control neurons (GFP) and in those treated with AP25-35 (GFP+AP25-35). Note the degeneration of Map 2 signal in neurons treated with AP25-35. N=20 images per condition, p<0.0001. C. The histograms represent neurons treated with AP25-35 in the control (GFP) and after SINEUP transfection. Data are expressed as mean % and normalized to the control condition, p=0.0001. D) Equal number of neurons per condition was ensured by counting NeuN-positive cells in each image. N=20.

[0066] Article 170a (2), (3) and (4) of the Italian Industrial Property Code (CPI)

[0067] With regard to the provisions of Article 170a (2), (3) and (4) of the CPI, the following is specified:

[0068] 1. The animal-borne biological material, namely HEK293 human cell line and SH- SY5Y human neuroblastoma cell line, which is the basis of the present invention, is of a commercial nature; the aforementioned cell lines can be purchased through the company Merck under the codes: No 12022001 for HEK293 and No 94030304 for SH-SY5Y.

[0069] 2. The present invention does not concern or use human-borne biological material which requires obtaining express free and informed consent, as the human cell lines used are of commercial origin.

[0070] 3. The present invention does not concern or use biological material containing micro-organisms or genetically modified organisms which imply compliance with the obligations deriving from national or community regulations relating to such modifications, and in particular from the provisions of paragraph 6 of Article 170a of the CPI and Legislative Decrees No 206 of 12 April 2001 and No 224 of 8 July 2003.

[0071] Experimental Section

[0072] The experimental section that follows is purely illustrative and should not be understood as limiting the scope of the invention as defined in the appended claims.

[0073] Materials and Methods

[0074] Plasmids and SINEUP

[0075] In addition to the plasmid containing the above-described preferred embodiment SINEUP - PAN which hybridizes to all BDNF transcripts, the following plasmids: pExl-BDNF-GFP (transcript variant 2, NM_012513.4), pEx2B-BDNF-GFP (transcript variant 4, NM_00 1270632.1), pEx2C-BDNF-GFP (transcript variant 3, NM_001270631.1) were used to express different 5’UTR-BDNF transcripts. All BDNF mRNA constructs were cloned under the CMV promoter. pEGFP-Nl (Clontech) was used as a control.

[0076] Cell cultures and transfections

[0077] HEK293T cells (purchased from Merck, code: No 12022001) were conventionally grown in DMEM supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin (Euroclone). For transfection, 3xl05HEK293T cells / mL were seeded and used after 24 hours. Transfection of the different plasmids in the appropriate ratio was performed with the TransIT-X2 Dynamic Delivey System (Mirus) following the manufacturer's instructions. For each condition, 130 ng of pEXl-BDNF-GFP plasmid DNA were used and co-transfected with increasing concentrations of plasmids encoding SINEUP molecules at ratios of 1 : 1 (130: 130 ng), 1 :3 (130:390 ng), 1 :4 (130:520 ng), 1 :6 (130:780 ng). Transfection efficiency was 70-80%.

[0078] Hippocampal neurons were prepared from postnatal day 0-1 from Wistar rats. The animals were treated according to institutional guidelines, in accordance with Directive 2010 / 63 / EU of the Council of the European Community for the care and use of experimental animals. Authorization for animal testing was obtained from the local ethics committee on November 10, 2017, and was communicated to the Ministry of Health, in accordance with Legislative Decree 116 / 92 and Law 96 / 2013, article 13. 13. Every effort was made to minimize animal suffering and to reduce the number of animals used.

[0079] Hippocampi were collected in 1.8 mL of cold Hank's balanced salt solution containing: 4.2 mM NaHCOs, 0.952% Hank's salt powder, 12 mM HEPES (4-(2-hy droxy ethyl- 1- piperazineethanesulfonic acid) (Sigma), 33 mM D-glucose, 100 mM kynurenic acid, 1 mg / ml penicillin-streptomycin (Euroclone). Hippocampi were digested with trypsin (0.25%) for 8 minutes at 37°C. The cells were seeded at a concentration of 240000 cells / mL (640 cells / mm2) on poly-L-ornithine pre-coated plates in the presence of a 2% Matrigel layer (Corning). The cells were grown in Neurobasal medium supplemented with B27 (Life Technologies), 1 mM L-glutamine, and antibiotics (Euroclone). On day in vitro 3 (DIV3), the culture medium was exchanged with a fresh medium supplemented with 2.5 mM cytosine b-D-arabinofuranoside (Ara-C). Plasmid transfection in primary hippocampal neurons was performed in DIV3 cultures using Lipofectamine 2000TM (Thermo Scientific) according to the manufacturer's instructions. A maximum of 1 pg of total plasmid DNA was used for each condition. Transfection efficiency in neurons was 14%.

[0080] SH-SY5Y cells (purchased from Merck, code No. 94030304) were cultured with complete DMEM / F12 (supplemented with 10% Fetal Bovine Serum (FBS) and 1% penicillin / streptomycin) in a humidified incubator at 37°C, 5% CO2. The cells were cultured without coating. SINEUP and GFP plasmids were transfected with Lipofectamine 2000 according to the manufacturer's instructions. Briefly, 3.5 x 105cells were seeded in 2 ml of culture medium on 6-well plates one day before transfection. On Day 1, SINEUP (1 pg) and GFP (1 pg) plasmids were transfected with lipofectamine 2000 (4 pl) in the cells for 4 hours, after changing the medium. The cells were incubated at 37°C in a CO2 incubator for 24 hours and then blocked with lysis buffer to extract the proteins.

