Cyclo-hispro derivative and use thereof for preventing, ameliorating or treating fibrosis
The cyclo-hispro derivative NOV-JD-1 addresses the limitations of current fibrosis treatments by inhibiting key fibrotic pathways, demonstrating efficacy in reducing fibrotic protein expression and improving tissue function.
Patent Information
- Application Number
- PCT/KR2024/020629
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-12-18
- Filing Date
- 2024-12-18
- Publication Date
- 2025-06-26
AI Technical Summary
Current treatments for fibrosis, such as corticosteroids and immunosuppressive drugs, have shown limited effectiveness in clinical trials, highlighting the need for novel therapeutic approaches.
The development of a cyclo-hispro derivative, NOV-JD-1, which inhibits the activation and expression of fibronectin, α-SMA, collagen, and inflammatory cytokines induced by TGF-β, offering a potential antifibrotic agent.
NOV-JD-1 effectively inhibits fibrosis in various tissues by reducing the expression of fibrotic proteins and genes, thereby improving liver and lung function and potentially treating fibrotic diseases.
Smart Images

Figure KR2024020629_26062025_PF_FP_ABST
Abstract
Description
Cyclo-hispro derivatives and their use for preventing, ameliorating or treating fibrosis
[0001] This application claims priority to Republic of Korea Patent Application No. 10-2023-0185147, filed December 18, 2023, the entire disclosure of which is incorporated herein by reference.
[0002] The present invention relates to a cyclo-hispro (CHP) derivative and its use for preventing, improving or treating fibrosis, and more particularly, to a cyclo-hispro derivative in which deuterium is substituted on the imidazole group of cyclo-hispro, and a pharmaceutical composition for preventing or treating fibrosis comprising the same, a health functional food composition for preventing or improving fibrosis, an anti-fibrotic composition and a method for preventing, improving or treating fibrosis using the same.
[0003] Fibrosis is a disease characterized by the abnormal production, accumulation, and deposition of extracellular matrix by fibroblasts, resulting in fibrosis of organs or tissues. Fibrosis is a highly fatal disease that can cause organ damage. For example, idiopathic pulmonary fibrosis (IPF) is a chronic, progressive, and fatal disease that results from recurrent alveolar epithelial cell damage associated with fibroblast accumulation and myofibroblast differentiation, leading to irreversible destruction of lung parenchyma and excessive accumulation of extracellular matrix (ECM).
[0004] Conventional therapeutic studies have largely targeted the inflammatory process of fibrosis, using corticosteroids and immunosuppressive drugs. However, these agents have shown little efficacy in clinical trials, necessitating the development of new drugs to treat fibrosis.
[0005] Meanwhile, Korean Patent No. 10-2140910 discloses a composition for preventing, improving, or treating fibrosis containing cyclo-hispro, but the antifibrotic effect of the cyclo-hispro derivative is unknown.
[0006] The purpose of the present invention is to provide a novel cyclo-hispro derivative.
[0007] Another object of the present invention is to provide a pharmaceutical composition for preventing or treating fibrosis comprising a cyclo-hispro derivative.
[0008] Another object of the present invention is to provide a health functional food composition for preventing or improving fibrosis, comprising a cyclo-hispro derivative.
[0009] Another object of the present invention is to provide an antifibrotic composition comprising a cyclo-hispro derivative.
[0010] Another object of the present invention is to provide a method for preventing, improving or treating fibrosis using a cyclo-hispro derivative.
[0011] Another object of the present invention is to provide a use of a cyclo-hispro derivative for the manufacture of a medicament or health functional food for preventing, improving or treating fibrosis.
[0012] To solve the above-described problem, the present invention provides a compound represented by the following chemical formula 1, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof:
[0013] [Chemical Formula 1]
[0014] .
[0015] In addition, the present invention provides a pharmaceutical composition for preventing or treating fibrosis, comprising a compound represented by the above chemical formula 1 or a pharmaceutically acceptable salt thereof.
[0016] Additionally, the present invention provides a health functional food composition for preventing or improving fibrosis, comprising a compound represented by the above chemical formula 1 or a food-wise acceptable salt thereof.
[0017] In addition, the present invention provides a method for preventing or treating fibrosis, comprising a step of administering an effective amount of a compound represented by the above chemical formula 1 or a pharmaceutically acceptable salt thereof to a subject in need thereof.
[0018] In addition, the present invention provides a composition comprising a compound represented by the above chemical formula 1 or a pharmaceutically or food-wise acceptable salt thereof for use in the prevention, improvement or treatment of fibrosis.
[0019] Additionally, the present invention provides the use of a cyclo-hispro derivative for the manufacture of a medicament or health functional food for preventing, improving or treating fibrosis.
[0020] In the present invention, the fibrosis may be at least one selected from the group consisting of liver fibrosis, pulmonary fibrosis, renal fibrosis, skin fibrosis, cardiac fibrosis, pancreatic fibrosis, nerve fibrosis, muscle fibrosis, and joint fibrosis.
[0021] In the present invention, the liver fibrosis may be caused by at least one selected from the group consisting of chronic liver disease, hepatitis B virus infection, hepatitis C virus infection, hepatitis D virus infection, schistosomiasis, alcoholic liver disease, steatohepatitis related to metabolic disorders, metabolic diseases, protein deficiencies, coronary artery disease, autoimmune hepatitis, cystic fibrosis, alpha-1 antitrypsin deficiency, primary biliary cirrhosis, drug reactions, and toxins.
[0022] In the present invention, the pulmonary fibrosis may be caused by at least one selected from the group consisting of idiopathic pulmonary fibrosis, radiation-induced lung injury, nonspecific interstitial pneumonia, acute interstitial pneumonia, cryptogenic organizing pneumonia, respiratory bronchiolitis-associated interstitial lung, desquamative interstitial pneumonia, lymphoid interstitial pneumonia, interstitial pulmonary fibrosis, diffuse pulmonary fibrosis, pulmonary edema, cystic fibrosis, and metabolic disease.
[0023] Furthermore, the present invention provides an anti-fibrotic composition comprising a compound represented by the above chemical formula 1 or a pharmaceutically acceptable salt thereof.
[0024] The composition comprising the cyclo-hispro derivative of the present invention can effectively inhibit fibrosis of various tissues by inhibiting the activation and expression of fibronectin, α-SMA, collagen (Collagen I, Collagen III, Collagen IV) and inflammatory cytokines (IL-1β, IL-6) by TGF-β, which is a cause of fibrosis.
[0025] Figure 1 shows changes in the expression of fibronectin, a fibrotic protein, following treatment with NOV-JD-1 in LX2 cells, a human liver cell line.
[0026] Figure 2 shows changes in the expression of fibronectin, a fibrogenic protein, following treatment with NOV-JD-1 in AML12 cells, a mouse liver cell line.
[0027] Figure 3 shows changes in the expression of fibronectin, a fibrotic protein, following treatment with CHP and NOV-JD-1 in LX2 cells, a human liver cell line.
[0028] Figure 4 shows changes in the expression of fibronectin, a fibrotic protein, following treatment with CHP and NOV-JD-1 in AML12 cells, a mouse liver cell line.
[0029] Figure 5 shows the change in blood ALT activity in liver function measured by NOV-JD-1 administration in CCl4-induced liver fibrosis / MASH model animals.
[0030] Figure 6 shows changes in gene expression of inflammatory cytokines IL-1β (A) and IL-6 (B) in liver tissues by NOV-JD-1 administration in CCl4-induced hepatic fibrosis / MASH model animals.
[0031] Figure 7 shows changes in the expression of fibrotic genes Collagen I (A), Collagen III (B), and α-SMA (C) in liver tissues by NOV-JD-1 administration in CCl4-induced liver fibrosis / MASH model animals.
[0032] Figure 8 is a diagram measuring changes in hydroxyproline levels in liver tissues by administration of CHP and NOV-JD-1 in CCl4-induced hepatic fibrosis / MASH model animals.
[0033] Figure 9 is a diagram confirming the change in the expression of α-SMA, a fibrotic gene, in liver tissue by administration of CHP and NOV-JD-1 in CCl4-induced liver fibrosis model animals.
[0034] Figure 10 is a diagram confirming changes in the expression of inflammatory cytokine IL-1β (A) and IL-6 (B) genes in liver tissues by administration of CHP and NOV-JD-1 in CCl4-induced liver fibrosis model animals.
[0035] Figure 11 is a diagram confirming the change in the expression of fibronectin, a fibrogenic protein, in liver tissue by administration of CHP and NOV-JD-1 in CCl4-induced liver fibrosis model animals.
[0036] Figure 12 shows changes in the expression of fibronectin, a fibrogenic protein, following treatment with NOV-JD-1 in MRC5 cells, a human lung fibroblast cell line.
[0037] Figure 13 shows changes in the expression of the fibrogenic protein Collagen I in mouse primary lung fibroblasts following treatment with NOV-JD-1.
[0038] Figure 14 shows changes in the expression of fibronectin, a fibrogenic protein, in primary lung fibroblasts of mice following treatment with CHP and NOV-JD-1.
[0039] Figure 15 shows the change in the amount of hydroxyproline in lung tissues measured by administration of NOV-JD-1 in BLM-induced IPF model animals.
[0040] Figure 16 shows changes in the expression of fibrotic genes Fibronectin (A), Collagen I (B), Collagen III (C), and Collagen IV (D) in lung tissues by NOV-JD-1 administration in BLM-induced IPF model animals.
[0041] Figure 17 shows changes in the expression of fibronectin, a fibrogenic protein, in lung tissues following administration of NOV-JD-1 in BLM-induced IPF model animals.
[0042] Figure 18 shows changes in the expression of fibrotic genes αSMA (A) and Vimentin (B) in lung tissues by administration of CHP and NOV-JD-1 in BLM-induced IPF model animals.
[0043] As described above, conventional fibrosis treatment studies have largely targeted the inflammatory process of fibrosis using corticosteroids and immunosuppressive drugs. However, these agents have shown little effect in clinical trials, and novel drugs for treating fibrosis are needed.
[0044] Accordingly, the present inventors synthesized (3S,8aS)-3-((1H-imidazol-4-yl-2-d)methyl)hexahydropyrrolo[1,2-a]pyrazine-1,4-dione (NOV-JD-1), a derivative of cyclo-hispro, and confirmed that the compound is effective in preventing, improving, or treating fibrosis by inhibiting the activation and expression of fibronectin, α-SMA, collagen (Collagen I, Collagen III, Collagen IV) and inflammatory cytokines (IL-1β, IL-6) by TGF-β, thereby inhibiting fibrosis of various tissues, thereby completing the present invention.
