Compositions and methods for modulating sptlc2

By employing antisense oligonucleotides to target and modulate SPTLC2 mRNA transcripts, the treatment of diseases resulting from dysregulation of L-serine biosynthesis is achieved, effectively reducing SPTLC2 protein levels and addressing associated metabolic dysregulation.

WO2025136934A1PCT designated stage expired Publication Date: 2025-06-26LEAL THERAPEUTICS INC
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/US2024/060495
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-02-07
Filing Date
2024-12-17
Publication Date
2025-06-26

AI Technical Summary

Technical Problem

Mutations in genes associated with L-serine biosynthesis, such as SPTLC2, lead to dysregulation of L-serine metabolism, contributing to various diseases and disorders, including retinal diseases, Hereditary Sensory and Autonomic Neuropathy type 1 (HSAN1), and neurodegenerative disorders.

Method used

The use of isolated nucleic acids, specifically antisense oligonucleotides, that bind to mRNA transcripts of SPTLC2, thereby modulating the level, transcription, splicing, and translation of the SPTLC2 protein, to treat diseases associated with dysregulation of L-serine biosynthesis.

Benefits of technology

This approach effectively decreases the levels of functional SPTLC2 protein, thereby addressing the dysregulation of L-serine metabolism and providing therapeutic benefits for associated diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2024060495_26062025_PF_FP_ABST
    Figure US2024060495_26062025_PF_FP_ABST
Patent Text Reader

Abstract

Aspects of the disclosure relate to compositions and methods for modulating translation of one or more RNA transcripts (e.g., mRNA transcripts) in a cell or subject. The disclosure is based, in part, on isolated nucleic acids that bind to mRNA transcripts of genes involved in L- serine biosynthesis, for example serine palmitoyltransferase long chain base subunit 2 (SPTLC2'). In some embodiments, compositions of the disclosure are useful for treating diseases or disorders associated with dysregulation of L-serine biosynthesis, such as retinal diseases (e.g., MacTel2 and Age-related macular degeneration (AMD) such as AMD with geographic atrophy), HSAN1 (e.g., HSANl(a)), diabetic retinopathy, a peripheral neuropathy (e.g., motor neuropathy, sensory neuropathy, autonomic nerve neuropathy, combination neuropathies, inherited or acquired peripheral neuropathies, etc.), neurodegeneration (e.g., Parkinson's disease (PD), Friedreich's ataxia, motor neuron disease, Alzheimer's disease (AD), amyotrophic lateral sclerosis (ALS), etc.), spastic paraplegia, or a psychiatric disorder (e.g., resistant depression, treatment resistant depression, schizophrenia, and / or treatment resistant schizophrenia).
Need to check novelty before this filing date? Find Prior Art

Description

[0001]COMPOSITIONS AND METHODS FOR MODULATING SPTLC2 RELATED APPLICATIONS The application claims the benefit under 35 U.S.C.119(e) of U.S. Provisional Application number 63 / 611,339, filed on December 18, 2023, and U.S. Provisional Application number 63 / 550,775, filed on February 7, 2024, each of which is herein incorporated by reference in its entirety. REFERENCE TO AN ELECTRONIC SEQUENCE LISTING The contents of the electronic sequence listing (L090770042WO00-SEQ-MFM.xml; Size: 105,775 bytes; and Date of Creation: November 25, 2024) are herein incorporated by reference in its entirety. BACKGROUND L-serine is important for a number of biological processes in the central nervous system (CNS), for example lipid biosynthesis and production of D-serine. In the CNS, L-serine biosynthesis occurs in astrocytes. Mutations in genes associated with L-serine biosynthesis and lipid (e.g., sphingolipid) biosynthesis have been associated with certain diseases and disorders of the CNS, for example macular telangiectasia type 2 (MacTel2) and Hereditary sensory neuropathy type 1 (HSAN1). SUMMARY Aspects of the disclosure relate to isolated nucleic acids that bind to mRNA transcripts of genes involved in L-serine biosynthesis, for example serine palmitoyltransferase long chain base subunit 2 (SPTLC2). In some embodiments, compositions of the disclosure are useful for treating diseases or disorders associated with dysregulation of L-serine biosynthesis, such as retinal diseases (e.g., MacTel2 and Age-related macular degeneration (AMD) such as AMD with geographic atrophy), HSAN1 (e.g., Hereditary Sensory and Autonomic Neuropathy type 1(a), HSAN1(a)), diabetic retinopathy, a peripheral neuropathy (e.g., motor neuropathy, sensory neuropathy, autonomic nerve neuropathy, combination neuropathies, inherited or acquired peripheral neuropathies, such as diabetic neuropathy, chemotherapy-induced neuropathy or other forms of toxic peripheral neuropathy, etc.), neurodegeneration (e.g., Parkinson’s disease (PD), 12155096.1 Friedreich’s ataxia, motor neuron disease, Alzheimer’s disease (AD), amyotrophic lateral sclerosis (ALS), etc.), spastic paraplegia, or a psychiatric disorder (e.g., resistant depression, treatment resistant depression, schizophrenia, and / or treatment resistant schizophrenia). The disclosure is based, in part, on compositions and methods for modulating a level, transcription, splicing, and / or translation of one or more RNA transcripts (e.g., mRNA transcripts) in a cell or subject. Accordingly, in some aspects, the disclosure provides an isolated nucleic acid that comprises a region of complementarity with a human SPTLC2 mRNA transcript, and upon binding to the mRNA transcript decreases a level, transcription, splicing, and / or translation of functional SPTLC2 protein from the mRNA transcript. In some embodiments, the isolated nucleic acid comprises a nucleic acid sequence that is at least 60% (e.g., 60%, 70%, 80%, 90%, 99%, or 100%) identical to any one of the nucleic acid sequences set forth in SEQ ID NOs: 1- 109. In some embodiments, the isolated nucleic acid comprises RNA. In some embodiments, the isolated nucleic acid is an antisense oligonucleotide (ASO). In some embodiments, the isolated nucleic acid comprises or consists of between 10 and 40 nucleotides. In some embodiments, the isolated nucleic acid comprises or consists of between 18 and 25 nucleotides. In some embodiments, the isolated nucleic acid comprises one or more chemical modifications. In some embodiments, the one or more chemical modifications comprise one or more nucleoside modifications and / or one or more sugar-phosphate backbone modifications. In some embodiments, the one or more nucleoside modifications comprises a 2′-O-methyl (2′- OMe) modification, a 2'-O-MOE modification, a 2′-fluoro modification, or a locked nucleic acid (LNA) modification. In some embodiments, the one or more sugar-phosphate backbone modifications comprises a phosphorothioate backbone modification. In some embodiments, the isolated nucleic acid is fully chemically modified (e.g., contains a fully modified sugar- phosphate backbone, and all nucleotides of the isolated nucleic acid are chemically modified). In some embodiments, the isolated nucleic acid comprises one or more deoxyribonucleotides. In some embodiments, the isolated nucleic acid is a gapmer. In some embodiments, the region of complementarity is located in an untranslated region of the SPTLC2 mRNA transcript. In some embodiments, the untranslated region comprises a 5′ UTR, an intron, or a 3′ UTR of the SPTLC2 mRNA transcript. 12155096.1 In some embodiments, the region of complementarity is located in a protein coding region of the SPTLC2 mRNA transcript. In some embodiments, the region of complementarity is located on an intron-exon boundary (e.g., the region of complementarity spans an intron exon boundary, such that the isolated nucleic acid hybridizes binds to both an intron and an exon at the same time) of the SPTLC2 mRNA transcript. In some embodiments, the region of complementarity comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 continuous nucleotides of the sequence set forth in SEQ ID NO: 109. In some embodiments, the isolated nucleic acid comprises the nucleotide sequence set forth in any one of the nucleotide sequences set forth in Table 1. In some aspects, the disclosure provides a method for increasing L-serine biosynthesis in a cell or subject, the method comprising administering an isolated nucleic acid as described herein to a subject in need thereof. In some embodiments, the subject is characterized as having low serine. In some embodiments, the subject comprises one or more mutations in a gene that is associated in L-serine biosynthesis. In some embodiments, the gene is SPTLC2. In some embodiments, the cell or subject is a human cell or subject. In some embodiments, the subject has or is suspected of having a disease or disorder associated with dysregulation of L-serine metabolism. In some embodiments, the disease or disorder is retinal diseases (e.g., MacTel2 and Age-related macular degeneration (AMD) such as AMD with geographic atrophy), HSAN1 (e.g., HSAN1(a)), diabetic retinopathy, a peripheral neuropathy (e.g., motor neuropathy, sensory neuropathy, autonomic nerve neuropathy, combination neuropathies, inherited or acquired peripheral neuropathies, such as diabetic neuropathy, chemotherapy-induced neuropathy or other forms of toxic peripheral neuropathy, etc.), neurodegeneration (e.g., Parkinson’s disease (PD), Friedreich’s ataxia, motor neuron disease, Alzheimer’s disease (AD), amyotrophic lateral sclerosis (ALS), etc.), spastic paraplegia, or a psychiatric disorder (e.g., resistant depression, treatment resistant depression, schizophrenia, and / or treatment resistant schizophrenia). In some embodiments, the administration is systemic administration. In some embodiments, the systemic administration comprises intravenous injection. 