[0081] Treatments with A

[0082] For treatments with Ap, AP25-35 peptide stock solution (Bachem, Switzerland) was prepared by dissolving the peptide in sterile water at a concentration of 5 mg / ml. AP25-35 aggregation was obtained in phosphate buffered saline (PBS) in 24 hours at 37°C. Aggregated AP25-35 oligomers were stored at 4°C and used within a few weeks of preparation. Primary cell cultures of hippocampal neurons previously transfected with SINEUP plasmids on DIV3 were treated with AP25-35 (10 pM) in culture medium on DIV5 for 24 hours to assess the effect of AP25-35 on DIV6.

[0083] Total protein extracts and Western blot

[0084] Hippocampal neuron lysates were prepared 24 hours after transfection in cold RIPA lysis buffer (150 mM NaCl, 1% Triton X-100, 0.5% sodium deoxycholate, 1 mM EDTA, 50 mM Tris, pH 8) supplemented with a protease inhibitor cocktail (Roche). The Bradford assay (Abeam) was used to determine protein concentration and ensure correct loading on SDS- PAGE. For the Western blot, the blots were incubated with rabbit anti-proBDNF antibody (1 : 1000; Alomone) and HRP-conjugated secondary antibody (Sigma, 1 :20000 dilution). The signals were obtained with ECL Prime western blotting detection reagent (GE Healthcare Life Sciences). For gel loading controls, the blots were stripped for 30 minutes in Restore PLUS WB Stripping Buffer (Thermo Fisher), washed, and incubated with anti-alpha tubulin antibody (GeneTex, 1 : 10000 dilution). The signal intensity was then quantified with ImageJ.

[0085] Neuroblastoma SH-SY5Y cell lysates were prepared from 3.5 x 105cells / well seeded in a 6- well plate. 70 pl of cold RIPA lysis buffer supplemented with HALT protease and phosphatase inhibitors were added to each well. Then, protein extracts were sonicated and centrifuged. 50 pg of protein extracts were separated in a 15% SDS-PAGE gel and then transferred to a PVDF membrane. The membrane was blocked with 5% skimmed milk in TBST solution (Ihr, RT) and then incubated with rabbit anti-Pro-BDNF antibodies (Alomone Cat. # ANT-006, 1 :500 dilution) and mouse anti-alpha tubulin antibodies (Sigma, Cat. # T6074, 1 :3000 dilution) overnight at 4°C. Anti-rabbit 488 (Abeam Olc, 1 : 1000) and anti-mouse 488 (Abeam Olc, 1 : 1000) were used as secondary antibodies. The bands were detected on Chemidoc and quantified with ImageLAB software.

[0086] Immunofluorescence microscopy

[0087] Hippocampal neurons were fixed in 4% paraformaldehyde / phosphate buffer (PF A) solution for 20 minutes at room temperature and incubated with anti-Map2 (GeneTex) and anti-NeuN (Millipore) antibodies (1 :500) or with anti-BDNF monoclonal antibody (Cat. #B5050, Sigma at 20 pg / mL). The signals were detected with anti-IgG Alexa Fluor 568 or Alexa Fluor 488 antibodies (Thermo Scientific) (1 : 1000 dilution). Nuclei were counterstained with Hoechst 33342 dye (0.001%, Thermo Scientific). The samples were covered with an antibleach reagent (Southern Biotech) to preserve fluorescence and were visualized with the Nikon ECLIPSE Ti-E epifluorescence microscope for live-imaging, using a 20X lens. Fields were acquired using Nikon NIS-elements acquisition software. NeuN- and Hoechst-positive cells were counted using the “Object Analyzer” option of NIS-Elements. Images were acquired with a comparable number of neurons per field. The total dendritic length (TDL) and number of dendritic endpoints were analysed by Map2 tracking and quantified with Neurite Quant (Dehmelt et al. 2011). In microscopy experiments, Map2 signal was quantified to define the area with the highest Map2 fluorescence intensity by setting an arbitrary fluorescence intensity threshold mask in NIS-Elements.

[0088] Statistical analysis

[0089] Data were analysed in Microsoft Excel (Office) and GraphPad Prism 7. Based on the Shapiro-Wilk normality test, statistical significance between 2 groups / conditions was obtained with Student’s t-test if the normality test was positive. For two groups / conditions that failed the normality test, the Mann-Whitney Rank Sum test was performed to compare two groups / conditions. For multiple comparisons between more than 2 groups / conditions, the One-Way ANOVA test was performed if the normality test was positive; for non-normal data, the Kruskal-Wallis test was used.