[0045] Accordingly, the present invention provides a pharmaceutical composition for preventing or treating fibrosis comprising a compound of the following formula 1 or a pharmaceutically acceptable salt thereof, which is a cyclo-hispro derivative, or consisting essentially of a compound of the following formula 1 or a pharmaceutically acceptable salt thereof, or consisting of a compound of the following formula 1 or a pharmaceutically acceptable salt thereof, and / or a health functional food composition for preventing or improving fibrosis comprising a compound of the following formula 1 or a food-based acceptable salt thereof, or consisting essentially of a compound of the following formula 1 or a food-based acceptable salt thereof, or consisting of a compound of the following formula 1 or a food-based acceptable salt thereof.
[0046] The present invention also provides an antifibrotic composition comprising a compound of the following formula 1 or a pharmaceutically acceptable salt thereof, consisting essentially of a compound of the following formula 1 or a pharmaceutically acceptable salt thereof, or consisting of a compound of the following formula 1 or a pharmaceutically acceptable salt thereof.
[0047] [Chemical Formula 1]
[0048]
[0049] In the present invention, "Cyclo-HisPro (CHP)" refers to a naturally occurring circular dipeptide composed of histidine-proline, a metabolite of thyrotropin-releasing hormone (TRH), or a physiologically active dipeptide that is synthesized in the body through TRH metabolism and de novo, and is a substance widely distributed throughout the brain, spinal cord, and gastrointestinal tract. In addition, Cyclo-HisPro is a compound registered with CAS Number: 53109-32-3, and is also called (3S,8aS)-3-((1H-imidazol-4-yl)methyl)hexahydropyrrolo[1,2-a]pyrazine-1,4-dione.
[0050] The present inventors synthesized (3S,8aS)-3-((1H-imidazol-4-yl-2-d)methyl)hexahydropyrrolo[1,2-a]pyrazine-1,4-dione (NOV-JD-1), a cyclo-hispro derivative in which deuterium is substituted on the imidazole group of cyclo-hispro, according to the following reaction scheme, and named it "NOV-JD-1".
[0051] [Reaction formula]
[0052]
[0053] In the present invention, the term "isomer" refers to a compound of the present invention or a salt thereof that has the same chemical formula or molecular formula but is structurally or sterically different. Such isomers may include racemates, enantiomers, diastereomers, mixtures of enantiomers, or mixtures of diastereomers.
[0054] In the present invention, the term "fibrosis" is used interchangeably with "fibrotic condition", "fibroproliferative condition", "fibrotic disease", "fibroproliferative disease", "fibrotic disorder", and "fibroproliferative disorder", and refers to a condition, disease, or disorder characterized by dysregulated proliferation or activity of fibroblasts, abnormal accumulation of fibronectin, and / or pathological or excessive accumulation of collagenous tissue. Typically, such conditions, diseases, or disorders are treatable by administration of a compound having antifibrotic activity.
[0055] In the present invention, the fibrosis may occur in one or more selected from the group consisting of, for example, the liver, lungs, kidneys, skin, heart, pancreas, urinary system, reproductive system, sweat glands, nerves, brain, bone marrow, muscles, and joints. Specifically, the fibrosis may be one or more selected from the group consisting of, but is not limited to, liver fibrosis, pulmonary fibrosis, renal fibrosis, skin fibrosis, cardiac fibrosis, pancreatic fibrosis, nerve fibrosis, muscle fibrosis, and joint fibrosis.
[0056] For example, the fibrosis of the present invention may be at least one selected from the group consisting of pulmonary fibrosis, idiopathic pulmonary fibrosis, radiation-induced lung injury, or pulmonary fibrosis, pulmonary edema, cystic fibrosis, liver fibrosis, endomyocardial fibrosis, myocardial infarction, atrial fibrosis, glial scar, renal fibrosis, myelofibrosis, arthrofibrosis, fat fibrosis, skin fibrosis, nerve fibrosis, and muscle fibrosis, but is not limited thereto.
[0057] More specifically, the cyclo-hispro derivative (NOV-JD-1) according to the present invention exhibits therapeutic effects on various fibrosis conditions described herein.
[0058] In the use of the composition of the present invention for preventing, improving or treating fibrosis, the first aspect relates to liver fibrosis, which is fibrosis occurring in the liver.
[0059] In the present invention, the term "liver fibrosis" refers to a symptom in which fibrous tissue proliferates due to chronic damage to the liver, and may include any one or more selected from the group consisting of chronic liver disease, hepatitis B virus infection, hepatitis C virus infection, hepatitis D virus infection, schistosomiasis, alcoholic liver disease, steatohepatitis associated with metabolic disorders, metabolic diseases, protein deficiencies, coronary artery disease, autoimmune hepatitis, cystic fibrosis, alpha-1 antitrypsin deficiency, primary biliary cirrhosis, drug reactions, and toxins, and the liver fibrosis may include, but is not limited to, steatohepatitis associated with metabolic disorders.
[0060] Liver fibrosis, a precursor lesion to cirrhosis, is initiated by the action of various cytokines and growth factors as a result of severe liver damage that causes chronic liver disease. Typically, liver fibrosis is reversible and consists of thin fibrils. If nodules are not formed and the cause of liver damage is temporary, the increased extracellular matrix (ECM) is degraded by apoptosis and matrix metalloproteinases (MMPs), allowing normal recovery. However, if liver fibrosis is repetitive and persistent, thick fibrils form and progress to nodular cirrhosis. Furthermore, various inflammatory factors damage hepatocytes, leading to the accumulation of abnormal extracellular matrix proteins, including collagen, leading to liver fibrosis, which in turn induces cirrhosis. Controlling the accumulation of extracellular matrix is crucial for the progression of cirrhosis. When hepatocytes are damaged, the inflammatory response activates resting hepatic stellate cells to secrete extracellular matrix and various cytokines and chemokines, among which TGF-β1 acts as a potent growth inhibitor. TGF-β1 is a 25 kD substance that binds to latent TGF-β1 binding protein and is secreted in an inactive latent form, and exists in a bound state with extracellular matrix components such as type 1,4 collagen, laminin, and decorin, and is activated by various stimuli. TGF-β1 regulates collagen expression by decreasing collagenase production or increasing collagenase inhibitor production, and plays an important role in the fibrosis process by increasing the production of TNF-α, IL-1, and PDGF in macrophages. Currently, TGF-β1 is known to play an important role in liver fibrosis, as it is expressed only in areas where fibrosis has progressed and not in normal liver tissue or inactive areas.
[0061] Meanwhile, metabolic dysfunction-associated steatotic liver disease (MASLD) was previously called nonalcoholic fatty liver disease (NAFLD). It refers to a wide range of diseases that can be caused by obesity, diabetes, hyperlipidemia, drugs, etc. regardless of alcohol consumption, and include simple fatty liver disease (steatosis) without an inflammatory response, metabolic dysfunction-associated steatohepatitis (MASH) that shows an inflammatory response of hepatocytes (hepatocellular inflammation), advanced fibrosis, and liver cirrhosis as it progresses. The metabolic dysfunction-associated steatohepatitis (MASH) was also previously called non-alcoholic steatohepatitis (NASH).
[0062] Metabolic fatty liver disease (MASLD) is a disease that has increased in adults due to the consumption of high-fat and high-calorie diets in modern society. It is reported that 20-30% of the adult population in developed countries has MASLD, and 2-3% of them develop metabolic steatohepatitis (MASH). In particular, histological findings of steatohepatitis accompanied by fibrosis and inflammation are shown, which greatly increases the risk of developing cirrhosis, liver failure, and liver cancer.
[0063] Fatty liver disease is not a pathological condition per se, but rather a reversible condition that resolves naturally once the causative agent is removed. However, if excessive fat accumulation in the liver tissue persists, steatohepatitis develops. This leads to repeated hepatocyte necrosis and regeneration. During this process, the fibrous extracellular matrix (ECM) increases, leading to liver fibrosis. When liver damage reaches a certain stage, regardless of the causative agent, the accumulation of ECM increases. This continuous destruction and regeneration of hepatocytes leads to the formation of regenerative nodules, which can progress to irreversible liver cirrhosis.
[0064] Therefore, in the present invention, liver fibrosis is a disease clearly distinct from fatty liver, which is a reversible symptom, and refers to all diseases in which liver tissue is changed into fibrotic tissue such as regenerative nodules, resulting in a decline in liver function.
[0065] In one embodiment of the present invention, fibrosis was induced in human and mouse liver cell lines using TGF-β, and then the fibrosis inhibitory effect was evaluated by treating the cells with (3S,8aS)-3-((1H-imidazol-4-yl-2-d)methyl)hexahydropyrrolo[1,2-a]pyrazine-1,4-dione (NOV-JD-1), a novel synthesized cyclo-hispro derivative. As a result, as confirmed in Figures 1 and 2, the expression of fibronectin, a fibrogenic protein increased by TGF-β, was significantly reduced by treatment with NOV-JD-1.
[0066] In another embodiment of the present invention, to compare the anti-fibrotic effects of cyclo-hispro and its derivative NOV-JD-1 in liver cells, fibrosis was induced in liver cell lines using TGF-β, and then cyclo-hispro and NOV-JD-1 were treated at the same concentration to evaluate the anti-fibrotic effects. As a result, as confirmed in Figures 3 and 4, the expression of fibronectin, a fibrotic protein increased by TGF-β, was reduced by both cyclo-hispro and NOV-JD-1 treatment, and in particular, the reduction effect by NOV-JD-1 was significantly superior to that by CHP.
[0067] In another embodiment of the present invention, the effect of NOV-JD-1 administration on improving liver function and inhibiting fibrosis was evaluated in a liver fibrosis / MASH animal model induced using carbon tetrachloride (CCl4). As a result, as confirmed in Figures 5 to 7, in the carbon tetrachloride administration group, ALT (Alanine transaminase) increased due to liver damage caused by carbon tetrachloride, and the expression of genes for inflammation (IL-1β, IL-6) and fibrosis (Collagen I, Collagen III, α-SMA) in liver tissue was significantly increased. However, administration of NOV-JD-1 significantly decreased ALT, restored liver function, and significantly reduced the expression of genes for inflammation (IL-1β, IL-6) and fibrosis (Collagen I, Collagen III, α-SMA).
[0068] In another embodiment of the present invention, the antifibrotic effects of cyclo-hispro and NOV-JD-1 were compared by administering the same amount to a carbon tetrachloride (CCl4)-induced liver fibrosis / MASH animal model. As a result, as confirmed in Fig. 8, the hydroxyproline level, which was rapidly increased by CCl4, was reduced by both cyclo-hispro and NOV-JD-1 treatment, and in particular, the reduction effect by NOV-JD-1 was significantly superior to that by CHP. In addition, as confirmed in Figs. 9 and 10, the expression of the fibrotic gene α-SMA and the inflammatory cytokine genes IL-1β and IL-6, which were increased by CCl4, were reduced by both cyclo-hispro and NOV-JD-1 treatment, and in particular, the reduction effect by NOV-JD-1 was significantly superior to that by CHP. Furthermore, as confirmed in Fig. 11, the expression of fibronectin, a fibrotic protein increased by CCl4, was reduced by both cyclo-hispro and NOV-JD-1 treatment, and in particular, the reduction effect by NOV-JD-1 was significantly superior to that by CHP.