12155096.1 In some embodiments, the administration comprises direct administration to a target tissue of the subject. In some embodiments, the direct administration comprises direct injection to the central nervous system (CNS) of the subject. In some embodiments, the direct administration comprises direct injection to the peripheral nervous system (PNS) of the subject. In some embodiments, the direct administration comprises direct administration to the eye of the subject (e.g., via intraocular injection, topical injection, etc.). In some embodiments, the administration comprises placing the subject in a Trendelenburg position during the administration. In some aspects, the disclosure provides a method for decreasing deoxy-sphingolipid (deoxy-SL) biosynthesis in a cell or subject, the method comprising administering an isolated nucleic acid as described herein, to a subject in need thereof. In some embodiments, the subject is characterized as having low serine In some embodiments, the subject comprises one or more mutations in a gene that is associated in L-serine biosynthesis. In some embodiments, the gene is SPTLC2. In some embodiments, the cell or subject is a human cell or subject. In some embodiments, the subject has or is suspected of having a disease or disorder associated with dysregulation of L-serine metabolism. In some embodiments, the disease or disorder is retinal diseases (e.g., MacTel2 and Age-related macular degeneration (AMD) such as AMD with geographic atrophy), HSAN1 (e.g., HSAN1(a)), diabetic retinopathy, a peripheral neuropathy (e.g., motor neuropathy, sensory neuropathy, autonomic nerve neuropathy, combination neuropathies, inherited or acquired peripheral neuropathies, such as diabetic neuropathy, chemotherapy-induced neuropathy or other forms of toxic peripheral neuropathy, etc.), neurodegeneration (e.g., Parkinson’s disease (PD), Friedreich’s ataxia, motor neuron disease, Alzheimer’s disease (AD), amyotrophic lateral sclerosis (ALS), etc.), spastic paraplegia, or a psychiatric disorder (e.g., resistant depression, treatment resistant depression, schizophrenia, and / or treatment resistant schizophrenia). In some embodiments, the administration is systemic administration. In some embodiments, the systemic administration comprises intravenous injection. In some embodiments, the administration comprises direct administration to a target tissue of the subject. In some embodiments, the direct administration comprises direct injection to the central nervous system (CNS) of the subject. In some embodiments, the direct administration comprises direct injection to the peripheral nervous system (PNS) of the subject. 12155096.1 In some embodiments, the direct administration comprises direct administration to the eye of the subject (e.g., via intraocular injection, topical injection, etc.). In some embodiments, the administration comprises placing the subject in a Trendelenburg position during the administration. In some aspects, the disclosure provides a method for preventing or treating a disease or disorder associated with dysregulation of L-serine biosynthesis in a subject in need thereof, the method comprising administering to the subject an isolated nucleic acid as described herein. In some embodiments, the subject is a human. In some embodiments, the disease or disorder is retinal diseases (e.g., MacTel2 and Age- related macular degeneration (AMD) such as AMD with geographic atrophy), HSAN1 (e.g., HSAN1(a)), diabetic retinopathy, a peripheral neuropathy (e.g., motor neuropathy, sensory neuropathy, autonomic nerve neuropathy, combination neuropathies, inherited or acquired peripheral neuropathies, such as diabetic neuropathy, chemotherapy-induced neuropathy or other forms of toxic peripheral neuropathy, etc.), neurodegeneration (e.g., Parkinson’s disease (PD), Friedreich’s ataxia, motor neuron disease, Alzheimer’s disease (AD), amyotrophic lateral sclerosis (ALS), etc.), spastic paraplegia, or a psychiatric disorder (e.g., resistant depression, treatment resistant depression, schizophrenia, and / or treatment resistant schizophrenia). In some embodiments, the administration comprises direct administration to a target tissue of the subject. In some embodiments, the direct administration comprises direct injection to the central nervous system (CNS) of the subject. In some embodiments, the direct administration comprises direct injection to the peripheral nervous system (PNS) of the subject. In some embodiments, the direct administration comprises direct administration to the eye of the subject (e.g., via intraocular injection, topical injection, etc.). BRIEF DESCRIPTION OF DRAWINGS FIG.1 shows a schematic depicting modulation of RNA (e.g., mRNA, such as mature mRNA or pre-mRNA) translation by antisense oligonucleotides (ASOs). Composition “A” represents an ASO that binds to the 5' untranslated region (5' UTR) of an RNA. Composition “B” represents an ASO that binds to an intron of an RNA. Composition “C” represents an ASO that binds to a splice boundary (e.g., a splice junction) between an exon and intron of an RNA. Composition “D” represents an ASO that binds to an exon (e.g., protein coding region) of an RNA. Composition “E” represents a combination of an ASO binding to a 3' UTR of an RNA, 12155096.1 alone or with a trans-regulator. Composition “F” represents a “gapmer” ASO that binds to an exon (e.g., protein coding region) of an RNA and mediates RNaseH decay. Composition “G” represents a “gapmer” ASO that binds to a 3' UTR of an RNA, alone or with a trans-regulator, and mediates RNaseH decay. In some embodiments, ASOs binding to an RNA result in translation of a truncated protein that has a dominant negative effect on the wild-type, full-length protein. FIGs.2A-2D show representative data regarding expression profiling of human Serine palmitoyltransferase long chain base subunit 2 (SPTLC2). FIG.2A shows bulk tissue gene expression of human SPTLC2. FIG.2B shows a schematic depicting non-limiting examples of sequences corresponding to SPTLC2 isoforms (e.g., NCBI Ref. Seq. NM_004863.4). FIG.2C shows representative data for exon expression analysis of human SPTLC2 splice variants in CNS tissue. FIG.2D shows representative data for human SPTLC2 expression in CNS cells in samples from control and Alzheimer’s disease (AD) subjects. DETAILED DESCRIPTION Aspects of the disclosure relate to compositions and methods for modulating a level, transcription, splicing, and / or translation of one or more RNA transcripts (e.g., mRNA transcripts) in a cell or subject. The disclosure is based, in part, on isolated nucleic acids that bind to mRNA transcripts of genes involved in L-serine biosynthesis or lipid (e.g., sphingolipid) biosynthesis, for example serine palmitoyltransferase long chain base subunit 2 (SPTLC2). In some embodiments, compositions of the disclosure are useful for treating diseases or disorders associated with dysregulation of L-serine biosynthesis or lipid (e.g., sphingolipid) biosynthesis, such as retinal diseases (e.g., MacTel2 and Age-related macular degeneration (AMD) such as AMD with geographic atrophy), HSAN1 (e.g., HSAN1(a)), diabetic retinopathy, a peripheral neuropathy (e.g., motor neuropathy, sensory neuropathy, autonomic nerve neuropathy, combination neuropathies, inherited or acquired peripheral neuropathies, such as diabetic neuropathy, chemotherapy-induced neuropathy or other forms of toxic peripheral neuropathy, etc.), neurodegeneration (e.g., Parkinson’s disease (PD), Friedreich’s ataxia, motor neuron disease, Alzheimer’s disease (AD), amyotrophic lateral sclerosis (ALS), etc.), spastic paraplegia, or a psychiatric disorder (e.g., resistant depression, treatment resistant depression, schizophrenia, and / or treatment resistant schizophrenia). 12155096.1 L-serine and lipid biosynthesis Serine is a non-essential amino acid important for a variety of biochemical processes. In some instances, canonical roles of serine relate to its function in metabolism. In some instances, serine is important for the biosynthesis of proteins, the amino acids glycine and cysteine, and purines and pyrimidines. Once incorporated into proteins, the side chain chemistry of serine can fulfill different roles including, but not limited to, serving as a nucleophile during protease cleavage, serving as a site for phosphorylation by protein kinases, and as an acceptor residue for O-linked protein glycosylation. In the mammalian central nervous system (CNS), L-serine is used in the production of lipids, such as sphingolipids, which are involved in signaling functions at the cell membrane of brain cells. Production of sphingolipids in the brain from serine typically occurs in astrocytes. In some instances, dietary L-serine can be used directly by cells for sphingolipid synthesis. In other instances, serine is synthesized from glucose. Biosynthesis of L-serine involves several enzymatic steps including, for example, conversion of 3-phosphoglycerate derived from glucose into 3-phosphohydroxypyruvate by the enzyme phosphoglycerate dehydrogenase (PHGDH). Ultimately, 3-phosphoglycerate is used as a substrate for a series of enzymatic reactions to produce L-serine. Exogenous dietary and serine derived from glucose are used in the production of sphingolipids by condensation of L-serine with palmitoyl-CoA by the enzyme serine palmitoyl transferase (SPT). One subunit of SPT is provided by the SPTLC2 gene in humans which fulfills catalytic roles in the enzymatic activity of SPT. Mutations in SPTLC2 result in atypical production of sphingolipids, such as