[0090] Results

[0091] Example 1. SINEUPs increase Exl-BDNF mRNA translation

[0092] BDNF transcripts have a bipartite structure consisting of one of the eight upstream alternatively spliced exons, each encoding a different 5'-UTR, and a downstream exon that is identical for all transcripts, carrying the coding sequence (CDS) and the 3'-UTR (Fig. 1 A). The mechanism of action of SINEUPs involves the generation of an RNA duplex between the SINEUP and the target mRNA sequence at the translation start site (AUG). This assembly results in the recruitment of the translation initiation complex and increased protein synthesis. BDNF-specific SINEUPs were designed to bind a specific target sequence on BDNF transcripts and promote BDNF protein expression. SINEUP -PAN targets a sequence located in exon IX at the beginning of the CDS, which is common to all transcripts and overlaps with most BDNF transcripts, while SINEUP -Ex 1 was designed to specifically recognize BDNF exon I (Fig. IB). The amount of transfected SINEUP RNA must be optimized in each experimental condition. Therefore, a set of co-transfection experiments were performed in HEK293T cells to define the most appropriate plasmid ratio. The 1 :3 ratio was found to be the lowest in order to obtain the greatest effect on BDNF translation levels and was therefore used in all examples.

[0093] In order to verify the specificity and efficacy of SINEUP -PAN and SINEUP -Ex 1 on the different BDNF target transcripts, experiments were performed by co-transfecting SINEUP and BDNF plasmids encoding different 5'UTR sequences. Plasmids pExl-BDNF-GFP (Fig. 1C-D) and pEx2B- or pEx2C-BDNF-GFP (Fig. 1E-H) were co-transfected in HEK293T cells at a 1 :3 ratio with SINEUP -PAN, SINEUP -Exl or pEGFP-Nl alone (GFP), and BDNF protein expression was measured by Western immunoblot. Both SINEUP -PAN and SINEUP -Exl significantly increased BDNF protein expression compared to control samples, when pExl-BDNF-GFP was co-transfected with SINEUP (p=0.0005 and p=0.03; Fig. 1C,D). In addition, SINEUP -PAN also increased BDNF in samples transfected with pEx2B -BDNF -GFP or pEx2C-BDNF-GFP, although not at significant levels (Fig. IE, F), whereas, as expected, SINEUP -Exl was not effective on these BDNF transcripts (Fig. 1G, H).

[0094] In a second set of experiments, the effectiveness of SINEUP constructs in promoting increased translation of endogenous BDNF in the soma and dendrites of hippocampal neurons was tested (Fig. 2). For this purpose, hippocampal neurons were co-transfected on day in vitro 3 (DIV3) with plasmids pEGFP-Nl and SINEUP (1 :5 ratio). After cell fixation, immunofluorescent staining against BDNF was performed. GFP -positive neurons (bona fide co-transfected with SINEUP plasmid) were imaged with an epifluorescence microscope at 60x magnification under constant lighting conditions and acquisition time (Fig. 2 A). Three regions of interest (ROIs) were drawn on each GFP-positive pyramidal neuron. The first ROI (Fig. 2 B, 1) was drawn on the soma, excluding nuclei, with a surface size ranging from approximately 40 to 60 square microns. The second ROI (Fig. 2 B, 2) was made with a 2 pm-wide line from the apical hillock of the dendrite to the end of the BDNF labelling signal. This second ROI was used to plot the BDNF staining profile along the dendrites, also considering the distance from the soma. A third ROI was drawn (Fig. 2 B, 3) in a region of each image devoid of stained cells to measure the background signal intensity. Quantification of the background- subtracted anti-BDNF immunofluorescence intensity of each image showed that endogenous BDNF expression levels were highly significantly increased in both somi and dendrites after 3 days of treatment with SINEUP-PAN or SINEUP-Exl, with substantially equivalent effects of the two SINEUP constructs (Fig. 2 C). In addition, to determine the efficiency of SINEUPs in enhancing human BDNF expression, plasmids encoding EGFP, SINEUP-PAN or SINEUP-Exl were transfected in SH-SY5Y human neuroblastoma cells. This cell line has a baseline level of endogenous BDNF and SINEUP-PAN, but neither EGFP nor SINEUP-Exl were able to significantly increase pro- BDNF levels 24 hours after transfection (p<0.05; Fig. 2 D).

[0095] These results show that both SINEUP-PAN and SINEUP-Exl can promote an increase in endogenous BDNF levels in mouse hippocampal neurons, whereas only SINEUP-PAN increases endogenous BDNF expression in human neuroblastoma cells.

[0096] Example 2. BDNF-specific SINEUPs affect neuronal development and maturation in vitro

[0097] Cultured hippocampal rat neurons show a progressive increase in total dendritic length (TDL) during the first 6 days in vitro (DIV6), followed by a plateau phase around DIV7-9 and a further progressive increase from DIVIO to DIV15. To investigate how the development of primary rat hippocampal neurons is affected by SINEUP -mediated endogenous BDNF increase, several morphological parameters were analysed at various time points. Rat hippocampal neurons were transfected with SINEUP on DIV3 and then the dendrites were imaged by performing an immunofluorescence assay on DIV4, DIV6, DIV9 and DIV12 using antibodies specific for the cytoskeletal protein Map2 (Fig. 3 A). The number of neurons was quantified by anti-NeuN immunostaining, while the total number of plated cells was obtained by counting the nuclei stained with Hoechst-33342. These data were used to quantify the total dendritic length (TDL) of neurons and neurite endpoints. When cell morphology was analysed on DIV4, DIV6 and DIV9, no significant increase was found in TDL or in the number of dendritic endpoints in cultures transfected with SINEUP- PAN or SINEUP-Exl, compared to the control (Fig. 3B,C). However, on DIV12, SINEUP- Exl induced a significant increase in TDL (+127.5±8.42%; p=0.008), compared to the control (Fig. 3B), with no changes in the percentage of neurons in the total number of plated cells (Fig. 4). In addition, DIV12 cultures transfected with SINEUP-Exl showed significantly more endpoints than control cultures (+119±8.23%; p=0.046; Fig. 3C).