[0069] As demonstrated in Figures 1 and 2, NOV-JD-1 has an excellent effect in reducing the expression level of fibronectin protein, a fibrogenic protein, in liver cells induced with fibrosis. In particular, as demonstrated in Figures 3 and 4, NOV-JD-1 has a significantly better effect in reducing the expression of fibronectin protein compared to cyclo-hispro in liver cells induced with fibrosis. In addition, as demonstrated in Figures 5 to 7, NOV-JD-1 has an excellent effect in improving liver function and reducing the expression of inflammatory genes and fibrogenic genes in an animal model induced with liver fibrosis / MASH. In particular, as demonstrated in Figures 8 to 11, NOV-JD-1 has a more significant effect in reducing the expression of fibrogenic genes and inflammatory genes, and reducing the expression of fibronectin protein compared to cyclo-hispro in an animal model induced with liver fibrosis / MASH. Accordingly, NOV-JD-1 exhibits fundamental antifibrotic effects and can be applied to treat various liver fibrosis, as well as liver failure and liver cancer that progress from cirrhosis, regardless of the cause of fibrosis.
[0070] In the use of the composition of the present invention for preventing, improving or treating fibrosis, the second aspect relates to pulmonary fibrosis, which is fibrosis occurring in the lungs.
[0071] Among fibrosis, pulmonary fibrosis in particular is a disease in which chronic inflammatory cells infiltrate the alveolar walls of lung tissue, inducing tissue fibrosis and causing serious structural changes in the lung tissue. Once fibrosis progresses due to any cause, the lung tissue hardens and the alveolar walls thicken, reducing the oxygen supply from the blood and making breathing difficult. Currently, there is no treatment that can completely restore lung tissue that has already progressed to fibrosis. Therefore, unless fibrosis is detected in the early stages or a lung transplant is performed, patients usually die 3 to 5 years after the onset of symptoms.
[0072] Specifically, the term "pulmonary fibrosis" in the present invention refers to the development of scarred (fibrous) tissue due to the formation or development of excessive fibrous connective tissue (fibrosis) in the lungs. Specifically, pulmonary fibrosis is a chronic disease that causes swelling and scarring of the alveoli and interstitial tissue of the lungs. This scar tissue replaces healthy tissue, causing inflammation, and chronic inflammation can be considered a precursor to fibrosis. This damage to lung tissue can cause the lungs to stiffen, making it difficult for the individual to breathe on their own.
[0073] In the present invention, pulmonary fibrosis may be caused by at least one selected from the group consisting of idiopathic pulmonary fibrosis, radiation-induced lung injury, nonspecific interstitial pneumonia, acute interstitial pneumonia, cryptogenic organizing pneumonia, respiratory bronchiolitis-associated interstitial lung, desquamative interstitial pneumonia, lymphoid interstitial pneumonia, interstitial pulmonary fibrosis and diffuse pulmonary fibrosis, pulmonary edema, cystic fibrosis, and metabolic diseases, but is not limited thereto.
[0074] The aforementioned pulmonary fibrosis can be caused by various factors, such as microscopic damage to the lungs induced by inhalation of fine particles (such as asbestos, rock dust, metal dust, particles present in cigarette smoke, and silica dust). Furthermore, pulmonary fibrosis can occur as a secondary effect of other diseases (such as autoimmune diseases and viral or bacterial infections), and can be induced by certain medications, such as cytotoxic agents (such as bleomycin, busulfan, and methotrexate); antibiotics (such as nitrofurantoin and sulfasalazine); antiarrhythmics (such as amiodarone and tocainide); anti-inflammatory drugs (such as gold and penicillamine); and illicit drugs (such as narcotics, cocaine, and heroin). In the case of idiopathic pulmonary fibrosis, it may be caused by unknown causes other than these. Furthermore, long-term consumption of a high-fat diet induces pulmonary fibrosis, which appears to be due to increased inflammation levels associated with high-fat intake.
[0075] In one embodiment of the present invention, fibrosis was induced in human and mouse lung fibroblast cell lines using TGF-β, and then treated with a novel synthesized cyclo-hispro derivative, NOV-JD-1, to evaluate its anti-fibrosis effect. As a result, as confirmed in Figures 12 and 13, the expression of fibronectin and Collagen I, fibrotic proteins that are increased by TGF-β, was significantly reduced by treatment with NOV-JD-1.
[0076] In another embodiment of the present invention, fibrosis was induced in a mouse lung fibroblast line using TGF-β, and then cyclo-hispro and its derivative NOV-JD-1 were treated at the same concentration to compare the fibrosis inhibitory effects. As a result, as confirmed in Fig. 14, the expression of fibronectin, a fibrotic protein increased by TGF-β, was reduced by treatment with both cyclo-hispro and NOV-JD-1, and in particular, the reduction effect by NOV-JD-1 was more remarkable than that by cyclo-hispro.
[0077] In another embodiment of the present invention, the inhibitory effect of NOV-JD-1 administration on fibrosis was evaluated in an animal model of idiopathic pulmonary fibrosis (IPF) induced using bleomycin. As a result, as confirmed in Figures 15 to 17, in the bleomycin-administered group, the level of hydroxyproline rapidly increased, and the expression of fibrogenic genes (Fibronectin, Collagen I, Collagen III, Collagen IV, and α-SMA) and proteins (Fibronectin) in lung tissue significantly increased, but the administration of NOV-JD-1 significantly decreased the level of hydroxyproline, and the expression of fibrogenic genes (Fibronectin, Collagen I, Collagen III, Collagen IV, and α-SMA) and proteins (Fibronectin) significantly decreased.
[0078] In another embodiment of the present invention, cyclo-hispro and its derivative NOV-JD-1 were administered in equal amounts to an IPF animal model induced using bleomycin, and their antifibrotic effects were compared. As a result, as confirmed in Fig. 18, the expression of fibrotic genes αSMA and Vimentin, which were increased by BLM, were both reduced by administration of cyclo-hispro and NOV-JD-1, and in particular, the reduction effect by NOV-JD-1 was significantly superior to that by cyclo-hispro.
[0079] As demonstrated in Figures 12 and 13, NOV-JD-1 is excellent in reducing the expression levels of fibrotic proteins, fibronectin and Collagen I, in lung fibroblasts induced with fibrosis. In particular, as demonstrated in Figure 14, NOV-JD-1 significantly reduces the expression of fibrotic protein fibronectin compared to cyclo-hispro in lung fibroblasts induced with fibrosis. In addition, as demonstrated in Figures 15 to 17, NOV-JD-1 is excellent in reducing the level of hydroxyproline and the expression of major fibrotic genes (Fibronectin, Collagen I, Collagen III, and Collagen IV) and proteins (Fibronectin) in an animal model induced with pulmonary fibrosis. In particular, as demonstrated in Figure 18, NOV-JD-1 was found to be more effective in reducing the expression of fibrogenic genes (αSMA and Vimentin) compared to cyclo-hispro in an animal model of pulmonary fibrosis. Accordingly, NOV-JD-1 exhibits fundamental antifibrotic effects and can be applied to treat various pulmonary fibrosis types regardless of the underlying cause.
[0080] In the use of the composition of the present invention for preventing, improving or treating fibrosis, the third aspect relates to renal fibrosis, which is fibrosis occurring in the kidney.
[0081] Kidney disease is classified into acute renal failure or chronic renal failure depending on the progression, and depending on the cause, it is divided into glomerulonephritis caused by deposition of vascular complexes, diabetic nephropathy accompanying diabetes, hypertensive nephropathy accompanying hypertension, toxic nephropathy caused by drug administration such as antibiotics or anticancer drugs, bacterial infection, etc. Regardless of the type of kidney disease that causes it, if renal function impairment progresses chronically and the glomerular filtration rate decreases below 50%, in most cases the glomerular filtration rate continues to decrease, ultimately reaching end-stage renal failure, and complications such as hematological abnormalities, neurological complications, gastrointestinal complications, immunological complications, infections, or osteodystrophy may occur, and in severe cases, it can lead to death.
[0082] Chronic renal failure (CKD) is a condition in which renal function progressively declines unidirectionally (irreversibly) and the body's homeostasis is impaired. All kidney diseases are accompanied by renal fibrosis, ultimately leading to end-stage renal failure. Because chronic renal function decline is closely linked to the progression of renal fibrosis, inhibiting the progression of fibrosis can lead to the suppression of chronic renal failure.
[0083] In the present invention, the term "renal fibrosis" includes all diseases in which fibrosis occurs in the kidney due to various causes, and the fibrosis may include, but is not limited to, any one or more selected from the group consisting of catheter placement, glomerulosclerosis, glomerulonephritis, nephritis, acute renal failure, chronic renal failure, end-stage renal disease, and metabolic disease.
[0084] The types of nephritis include, for example, any interstitial nephritis, for example, staphylococcal nephritis, pneumococcal nephritis, viral nephritis accompanying smallpox, hepatitis B, hepatitis C, HIV, etc., nephritis due to parasitic infection such as malaria, fungal nephritis, infectious interstitial nephritis accompanying mycoplasma nephritis, etc., interstitial nephritis accompanying collagen diseases such as systemic erythematosus (lupus nephritis), systemic scleroderma (collagen disease kidney), Sjgren's syndrome, nephritis accompanying purpura nephritis, polyarteritis, rapidly progressive glomerulonephritis, interstitial nephritis accompanying vascular immune diseases such as radiation exposure, gold preparations, NSAIDs, penicillamine, It may be, but is not limited to, drug-induced interstitial nephritis caused by anticancer drugs such as bleomycin, antibiotics, paraquat, allergic nephritis caused by insect stings, pollen, poison ivy, amyloidosis nephritis, diabetic renal failure, chronic glomerulonephritis, malignant nephrosclerosis, nephritis accompanying multiple cystic kidney failure, tubulointerstitial nephritis, nephritis accompanying toxemia of pregnancy or cancer, membranous proliferative glomerulonephritis, IgA renal failure, mixed cryoglobulinemia nephritis, Goodpasture's-syndrome nephritis, Begena granulomatosis nephritis, acute interstitial nephritis, and idiopathic interstitial nephritis.
[0085] In the use of the composition of the present invention for preventing, improving or treating fibrosis, the fourth aspect relates to skin fibrosis.