condensation of palmitoyl-CoA with alanine to form cytotoxic deoxysphingolipids. SPTLC2 mutations are also implicated in diseases or disorders of the nervous system, such as Parksinon’s disease (PD), Alzheimer’s disease (AD), amyotrophic lateral sclerosis (ALS), and Hereditary Sensory and Autonomic Neuropathy type 1 (HSAN1). Aspects of the disclosure relate to the inventors’ recognition that certain nucleic acid molecules, for example isolated nucleic acids, such as RNA processing modulators (e.g., antisense oligonucleotides), can be used to tune transcription and / or translation of certain mRNA encoded by genes associated with L-serine biosynthesis. A “gene associated with L-serine biosynthesis” refers to a gene encoding a gene product (e.g., an mRNA, protein, etc.) that is genetically, biochemically or functionally associated with production of L-serine in a cell or subject. A “gene associated with lipid biosynthesis” refers to a 12155096.1 gene encoding a gene product (e.g., an mRNA, protein, etc.) that is genetically, biochemically or functionally associated with production of lipids in a cell or subject. In some embodiments, a gene associated with lipid biosynthesis is serine palmitoyltransferase long chain base subunit 2 (SPTLC2). In some embodiments, the lipid biosynthesis is sphingolipid biosynthesis or deoxy- sphingolipid (deoxy-SL or d-SL) biosynthesis. In some embodiments, a gene associated with lipid biosynthesis encodes an mRNA encoding a subunit of an SPT protein, for example serine palmitoyltransferase long chain base subunit 2 (SPTLC2). In humans, SPTLC2 is encoded by the SPTLC2 gene, located on chromosome 14 (e.g., encoded by Ensembl ID NO: ENSG00000100596.6, Chromosome 14: 77,972,340-78,083,116 reverse strand). In some embodiments, SPTCL2 encodes a peptide that is represented by NCBI Reference Sequence NP_004854.1 or XP_011535686.1. In some embodiments, an SPTLC2 gene encodes an mRNA comprising the sequence set forth in NCBI Reference Sequence NM_004863.4 or XM_011537384.3. In some embodiments, an mRNA is encoded by an SPTLC2 gene comprising the sequence set forth below: NM_004863.4 AGCCGCCGCCGCTGCCACCGCCTACAGAGCCTGCCTTGCGCCTGGTGCTGCCAGGAAGATGCGGCCGGAGCCCGGAG GCTGCTGCTGCCGCCGCACGGTGCGGGCGAATGGCTGCGTGGCGAACGGGGAAGTACGGAACGGGTACGTGAGGAGC AGCGCTGCAGCCGCAGCCGCAGCCGCCGCCGGCCAGATCCATCATGTTACACAAAATGGAGGACTATATAAAAGACC GTTTAATGAAGCTTTTGAAGAAACACCAATGCTGGTTGCTGTGCTCACGTATGTGGGGTATGGCGTACTCACCCTCT TTGGATATCTTCGAGATTTCTTGAGGTATTGGAGAATTGAAAAGTGTCACCATGCAACAGAAAGAGAAGAACAAAAG GACTTTGTGTCATTGTATCAAGATTTTGAAAACTTTTATACAAGGAATCTGTACATGAGGATAAGAGACAACTGGAA TCGGCCAATCTGTAGTGTGCCTGGAGCCAGGGTGGACATCATGGAGAGACAGTCTCATGATTATAACTGGTCCTTCA AGTATACAGGGAATATAATAAAGGGTGTTATAAACATGGGTTCCTACAACTATCTTGGATTTGCACGGAATACTGGA TCATGTCAAGAAGCAGCCGCCAAAGTCCTTGAGGAGTATGGAGCTGGAGTGTGCAGTACTCGGCAGGAAATTGGAAA CCTGGACAAGCATGAAGAACTAGAGGAGCTTGTAGCAAGGTTCTTAGGAGTAGAAGCTGCTATGGCGTATGGCATGG GATTTGCAACGAATTCAATGAACATTCCTGCTCTTGTTGGCAAAGGTTGCCTGATTCTGAGTGATGAACTGAATCAT GCATCACTGGTTCTGGGAGCCAGACTGTCAGGAGCAACCATTAGAATCTTCAAACACAACAATATGCAAAGCCTAGA GAAGCTATTGAAAGATGCCATTGTTTATGGTCAGCCTCGGACACGAAGGCCCTGGAAGAAAATTCTCATCCTTGTGG AAGGAATATATAGCATGGAGGGATCTATTGTTCGTCTTCCTGAAGTGATTGCCCTCAAGAAGAAATACAAGGCATAC TTGTATCTGGATGAGGCTCACAGCATTGGCGCCCTGGGCCCCACAGGCCGGGGTGTGGTGGAGTACTTTGGCCTGGA TCCCGAGGATGTGGATGTTATGATGGGAACGTTCACAAAGAGTTTTGGTGCTTCTGGAGGATATATTGGAGGCAAGA AGGAGCTGATAGACTACCTGCGAACACATTCTCATAGTGCAGTGTATGCCACGTCATTGTCACCTCCTGTAGTGGAG CAGATCATCACCTCCATGAAGTGCATCATGGGGCAGGATGGCACCAGCCTTGGTAAAGAGTGTGTACAACAGTTAGC TGAAAACACCAGGTATTTCAGGAGACGCCTGAAAGAGATGGGCTTCATCATCTATGGAAATGAAGACTCTCCAGTAG TGCCTTTGATGCTCTACATGCCTGCCAAAATTGGCGCCTTTGGACGGGAGATGCTGAAGCGGAACATCGGTGTCGTT GTGGTTGGATTTCCTGCCACCCCAATTATTGAGTCCAGAGCCAGGTTTTGCCTGTCAGCAGCTCATACCAAAGAAAT ACTTGATACTGCTTTAAAGGAGATAGATGAAGTTGGGGACCTATTGCAGCTGAAGTATTCCCGTCATCGGTTGGTAC CTCTACTGGACAGGCCCTTTGACGAGACGACGTATGAAGAAACAGAAGACTGAGCCTTTTTGGTGCTCCCTCAGAGG AACTCTCCCTCACCCAGGACAGCCTGTGGCCTTTGTGAGCCAGTTCCAGGAACCACACTTCTGTGGCCATCTCACGT GAAAGACATTGCCTCAGCTACTGAAGGTGGCCACCTCCACTCTAAATGACATTTTGTAAATAGTAAAAAACTGCTTC TAATCCTTCCTTTGCTAAATCTCACCTTTAAAAACGAAGGTGACTCACTTTGCTTTTTCAGTCCATTAAAAAAACAT TTTATTTTGCAACCATTCTACTTGTGAAATCACGCTGACCCTAGCCTGTCTCTGGCTAACCACACAGGCCATTCCCC TCTCCCAGCACCTTGCAGACTTGGGCCCATCAAGAGCTACTGCTGGCCCTGGCTCCGCAGCCTGGATACTTACCTGG CCCTCCTCCCTAGGGAGCAAGTGCCTTCCACTTACTTCCCATCCAGGTCTCAGAGGTCTCAAGGCCAACCTTGGAAT CCTTATTTAACCATTCAAGTAATCAACGGAAGTTTTCACCCTTTAATCTTAAGTTTAGCCTTTTAAGAAAAACAGTA 12155096.1 AGCGATGACTGCTGAAAGGCTCATTGTGTAATCTCCCAAGGGTTTGGTCTTATTCCATTTTCTTCTGGTCACCAGAT GATTTCTTCCTTTACCATCAAATACTTCTTCATAATGGTCACAGTCTGAGGATGTGCGCAAATTCTGGTTCTTCCCA AGCTCTAACCGTAACACGTCCCACCCCCTTTTTAAAGCACTTACTGTTTTCAGAGCACCCATATCCCACCCTGGTGA GAAGGCCACTCTCACATCTGAGTGTTGGGTACAAAGCTGCTCCGTAGAGTGATGTGCACTCCTGGTGGGTGAGGGGC AGGGGCAGTGGCAGTGTGCAAAGAATTGATTACTCCTTGCAGAGCCTGTGGCTTGCATTTCCTACTGCTTTCTACGT TTGAAAATTATGACAGTCTCTGGCTAGGTCTGGGTCCAGATTAGGATTTAAACTGATAAAGGAAACTGTTGGTAAAT CCTCTGCTCAGAAAGCATTTATCATGTTCCTATTTAAGGATTAGGTTTATTAATTTAGGCCTCTTAGAAGCTAACCC ACTTAAATATTACTCTTCTGAATGCTAGTTCTCTTTTATTCTTGATGTCCTAAGTCAATTGAATCTGGCATCTGGGG CTAGGGTCTGCCTGTCTACATATTTTTTATTTTTTTCTGAGAAATTCTGAACACATAGATCTCTTTCCTAAACTGAC ATTTTCTATTTTGACTGTTTTCATACTATAACCAGGTAAAGGGACTTCTTTCAGAGAGCTTTATACTGCCTGACCAA AGAACAAATCTGAAAATCACCATTTTAAAGTTATTTTTTCAGTTGAACCAAAGTTTAAGTGAAGAGGACTTTTGGCA TATTATACCCAGGATCAGTTTGTCTTTTTGTATCCATCAAGTATTACAGGAGAAGGATTGGGAACAGAATGGAAAAA CAGTGTATGAAAGTCATGTTACAGGCCGAGTGCGGTGGCTCACACCTGTAATCCTAGCACTTTGGGAGGCTGAGGCA GGTGGCTCACTTGAGGTCAGGAATTCAAGACCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAGACAAA AAATTAGCTGGGCGTGGTGGCGGGCACCTATAATCCCACCTACTTGGTAGGCTGAGGCAGGAGAATCGCTTGAACCC AGGAGGCGGAGGTTGCAGTGAGACGAGATTGTGCCACTGCACTCTAGCCTGGGTGACAGAGCAAAACTGTGTCTCAA AAAAAAAAGTCATGTTACACATTTAAGTTTTTGAAATTGCTCCTTTTATCGGTAAAGATTCTCAATCCAAATTCTCC TGGGTGTGTTGTCATCAGCTGTGATATGTTTGTGCACATTACGTATAGCAGAGGATGTAAGCAATATTATTGTTTGT GAAGTTTTGTTTTTAATGTCTTGAGTATGAGTTATGTTTAGTCACTGTCAGCATCTGAGAACTTTAATAAGCCCTTG AGATATTCCAAAGTTTTATTTTACTTTTTTAAAGAACAGAAAAAGATGAATGAAAGAACCAAGGAGAGATGCAGAGA CTATATTTAGCATGTATAGGTTAAAGTAAGAAGGAGGTTGTGGTAACTAAATAGGAGTCCTATAAAATCAAATACAT TGTCAACCTTTTCTGCACATCTAGTTTCCTACCATAGAATCCCACTGGAATACCACATAGCTTTTGCACTGCAGTTA CTATTTACTAATGTAAACGTAGGGTTTGTAAAAGTCACAAACTTATAAGCAATGAACTTACCTGCTAGTCTTTTTAT TTTGGCTTGCATGAAGTCACTGCAAATTCAAATGTCAGTACCGGCATTTAAAATATATCTATATCACTTTGTTGGTA CAAAGTTATTTCAAGATAAGTGTAATTTTGTTACAAGTTTATTTTGAAGAGACAAATCTCCTGTGATCTATGCAGGA CCTCTGTACTTTCTAAAGAACAAAATGTTATGTAGACATTATACATGGTTGGTTGTCTCTTCTTGAAACTGTAATGT AAATCTAGGGTCCAGTCATATCCTAGGTATCATCATTTATCCAAGTACTTGGAGGAATACAAGTATATATAAATACA GTCATTGAGAATAAGTCGATTTGAGGCATACAAGAGTAGTTTCTTACACAGTTTAACACGGCCTGATTCAAGACTCT GATAGGATTCAAACAGATACCGGTTAACCATGACTACCAAAACTGATCATCTGAGTCGATTGATAGAGGTGTGACTA GTCCTTAGCACTTTTTCTCATTCCTCTTTTTATTCAGCATTGCTGTTACCTATTTCAGGTTTATAAGACCTCTTTCA GCAGATCACATCAGAAGCCAGGAAATGCATAGCTAGGAGATGTCAAAAGCCCATATGAGGAGTGGACCAAGCAGCAG TGGCGGTTTCTCCTCGCATCTTTTTTTTTTTAAGCTTTAACTTAGCAGGGGCATGGACTTTATAGCACTTTTTCAAC TTTTTGCTTTGCTTTGGATAAGAAATCCTTACCTTTAAAAAAAGCTTCTAGTCTCCATAACCCCCAAAGTACTGCTT ATTTGTTTGAAGAATCCAGCCATCGTAGTGCTTTAGTCACTATCGTAAACATTCATGATAGGGCAAGGATTTTAAAA CAGGATTCTTGCTTCTGTAGTCATCAAGGTGAACAGAAGCATCCTACACAACCACTAAGGGCTCTATGTTTGTGTCA TGCCTCTTCAAACACCAAGGAGTTGAACATGCTTCCAGTGATTTGTCTCCGTAATGCCTTCTTCCTTTATTTGGCCT TTCTTTCTTTCTGTACCTTCAAGTTCTTGATTTTTAAAATTCCAACTCTAGAGAAAACCAATATATGGTGGTGCTGG GCTTTGAAGATAGCATATCAGACGCCTTGGTTCTGTTTGTACACTTAGCCTTACATTTCAGGAGGAGGCTTTTCATT AGGGGCTTAAGCTAGCTCCTTTGGCTTTTAAAAAAAATTTTTTTTCAAATTTCTTCATTACCTAAGGGAGCCTGCAT CTAAATTTCTCAACTAGTTCAGCCTAGCTGAATTTTCTAGTGTGTTATACACTTTGCTTCCTTCTTATTGGTGAAAA CCAGGGGGATGAGTGGCTTCCATGGAGAGATTTCCTGATTTCTCAGGGAGGAAAAAAGTGATGACATTTACCACTAC TTTTATGTTTTTCCCCTTTTTCCAAATTGATAAGGATTTCTGGTTCCTAGTGATCCGGGATTGGGCAACAGTGCAGA ACTGCCAGTCATGCCGTAGGCCGTGAAGAAAGAATGTGAGTAACTGTTGTTTTGCAAGGATTTGTAGGGTTATGGGC AGTTGTTGTTTGAAGCATTGCTATGACCTAATTCCCAAGGTATCTTTCCTCTCTTGGTGTTCTAGGTAAGCCAATGA GCTTTAATCTCTACTTGCTATAACCGTGTGCTTAGAAAAAGAGGTGAGAGTAGTGGTTTTCCTTCAAACTGTCCACA TTCATGAAGATTATGAATTGTTAGGACAGCCAGGGCAAGATAGACCCTGTCTCTACAAAAATTTTTTTCTAAATTAA CCGGGCATGGTGGTGCCTGCCTGTAGTCCCACCTGTGTGGGAGAATCACTTGAGCCTGGGAGGTCAAGGCTGCAGTG AGCCATGATTGCACCCCTGCACTCCAGCCTGGGTGACAGAGTGAGACCCTGGCTCAATAAGAGGGGGAAAAAAAATT GTTAGGAGCTGGGTGCGGATGCAGCCTGCAATCCCAGCTACTTGAGAGGCTGAGGCCGGAGGATTGCTTAAACCCAA GAATTTGAGCGTAGCCTGGGCAACACAGCAAGACCCCATCTAAGAAAAAAATGTTTTTTAAATCAGCTTAGCCCAAA GGGGTTGTGAATGGGGAGGTATAAAAAGCAAAGATTATTTTTTGGCTACTAAGCCAAGAACTTACAGGGATTTTTTT TTTCAGTCCCAGAACCTACAGATACCCTGCTACTTGCTTCACGTGGATGCTCAGTGCCCAGCAGCCATCTTAATACA TTAAACCAGTTTAAAAAATACCTTCCATGTGGAGAAAAACATGTCTTTTTCTCGCCTCAACTTTATCCACATGAAAT ATGTGCCCATGGCTGGGCGCAGTGGCTCACCTGTAATCCCAACACTTTGGGAGGCTGAAGCAGGCAGATTGCTTGAG GCCAGGAGTTCGAGAACAGTCTGGCCAACATGGCGAAACCTCATCTCTACTAAAATTACAAAAATTAGCCGGGCATG GTGGCACATGCCTGTAATCCCAGCTACGTCAGGAGGCTGAGGCACAGGAATTGCTTGAACCCAAGAGGCAGAGGATG CAATGAGCCAAGATCACACCACTGCACTCCAGCCTTGGCGACAGAGGGAGACTCTGTCTCAAAAAAAAAAAAAAAAG GTGTGCCCAGGCCCCTAGCCATTGCCATGTGCCCAGCCAGAGAGCCAAATTAGAGGGCTGGCTTCCCTATCACACAG 12155096.1 AATAAATGCTAGTGCTAGCCAATGATCCCTTTGCTTTTAATGTATAGAAAATACTGTTGTTCCTTTTGTCATTTCCA GTGACATCTGTTTTCTAAGCAGCTCTTTTCTAGGGAGGAAACCAAAGGGGCTAGGTTAAGACCCTAATAGAAATGTT TTTTCTAATCTCTGGTGAGTCTGGAAGTGTCACATTCACAGTCCACCCTTGGGAGTGGCTTGGTGGAGCTGGGGACA AGGTTTTGTTTACTACATAGTGCACATGATAAATGGCCTTAAACTGTGATTCTTTCTGGTAGGATAAGTTATAATAA ACTGACCCTAAAGAATGCAATGGCTTTTAAACTGCAGTTACTGTGTTCTTAATGAAGCAATACCCAAAGCTCTGTTC TTTTGGAGCACTTGAGGGGAGCTTGAATGAAAGGTGCAGATAAGAGCAGTACCTTGATCTTATGCTTTCTGAGTGTC CTGCCTTGTTGCCATCTGCATGGATGAGTGAATGCTTCTATGCACGAGGAGACTCAAGCCAACTCAGAGTCTGCTTT TTCCAACGCTCTTCCCAGGTTTCTTTTGCAAAGCTTGGTCATTTGGCCCAGGTCTTCCTGGAAAGTGGAGTACATGT CACTGACTAGGGTGGCGTGGTGTCTTTACCCTTAACATTAAGTCTTGTTACCTCAGTGATGTGAAGCCAATGGTTGG