[0098] These results show that treatment of hippocampal neurons with SINEUP-Exl from DIV3 promotes increased complexity of dendritic arborization on DIV12.

[0099] Example 3. Effect of SINEUPs in primary rat hippocampal neurons following stimulation with Af

[0100] In order to assess the potential neuroprotective effect of BDNF-specific SINEUPs, dendritic atrophy was induced by stimulation with aggregated AP25-35 (AP) oligomers in in vitro hippocampal neurons, and then it was investigated whether SINEUP-PAN or SINEUP-Exl could counteract neuronal damage. AP25-35 is an 11 -amino acid peptide corresponding to the functional domain of the full-length Ap peptide and has been shown to have high toxicity in vitro, causing neuronal damage, and is found in the brain of AD patients. Accordingly, neuronal cultures on DIV3 with SINEUP were transfected with SINEUPs or GFP and then treated with 10 pM aggregated AP25-35 oligomers on DIV5 for 24 hours. AP25-35 concentration was determined using a dose-response curve in the MTT assay (data not shown) to produce a neuronal mortality limited to 24 hours (approximately 15-20% of NeuN / Hoechst positive cells). Immunofluorescence staining for Map2 and NeuN was performed on DIV6 to assess TDL, neuronal density and dendrite endpoints, apical dendrite diameter, and soma size. As shown in Fig. 5A, treatment with Ap induced a significant reduction in mean TDL compared to control. In particular, after treatment with AP25-35, TDL was 82.1 ± 3.901% (p=0.0153) relative to control conditions (100 ± 6.573%; n=3; Fig. 5A). Although the expression of both SINEUPs did not have a significant effect on TDL (Fig. 5B), SINEUP-PAN had a significant effect on dendrite endpoints (p=0.0188; Fig. 5C) and soma size (p<0.0001; Fig. 5E). In addition, both SINEUP-PAN and SINEUP-Exl induced a significant increase (p<0.0001) in the apical dendrite diameter measured at a distance of 20 pm from the soma (Fig. 5D).

[0101] Stimulation with Ap oligomers and incorrect sorting of endogenous Tau in the somatodendritic compartment are early events in AD that lead to spine depletion and microtubule disruption in dendrites. Consequently, it was examined whether SINEUP - induced restoration of atrophic dendritic morphology induced by Ap administration could be explained in terms of microtubule stabilization. Therefore, using an automated fluorescence analysis of Map2 based on the definition of a threshold mask applied to each image (Fig. 6A), the intensity of Map2 per neuron was quantified in control and AP-treated cultures. A significant decrease in Map2 fluorescent signal, detected according to the defined threshold analysis, was observed in neurons treated with AP25-35 (56.29 ± 3.0 %; p=0.0001) versus control (100 ± 4.9%; Fig. 6B). In contrast, Map2 immunofluorescence intensity was significantly increased in the presence of SINEUP-PAN (148.9 ± 11.58%; p=0.0001) compared to the control (100 ± 5%; Fig. 6C). No significant differences were found in the number of neurons per condition (Fig. 6D).

[0102] Overall, these data support a positive preventive effect of SINEUP-PAN on microtubule disruption induced by AP25-35 treatment in hippocampal neurons.

[0103] Discussion

[0104] In this study, SINEUP technology was successfully applied to increase intracellular expression of the BDNF protein and exert a neuroprotective action against stimulation with Ap peptides. To achieve this result, two SINEUPs were designed, the first being based on sequences complementary to the coding exon, common to all BDNF transcripts (SINEUP- PAN), and the second being complementary to the transcript of the 5' exon-I of BDNF (SINEUP SINEUP -Exl). It has been shown that during the in vitro development of primary cultures of rat hippocampal neurons, SINEUP-Exl, but not SINEUP-PAN, is able to induce a more complex dendritic arborization (i.e., greater total dendritic length and a higher number of endpoints), which is an effect visible on DIV12, but not at earlier stages. However, after a 24-hour incubation with the aggregated AP25-35 peptide in DIV6 rat hippocampal neurons, both SINEUP-PAN and SINEUP-Exl exerted protection against dendritic atrophy. The protective effect achieved with the two different SINEUPs appears to involve different mechanisms, as only SINEUP-PAN was able to increase the immunofluorescence for Map2, a dendritic microtubule marker. Since the SINEUP strategy acts on the basal transcripts at the post-translational level, the results suggest the involvement of BDNF-specific transcripts in countering the effects of Ap.

[0105] The first set of experiments focused on testing the ability of the two SINEUP constructs to increase the translation of BDNF mRNA transcripts in HEK293T cells. A significant increase in BDNF protein expression was detected from a 1 :3 ratio of SINEUP compared to an unrelated control plasmid encoding the GFP protein. A 4-fold increase in Ex 1 -BDNF protein expression was found to be induced by SINEUP -PAN and a 5-fold increase was found to be induced by SINEUP-Exl, which is specific for exon I. In addition, SINEUP - PAN was shown to have an enhancing effect on the expression of Exl-BDNF protein in both exon IIB and exon IIC (3-fold and 2-fold, respectively).