[0086] The term "dermal fibrosis" in this invention refers to excessive scarring of the skin, resulting from a pathological wound healing response. A wide range of fibrotic skin diseases exist: scleroderma, nephrosclerotic dermatitis, mixed connective tissue disease, sclerosing myxedema, sclerosing edema, and eosinophilic fasciitis. Exposure to chemicals or physical agents (mechanical trauma, burn wounds) is also a potential cause of fibrotic skin diseases. Dermal fibrosis can be driven by immune, autoimmune, and inflammatory mechanisms. The balance between collagen production and degradation by fibroblasts plays a crucial role in the pathophysiology of dermal fibrosis. Certain cytokines, such as transforming growth factor-β (TGF-β) and interleukin-4 (IL-4), promote wound healing and fibrosis. Fibroblasts in normal skin are quiescent. They regulate the amount of connective tissue proteins and have low proliferative activity. After skin damage, these cells become activated, expressing α-smooth muscle actin (α-SMA) and synthesizing large amounts of connective tissue proteins. These activated cells are commonly called myofibroblasts.
[0087] In the present invention, the term "skin fibrosis" also means including "scleroderma".
[0088] Scleroderma is a chronic autoimmune connective tissue disease of unknown etiology characterized by vascular abnormalities and the hardening and thickening of skin, either locally or throughout the body, due to excessive collagen accumulation within the dermis. Collagen forms connective tissue, supporting and connecting the body's tissues. Scleroderma has several forms, with symptoms occurring only in specific areas of the body and others affecting the entire body, including internal organs. Scleroderma can be divided into localized scleroderma, which causes hardening of only a few areas of the skin, and systemic scleroderma, which causes fibrosis due to collagen accumulation not only in the skin but also in internal organs such as the lungs, digestive tract, kidneys, and heart. Systemic sclerosis is further classified into limited and widespread forms based on the extent of skin and internal organ involvement, prognosis, and immunological findings.
[0089] In the use of the present invention for preventing, improving or treating skin fibrosis, the skin fibrosis may include, but is not limited to, any one or more selected from the group consisting of scars, hypertrophic scars, keloid scars, localized scleroderma and systemic sclerosis.
[0090] The cause of scleroderma is not yet clearly known, but tissue fibrosis is thought to play a significant role.
[0091] The early symptoms of scleroderma vary widely, but skin symptoms become particularly pronounced in the later stages. Common symptoms of scleroderma include joint pain, morning stiffness, fatigue, and weight loss. Cold exposure also temporarily reduces blood flow to the fingers, toes, nose, and ears. This is an early and common symptom of scleroderma. Patients with scleroderma develop skin hardening. This hardening is widespread and typically occurs on both sides of the body. Eventually, tissue damage occurs, leading to skin discoloration.
[0092] Localized scleroderma is 2.6 times more common in women than in men. 75% of patients with localized scleroderma develop between the ages of 20 and 50, while pre-existing scleroderma tends to develop at an earlier age. Localized scleroderma is classified as localized scleroderma, systemic localized scleroderma, pre-existing localized scleroderma, or subcutaneous localized scleroderma.
[0093] Localized scleroderma often begins as erythematous or purplish patches, which become distinct from the surrounding normal skin. The skin in these areas becomes hard and loses elasticity. These patches may appear brown or, in many cases, discolored and white. While usually solitary, multiple patches can develop, and their size can vary from the size of a coin to the size of an adult's palm. While it can cause cosmetic problems, it does not progress to systemic sclerosis. In some patients, the hardened skin softens and recovers spontaneously without treatment.
[0094] Systemic focal scleroderma is a severe form of localized scleroderma, characterized by widespread hardening and hyperpigmentation of the skin. The skin hardens extensively on the trunk, buttocks, and legs. However, it is distinguished from systemic sclerosis by the absence of Raynaud's phenomenon or internal organ involvement.
[0095] Localized scleroderma is a condition in which the skin hardens in long, linear lines, often appearing on the legs, arms, forehead, and chest in that order. When vertical depressions form on the forehead, they are called "en coup de sabre" and can be a cosmetic problem. Unlike localized scleroderma, localized scleroderma affects not only the skin but also the underlying muscles and periosteum, becoming fixed to the underlying tissues. It occurs more frequently in children and can sometimes cause severe skeletal abnormalities in the limbs and face.
[0096] Subcutaneous scleroderma is characterized by sclerosis of the fat layer, fascia, muscles, and sometimes bones, and may cause limited joint movement. Because the lesions are deep, the characteristic skin pigmentation of scleroderma is not observed.
[0097] Systemic sclerosis (SSc) is approximately four times more common in women than in men, and can occur at any age, but is most common between the ages of 30 and 50. The widespread form is known to develop at a younger age than the limited form. Raynaud's phenomenon is the earliest symptom of SSc, followed by sclerosis of the skin and internal organs. SSc is classified into cutaneous and internal organ manifestations.
[0098] In systemic sclerosis, the first skin symptoms begin in the fingers and hands. Initially, only Raynaud's phenomenon is present, followed by swelling, stiffness, and redness of the fingers and hands. The skin gradually hardens, spreading to the arms and face. In the more extensive form, the skin hardens continuously, including over the entire body, including the trunk. Facial sclerosis causes a general loss of wrinkles and difficulty making facial expressions. The nose appears pointed, the mouth becomes difficult to open, the lips become thin, and radial wrinkles develop around the mouth, giving it a senile appearance. Joint movement becomes limited, making it difficult to fully grasp the hand, and the fingers become curved and pointed, a condition called digital sclerosis. Painful, stubborn ulcers develop on the fingertips and joints.
[0099] Widespread hyperpigmentation and localized hypopigmentation may occur, along with hair loss and decreased sweating in affected areas. Telangiectasias may appear as round spots on the face and upper trunk, or may be observed around the nail folds. In patients with Raynaud's disease, abnormalities in the nail fold capillaries can lead to subsequent systemic sclerosis, making capillary changes important in determining prognosis. Skin calcification may also be observed, occurring relatively commonly around the finger joints.
[0100] Internal organ symptoms occur in the gastrointestinal tract, lungs, heart, or kidneys. The esophagus is the most commonly affected site in the gastrointestinal tract, accounting for over 90% of cases. Esophageal peristalsis, dysphagia, and reflux esophagitis are common. Small intestinal motility impairment can lead to constipation, diarrhea, and malabsorption. Pulmonary symptoms are the most common cause of death in systemic sclerosis patients, occurring in approximately 70% of cases. Lung fibrosis causes dyspnea and coughing during exercise. Alveolitis frequently occurs, leading to persistent decline in lung function. Cardiac symptoms include conduction disturbances, heart failure, and pericarditis, and myocardial sclerosis can occur in 50-70% of patients. Renal symptoms occur in approximately 45% of systemic sclerosis patients. These symptoms include sudden onset of acute renal failure and hypertension, and slowly progressive uremia may also occur.
[0101] Therefore, in the use of the present invention for preventing, improving or treating skin fibrosis, skin fibrosis includes, without limitation, fibrosis of internal cavities of organs or glands such as blood vessels and veins, ducts of submandibular, gall bladder, thyroid follicles, sweat gland ducts, ovaries and kidneys; epithelial cells of the gums, tongue, palate, nose, larynx, esophagus, stomach, intestines, rectum, anus and vagina; fibrosis of any skin tissue and epithelial cells including the dermis, scar, skin and scalp.
[0102] In the use of the composition of the present invention for preventing, improving or treating fibrosis, the fifth aspect relates to cardiac fibrosis, which is fibrosis occurring in the heart.
[0103] In the present invention, the term "cardiac fibrosis" refers to a phenomenon in which the heart hardens due to excessive deposition of matrix proteins between cardiac cells, which mainly occurs in the hearts of patients with myocardial infarction and is the main cause of decreased cardiac function, and may include, but is not limited to, any one or more selected from the group consisting of endomyocardial fibrosis, atrial fibrosis, heart failure, myocardial infarction, and cardiac fibrosis caused by metabolic diseases.
[0104] Fibrosis is characterized by the imbalanced accumulation of fibrous collagen following cardiomyocyte death, inflammation, increased workload, hypertrophy, and stimulation by multiple hormones, cytokines, and growth factors.
[0105] Cardiac fibrosis can also refer to abnormal thickening of the heart valves due to the imbalanced proliferation of cardiac fibroblasts, but more commonly, it refers to the proliferation of fibroblasts in the heart muscle. Fibrocytes normally secrete collagen and provide structural support to the heart. When overactive, this process can lead to thickening and fibrosis of the valves.
[0106] Since cardiac fibrosis is a major cause of heart failure and myocardial infarction, the term “cardiac fibrosis” can be interpreted to encompass heart failure and / or myocardial infarction caused by cardiac fibrosis.
[0107] In the use of the composition of the present invention for preventing, improving or treating fibrosis, the sixth aspect relates to fatty fibrosis.
[0108] As described above, the present invention has confirmed that NOV-JD-1 exhibits anti-fibrotic activity by reducing the expression of various fibrosis marker genes or proteins in various tissue cells and animal models in which fibrosis is induced, and thus it can be expected that it can be effectively applied to the prevention, improvement, or treatment of fibrosis occurring in various tissues and / or organs in the body, including the liver, lungs, skin, kidney, heart, pancreas, nerves, muscles, and joints.
[0109] In the composition for preventing, improving or treating fibrosis of the present invention, the terms “prevention,” “improvement” and / or “treatment” mean any act of inhibiting or delaying the onset of a disease or condition, any act of improving or beneficially altering the state of a disease or condition, and any act of delaying, stopping or reversing the progression of a disease or condition.
[0110] As used herein, the term "pharmaceutically acceptable" means physiologically acceptable and does not typically cause an allergic reaction or similar reaction when administered to a human, and the salt is preferably an acid salt formed by a pharmaceutically acceptable free acid.
[0111] The pharmaceutically acceptable salt may be an acid addition salt formed using an organic acid or an inorganic acid, wherein the organic acid includes, for example, formic acid, acetic acid, propionic acid, lactic acid, butyric acid, isobutyric acid, trifluoroacetic acid, malic acid, maleic acid, malonic acid, fumaric acid, succinic acid, succinic acid monoamide, glutamic acid, tartaric acid, oxalic acid, citric acid, glycolic acid, glucuronic acid, ascorbic acid, benzoic acid, phthalic acid, salicylic acid, anthranilic acid, dichloroacetic acid, aminooxyacetic acid, benzenesulfonic acid, p-toluenesulfonic acid or methanesulfonic acid. The inorganic acid includes, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, carbonic acid or boric acid. The acid addition salt may preferably be in the form of a hydrochloride or an acetate salt, and more preferably in the form of a hydrochloride salt.
[0112] In addition, other possible salt forms include gabapentin salt, gabapentin salt, pregabalin salt, nicotinate salt, adipate salt, hemimalonate salt, cysteine salt, acetylcysteine salt, methionine salt, arginine salt, lysine salt, ornithine salt, or aspartate salt, etc.
[0113] In addition, the pharmaceutical composition of the present invention may further include a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers may further include, for example, carriers for oral administration or carriers for parenteral administration. Carriers for oral administration may include lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like. Carriers for parenteral administration may include water, suitable oils, saline solutions, aqueous glucose, and glycols, and the like. In addition, stabilizers and preservatives may further be included. Suitable stabilizers include antioxidants such as sodium bisulfite, sodium sulfite, or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben, and chlorobutanol. Other pharmaceutically acceptable carriers may be referred to those described in the following literature (Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995).