AATTATAAAAAGCATCCTTGCTGGTTCTTCACAGGACACTGGAACCCACCCTGTCAATTCAGCTAGCATGTCCACAC AGTCTTGATGATCCCTCTCTGTAACAGGCAGCTAACATTAAGAGAAGGGGGAAAGAGAAGAAGAGAGCAATAGCTTA TGGGAGAGCTGAGATCTTACTTCGTTGACCCATATTTTTCCCCTGACCAAGTTACCTGTAAACTGGAATTTGCAAGG GGATGCTGTGATGATAACCCCTTTCTATTGCTGTAATGTTCATATAACCTGGGAAACTGAGAGAAGGGGATGTGTAA ATAAAAGCTTAAACATTTTAGTAATGTGTTAAAATGTCACTCTCTCTTACCCTGTTTCCCTTTTTTGCCAGATGATG ATTTTTTTATTTTTATTTTGTACTTTACTGGATGACTGTGAAGCGATGAGTATTGGGTTGGGGTAGGTGTGTTGATT TTGAGAGTGCATGTTAAGAACTGAAGGGGAACTACTTGAGATGACTTAAGAAGCATCCCATGCAAATATCTTGTTTT GCCCTAATAAAATATTCAGAAAGATA (SEQ ID NO: 110) The skilled artisan recognizes that when referring to a gene sequence encoding an mRNA, the sequence of the mRNA is identical to the recited gene sequence, except that each instance of “T” is replaced with “U”. In some embodiments, an SPTLC2 gene (or an mRNA encoded by an SPTLC2 gene) comprises one or more nucleotide substitutions, one or more nucleotide insertions, and / or one or more nucleotide deletions relative to a wild type SPTLC2 gene (or mRNA encoded by a wild type SPTLC2 gene), and may be referred to as a “mutant” SPTLC2 gene or an SPTLC2 variant. The number of nucleotide substitutions in a SPTLC2 variant may vary. In some embodiments, an SPTLC2 variant comprises between 1 and 20, 5 and 10, 2 and 15, 10 and 30, or 20 and 100 nucleotide substitutions, nucleotide insertions, and / or nucleotide deletions relative to a wild type SPTLC2 gene (or mRNA encoded by a wild type SPTLC2 gene). In some embodiments, the one or more nucleotide substitutions, one or more nucleotide insertions, and / or one or more nucleotide deletions results in an amino acid substitution in the protein encoded by the SPTLC2 variant. In some embodiments, the one or more nucleotide substitutions, one or more nucleotide insertions, and / or one or more nucleotide deletions results in a nonsense mutation (e.g., insertion of a premature stop codon) in an mRNA encoded by the SPTLC2 variant. In some embodiments, an SPTLC2 variant protein forms a part of a SPT protein complex that prefers alanine over serine for production of 3-keto-sphingamine. In some embodiments, the one or more nucleotide substitutions, one or more nucleotide insertions, and / or one or more nucleotide deletions results in a frameshift mutation of the SPTLC2 variant relative to a wild type SPTLC2 gene. In some embodiments, a mutation or mutations present in an SPTLC2 variant result in the production of one or more splice variants of 12155096.1 SPTLC2 mRNA. A “splice variant” may refer to a mRNA resulting from one or more mutations in a DNA sequence that occur at the boundary of an exon and an intron (splice site) of a gene. Splice site mutations generally disrupt RNA splicing and result in the loss of exons or the inclusion of introns and an altered protein-coding sequence (e.g., a “splice variant”). Aspects of the disclosure relate to isolated nucleic acids, for example RNA processing modulators (e.g., ASOs) that bind to one or more target regions of an mRNA encoded by a gene associated with L-serine biosynthesis. In some embodiments, the isolated nucleic acids bind to more or more splice variants of an SPTLC2 gene (e.g., a human SPTLC2 splice variant). In some embodiments, an isolated nucleic acid described by the disclosure binds to a region of an SPTLC2 splice variant (e.g., mRNA encoded by an SPTLC2 variant) selected from an untranslated region (UTR). In some embodiments, the UTR is a 5′ UTR. In some embodiments, the UTR is a 3′ UTR. In some embodiments, the UTR is an intron. In some embodiments, an isolated nucleic acid described by the disclosure binds to an intron-exon boundary of an SPTLC2 splice variant (e.g., mRNA encoded by an SPTLC2 variant). An intron-exon boundary refers to a contiguous nucleotide sequence that includes portions of an intron and exon that are adjacent to one another in the mRNA transcript. In some embodiments, an isolated nucleic acid (e.g., antisense oligonucleotide) binds to an mRNA expressed from a particular allele of SPTLC2 (e.g., binds to a target mRNA in an allele-specific manner). Isolated nucleic acids In some embodiments of the present disclosure, a nucleic acid is an isolated nucleic acid. In some cases, nucleic acids are alternatively referred to as oligonucleotides. In some embodiments, an isolated nucleic acid comprises DNA (e.g., deoxyribonucleotides). In some embodiments, an isolated nucleic acid comprises RNA (e.g., ribonucleotides). In some embodiments, an isolated nucleic acid comprises both DNA (e.g., deoxyribonucleotides) and RNA (e.g., ribonucleotides), such as an isolated nucleic acid comprising a gapmer structure that comprises a region of deoxyribonucleotides which are flanked by regions of ribonucleotides. An isolated nucleic acid may be single stranded or double stranded. In some embodiments, the isolated nucleic acid is an RNA oligonucleotide. In some embodiments, the isolated nucleic acid is a single stranded RNA oligonucleotide (which may also be referred to as a single stranded RNA polynucleotide). 12155096.1 As used herein, the term “isolated” means artificially produced. Artificial production of an isolated nucleic acid may be achieved, for example, through amplification in vitro through polymerase chain reaction (PCR), recombinant cloning, or chemical synthesis. Methods of synthesizing isolated nucleic acids, for example RNAs, are known in the art, for example as described by Soukchareun et al. Preparation and characterization of antisense oligonucleotide- peptide hybrids containing viral fusion peptides. Bioconjug Chem.1995 Jan-Feb;6(1):43-53. doi: 10.1021 / bc00031a004. PMID: 7711103. The length of an isolated nucleic acid may vary. In some embodiments, an isolated nucleic acid (e.g., a single stranded RNA) is 10, 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or up to 120 nucleotides in length. In some embodiments, an isolated nucleic acid ranges from about 1 to 100, 2 to 30, 5 to 20, 10 to 40, or 20 to 80 nucleotides in length. In some embodiments, an isolated nucleic acid is between 10 and 50 nucleotides in length. In some embodiments, an isolated nucleic acid comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length. In some embodiments, an isolated nucleic acid is more than 50 nucleotides in length (e.g., 60, 70, 80, 90, 100, etc., nucleotides in length). In some embodiments, an isolated nucleic acid is no greater than 200 nucleotides in length. In some embodiments, an isolated nucleic acid of the disclosure comprises an antisense oligonucleotide comprising the sequence set forth in any one of SEQ ID NOs: 1-109 (provided in Column A of Table 1). In some embodiments, an isolated nucleic acid of the disclosure comprises an antisense oligonucleotide comprising at least 15 nucleotides (e.g., at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 nucleotides) of the any one of the sequences set forth in SEQ ID NOs: 1-109 (provided in column A of Table 1). In some embodiments of the present invention, an isolated nucleic acid is modified (e.g., comprises one or more modifications, for example chemical modifications, such as those in Column C of Table 1). A modified nucleic acid may refer to an oligonucleotide that has been structurally altered in a non-natural manner (e.g., a manner that does not occur in nature). Nucleic acid modifications may be used to endow the nucleic acid with specific functional characteristics relative to unmodified nucleic acids. In some embodiments, modification of an isolated nucleic acid promotes binding of the isolated nucleic acid to a target molecule or increases stability of the isolated nucleic acid (e.g., makes the isolated nucleic acid resistant to enzymatic degradation). 12155096.1 In some embodiments, the one or more modifications is between 1 and 50 modifications, 2 and 20, 5 and 30, 10 and 40, or 15 and 50 modifications. In some embodiments, an isolated nucleic acid comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 modifications. In some embodiments, an isolated nucleic acid comprises more than 50 modifications (e.g., 60, 70, 80, 90, 100, etc., modifications). In some embodiments, an isolated nucleic acid comprises more than 50 modifications (e.g., up to 60, 70, 80, 90, or 100, etc., modifications). In some embodiments, an isolated nucleic acid comprises chemical modifications on each nucleotide and each sugar-phosphate backbone linkage. Such a modified isolated nucleic acid may be referred to as a “fully modified” isolated nucleic acid. In some embodiments, less than all of the nucleotides of an isolated nucleic acid are modified. A chemical modification may comprise a modification of a nucleobase or a nucleotide, and / or a modification of a sugar-phosphate backbone (e.g., modification of one or more sugar- phosphate backbone linkages). In some embodiments, an isolated nucleic acid of the disclosure comprises one or more chemical modification(s) listed in Column C of Table 1. In some embodiments, an isolated nucleic acid comprises one or more modifications to a 5’ carbon atom (e.g., a 5’-carbon atom of a sugar) and / or one or more modifications to a 5- carbon of a nucleobase. Examples of modifications include, but are not limited to, 5-(2- amino)propyl uridine, 5-bromo uridine, 5-propyne uridine, 5-propenyl uridine, 5- carboxymethylaminomethyl-2-thiouracil, and 5-carboxymethylaminomethyl uracil. In other embodiments, the nucleic acid modification is targeted to the 6-carbon atom of a nucleobase. In some embodiments, an isolated nucleic acid comprises one or more modifications to a 6-carbon atom (e.g., a 6-carbon atom of a nucleobase) for example a 6-(2-amino)propyl uridine. In some embodiments, an isolated nucleic acid comprises one or more