[0106] Next, experiments were performed in primary hippocampal neurons, by acting on endogenous BDNF. It has been observed that SINEUP -PAN, but not the exon I-specific SINEUP-Exl, can promote a significant increase in endogenous BDNF levels in the SH- SY5Y human neuroblastoma cell line. In this cell line, the BDNF transcript containing exon 1 is substantially not expressed, which explains why SINEUP-Exl was unable to increase BDNF expression levels and provides excellent control of the specificity of these strategies.

[0107] However, SINEUP-Exl, but not SINEUP -PAN, was shown to be able to increase dendritic arborization in primary hippocampal neurons when transfected on DIV3 and observed on DIV12. A possible explanation for the lack of effects in neurons of SINEUP -PAN, despite its high efficacy in increasing BDNF levels in HEK293 cells, could be related to intrinsic self-regulation mechanisms, which may prevent the translation of BDNF when it reaches levels that are too high. Indeed, a homeostatic regulation of BDNF through miRNA-132 has been described in neurons. However, SINEUP -PAN was effective in the second set of experiments, in which neurons were stressed with Ap. It is known that under these stress conditions, proteolytic pathways are upregulated and protein biosynthesis is altered, so it is conceivable that SINEUP -PAN could increase BDNF protein levels within a more physiological range.

[0108] In the second set of experiments, dendritic integrity was assessed in hippocampal neurons treated with AP25-35. In agreement with previous literature data, a significant reduction in mean neurite length was observed in neurons treated with AP25-35. In these experiments, a significant increase in the number of endpoints and soma size was observed following treatment with SINEUP-PAN and an increase in the diameter of apical dendrites was observed following both treatment with SINEUP-Exl and treatment with SINEUP-PAN, whereas no significant effect of the two SINEUPs on total dendritic length was detected. The lack of effects on total dendritic length on DIV6 was not expected but, given the positive effect on TDL observed with SINEUP-Exl in naive primary neurons on DIV12, one possible explanation is that SINEUP treatment may require a longer time or a different time window to induce dendrite elongation.

[0109] On the other hand, the significant effects detected in the whole population strongly suggest that the trophic effect of the increased intracellular BDNF expression spreads over a large population of neurons in the culture, through increased availability of secreted BDNF. Overall, the results obtained provide convincing evidence that SINEUP expression induces a protective trophic signalling against Ap-induced damage.

[0110] Sequences

[0111] SEQ ID NO: 1 tcatcactcttctcacctggtggaac

[0112] SEQ ID NO:2 acattgtggctttgctgtcctggagactcagtgtcttaaaatct

[0113] SEQ ID NO:3 cagtgctagaggaggtcagaagagggcattggatcccccagaactggagttatacggtaacctcgtggtggttgtgaaccaccat gtggatggatattgagttccaaacactggtcctgtgcaagagcatccagtgctcttaagtgctgagccatctctttagctcc

[0114] SEQ ID NO:4 gaactggagttatacggtaacctcgtggtggttgtgaaccaccatgtggatggatattgagttccaaacactggtcc

[0115] SEQ ID N0:5 cctcgtggtggttgtgaaccaccatgtgg

[0116] SEQ ID N0:6 gttatacggtaacctcgtggtggttgtgaaccaccatgtggatggatattgagttccaaac

[0117] SEQ ID N0:7 atcccccagaactggagttatacggtaacctcgtggtggttgtgaaccaccatgtggatggatattgagttccaaacactggtcctgt gcaagagcat

[0118] SEQ ID N0:8 gaagagggcattggatcccccagaactggagttatacggtaacctcgtggtggttgtgaaccaccatgtggatggatattgagttcc aaacactggtcctgtgcaagagcatccagtgctcttaagtgc

[0119] SEQ ID N0:9 gggcagtgctagaggaggtcagaagagggcattggatcccccagaactggagttatacggtaacctcgtggtggttgtgaaccac catgtggatggatattgagttccaaacactggtcctgtgcaagagcatccagtgctcttaagtgctgagccatctctttagctccagtc tcttaagct

[0120] SEQ ID NO: 10 gaactggagttatacggtaacctcgtggtggttgtgaaccaccatgtggatggatattgagttccaa

[0121] SEQ ID NO: 11 ggatcccccagaactggagttatacggtaacctcgtggtggttgtgaaccaccatgtggatggatattgagttccaaacactggtcct gtgcaagagcatccagtgc

[0122] SEQ ID NO: 12 agagggcattggatcccccagaactggagttatacggtaacctcgtggtggttgtgaaccaccatgtggatggatattgagttccaa acactggtcctgtgcaagagcatccagtgctcttaagtgc

[0123] SEQ ID NO: 13 ggtaacctcgtggtggttgtgaaccaccatgtggatgg SEQ ID N0: 14 cagtgctagaggaggtcagaagagggcattggatcccccagaactggagttatacgataacctcgtggtggttgtgaaccaccat gtggatggatattgagttccaaacactggtcctgtgcaagagcatccagtgctcttaagtgctgagccatctctttagctccagtctctt aagct

[0124] SEQ ID N0: 15 cagtgctagaggaggtcagaagagggcattggatcccccagaactggagttatacgctaacctcgtggtggttgtgaaccaccat gtggatggatattgagttccaaacactggtcctgtgcaagagcatccagtgctcttaagtgctgagccatctctttagctccagtctctt aagct