[0114] The pharmaceutical composition of the present invention can be administered to mammals, including humans, by any method. For example, it can be administered orally or parenterally. Parenteral administration methods include, but are not limited to, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, or rectal administration.
[0115] The pharmaceutical composition of the present invention may be formulated as a preparation for oral administration or parenteral administration according to the administration route as described above. When formulated, it may be prepared using one or more buffers (e.g., saline or PBS), carbohydrates (e.g., glucose, mannose, sucrose, or dextran, etc.), antioxidants, bacteriostats, chelating agents (e.g., EDTA or glutathione), fillers, bulking agents, binders, adjuvants (e.g., aluminum hydroxide), suspending agents, thickening agents, wetting agents, disintegrating agents, or surfactants, diluents, or excipients.
[0116] Solid preparations for oral administration include tablets, pills, powders, granules, liquids, gels, syrups, slurries, suspensions, capsules, etc., and these solid preparations can be prepared by mixing the pharmaceutical composition of the present invention with at least one excipient, for example, starch (including corn starch, wheat starch, rice starch, potato starch, etc.), calcium carbonate, sucrose, lactose, dextrose, sorbitol, mannitol, xylitol, erythritol maltitol, cellulose, methyl cellulose, sodium carboxymethylcellulose, and hydroxypropylmethyl-cellulose, or gelatin. For example, tablets or sugar-coated tablets can be obtained by mixing an active ingredient with a solid excipient, grinding the mixture, adding a suitable auxiliary agent, and then processing the mixture into a granule mixture.
[0117] In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral administration include suspensions, solutions, emulsions, and syrups. In addition to the commonly used simple diluents, such as water or liquid paraffin, various excipients may be included, such as wetting agents, sweeteners, flavoring agents, or preservatives.
[0118] Additionally, cross-linked polyvinylpyrrolidone, agar, alginic acid, or sodium alginate may be added as a disintegrating agent in some cases, and anti-coagulants, lubricants, wetting agents, fragrances, emulsifiers, and preservatives may be additionally included.
[0119] When administered parenterally, the pharmaceutical composition of the present invention may be formulated in the form of injections, transdermal administration agents, and nasal inhalants together with a suitable parenteral carrier according to methods known in the art. In the case of injections, they must be sterilized and protected from contamination by microorganisms such as bacteria and fungi. Examples of suitable carriers for injections include, but are not limited to, solvents or dispersion media containing water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), mixtures thereof, and / or vegetable oils. More preferably, suitable carriers include Hanks' solution, Ringer's solution, phosphate buffered saline (PBS) containing triethanolamine, or isotonic solutions such as sterile water for injection, 10% ethanol, 40% propylene glycol, and 5% dextrose. To protect the above injection from microbial contamination, various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, and thimerosal, may be additionally included. In addition, the above injection may, in most cases, additionally include an isotonic agent, such as sugar or sodium chloride.
[0120] Transdermal administration agents include ointments, creams, lotions, gels, topical solutions, pastes, liniments, and aerosols. "Transdermal administration" as used herein refers to topically administering a pharmaceutical composition to the skin, thereby delivering an effective amount of the active ingredient contained in the pharmaceutical composition into the skin.
[0121] For inhalation administration, the compounds used according to the present invention may conveniently be delivered in the form of an aerosol spray from a pressurized pack or nebulizer using a suitable propellant, such as dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide, or another suitable gas. For pressurized aerosols, the dosage unit may be determined by providing a valve to deliver a metered amount. For example, gelatin capsules and cartridges for use in inhalers or insufflators may be formulated to contain a powder mixture of the compound and a suitable powder base such as lactose or starch. Formulations for parenteral administration are described in the well-known prescription book of pharmaceutical chemistry (Remington's Pharmaceutical Science, 15th Edition, 1975. Mack Publishing Company, Easton, Pennsylvania 18042, Chapter 87: Blaug, Seymour).
[0122] The pharmaceutical composition of the present invention can provide a desirable preventive, ameliorating, or therapeutic effect for fibrosis when it contains an effective amount of a cyclo-hispro derivative. As used herein, the term "effective amount" refers to an amount that exhibits a greater response than a negative control, and preferably refers to an amount sufficient to prevent, ameliorate, or treat fibrosis. The pharmaceutical composition of the present invention may contain 0.01 to 99.9% of the cyclo-hispro derivative, with the remainder being comprised of a pharmaceutically acceptable carrier. The effective amount of the cyclo-hispro derivative contained in the pharmaceutical composition of the present invention will vary depending on the form in which the composition is commercialized, etc.
[0123] The total effective amount of the pharmaceutical composition of the present invention can be administered to a patient as a single dose, or can be administered by a fractionated treatment protocol in which multiple doses are administered over a long period of time. The pharmaceutical composition of the present invention can vary the content of the active ingredient depending on the severity of the disease. For example, based on the cyclo-hispro derivative, it can be administered in one to several divided doses so as to be administered in an amount of preferably 0.001 to 100 mg, more preferably 0.01 to 10 mg per kg of body weight per day. However, since the dosage of the cyclo-hispro derivative is determined by taking into consideration various factors such as the route of administration and the number of treatments of the pharmaceutical composition, as well as the patient's age, weight, health status, sex, severity of the disease, diet, and excretion rate, a person having ordinary skill in the art will be able to determine an appropriate effective dosage of the cyclo-hispro derivative according to a specific use for preventing, treating, or improving fibrosis. The pharmaceutical composition according to the present invention is not particularly limited in its formulation, administration route, and administration method as long as it exhibits the effects of the present invention.
[0124] The pharmaceutical composition for preventing or treating fibrosis of the present invention can be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, or biological response modifiers.
[0125] The pharmaceutical composition of the present invention for preventing or treating fibrosis may also be provided in the form of an external preparation comprising a cyclo-hispro derivative. In this respect, the composition of the present invention may be a quasi-drug composition for preventing or improving fibrosis, or a quasi-drug comprising the composition.
[0126] The above-mentioned topical agent can be directly applied to the skin or oral cavity. When the pharmaceutical composition for preventing or treating fibrosis of the present invention is used as an topical agent, it may additionally contain adjuvants commonly used in the field of dermatology, such as fatty substances, organic solvents, solubilizers, thickening and gelling agents, softeners, antioxidants, suspending agents, stabilizers, foaming agents, fragrances, surfactants, water, ionic emulsifiers, nonionic emulsifiers, fillers, sequestering agents, chelating agents, preservatives, vitamins, blocking agents, humectants, essential oils, dyes, pigments, hydrophilic active agents, lipophilic active agents, or lipid vesicles. In addition, the above-mentioned components may be introduced in amounts commonly used in the field of dermatology.
[0127] When the composition of the present invention is provided as an external preparation, it may be in the form of a liquid, ointment, patch, gel, cream, or spray, but is not limited thereto. According to one embodiment of the present invention, the external preparation of the present invention may include oral care products including toothpaste, mouthwash, and mouth spray, ointments, masks, wet compresses, patches, and transdermal absorbents.
[0128] When the composition of the present invention is used as a quasi-drug composition, the cyclo-hispro derivative may be added directly or used appropriately in combination with other quasi-drug ingredients according to conventional methods. The amount of active ingredient mixed may be appropriately determined depending on the intended use (prevention, health, or therapeutic treatment).
[0129] The contents of the pharmaceutical composition and health functional food composition of the present invention may be applied to the pharmaceutical composition and the health functional food of the present invention.
[0130] In the present invention, the term "food-wise acceptable" means physiologically acceptable and does not typically cause an allergic reaction or similar reaction when ingested by humans, and the salt is preferably an acid salt formed by a food-wise acceptable free acid.
[0131] In the present invention, preferred examples of “food-based acceptable salt” may include the types of “pharmaceutically acceptable salt” described above.
[0132] In the present invention, the term “health functional food” includes both the meanings of “functional food” and “health food.”
[0133] In the present invention, the term “health functional food” includes both the meanings of “functional food” and “health food.”
[0134] In the present invention, the term "functional food" is the same as food for special health use (FoSHU), and refers to a food with high medical and therapeutic effects that is processed to efficiently exhibit a bioregulatory function in addition to providing nutrition.
[0135] In the present invention, the term "health food" refers to a food that has a more active health maintenance or promotion effect than regular food, and "health supplement food" refers to a food for health supplement purposes. In some cases, the terms "functional food," "health food," and "health supplement food" may be used interchangeably. The above foods may be manufactured in various forms, such as tablets, capsules, powders, granules, liquids, and pills, to achieve beneficial effects in improving and restoring liver function.
[0136] As a specific example of such functional foods, processed foods can be manufactured by using the composition to improve the storage properties of agricultural, livestock or marine products while simultaneously modifying them to preserve their characteristics.
[0137] The health functional food composition of the present invention can also be manufactured in the form of a nutritional supplement, food additive, feed, etc., and is intended for consumption by humans or animals including livestock.
[0138] The above type of food composition can be manufactured in various forms according to conventional methods known in the art. General foods include, but are not limited to, beverages (including alcoholic beverages), fruits and processed foods thereof (e.g., canned fruits, bottled fruits, jams, marmalades, etc.), fish, meats and processed foods thereof (e.g., ham, sausages, corned beef, etc.), breads and noodles (e.g., udon, buckwheat noodles, ramen, spagate, macaroni, etc.), fruit juices, various drinks, cookies, taffy, dairy products (e.g., butter, cheese, etc.), edible plant oils, margarine, vegetable proteins, retort foods, frozen foods, various seasonings (e.g., soybean paste, soy sauce, sauces, etc.), etc., which can be manufactured by adding the cyclo-hispro derivative.
[0139] In addition, nutritional supplements may be manufactured by adding a cyclo-hispro derivative or a food-related acceptable salt thereof to capsules, tablets, pills, etc., but are not limited thereto.
[0140] In addition, as a health functional food, it is not limited to this, but for example, the cyclo-hispro derivative or its food-related acceptable salt can be manufactured in the form of tea, juice, and drink and consumed by liquefying, granulating, encapsulating, and powdering so that it can be consumed (health drink). In addition, in order to use the cyclo-hispro derivative or its food-related acceptable salt in the form of a food additive, it can be manufactured in the form of a powder or concentrate. In addition, it can be manufactured in the form of a composition by mixing the cyclo-hispro derivative with a known active ingredient known to be effective in preventing or improving fibrosis.