modifications to an 8-carbon atom (e.g., an 8-carbon atom of a nucleobase). Examples of 8 modifications include, but are not limited to, 8-bromo guanosine, 8-chloro guanosine, and 8-fluoroguanosine. In some embodiments, an isolated nucleic acid comprises one or more modifications to a 2' carbon of the sugar group. Examples of modified sugar groups include, but are not limited to, D-ribose, 2'-O-alkyl (including 2'-O-methyl and 2'-O-ethyl), i.e., 2'-alkoxy, 2'-amino, 2'-S-alkyl, 2'-halo (including 2'-fluoro), 2'-2-O-methoxyethoxy, 2'-allyloxy (-OCH2CH=CH2), 2'- propargyl, 2'-propyl, ethynyl, ethenyl, propenyl, and cyano and the like. In some embodiments, a 12155096.1 modified sugar moiety comprises a hexose and incorporated into an oligonucleotide as described (Augustyns, K., et al., Nucl. Acids. Res.18:4711 (1992)). Other examples of 2’ modifications include, but are not limited to, substitutions of the bound OH group with H, OR, R, F, Cl, Br, I, SH, SR, NH, NHR, NR, COOR, or OR, wherein R is a substituted or unsubstituted aliphatic group. Other 2’ modifications are found in the art. The term “aliphatic,” as used herein, includes both saturated and unsaturated, straight chain (i.e., unbranched), branched, acyclic, cyclic, or polycyclic aliphatic hydrocarbons, which are optionally substituted with one or more functional groups. As will be appreciated by one of ordinary skill in the art, “aliphatic” is intended herein to include, but is not limited to, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, and cycloalkynyl moieties. In some embodiments, an isolated nucleic acid modification a sugar-phosphate backbone modification. One example of a phosphate group modifications is substitution of an oxygen atom with a sulfur atom. In other embodiments, the backbone of the nucleic acid is modified. Examples of backbone modifications include, but are not limited to, phosphorothioate, borano- phosphate, alkyl phosphonate nucleic acid, peptide nucleic acid, and morpholino. Morpholino backbones are described, for example by Corey and Abrams Genome Biol.2001; 2(5): reviews1015.1–reviews1015.3. Other examples of modified bases include N4,N4-ethanocytosine, 7-deazaxanthosine, 7- deazaguanosine, 8-oxo-N6-methyladenine, 4-acetylcytosine, dihydrouracil, inosine, N6- isopentenyl-adenine, 1-methyladenine, 1-methylpseudouracil, 1-methylguanine, 1- methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5- methylcytosine, N6 -methyladenine, 7-methylguanine, 2-methylthio-N6-isopentenyladenine, pseudouracil,5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 2-thiocytosine, and 2,6- diaminopurine. Other examples of nucleic acid modifications are described for example by Eckstein, Antisense Nucleic Acid Drug Dev.2000 Apr.10(2):117-21, Rusckowski et al. Antisense Nucleic Acid Drug Dev.2000 Oct.10(5):333-45, Stein, Antisense Nucleic Acid Drug Dev.2001 Oct.11(5): 317-25, Vorobjev et al. Antisense Nucleic Acid Drug Dev.2001 Apr. 11(2):77-85, Duffy. BMC Bio.2020 Sep.2(8):112, and US Patent No. US5684143. Additional modifications of isolated nucleic acids (e.g., ASOs) are described by Duffy et al. BMC Biology volume 18, Article number: 112 (2020), the entire contents of which are incorporated herein by reference. 12155096.1 In some embodiments, an isolated nucleic acid of the disclosure comprises a nucleic acid sequence from Column A of Table 1 and one or more chemical modifications (or combinations of chemical modifications) from Column C of Table 1, optionally where Columns A and C are from the same row of Table 1. RNA processing modulators Aspects of the disclosure relate to compositions (e.g., isolated nucleic acids, agents, etc.) that modulate mRNAs encoded by genes associated with L-serine biosynthesis or lipid (e.g., sphingolipid) biosynthesis. In some embodiments, the gene associated with lipid biosynthesis is SPTLC2 (e.g., a human SPTLC2 gene). In some embodiments, a composition comprises an RNA processing modulator. As used herein, an “RNA processing modulator” or “RPM” refers to an agent that binds to, and up-regulates, down-regulates, or otherwise change function or activity, of a target mRNA (e.g., an mRNA encoded by a gene associated with L-serine biosynthesis, such as SPTLC2, or a gene product, such as a protein encoded by the mRNA) by affecting a level, transcription, splicing, and / or translation of the mRNA. In some embodiments, an RNA processing modulator may be an isolated nucleic acid or ASO as described herein. In some embodiments, an RNA processing modulator is an isolated nucleic acid that affects splicing, transcription or translation of the target mRNA (e.g., an mRNA encoded by a SPTLC2 gene). In some embodiments, an RNA processing modulator is an antisense oligonucleotide that affects transcription, levels, splicing, and / or translation of a target mRNA (e.g., an mRNA encoded by a SPTLC2 gene). In some embodiments, an mRNA (e.g., a target mRNA, such as an mRNA encoded by a SPTLC2 gene) is a pre-mRNA (e.g., an RNA that has been transcribed from a gene, such as a SPTLC2 gene, but has not been processed to remove introns, for example by splicing). In some embodiments, an mRNA is a mature mRNA that has been processed (e.g., an mRNA transcribed from a SPTLC2 gene and that has undergone processing). In some embodiments, an RNA processing modulator upregulates transcription, levels, splicing, and / or translation of a target mRNA. Upregulation of transcription or translation may comprise binding to a regulatory region (e.g., an untranslated region, such as a 5' UTR or 3' UTR) of a target mRNA and reducing non-productive splicing or translation initiation from alternative start codons present in the target mRNA, for example through steric blocking of non- productive splice site(s) or alternative start codons (such as “upstream alternative start codons” located in the 5' UTR of the target mRNA), or causing a mRNA frameshift (e.g., a splice 12155096.1 variant) resulting in translation of a protein variant from the target mRNA that lacks one or more inhibitory domains. The amount of upregulation of transcription or translation mediated by an RNA processing modulator may vary. In some embodiments, an RNA processing modulator increases transcription or translation of a target mRNA transcript (e.g., increases relative to a cell or subject prior to the administration of the RPM, or increases relative to a control cell or subject) between 1-fold and 100-fold, 2-fold and 10-fold, 5-fold and 20-fold, 10-fold and 30-fold, 20- fold and 50-fold, or 25-fold and 100-fold, or any value therebetween. In some embodiments, an RNA processing modulator increases transcription or translation of a target mRNA transcript more than 100-fold, for example at least 200-fold, 400-fold, 500-fold, or 1000-fold. In some embodiments, an RNA processing modulator increases transcription, levels, splicing, and / or translation of a target mRNA transcript no more than 1000-fold. In some embodiments, upregulation of a level, transcription, splicing, and / or translation of a target mRNA is useful to increase expression of a desired (e.g., wild-type) allele encoding the target mRNA. In some embodiments, a desired allele encodes an SPTLC2 subunit that, when included in an SPT complex, the SPT complex prefers serine over alanine for production of 3-keto-sphingamine. In some embodiments, an RNA processing modulator downregulates transcription or translation of a target mRNA. Downregulation of transcription or translation may comprise binding to a regulatory region (e.g., an untranslated region, such as a 5' UTR or 3' UTR) of a target mRNA and blocking transcription the target mRNA, for example through steric blocking of a transcription initiation site, binding to an mRNA and subsequently initiating RNAse H- mediated degradation (e.g., in the context of a ‘gapmer’ RNA processing modulator), or causing an mRNA frameshift (e.g., a splice variant) resulting in translation of a protein variant from the target mRNA that is inactive, or has reduced function or activity (e.g., enzymatic activity, the ability to interact with other proteins to form protein complexes, etc.). In some embodiments, the resulting protein variant is a dominant negative protein variant. In some embodiments, downregulation of a level, transcription, splicing, and / or translation of a target mRNA is useful to increase expression of an undesirable (e.g., mutant, or disease-associated) allele encoding a target mRNA. In some embodiments, an undesirable allele of SPTLC2 encodes an SPTLC2 subunit that, when included in an SPT complex, the SPT complex prefers alanine over serine for production of 3-keto-sphingamine. 