[0125] SEQ ID N0: 16 cagtgctagaggaggtcagaagagggcattggatcccccagaactggcgttatacggtaacctcgtggtggttgtgaaccaccat gtggatggatattgagttccaaacactggtcctgtgcaagagcatccagtgctcttaagtgctgagccatctctttagctccagtctctt aagct

[0126] SEQ ID N0: 17 cagtgctagaggaggtcagaagagggcattggatcccccagaagtggagttatacggtaacctcgtggtggttgtgaaccaccat gtggatggatattgagttccaaacactgctcctgtgcaagagcatccagtgctcttaagtgctgagccatctctttagctccagtctctt aagct

[0127] SEQ ID N0: 18 cagtgctagaggaggtcagaagagggcattggatcccccagatggtgagttatacggtaacctcgtggtggttgtgaaccaccat gtggatggatattgagttccaaacacgtcacctgtgcaagagcatccagtgctcttaagtgctgagccatctctttagctccagtctctt aagct

[0128] SEQ ID N0: 19 cagtgctagaggaggtcagaagagggcattggatcccccagaactgcactatacggtaacctcgtggtggttgtgaaccaccatg tggatggatattgagttccaaatgagtggtcctgtgcaagagcatccagtgctcttaagtgctgagccatctctttagctccagtctctt aagct

[0129] SEQ ID NO:20 gggcattggatcccccagaactggagttatacggtaacctcgtggtggttgtgaaccaccatgtggatggatattgagttccaaaca ctggtcctgtgcaagagcatccagtgctc

[0130] SEQ ID N0:21 ggactggagttatacggtaacctcgtggtggttgtgaaccaccatgtggatggatattgagttccaaacactggtcc

[0131] SEQ ID NO:22 gaactggcgttatacggtaacctcgtggtggttgtgaaccaccatgtggatggatattgagttccaaacactggtcc

[0132] SEQ ID NO:23 gatgccttagaagtggagttaagagttgtgagctgccgttttttggttctgggactcgaactcgtttcctctgatactatcaaccaccaa gccatctcttcagcccc

[0133] SEQ ID NO:24 gccagaagaagttgtgggattccctggaactggagcaaccaacagtttgtgtgcaccatgtgggtaatgggaatcgaacctgggtc ctctataagactggccagtgctcttaactactgaggtgcatttct

[0134] SEQ ID NO:25 ttattttaaatatatgagtatttcacctgcataggcgcacagtacccacagagactagaagagggtggcagatctcctgagactgga gttaatgcttgtgagctgccatgtggatgctggaaatcaaacccaggtcctttggaaggcaggcaggtgctcttaatcatggaagca tctcttcagctcc

[0135] SEQ ID NO:26 cagcgacatcagaagaggatattggatcccattacagatggttgaaggccaccatgtcgttgctgggaatgaactcaagacctctg gaagagcagtcagtgctcttaacctctgagccatctctccagccc

[0136] SEQ ID NO:27 atcccctccaaagctcaagatggttgtaagccaccctgtgattgctgggatttgaactcaagacctccggaagagcaattagtgctct taaccgctgagcaatctctccagccc

[0137] SEQ ID NO:28 gtgcagtgctagaggaggtcagaagagggcattggatcccccagaactggagttatacggtaacctcgtggtggttgtgaaccac catgtggatggatattgagttccaaacactggtcctgtgcaagagcatccagtgctcttaagtgctgagccatctctttagctccttattt taaatatatgagtatttcacctgcataggcgcacagtacccacagagactagaagagggtggcagatctcctgagactggagttaat gcttgtgagctgccatgtggatgctggaaatcaaacccaggtcctttggaaggcaggcaggtgctcttaatcatggaagcatctctt cagctcc

[0138] SEQ ID NO:29 gtgcagtgctagaggaggtcagaagagggcattggatcccccagaactggagttatacggtaacctcgtggtggttgtgaaccac catgtggatggatattgagttccaaacactggtcctgtgcaagagcatccagtgctcttaagtgctgagccatctctttagctccgtgc gaattcggtgcagtgctagaggaggtcagaagagggcattggatcccccagaactggagttatacggtaacctcgtggtggttgtg aaccaccatgtggatggatattgagttccaaacactggtcctgtgcaagagcatccagtgctcttaagtgctgagccatctctttagct ccgtgcgaattcggtgcagtgctagaggaggtcagaagagggcattggatcccccagaactggagttatacggtaacctcgtggt ggttgtgaaccaccatgtggatggatattgagttccaaacactggtcctgtgcaagagcatccagtgctcttaagtgctgagccatct ctttagctcc

[0139] SEQ ID NO:30 tttttttaaaaatttatttttattttatgtgtatgagtgttttgcctgcatgtatgtctgtgtaccacgtgcgtgcctggtgcccgcggaggcc agaagagggcgtcggatcccctggaactggagttacagatggttgtgagccgccatgtgggtgctgggaatcgaacccgggtcc tctggaagagcagccagtgctcttaaccgctgagccatctctccagcccc

[0140] SEQ ID N0:31 ttttttttacttgtataggtgttttgcctgcatgtgtatctatctatgtaccgaatatgttcctggtatccacagagaccaaaagtggatgttg tatctcctgaaattggagtcatagacagttatgagctgccatttgagtgcttggaatagaacccaggtcctcttaaagagcatccagtg ctcttaaaaactgagacatctctgtagcctc