[0141] When the food composition of the present invention is used as a health beverage composition, the health beverage composition may contain various flavoring agents or natural carbohydrates as additional ingredients, like conventional beverages. The natural carbohydrates described above may be monosaccharides such as glucose and fructose; disaccharides such as maltose and sucrose; polysaccharides such as dextrin and cyclodextrin; and sugar alcohols such as xylitol, sorbitol, and erythritol. The sweetener may be a natural sweetener such as thaumatin and stevia extract; or a synthetic sweetener such as saccharin and aspartame. The proportion of the natural carbohydrate is generally about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g, per 100 mL of the composition of the present invention.
[0142] The cyclo-hispro derivative or a food-wise acceptable salt thereof of the present invention may be contained as an active ingredient of a food composition for preventing or improving fibrosis. The amount thereof is an amount effective to obtain the above-described preventive or improving effect, and is preferably, for example, 0.01 to 100 wt% based on the total weight of the entire composition, but is not particularly limited thereto. The food composition of the present invention may be prepared by mixing the cyclo-hispro derivative or a food-wise acceptable salt thereof with another active ingredient known to be effective in preventing or improving fibrosis.
[0143] In addition to the above, the health functional food of the present invention may contain various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid, salts of pectic acid, alginic acid, salts of alginic acid, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, or carbonating agents. In addition, the health functional food of the present invention may contain fruit pulp for the production of natural fruit juice, fruit juice drinks, or vegetable drinks. These ingredients may be used independently or in mixtures. The proportion of these additives is not particularly important, but is generally selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention.
[0144] The present invention also relates to a method for preventing, ameliorating or treating fibrosis, comprising administering to a subject in need thereof an effective amount of a cyclo-hispro derivative or a pharmaceutically acceptable salt thereof.
[0145] In the methods of the present invention, the term "subject" includes, but is not limited to, any animal (e.g., a human, horse, pig, rabbit, dog, sheep, goat, non-human primate, cow, cat, guinea pig, or rodent). This term does not indicate a specific age or sex. Therefore, it is intended to include female / female or male / male, adult / adult and newborn subjects, as well as fetuses. A patient refers to a subject suffering from a disease or disorder. The term patient includes human and veterinary subjects.
[0146] In the method of the present invention, the description of the composition including the effect of the cyclo-hispro derivative and its administration route, number of administrations, dosage, etc. is the same as described above, and therefore, description thereof is omitted.
[0147] The present invention also provides the use of a cyclo-hispro derivative or a pharmaceutically acceptable salt thereof for the manufacture of a medicament or health functional food for preventing, improving or treating fibrosis.
[0148] Hereinafter, the present invention will be described in more detail through examples. However, the present invention can be modified in various ways and can take various forms. Therefore, the specific examples and descriptions described below are only intended to aid in understanding the present invention and are not intended to limit the present invention to a specific disclosed form. It should be understood that the scope of the present invention includes all modifications, equivalents, and substitutes included in the spirit and technical scope of the present invention.
[0149] [Example 1]
[0150] Synthesis of (3S,8aS)-3-((1H-imidazol-4-yl-2-d)methyl)hexahydropyrrolo[1,2-a]pyrazine-1,4-dione
[0151] [Reaction formula]
[0152]
[0153] 3 g of (3S,8aS)-3-((1H-imidazol-4-yl)methyl)hexahydropyrrolo[1,2-a]pyrazine-1,4-dione (Bachem) was dissolved in 10 ml of a solution adjusted to pH 8.0 in D2O using a 20 wt% solution of deuterium chloride dissolved in D2O and a 40 wt% solution of sodium deuteroxide dissolved in D2O, and stirred at 80°C for 2 days. The solution was freeze-dried for 24 hours. The above procedure was repeated three times. The solid obtained after three repetitions was dissolved in 10 ml of 0.1 M HCl and stirred for 24 hours. After the above solution was freeze-dried for 24 hours, it was dissolved in MeOH, filtered under reduced pressure, concentrated under reduced pressure, and dried under vacuum to obtain (3S,8aS)-3-((1H-imidazol-4-yl-2-d)methyl)hexahydropyrrolo[1,2-a]pyrazine-1,4-dione (NOV-JD-1) (yield 95%).
[0154] 1H NMR (400 MHz, Methanol-d4) δ 7.07 - 6.83 (m, 1H), 4.15 - 4.07 (m, 1H), 3.55 (dd, J = 12.4, 8.1 Hz, 1H), 3.51 - 3.35 (m, 1H), 3.35 - 3.21 (m, 2H), 3.21 - 3.11 (m, 1H), 3.09 (dt, J = 7.2, 3.6 Hz, 1H), 3.01 (ddd, J = 14.5, 5.0, 1.9 Hz, 1H), 2.28 - 2.11 (m, 1H), 2.01 - 1.89 (m, 1H), 1.89 - 1.71 (m, 2H).
[0155] [Example 2]
[0156] Confirmation of the antifibrotic effect of CHP derivatives in liver cells
[0157] 2-1. Cell culture
[0158] LX2 cells (Sigma-Aldrich SCC064), a human liver cell line, were cultured in an incubator at 37°C and 5% CO2 using DMEM medium (Hyclone) containing 10% FBS (Hyclone) and 1% penicillin / streptomycin antibiotics (Thermo).
[0159] AML12 cells (ATCC CRL-2254), a mouse liver cell line, were cultured in an incubator at 37°C and 5% CO2 using DMEM / F12 medium (Thermo) containing 10% FBS, 1% antibiotics, and ITS (Insulin / Transferrin / Selenium; Thermo) and dexamethasone (Sigma).
[0160] 2-2. Induction of cell fibrosis and sample processing
[0161] 2x10 LX2 cells 5Cells were seeded in 6-well plates at a concentration of 10 cells / well. After 24 hours, the cell medium was removed, and the negative control group was treated with serum-free medium, and the fibrosis-inducing group was treated with serum-free medium containing 2 ng / ml of TGF-β (R&D systems) at a concentration of 0, 1, 5, and 25 μM of NOV-JD-1 synthesized in Example 1, respectively. After 24 hours, the cells were washed once with cold PBS and harvested using a scraper.
[0162] AML12 cells were cultured in 2x10 5 Cells were seeded into 6-well plates at a concentration of 10 cells / well. After 24 hours, the cell medium was removed, and the negative control group was treated with serum-free medium, and the fibrosis-inducing group was treated with serum-free medium containing TGF-β at a concentration of 2 ng / ml. NOV-JD-1 synthesized in Example 1 was treated at concentrations of 0 and 10 μM, respectively. After 16 hours, the cells were washed once with cold PBS and harvested using a scraper.
[0163] 2-3. Analysis of expression of intracellular fibrogenic proteins
[0164] 100 μl of RIPA lysis buffer (Thermo) containing protease and phosphatase inhibitors was added to each recovered cell, and the cells were lysed by pipetting. After incubating on ice for 10 minutes, the cells were centrifuged at 15,000 rpm for 10 minutes at 4°C. The supernatant was collected and the protein concentration was measured by the BCA quantitation method using a BCA protein quantitation kit (Intron), and equal amounts of samples were used in Bolt TMProteins were separated using a protein gel electrophoresis system (Thermo) and transferred to nitrocellulose membranes. The membranes were blocked with 5% skim milk for 1 hour at room temperature and then incubated with primary antibodies: fibronectin antibody (Abcam), Gapdh antibody (Cell signaling), and vinculin antibody (Cell signaling) overnight at 4°C. After washing three times with TBST for 10 minutes each, the membranes were incubated with secondary antibodies for 1 hour at room temperature. After washing three times with TBST for 10 minutes each, the expression level was measured by ECL. The density of the bands that appeared was quantified using the ImageJ program, and the fibronectin band density value was corrected by dividing it by the band density value of the loading control group.
[0165] As a result of the experiment, as shown in Fig. 1, the expression of fibronectin, a fibrotic protein that increases by TGF-β in LX2 cells, was confirmed to decrease by 21.6, 20.1 and 37.3% in the groups treated with 1, 5 and 25 μM of NOV-JD-1, respectively, showing a concentration-dependent decrease. In addition, as shown in Fig. 2, the expression of fibronectin, a fibrotic protein that increases by TGF-β in AML12 cells, was confirmed to decrease by 48.2% in the group treated with 10 μM of NOV-JD-1.
[0166] These results confirmed that NOV-JD-1 can improve fibrosis in LX2 and AML12 cells, which are liver cell lines. Furthermore, as NOV-JD-1 showed an anti-fibrosis effect in liver cell lines, it was expected that it could also improve liver tissue fibrosis and metabolically abnormal steatohepatitis (MASH).
[0167] [Example 3]
[0168] Comparison of the antifibrotic effects of CHP and CHP derivatives in liver cells.
[0169] In the same manner as in Example 2, the antifibrotic effects of CHP and NOV-JD-1 synthesized in Example 1 were compared in LX2 cells and AML12 cells in which fibrosis was induced.
[0170] As a result, as shown in Fig. 3, the expression of fibronectin, a fibrotic protein increased by TGF-β in LX2 cells, was confirmed to be reduced by 18.9 and 69.8% by CHP and 25 μM NOV-JD-1 treatment, respectively. The reduction by NOV-JD-1 showed a significant reduction of 62.8%, which was greater than that of CHP. This confirmed that NOV-JD-1 can improve fibrosis in LX2 cells, a liver cell line, and that its effect was superior to that of CHP. In addition, as shown in Fig. 4, the expression of fibronectin, a fibrotic protein increased by TGF-β in AML12 cells, was confirmed to be reduced by 23.9 and 70.6% by CHP and 10 μM NOV-JD-1 treatment, respectively. The reduction by NOV-JD-1 showed a significant reduction of 61.3%, which was greater than that of CHP. Through this, we confirmed that NOV-JD-1 can improve fibrosis in AML12 cells, a liver cell line, and its effect is superior to that of CHP.
[0171] Based on the above results, it was expected that NOV-JD-1 would be able to more effectively improve fibrosis and metabolic-related steatohepatitis (MASH) in liver tissue, as it showed an effect of improving fibrosis in liver cell lines and showed a significantly better effect than CHP.
[0172] [Example 4]
[0173] Confirming the efficacy of CHP derivatives in an animal model of liver fibrosis / MASH.
[0174] 4-1. Establishment of an animal model for liver fibrosis / MASH induction
[0175] Nine-week-old male C57BL6 / J mice (Daehan Biolink) were housed in an environment at 23±3℃ with free access to food (Purina) and water. After acclimating to the environment for 1 week and measuring body weight, the mice were randomly distributed to three groups with uniform average body weights as shown in Table 2. To induce liver fibrosis / MASH, 0.2 ml / kg of carbon tetrachloride (CCl4) (CCl4:olive oil = 1:19) per mouse was intraperitoneally injected into the disease-induced and experimental groups on days 0, 2, 5, 7, 9, 12, 14, 16, and 19. The normal control group was injected with olive oil in the same manner. NOV-JD-1 was orally administered daily at a concentration of 35 mg / kg. The normal control group and the disease-induced group were orally administered the same amount of purified water (DW). Mice were euthanized 12 h after the last CCl4 injection, and blood and liver tissue were collected.