12155096.1 The amount of downregulation of transcription or translation mediated by an RNA processing modulator may vary. In some embodiments, an RNA processing modulator decreases transcription or translation of a target mRNA transcript between 1-fold and 100-fold, 2-fold and 10-fold, 5-fold and 20-fold, 10-fold and 30-fold, 20-fold and 50-fold, or 25-fold and 100-fold, or any value therebetween. In some embodiments, an RNA processing modulator increases transcription or translation of a target mRNA transcript more than 100-fold, for example at least 200-fold, 400-fold, 500-fold, or 1000-fold. In some embodiments, an RNA processing modulator decreases transcription, levels, splicing, and / or translation of a target mRNA transcript more than 100-fold, for example at least 200-fold, 400-fold, 500-fold, or 1000-fold. In some embodiments, an RNA processing modulator decreases transcription, levels, splicing, and / or translation of a target mRNA transcript no more than 1000-fold. An RNA processing modulator may alter the number and / or character of splice variants of a target mRNA. In some embodiments, an RNA processing modulator increases (relative to natural transcription or translation of a target mRNA) the number of different splice variants of an mRNA, or the ratio between different splice variants of an mRNA. In some embodiments, an RNA processing modulator decreases (relative to natural transcription or translation of a target mRNA) the number of different splice variants of an mRNA, or the ratio between different splice variants of an mRNA. In some embodiments, contacting a target mRNA with an RNA processing modulator results in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more splice variants of the target mRNA being transcribed and / or translated. In some embodiments, contacting a target mRNA with an mRNA processing modulator results in a single splice variant of the target mRNA being transcribed and / or translated. The binding location of an RNA processing modulator may vary. In some embodiments, an RNA processing modulator affects splicing of the target mRNA. For example, an RNA processing modulator may bind to the target mRNA at a splice junction (e.g., a location spanning an intron-exon boundary) and mediate skipping of one or more exons in the mRNA transcript. In some embodiments, skipping of one or more exons in the target mRNA results in production of a truncated protein variant of the protein encoded by the target mRNA. In another example, an RNA processing modulator may bind to the target mRNA at a splice junction and mediate alternative splicing in which an intron is translated, and a protein variant of the target gene is produced. In some embodiments, an RNA processing modulator binds a target mRNA at a location comprising a coding sequence (e.g., a protein coding sequence or an exon). 12155096.1 In some embodiments, an RNA processing modulator comprises an agent selected from the group consisting of nucleic acid, peptide (including polypeptide), and small molecule. Examples of small molecule RNA processing inhibitors include but are not limited to translational readthrough-inducing drugs (TRIDs), such as certain aminoglycosides, non- aminoglycoside antibiotics (e.g., negamycin), ataluren (PTC124), and amlexanox. Examples of peptides include but are not limited to activator proteins (e.g., transcription factors), suppressor proteins (e.g., inducible cAMP early repressor (ICER), bZIP repressor, SP1 repressor, certain histone deacetylases, etc.), antibodies, etc. Examples of nucleic acids include but are not limited to suppressor tRNAs, dsRNA, siRNA, micro-RNA (miRNA), artificial miRNA (ami-RNA), aptamers, and antisense oligonucleotides. In some embodiments, an RNA processing modulator comprises an antisense oligonucleotide (ASO). As used herein, the term, “antisense nucleic acid,” or “ASO” refers to a single stranded nucleic acid that has sequence complementarity to a target sequence and is specifically hybridizable, e.g., under stringent conditions, with a nucleic acid having the target sequence. An antisense nucleic acid is specifically hybridizable when binding of the antisense nucleic acid to the target nucleic acid is sufficient to produce complementary base pairing between the antisense nucleic acid and the target nucleic acid, and there is a sufficient degree of complementarity to reduce or avoid non-specific binding of the antisense nucleic acid to non-target nucleic acid under conditions in which specific binding is desired, e.g., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed. In some embodiments, an ASO is chemically synthesized. An ASO may be a DNA polynucleotide, an RNA polynucleotide, or a DNA / RNA polynucleotide (e.g., an ASO comprising a gapmer structure that comprises a region of deoxyribonucleotides flanked by regions comprising ribonucleotides). Complementary refers to the capacity for precise pairing between two nucleotides. For example, if a nucleotide at a certain position of an antisense nucleic acid is capable of hydrogen bonding with a nucleotide at the corresponding position of a target nucleic acid (e.g., target RNA), then the antisense nucleic acid and target nucleic acid are considered to be complementary to each other at that position. The antisense nucleic acid and target nucleic acid are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides that can hydrogen bond with each other through their bases. Thus, “complementary” is a term that is used to indicate a sufficient degree of 12155096.1 complementarity or precise pairing such that stable and specific binding occurs between the antisense nucleic acid and target nucleic acid. However, it should be appreciated that 100% complementarity is not required. For example, in some embodiments, an antisense nucleic acid (e.g., an oligonucleotide) may be at least 80% complementary to (e.g., at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% complementary to) the consecutive nucleotides of a target nucleic acid (e.g., a target nucleic acid comprising an mRNA sequence encoded by SEQ ID NO: 110). Sequence identity, including determination of sequence complementarity for nucleic acid sequences, may be determined by sequence comparison and alignment algorithms known in the art. To determine the percent identity of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the first sequence or second sequence for optimal alignment). The nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same residue as the corresponding position in the second sequence, then the molecules are identical at that position. In some embodiments, the percent identity between the two sequences is a function of the number of identical positions shared by the sequences (e.g., % homology=# of identical positions / total # of positions×100), optionally penalizing the score for the number of gaps introduced and / or length of gaps introduced. In some embodiments, an antisense oligonucleotide has a length in a range of 5 to 40 nucleotides, 5 to 30 nucleotides, 10 to 30 nucleotides, 10 to 25 nucleotides, or 15 to 25 nucleotides. In some embodiments of the disclosure, an antisense oligonucleotide comprises a length of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides. In some embodiments, an antisense nucleic acid comprises a region of complementarity that is perfectly complementary to a portion of a target nucleic acid (e.g., 100% of the nucleotides of the ASO hybridize to the nucleotides of the target RNA, such as a target mRNA (e.g., an mRNA sequence encoded by SEQ ID NO: 110)). However, it should be appreciated that in some embodiments, an antisense nucleic acid comprises less than 100% sequence complementarity with a target nucleic acid (e.g., 50%, 60%, 70%, 80%, 90%, 95%, or 99% of the nucleotides of the ASO hybridize to the nucleotides of the target RNA, such as a target mRNA (e.g., an mRNA sequence encoded by SEQ ID NO: 110)). In addition, to minimize the likelihood of off-target effects, an antisense nucleic acid may be designed to ensure that it does 12155096.1 not have a sequence (e.g., of 5 or more consecutive nucleotides) that is complementary with an off-target nucleic acid (e.g., an mRNA that is not transcribed from an SPTLC2 gene). In some embodiments, an antisense oligonucleotide comprises a region of complementarity with an mRNA encoded by (e.g., transcribed from) a SPTLC2 gene. In some embodiments, an antisense oligonucleotide comprises a region of complementarity with a pre- mRNA sequence encoded by a human SPTLC2 gene, for example (e.g., encoded by Ensembl ID NO: ENSG00000100596.6, Chromosome 14: 77,972,340-78,083,116 reverse strand). In some embodiments, the region of complementarity of the antisense nucleic acid hybridizes with at least 6, e.g., at least 7, at least 8, at least 9, at least 10, at least 15 or more consecutive nucleotides of a target nucleic acid (e.g., a pre-mRNA encoded by Ensembl ID NO: ENSG00000100596.6, Chromosome 14: 77,972,340-78,083,116 reverse strand). In some embodiments, the antisense oligonucleotide comprises a region of complementarity with at least 6, e.g., at least 7, at least 8, at least 9, at least 10, at least 15 or more consecutive nucleotides of an intron encoded by Ensembl ID NO: ENSG00000100596.6, Chromosome 14: 77,972,340- 78,083,116 reverse strand. The skilled artisan recognizes that the forward strand of such a pre- mRNA transcript or mRNA transcript may also be targeted. In some embodiments, an antisense oligonucleotide comprises a region of complementarity with an mRNA encoded by (e.g., transcribed from) an SPTLC2 gene. In some embodiments, an antisense nucleic acid oligonucleotide comprises a region of complementarity with an mRNA encoded by the sequence as set forth in SEQ ID NO: 110. In some embodiments, the region of complementarity of the antisense nucleic acid hybridizes with at least 6, e.g., at least 7, at least 8, at least 9, at least 10, at least 15 or more consecutive nucleotides of a target nucleic acid (e.g., an mRNA encoded by the sequence set forth in SEQ ID NO: 110). In some embodiments, an antisense oligonucleotide comprises a region of complementarity with a 5' UTR, 3' UTR, an exonic sequence, a splice donor sequence, a splice acceptor sequence or a lariat branch point encoded by a human SPTLC2 gene. In some embodiments, an oligonucleotide binds to an mRNA expressed from a particular allele of SPTLC2 (e.g., binds to a target mRNA in an allele-specific manner). In some embodiments, an antisense oligonucleotide comprises a region of complementarity that is complementary with 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 continuous nucleotides of SEQ ID NO: 110. In some embodiments, an antisense oligonucleotide comprising 12155096.1 a region of