[0141] SEQ ID NO:32 tttattttgctttatgtgtctgagtgtttgcttgaatgtatgtctgtgtaccacgcctgtaccttgtgccttcagagttgagaggagggcata ggatctcctggaactggaattgcaggtggttgtgagccaccctgtgggtcctggggaccatactccagcaagaacatcatgtgctct taattcctgagtctccaacc

[0142] SEQ ID NO:33 tttatttacttatctttatgtgtatgagtgtgttgtcagactgttatgtctgtgtgtcacatgcatgcctgctgttcatggagtccagaagag ggcatcggatcccctggaactggagttacagatgagtggccatgtgaatgttaagaaccaaacctgggtcctctgaaagagcaga caatgctcttaactactgagctgtctctccagcccc SEQ ID NO:34 ttattttattcgtgtaagtgttttgccagcatctatgtcttcgcactatgtgcaggtctggtgcctgaggggtccagacgagagcactgg gtctccgggaactggagttacagatcattgtgagccaccatgtgggtgcagggaatcgaacctgggacctctggaggagcagcc actgctcttaaccactacactatttctccag

[0143] SEQ ID NO:35 tctgtggaccactgtgtacagaagcctgagaaggctagcagatccccagaactggaactgtgagacgctgtgctatggaggtgct aggaactgaaaatggatgggtcctctgcaagagcag

[0144] SEQ ID NO:36 ttgttttaattgaatggctatagggtgtttcttctgtatgtatatctatgtttggtacctacagaggcatcagatcctctggaactgtagttg ctgacagttgtgagctgtcatggggatgctggaattgaacctggatcctatgaaagaacagccagtgttcttaaccgctgagctatct ctccaggccc

[0145] SEQ ID NO:37 ttttttttttaattttaaaaaaaaagattttatttatttattttatatatgatgagtacactgtcactcttttcagacaccctagaaaaggggggc atcagatcccattacagatggttgtgagccacatggttgctgggaattgacctcaggacctctgaaagagcagtcagtgctctcaac ctttgagtcatctctccagccc

[0146] SEQ ID NO:38 atgtatatctgtaatgggacatactcacatacatgggcacgtgagtataaaaggccagaagagagcactggaccctctggagttga gattctaagcagttgtgaaccatctgatgtaggtgctgggaactgaacttgggtcctttgctagagaagtatgtctcttaaccactgag ccgtatctccatccc

[0147] SEQ ID NO:39 taaagatttattcattaagtacactgtagctatcttcagacgcatcagaagagggcgtcagatctctttacaggtggttgtgagccacc atgtggttgctggaatttgaactcaggaccttcaaaagagcagtcagtgttcttaaccgctgagccatctctccaacccc

[0148] SEQ ID NO:40 ttatttattataagtacactgtagctgtcttcagacacaacaaaagagggcgtcagatctcattacaggtggttgagccaccatgtggtt gctgggatttgaactcaggaccttcagaacagtcagtgctcttacccactgagccagcgagccagcccc SEQ ID NO:41 gaactggagttatacggtaacctcgtggtggttgggaaccaccatgtggatggatattgagttccaaacactggtcc

[0149] SEQ ID NO:42 gaactggagttatacggtaacctcgtggtggttcccaaccaccatgtggatggatattgagttccaaacactggtcc

[0150] SEQ ID NO:43 ggaccggagttatacggtaaccgcgtggtggttgtgaaccaccacgcggatggatattgagttccaaacaccggtcc

[0151] SEQ ID NO:44 gaactagagttatacggtaaccacatggtggttgtgaaccaccatgtggatggatattgagttccaaacactagttc

[0152] SEQ ID NO:45 ttattttaaatatatgagtatttcacctgcataggcgcacagtacccacagagactagaagagggtagtagatcccctagaactggag ttatacggtaacctcgtggtggttgtgagctaccatgtggatggatactgggaatcaaacccaggtcctgtggaaggcaggcaggt gctctcaagcactgagccatctcttcagctcc

[0153] SEQ ID NO:46 ttattttaaatatatgagtatttcacctgcataggcgcacagtgctcaaggagatcagaagagggcatcagatctcctgagactggag ttatacggtaacctcgtgatggttgtgaactaccatgtggatggatattgagttccaaacacaggtcctgtgcaagagcagcaggtg ctcttaagcacggaaccatctctttagctcc

[0154] SEQ ID NO:47 gaggctagaagagggtatcagatcccctgagactggagttatacggtaacctcgtggtggttgtgagccaccatgtggatggatac tgagaaccaaaccctggtcctgtgcaagagcatcaggtgctcttaagcacggaaccatctcttcagctcc

[0155] SEQ ID NO:48 gtcctgtgcaagagcatcgaactcggtgctcttaagcacagaagccaccaagccatctcttcagcccc

[0156] SEQ ID NO:49 cagtgctagaggaggtcagaagagggcatcccccagcctcgtggtggttgtgaaccaccatgtggctgtgcaagagcatgctctt aagtgctgagccatctctttagctc

[0157] SEQ ID NO:50 gagggcattggatcccccagaactggagttatacggtaacctcgtggtggttgtgaaccaccatgtggatggatattgagttccaaa cactggtcctgtgcaagagcatccagtgctcttaagtgc

[0158] SEQ ID N0:51 ggatcccccagaactggagttatacggtaacctcgtggtggttgtgaaccaccatgtggatggatattgagttccaaacactggtcct g