[0176] GroupNormal control groupDisease-induced groupExperimental groupCCl4Olive oilCCl40.2ml / kgadministrationDWDWNov-JD-135mg / kgoral administrationNumber of animals488
[0177] 4-2. Liver function test
[0178] To test the liver function of mice, blood was diluted 1:19 using the dilution buffer of the ALT assay kit (K-753) from Biovision and measured according to the kit's protocol. As shown in Figure 5, it was confirmed that ALT activity, which was increased by CCl4, was significantly reduced by 13.6% by NOV-JD-1 administration.
[0179] 4-3. Evaluation of gene expression in liver tissue
[0180] Liver tissue was extracted with NucleoZOL according to the manufacturer's (MACHEREY-NAGEL) total RNA isolation protocol, and 1 μg of RNA was synthesized cDNA by reverse transcription polymerase chain reaction (RT-PCR) using ReverTra Ace qPCR RT Master Mix (Toyobo). The synthesized cDNA was analyzed by real-time PCR using primer sets of inflammatory cytokines IL-1β and IL-6 genes and fibrosis genes Collagen I, Collagen III, and α-SMA and SYBR Green Realtime PCR Master mix (Toyobo). The sequence information of the primers for real-time PCR is shown in Table 2. The primers in Table 2 were synthesized by request from Bioneer. Each gene expression value was corrected by dividing it by the expression value of gapdh, a housekeeping gene.
[0181] Gene Forward (5'-3') Sequence Number Reverse (5'-3') Sequence Number IL-1βAAGGGCTGCTTCCAAACCTTTGAC1ATACTGCCTGCCTGAAGCTCTTGT2IL-6TTGCCTTCTTGGGACTGATG3TCCTCTGTGAAGTCTCCTCTC4FibronectinTTGGAGAGGAGTGGGAGC5GAAATGACCACTGCCAAAGC6Collagen IGCCTCAGAAGAACTGGTACAT7ATCCATCGGTCATGCTCTCT8Collagen IIIAGTCAAGGAGAAAGTGGTCG9CCAGGGAAACCCATGACAC10Collagen IVCGGTACACAGTCAGACCATT11CATCACGAAGGAATAGCCGA12αSMAGCATCCACGAAACCACCT13CAGGACGTTGTTAGCATAGAGAT14VimentinGGATCAGCTCACCAACGACA 15ATTTCTCTCGCAGCCGCAT16β-actinGGGAAGGTGACAGCATTG17ATGAAGTATTAAGGCGGAAGATT18GapdhCAGTATGACTCCACCCACGG19ATGGGCTTCCCGTTGATGAC20
[0182] As a result of the experiment, as shown in Fig. 6, it was confirmed that the inflammatory cytokines IL-1β and IL-6 increased by CCl4 were significantly reduced by 46.3 and 45.0%, respectively, by NOV-JD-1 administration. In addition, as shown in Fig. 7, it was confirmed that the fibrosis genes Collagen I, Collagen III, and α-SMA increased by CCl4 were significantly reduced by 26.1, 23.6, and 40.7%, respectively, by NOV-JD-1 administration. Through the above results, it was confirmed that NOV-JD-1 can improve MASH by significantly reducing the expression of inflammation and fibrosis genes in liver tissue and significantly restoring ALT liver function in liver fibrosis / MASH-induced mice.
[0183] [Example 5]
[0184] Comparison of the antifibrotic effects of CHP and CHP derivatives in a liver fibrosis / MASH animal model.
[0185] In the same manner as in Example 4, the anti-fibrotic effects of CHP and NOV-JD-1 synthesized in Example 1 were compared in an animal model in which fibrosis was induced. Each group was divided into four groups as shown in Table 3.
[0186] Group Normal control group Disease-induced group CHP group NOV-JD-1 group CCl4 Olive oil CCl4 0.2ml / kg administered DWD WCHP 35mg / kg Nov-JD-1 35mg / kg oral administered Number of animals 4888
[0187] 5-1. Measurement of hydroxyproline levels in liver tissue
[0188] The level of hydroxyproline, which is used as an indicator of collagen accumulation due to fibrosis, was measured using a hydroxyproline assay kit (MAK008, Sigma). As a result of measuring in the lung tissue of each group, as shown in Figure 8, the level of hydroxyproline, which was rapidly increased by CCl4, was significantly reduced by 10.1% by CHP administration and 26.2% by NOV-JD-1 administration. The reduction by NOV-JD-1 was confirmed to be 17.9% more than that by CHP, confirming that NOV-JD-1 improves liver fibrosis in an animal model and that its effect is superior to that of CHP.
[0189] 5-2. Evaluation of gene expression in liver tissue
[0190] The expression levels of α-SMA, a fibrosis gene, and IL-1β and IL-6, inflammatory cytokines, were evaluated using the same method as in Example 4-3.
[0191] As shown in Fig. 9, the expression of the fibrosis gene α-SMA, which was increased by CCl4, was significantly reduced by 10.7% by CHP administration and by 36.9% by NOV-JD-1 administration. The reduction by NOV-JD-1 was also confirmed to be significantly reduced by 29.4% compared to CHP.
[0192] In addition, as shown in Fig. 10, the gene expression of inflammatory cytokines IL-1β (A) and IL-6 (B), which were increased by CCl4, was decreased by 13.4 and 8.6%, respectively, by CHP administration, and was significantly and significantly decreased by 46.3 and 45.0%, respectively, by NOV-JD-1 administration. The decrease in the NOV-JD-1 administration group compared to the CHP administration group was also confirmed to be statistically significant.
[0193] 5-3. Evaluation of fibrotic protein expression in liver tissue
[0194] Liver tissue was homogenized with 500 μl of RIPA buffer containing protease and phosphatase inhibitors, left on ice for 15 minutes, and centrifuged at 15,000 rpm for 10 minutes at 4°C. The supernatant was collected to recover the lysate, and the subsequent Western blotting process was performed as in Example 2-3 using fibronectin and Gapdh primary antibodies.
[0195] As shown in Fig. 10, the expression of fibronectin, a fibrogenic protein increased by CCl4, was significantly reduced by 21.4% by CHP and by 49.6% by NOV-JD-1. Here, too, the reduction by NOV-JD-1 was significantly reduced by 35.9% compared to CHP.
[0196] Through this, we confirmed that NOV-JD-1 can improve liver fibrosis and MASH by significantly reducing the expression of fibrogenic genes and inflammatory cytokine genes in liver tissues in liver fibrosis / MASH-induced mice and also significantly reducing the amounts of fibronectin and hydroxyproline, which are major protein markers of fibrosis. In addition, we confirmed that the antifibrotic effect of NOV-JD-1 is more excellent than that of the same amount of CHP.
[0197] Statistical significance was analyzed using the t-test between groups. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.
[0198] [Example 6]
[0199] Confirmation of the anti-fibrotic effect of CHP derivatives in lung cells
[0200] 6-1. Cell culture
[0201] MRC5 cells (ATCC CCL-171), a human lung fibroblast cell line, were cultured in an incubator at 37°C and 5% CO2 using MEM medium containing 10% FBS and 1% antibiotics.
[0202] In addition, to isolate primary lung fibroblasts from mice (Daehan Biolink Co., Ltd.), the mice were anesthetized with 3% isoflurane, then laparotomy was performed, the aorta was cut, and 10 ml of PBS was injected into the right ventricle to perfuse the lungs. The lungs were then removed, washed with cold PBS, and finely minced with a scalpel. The finely minced tissue was dissolved in DMEM medium containing 10% FBS and 1% antibiotics and evenly distributed in a 150 mm culture dish. The cells were cultured in an incubator at 37°C and 5% CO2, and the medium was changed every two days. On the 6th to 7th day, only attached cells were isolated and cultured on a new culture dish.
[0203] 6-2. Induction of cell fibrosis and sample processing
[0204] 2x10 MRC5 cells 5 Cells were seeded into 6-well plates at a concentration of 10 cells / well. After 24 h, the medium was removed, and the negative control group was treated with serum-free medium, and the fibrosis-inducing group was treated with serum-free medium containing TGF-β at a concentration of 2 ng / ml. NOV-JD-1 was treated at concentrations of 0 and 10 μM, respectively. After 16 h, the cells were washed once with cold PBS and harvested using a scraper.
[0205] Primary lung fibroblasts isolated from mice were seeded at 2x10 5 Cells were seeded into 6-well plates at a concentration of 10 cells / well. After 24 h, the medium was removed, and NOV-JD-1 was treated at concentrations of 0 and 25 μM, respectively, using serum-free medium for the negative control group and serum-free medium containing TGF-β at a concentration of 5 ng / ml for the fibrosis-inducing group. After 48 h, the cells were washed once with cold PBS and harvested using a scraper.
[0206] 6-3. Analysis of expression of intracellular fibrogenic proteins
[0207] The expression of fibrogenic proteins was analyzed using the same method as in Example 2-3. As a result of the experiment, as shown in Fig. 11, it was confirmed that the expression of fibronectin, a fibrogenic protein that increases by TGF-β in MRC5 cells, was significantly reduced by 22% in the group treated with 10 μM NOV-JD-1. In addition, as shown in Fig. 12, it was confirmed that the expression of Collagen I, a fibrogenic protein that increases by TGF-β in mouse primary lung fibroblasts, was significantly reduced by 32% in the group treated with 25 μM NOV-JD-1.
[0208] These results confirmed that NOV-JD-1 can improve fibrosis in MRC5 cells, a lung cell line, and primary mouse lung fibroblasts. Therefore, given that NOV-JD-1 exhibits anti-fibrosis effects in lung cells, it was expected that it could also improve fibrosis in lung tissue.
[0209] [Example 7]
[0210] Confirmation of the anti-fibrotic effects of CHP and CHP derivatives in lung cells
[0211] The anti-fibrotic effects of CHP and NOV-JD-1 synthesized in Example 1 were compared in mouse primary lung fibroblasts induced to undergo fibrosis in the same manner as in Example 6.
[0212] As a result of analyzing the expression of intracellular fibrogenic proteins, as shown in Fig. 13, the expression of fibronectin, a fibrogenic protein that increases by TGF-β in primary mouse lung fibroblasts, was significantly reduced by 27% by CHP and by 53.8% by NOV-JD-1. The reduction by NOV-JD-1 was confirmed to be 36.7% greater than that by CHP. Through this, it was expected that NOV-JD-1 could improve fibrosis in primary mouse lung fibroblasts with a better effect than CHP, and could also improve lung tissue fibrosis in animals.