complementarity with an mRNA transcript encoded by SEQ ID NO: 110 comprises at least 60% sequence identity (e.g., 60-70%, 70-80%, 80-90%, 90-95%, or more than 95% sequence identity) to a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-109, as recited in Column A of Table 1. In some embodiments, an antisense oligonucleotide comprises a sequence of 10 or more contiguous nucleotides (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, or more contiguous nucleotides) of any one of the sequences set forth in SEQ ID NOs: 1-109, as recited in Column A of Table 1. In some embodiments, an antisense oligonucleotide comprises the nucleic acid sequence set forth in any one of SEQ ID NOs: 1-109, as recited in Column A of Table 1. In some embodiments, an antisense oligonucleotide comprises a nucleotide sequence having one or more mismatches (e.g., one or more bases that is not complementary to the nucleotide at a given position of the target mRNA) relative to an mRNA transcript encoded by the sequence set forth in SEQ ID NO: 110. In some embodiments, an antisense oligonucleotide comprises a sequence having 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches relative to an mRNA transcript encoded by the sequence set forth in SEQ ID NO: 110. In some embodiments, an antisense oligonucleotide comprising one or more mismatches relative to an mRNA transcript encoded by SEQ ID NO: 110 comprises at least 60% sequence identity (e.g., 60-70%, 70-80%, 80-90%, 90-95%, or more than 95% sequence identity) to a sequence of 10 or more contiguous nucleotides of any one of the sequences set forth in SEQ ID NOs: 1-109, as recited in Column A of Table 1. In some embodiments, an antisense oligonucleotide comprising at least 60% sequence identity to a sequence of 10 or more contiguous nucleotides (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, or more contiguous nucleotides) of any one of the sequences set forth in SEQ ID NOs: 1-109 differs at one or more nucleotide positions (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotide positions comprising a substitution, an insertion, or a deletion) relative to the sequence of 10 or more contiguous nucleotides of any one of the sequences set forth in SEQ ID NOs: 1-109, as recited in Column A of Table 1. In some embodiments, an antisense oligonucleotide comprising one or more mismatches relative to an mRNA transcript encoded by SEQ ID NO: 110 comprises at least 60% sequence identity (e.g., 60-70%, 70-80%, 80-90%, 90- 95%, or more than 95% sequence identity) to a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-109. In some embodiments, an antisense oligonucleotide comprising at least 60% sequence identity to a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-109 differs at one or more nucleotide positions (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotide 12155096.1 positions comprising a substitution, an insertion, or a deletion) relative to the nucleic acid sequence set forth in any one of SEQ ID NOs: 1-109. In some embodiments, RNA processing modulators (e.g., antisense oligonucleotides) are provided in a homogeneous preparation, e.g., in which at least 85%, at least 90%, at least 95%, or at least 99% of the RNA processing modulators (e.g., antisense oligonucleotides) are identical. For example, in some embodiments, homogeneous preparations of antisense oligonucleotides are provided in which at least 85%, at least 90%, at least 95%, or at least 99% of the oligonucleotides in the preparation are 10 to 25 nucleotides in length and comprise a region of complementarity that is complementary with at least 6 contiguous nucleotides of an mRNA transcript encoded by an SPTLC2 gene (e.g., an SPTLC2 gene comprising the nucleic acid sequence set forth in SEQ ID NO: 110). In some embodiments, RNA processing modulators (e.g., antisense oligonucleotides) are provided in a heterogeneous preparation, e.g., comprising at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different RNA processing modulators (e.g., antisense oligonucleotides each targeting a different sequence of an SPTLC2 mRNA transcript). RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure may be modified to achieve one or more desired properties, such as, for example, improved cellular uptake, improved stability, reduced immunogenicity, improved potency, improved target hybridization, susceptibility to RNAse cleavage, etc. In some embodiments, an antisense nucleic acid is modified such that when present in a cell that contains an SPTLC2 gene, it is capable of hybridizing with RNA transcribed from the SPTLC2 gene without inducing cleavage of the RNA by an RNase. In some embodiments, an antisense nucleic acid is modified such that when present in a cell that contains an SPTLC2 gene, it is capable of hybridizing with RNA transcribed from the SPTLC2 gene and inducing cleavage of the RNA by an RNase. RNA processing modulators (e.g., antisense oligonucleotides, e.g. a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-109, as recited in column A of Table 1) can be modified at a base moiety, sugar moiety and / or phosphate backbone. Accordingly, RNA processing modulators (e.g., antisense oligonucleotides) may have one or more modified nucleotides (e.g., a nucleotide analog) and / or one or more backbone modifications (e.g., a modified internucleotide linkage). RNA processing modulators (e.g., antisense oligonucleotides) may have a combination of modified and unmodified nucleotides. RNA processing modulators (e.g., antisense oligonucleotides) may also have a combination of modified and unmodified internucleotide linkages. RNA processing modulators (e.g., antisense 12155096.1 oligonucleotides) may comprise one or more chemical modifications (or combinations of chemical modifications) from Column C of Table 1. In some embodiments, an RNA processing modulator comprises a nucleic acid sequence from Column A of Table 1 and one or more chemical modifications (or combinations of chemical modifications) from Column C of Table 1, where Columns A and C are from the same row of Table 1. In some embodiments, the one or more modifications is between 1 and 50 modifications, 2 and 20, 5 and 30, 10 and 40, or 15 and 50 modifications. In some embodiments, an RNA processing modulator (e.g., antisense oligonucleotide) comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 modifications. In some embodiments, an RNA processing modulator (e.g., antisense oligonucleotide) comprises more than 50 modifications (e.g., 60, 70, 80, 90, 100, etc., modifications). In some embodiments, an RNA processing modulator (e.g., antisense oligonucleotide) comprises chemical modifications on each nucleotide and each sugar-phosphate backbone linkage. Such a modified RNA processing modulator (e.g., antisense oligonucleotide) may be referred to as a “fully modified” RNA processing modulator (e.g., antisense oligonucleotide). In some embodiments, a fully modified antisense oligonucleotide comprises the nucleic acid sequence of any one of SEQ ID NOs: 1- 109. In some embodiments, not all of the nucleotides of an antisense oligonucleotide are modified. RNA processing modulators (e.g., antisense oligonucleotides) may include ribonucleotides, deoxyribonucleotides, and combinations thereof (e.g., RNA processing modulators comprising a gapmer structure). Examples of modified nucleotides which can be used in antisense nucleic acids include, for example, 5-fluorouracil, 5-bromouracil, 5- chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5- (carboxyhydroxylmethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5- carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6- isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5- methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5′- methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5- oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 12155096.1 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, and 2,6-diaminopurine. In some embodiments, a modified nucleotide is a 2'-modified nucleotide. For example, the 2'-modified nucleotide may be a 2'-deoxy, 2'-fluoro, 2'-O-methyl, 2'-O-methoxyethyl, 2'- amino and 2'-aminoalkoxy modified nucleotides. In some embodiments, the 2'-modified nucleotide comprises a 2'-O-4'-C methylene bridge, such as a locked nucleic acid (LNA) nucleotide. In some embodiments of a 2' modified nucleotide the 2′-hydroxyl group is linked to the 3′ or 4′ carbon atom of the sugar ring thereby forming a bicyclic sugar moiety. In such embodiments, the linkage may be a methylene (—CH2—)n group bridging the 2′ oxygen atom and the 3′ or 4′ carbon atom wherein n is 1 or 2. In some embodiments, a linkage comprises a cEt modification (e.g., a -CH3 replacing a hydrogen in the methylene group of the bridge). RNA processing modulators (e.g., antisense oligonucleotides) may include combinations of LNA nucleotides and unmodified nucleotides. Antisense nucleic acids may include combinations LNA and RNA nucleotides. Antisense nucleic acids may include combinations LNA and DNA nucleotides. A further preferred oligonucleotide modification includes Locked Nucleic Acids (LNAs) in which the 2′-hydroxyl group is linked to the 3′ or 4′ carbon atom of the sugar ring thereby forming a bicyclic sugar moiety. RNA processing modulators (e.g., antisense oligonucleotides) acids may also include nucleobase-modified nucleotides, e.g., nucleotides containing a non-naturally occurring nucleobase instead of a naturally occurring nucleobase. Bases may be modified to block the activity of adenosine deaminase, for example. Examples of modified nucleobases include, but are not limited to, uridine and / or cytidine modified at the 5-position, e.g., 5-(2-amino)propyl