[0159] SEQ ID NO:52 tgctagaggaggtcagaagagggcattggatgcaaatccagtgctcttaagtgctgagccatctctttagct

[0160] SEQ ID NO:53 gagggcattggatcccccagaactggagttatacggtaacgatggatattgagttccaaacactggtcctgtgcaagagcatccag tgctctta

[0161] SEQ ID NO:54 atctgcagaattc

[0162] SEQ ID NO:55 tcatcactcttctcacctggtggaacatctgcagaattccagtgctagaggaggtcagaagagggcattggatcccccagaactgg agttatacggtaacctcgtggtggttgtgaaccaccatgtggatggatattgagttccaaacactggtcctgtgcaagagcatccagt gctcttaagtgctgagccatctctttagctcc

[0163] SEQ ID NO:56

[0164] Acattgtggctttgctgtcctggagactcagtgtcttaaaatctatctgcagaattccagtgctagaggaggtcagaagagggcattg gatcccccagaactggagttatacggtaacctcgtggtggttgtgaaccaccatgtggatggatattgagttccaaacactggtcctg tgcaagagcatccagtgctcttaagtgctgagccatctctttagctcc

Claims

CLAIMS1. A functional nucleic acid molecule which is an RNA or DNA molecule comprising:- a binding domain (BD), which comprises at least one antisense nucleotide sequence which is antisense with respect to a target nucleotide sequence which is present in the RNA encoding for the Brain-Derived Neurotrophic Factor (BDNF), and- an effector domain (ED), which comprises at least one regulatory SINEB2 nucleotide sequence capable of increasing the translation of the BDNF protein, or which comprises at least one functionally active fragment of the regulatory SINEB2 nucleotide sequence, wherein the at least one antisense nucleotide sequence of the binding domain comprises the nucleotide sequence SEQ ID NO: 1 or the nucleotide sequence SEQ ID NO:2.

2. The functional nucleic acid molecule according to claim 1, wherein the at least one antisense nucleotide sequence of the binding domain is between 26 and 60 nucleotides in length.

3. The functional nucleic acid molecule according to claim 1 or 2, wherein the at least one regulatory SINEB2 nucleotide sequence of the effector domain or a functionally active fragment thereof is selected from the group consisting of the sequences having at least 90% homology to a sequence selected from the group consisting of sequences SEQ ID NO:3 to SEQ ID NO:53.

4. The functional nucleic acid molecule according to claim 3, wherein the at least one regulatory SINEB2 nucleotide sequence of the effector domain or a functionally active fragment thereof is selected from the group consisting of sequences SEQ ID NO:3 to SEQ ID NO:53.

5. The functional nucleic acid molecule according to any one of claims 1 to 4, which comprises at least one linker nucleotide sequence located between the binding domain and the effector domain, wherein the at least one linker nucleotide sequence is preferably SEQ ID NO:54.

6. The functional nucleic acid molecule according to claim 1, which comprises or consists of SEQ ID NO:55 or SEQ ID NO:56.

7. An expression vector comprising a functional nucleic acid molecule according to any one of claims 1 to 6.

8. A host cell including the expression vector according to claim 7, wherein the host cell is preferably a eukaryotic cell, more preferably a mammalian cell.

9. A composition for increasing the brain-derived neurotrophic factor (BDNF) translation efficiency, comprising a functional nucleic acid molecule according to any one of claims 1 to 6, or an expression vector according to claim 7, or a host cell according to claim 8, and at least one pharmaceutically acceptable carrier, excipient and / or diluent.

10. A method for increasing the brain-derived neurotrophic factor (BDNF) translation efficiency, comprising the step (a) of allowing a functional nucleic acid molecule according to any one of claims 1 to 6 or an expression vector according to claim 7 to coexist with an RNA encoding for BDNF.

11. The method according to claim 10, wherein step (a) comprises transfecting or transducing the functional nucleic acid molecule according to any one of claims 1 to 6 or an expression vector according to claim 7 into a host cell.

12. A method for the production of the brain-derived neurotrophic factor (BDNF), comprising the step of increasing BDNF translation efficiency by the method according to claim 10 or 11.

13. The functional nucleic acid molecule according to any one of claims 1 to 6, or the expression vector according to claim 7, or the host cell according to claim 8, for use as a medicament.

14. The functional nucleic acid molecule according to any one of claims 1 to 6, or theexpression vector according to claim 7, or the host cell according to claim 8, for use in the therapeutic treatment of a disease selected from the group consisting of neurodegenerative diseases, neuropsychiatric diseases, congenital developmental defects, spinal cord lesions, peripheral motor and sensory axon lesions, skin lesions, gum lesions, and dental pulp lesions.

15. The functional nucleic acid molecule, or the expression vector, or the host cell, for use according to claim 14, wherein the neurodegenerative disease is selected from the group consisting of Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), Huntington's disease.

16. The functional nucleic acid molecule, or the expression vector, or the host cell, for use according to claim 14, wherein the congenital developmental defect is selected from the group consisting of Rett syndrome, Tourette syndrome, Angelmann syndrome.

17. The functional nucleic acid molecule according to any one of claims 1 to 6, or the expression vector according to claim 7, or the host cell according to claim 8, for use as a neuroprotector against neuronal damage caused by beta-amyloid (AP) oligomers.

Images