[0213] [Example 8]
[0214] Confirmation of the effectiveness of CHP derivatives in an animal model of idiopathic pulmonary fibrosis
[0215] 8-1. Establishment of an animal model of idiopathic pulmonary fibrosis
[0216] C57BL6 / J mice were housed in an environment of 23±3℃ after introduction, with free access to food and water. After acclimation to the housing environment for 1 week, 0.03 IU / 50μl of bleomycin per individual was injected intratracheally using a catheter to induce IPF. The normal control group received an equal volume of saline intratracheally. After 1 week, the body weights were measured, and the mice were randomly distributed to ensure uniform average body weights and divided into three groups as shown in Table 4. The normal control group and the disease-induced group were orally administered DW daily for 2 weeks starting 1 week after bleomycin injection, and the experimental group was orally administered NOV-JD-1 at a concentration of 35 mg / kg for the same period.
[0217] Group: Normal control group, disease-induced group, experimental group, bleomycin (BLM), saline solution, BLM 0.03 IU / head, DWDWNov-JD-125 mg / kg, oral administration, number of animals: 478
[0218] 8-2. Measurement of hydroxyproline levels in lung tissue
[0219] As a result of measuring the level of hydroxyproline, which is used as an indicator of collagen accumulation due to fibrosis, in the lung tissue of each group, it was confirmed that the level of hydroxyproline, which was rapidly increased by BLM, was significantly reduced by 32.4% by NOV-JD-1 administration, as shown in Fig. 14.
[0220] 8-3. Evaluation of gene expression in lung tissue
[0221] The expression levels of fibrotic genes, Fibronectin, Collagen I, Collagen III, and Collagen IV, in lung tissue were evaluated using the primers in Table 2 in the same manner as in Example 4-3. As a result of the experiment, as shown in Fig. 15, it was confirmed that the fibrotic genes, Fibronectin, Collagen I, Collagen III, and Collagen IV, which were increased by BLM, were significantly reduced by 35.2, 35.5, 32.5, and 48.1%, respectively, by NOV-JD-1 administration.
[0222] 8-4. Evaluation of fibrotic protein expression in lung tissue
[0223] The expression of fibronectin, a fibrogenic protein, was analyzed in lung tissue using the same method as in Example 2-3. As shown in Figure 16, the expression level of fibronectin protein, which was increased by BLM, was significantly reduced by 52.8% by NOV-JD-1 administration.
[0224] Through the above results, we confirmed that NOV-JD-1 can improve IPF as several fibrosis markers in lung tissue were significantly reduced by NOV-JD-1 administration in a BLM-induced IPF mouse model.
[0225] [Example 9]
[0226] Comparison of the antifibrotic effects of CHP and CHP derivatives in an animal model of idiopathic pulmonary fibrosis.
[0227] The anti-fibrotic effects of CHP and NOV-JD-1 synthesized in Example 1 were compared in an animal model of idiopathic pulmonary fibrosis using the same method as in Example 8. Each group was divided into four groups as shown in Table 5.
[0228] Group: Normal control group, disease-induced group, CHP group, experimental group, bleomycin (BLM), saline solution, BLM 0.03 IU / head, DWD WC HP 25 mg / kg, Nov-JD 125 mg / kg, oral administration, number of animals 4788
[0229] 9-1. Evaluation of gene expression in lung tissue
[0230] The expression levels of α-SMA and Vimentin genes, which are fibrosis genes, were evaluated in lung tissue using the primers in Table 2 in the same manner as in Example 4-3. Each gene expression value was corrected by dividing it by the expression values of β-actin and gapdh, which are housekeeping genes.
[0231] As shown in Fig. 17, the expression of fibrosis genes αSMA (A) and Vimentin (B), which were increased by BLM, was reduced by 33% and 25.4%, respectively, by CHP administration, and was further significantly reduced by 52.5% and 50.8%, respectively, by NOV-JD-1 administration. This confirmed that NOV-JD-1 can significantly improve IPF compared to CHP in the BLM-induced IPF mouse model.
[0232] Statistical significance was analyzed using the t-test between groups. *p<0.05, **p<0.01.
Claims
1. A compound represented by the following chemical formula 1, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof: [Chemical Formula 1] .
2. A pharmaceutical composition for preventing or treating fibrosis, comprising a compound represented by the following chemical formula 1, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof: [Chemical Formula 1] .
3. A pharmaceutical composition for preventing or treating fibrosis, wherein the fibrosis in the second paragraph is at least one selected from the group consisting of liver fibrosis, pulmonary fibrosis, renal fibrosis, skin fibrosis, cardiac fibrosis, pancreatic fibrosis, nerve fibrosis, muscle fibrosis, and joint fibrosis.
4. A pharmaceutical composition for preventing or treating fibrosis, wherein the liver fibrosis in paragraph 3 is caused by at least one selected from the group consisting of chronic liver disease, hepatitis B virus infection, hepatitis C virus infection, hepatitis D virus infection, schistosomiasis, alcoholic liver disease, steatohepatitis associated with metabolic disorders, metabolic diseases, protein deficiencies, coronary artery disease, autoimmune hepatitis, cystic fibrosis, alpha-1 antitrypsin deficiency, primary biliary cirrhosis, drug reactions, and toxins.
5. A pharmaceutical composition for preventing or treating fibrosis in claim 3, wherein the pulmonary fibrosis is caused by at least one selected from the group consisting of idiopathic pulmonary fibrosis, radiation-induced lung injury, nonspecific interstitial pneumonia, acute interstitial pneumonia, cryptogenic organizing pneumonia, respiratory bronchiolitis-associated interstitial lung, desquamative interstitial pneumonia, lymphoid interstitial pneumonia, interstitial pulmonary fibrosis, diffuse pulmonary fibrosis, pulmonary edema, cystic fibrosis, and metabolic disease.
6. Health functional food composition for preventing or improving fibrosis, comprising a compound represented by chemical formula 1 or a food-based acceptable salt thereof: [Chemical Formula 1] 7. A health functional food composition for preventing or improving fibrosis, wherein the fibrosis in paragraph 6 is at least one selected from the group consisting of liver fibrosis, pulmonary fibrosis, renal fibrosis, skin fibrosis, cardiac fibrosis, pancreatic fibrosis, nerve fibrosis, muscle fibrosis, and joint fibrosis.
8. A health functional food composition for preventing or improving fibrosis, wherein the liver fibrosis in paragraph 7 is caused by at least one selected from the group consisting of chronic liver disease, hepatitis B virus infection, hepatitis C virus infection, hepatitis D virus infection, schistosomiasis, alcoholic liver disease, steatohepatitis associated with metabolic disorders, metabolic diseases, protein deficiencies, coronary artery disease, autoimmune hepatitis, cystic fibrosis, alpha-1 antitrypsin deficiency, primary biliary cirrhosis, drug reactions, and toxins.
9. A health functional food composition for preventing or improving fibrosis, in claim 7, wherein the pulmonary fibrosis is caused by at least one selected from the group consisting of idiopathic pulmonary fibrosis, radiation-induced lung injury, nonspecific interstitial pneumonia, acute interstitial pneumonia, idiopathic organizing pneumonia, respiratory bronchiolitis-associated interstitial lung, desquamative interstitial pneumonia, lymphoid interstitial pneumonia, interstitial pulmonary fibrosis, diffuse pulmonary fibrosis, pulmonary edema, cystic fibrosis, and metabolic disease.
10. An antifibrotic composition comprising a compound represented by the following chemical formula 1 or a pharmaceutically acceptable salt thereof: [Chemical Formula 1] .
11. A method for preventing, improving or treating fibrosis, comprising administering to a subject in need thereof an effective amount of a compound represented by the following chemical formula 1 or a pharmaceutically acceptable salt thereof: [Chemical Formula 1] .
12. A method for preventing, improving or treating fibrosis in claim 11, wherein the fibrosis is at least one selected from the group consisting of liver fibrosis, pulmonary fibrosis, renal fibrosis, skin fibrosis, cardiac fibrosis, pancreatic fibrosis, nerve fibrosis, muscle fibrosis and joint fibrosis.
13. A method for preventing, improving or treating fibrosis, in claim 12, wherein the liver fibrosis is caused by at least one selected from the group consisting of chronic liver disease, hepatitis B virus infection, hepatitis C virus infection, hepatitis D virus infection, schistosomiasis, alcoholic liver disease, steatohepatitis associated with metabolic disorders, metabolic diseases, protein deficiencies, coronary artery disease, autoimmune hepatitis, cystic fibrosis, alpha-1 antitrypsin deficiency, primary biliary cirrhosis, drug reactions and toxins.
14. A method for preventing, improving or treating fibrosis according to claim 12, wherein the pulmonary fibrosis is caused by at least one selected from the group consisting of idiopathic pulmonary fibrosis, radiation-induced lung injury, nonspecific interstitial pneumonia, acute interstitial pneumonia, cryptogenic organizing pneumonia, respiratory bronchiolitis-associated interstitial lung disease, desquamative interstitial pneumonia, lymphoid interstitial pneumonia, interstitial pulmonary fibrosis, diffuse pulmonary fibrosis, pulmonary edema, cystic fibrosis and metabolic disease.
15. Use of a compound represented by the following chemical formula 1 or a pharmaceutically or food-wise acceptable salt thereof for the manufacture of a drug or health functional food for the prevention, improvement or treatment of fibrosis: [Chemical Formula 1] 16. The use of claim 15, wherein the fibrosis is at least one selected from the group consisting of liver fibrosis, pulmonary fibrosis, renal fibrosis, skin fibrosis, cardiac fibrosis, pancreatic fibrosis, nerve fibrosis, muscle fibrosis, and joint fibrosis.
17. The use according to claim 16, wherein the liver fibrosis is caused by at least one selected from the group consisting of chronic liver disease, hepatitis B virus infection, hepatitis C virus infection, hepatitis D virus infection, schistosomiasis, alcoholic liver disease, steatohepatitis associated with metabolic disorders, metabolic diseases, protein deficiencies, coronary artery disease, autoimmune hepatitis, cystic fibrosis, alpha-1 antitrypsin deficiency, primary biliary cirrhosis, drug reactions, and toxins.
18. The use according to claim 16, wherein the pulmonary fibrosis is caused by at least one selected from the group consisting of idiopathic pulmonary fibrosis, radiation-induced lung injury, nonspecific interstitial pneumonia, acute interstitial pneumonia, cryptogenic organizing pneumonia, respiratory bronchiolitis-associated interstitial lung disease, desquamative interstitial pneumonia, lymphoid interstitial pneumonia, interstitial pulmonary fibrosis, diffuse pulmonary fibrosis, pulmonary edema, cystic fibrosis, and metabolic disease.
Citation Information
Patent Citations
Cyclo-hispro derivative and composition for preventing, improving or treating of fibrosis comprising the same
KR1020250094840A
Methods for predicting enzyme activity based on sequence co-evolution analysis and uses thereof
KR1020250039541A
Composition comprising CHP (cyclo-his pro) for preventing, improving or treating of fibrosis
KR102140910B1
Mass spectrometry assay method for detection and quantitation of microbiota-related metabolites
WO2020055631A1