uridine, 5-bromo uridine; adenosine and / or guanosines modified at the 8 position, e.g., 8-bromo guanosine; deaza nucleotides, e.g., 7-deaza-adenosine; O- and N-alkylated nucleotides, e.g., N6- methyl adenosine are suitable. It should be noted that the above modifications may be combined. Within antisense nucleic acids (e.g., antisense oligonucleotides) of the disclosure, as few as one and as many as all nucleotides can be modified. In some embodiments, a modified RNA processing modulator (e.g., antisense oligonucleotide) will contain as few modified nucleotides as are necessary to achieve a desired level of in vivo stability and / or bioaccessibility or other desired property. Certain antisense oligonucleotides may include non-ionic DNA analogs, such as alkyl- and aryl-phosphonates (in which the charged non-bridging oxygen is replaced by an alkyl or aryl 12155096.1 group), phosphodiester and alkylphosphotriesters, in which the charged oxygen moiety is alkylated. Nucleic acids which contain a diol, such as tetraethyleneglycol or hexaethyleneglycol, at either or both termini have also been shown to be substantially resistant to nuclease degradation and may be used herein. In some embodiments, antisense nucleic acids may include at least one lipophilic substituted nucleotide analog and / or a pyrimidine-purine dinucleotide. In some embodiments, RNA processing modulators (e.g., antisense oligonucleotides) may have one or two accessible 5′ ends. It is possible to create modified oligonucleotides having two such 5′ ends, for instance, by attaching two oligonucleotides through a 3′-3′ linkage to generate an oligonucleotide having one or two accessible 5′ ends. The 3′-3′-linkage may be a phosphodiester, phosphorothioate, or any other modified internucleoside bridge. Additionally, 3′-3′-linked oligonucleotides where the linkage between the 3′ terminal nucleosides is not a phosphodiester, phosphorothioate, or other modified bridge, can be prepared using an additional spacer, such as tri- or tetra-ethylenglycol phosphate moiety. In some embodiments, a triazole ring is used. A phosphodiester internucleotide linkage of an RNA processing modulator (e.g., antisense oligonucleotide) can be replaced with a modified linkage. The modified linkage may be selected from, for example, phosphorothioate, phosphorodithioate, NR1R2-phosphoramidate, borano-phosphate, α-hydroxybenzyl phosphonate, phosphate-(C1-C21)—O-alkyl ester, phosphate-[(C6-C12)aryl-(C1-C21)—O-alkyl]ester, (C1-C8)alkylphosphonate and / or (C6- C12)arylphosphonate bridges, and (C7-C12)-α-hydroxymethyl-aryl. A phosphate backbone of the RNA processing modulators (e.g., antisense oligonucleotides) can be modified to generate peptide nucleic acid molecules. As used herein, the terms “peptide nucleic acids” or “PNAs” refer to nucleic acid mimics, e.g., DNA mimics, in which the deoxyribose phosphate backbone is replaced by a pseudopeptide backbone and only the four natural nucleobases are retained. The neutral backbone of PNAs has been shown to allow for specific hybridization to DNA and RNA under conditions of low ionic strength. The synthesis of PNA oligomers can be performed using standard solid phase peptide synthesis protocols, for example. RNA processing modulators (e.g., antisense oligonucleotides) also be formulated as morpholino oligonucleotides. In such embodiments, the riboside moiety of each subunit of an 12155096.1 oligonucleotide of the oligonucleotide reagent is converted to a morpholine moiety. Morpholinos may also be modified, e.g., as peptide conjugated morpholino, etc. Aspects of the disclosure relate to RNA processing modulators (e.g., antisense oligonucleotides) comprising a “gapmer” structure. A “gapmer” refers to an antisense oligonucleotide comprising the following formula Xn1-(Y)n2-(X)n3, where (X) is a ribonucleotide (e.g., an RNA base) and (Y) is a deoxyribonucleotide (e.g., DNA base), and where each of n1, n2, and n3 are an integer ranging from 1 to 50 (inclusive of all integers therebetween). In some embodiments, antisense oligonucleotides having a gapmer structure bind (e.g., hybridize) to a target mRNA (e.g., an mRNA encoded by an SPTLC2 gene) and induce ribonuclease H1 (RNAseH1)-mediated degradation of the target mRNA. Gapmer antisense oligonucleotides are known in the art, for example as described by Kasuya et al. Sci Rep.2016; 6: 30377. The number of DNA bases in a gapmer may vary. In some embodiments, a gapmer comprises between 1 and 10 DNA bases (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 DNA bases). In some embodiments, a gapmer comprises between 2 and 6 DNA bases (e.g., 2, 3, 4, 5, or 6 DNA bases). The DNA bases of a gapmer antisense oligonucleotide may be positioned toward to 5' end of the ASO (e.g., within 1, 2, 3, 4, 5, etc. nucleotides of the 5' terminal nucleotide of the ASO), toward the 3' end of the ASO (e.g., within 1, 2, 3, 4, 5, etc. nucleotides of the 3' terminal nucleotide of the ASO), or in the middle of the ASO (e.g., having an equal number of RNA bases flanking the DNA bases). In other embodiments, an RNA processing modulator (e.g., antisense oligonucleotide) can be linked to functional groups, such as peptides (e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane or the blood-brain barrier. For example, oligonucleotide reagents of the disclosure also may be modified with chemical moieties (e.g., cholesterol) that improve the in vivo pharmacological properties of the RNA processing modulator. In some embodiments, a functional group comprises a peptide, small molecule, sugar, lipid, nucleic acid, or combination of any of the foregoing. Table 1: Representative RPMs targeting SPTLC2 12155096.1 12155096.1 12155096.1 12155096.1 12155096.1 12155096.1 12155096.1 In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprises at least 18 continuous nucleotides (e.g., comprising or consisting of 18 nucleotides, 19 nucleotides, or 20 nucleotides) of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-109 (see Column A of Table 1). In some embodiments, an RNA processing modulator comprises at least 18 continuous nucleotides (e.g., comprising or consisting of 18 nucleotides, 19 nucleotides, or 20 nucleotides) of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-109 (see Column A of Table 1) and comprises one or more additional nucleotides either at the 5' end, at the 3' end, or both the 5' end and the 3' end which are complementary to a target sequence in a SPTLC2 mRNA that hybridizes to the 20 continuous nucleotides of the nucleic acid sequence selected from Column A of Table 1. In some embodiments, an RNA processing modulator comprising at least 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-109 (e.g., an ASO comprising or consisting of 18 nucleotides, 19 nucleotides, or 20 continuous nucleotides of any one of the nucleic acid sequences shown in Column A of Table 1) comprises one or more chemical modifications as set forth in any one of the rows in Column C of Table 1. In some embodiments, an RNA processing modulator comprising at least 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-109 (e.g., an ASO comprising or consisting of 18 nucleotides, 19 nucleotides, or 20 continuous nucleotides of any one of the nucleic acid sequences shown in Column A of Table 1) comprises a pattern of chemical modifications as set forth in any one of the rows in Column C of Table 1. In some embodiments, an RNA processing modulator comprising the at least 18 continuous nucleotides of any one of the nucleic acid 12155096.1 sequences set forth in SEQ ID NOs: 1-109 reduces the levels of a SPTLC2 mRNA (e.g., a mature mRNA or a pre-mRNA) and / or a SPTLC2 protein by 50% or more (e.g., 50-60%, 60- 70%, 70-80%, 80-90%, 90-95%, or 95-100%) in a cell or one or more tissues, such as a cell or one or more tissues (e.g., cerebrospinal fluid, plasma, and / or a brain tissue) in a subject when the RNA processing modulator or a composition thereof is administered to the subject in an effective amount. In some embodiments, an RNA processing modulator comprising the at least 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1- 109 reduces the levels of one or more lipids (e.g., toxic lipids, such as toxic deoxysphingolipids) by 50% or more (e.g., 50-60%, 60-70%, 70-80%, 80-90%, 90-95%, or 95-100%) in a cell or one or more tissues, such as a cell or one or more tissues (e.g., cerebrospinal fluid, plasma, and / or a brain tissue) in a subject when the RNA processing modulator or a composition thereof is administered to the subject in an effective amount. In some embodiments, an RNA processing modulator comprises or consists of 18 continuous nucleotides, comprises or consists of 19 continuous nucleotides, or comprises or consists of 20 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-109 (see Column A of Table 1), wherein one or more of positions comprising a “T” residue is substituted for a “U” residue. In some embodiments, an RNA processing modulator comprises or consists of 18 continuous nucleotides, comprises or consists of 19 continuous nucleotides, or comprises or consists of 20 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-109 (see Column A of Table 1), wherein each position comprising a “T” residue is substituted for a “U” residue. In some embodiments, an RNA processing modulator comprising at least 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-109 (e.g., an ASO comprising or consisting of 18 nucleotides, 19 nucleotides, or 20 continuous nucleotides of any one of the nucleic acid sequences shown in Column A of Table 1), wherein one or more of positions comprising a “T” residue is substituted for a “U” residue and wherein the RNA processing modulator comprises one or more chemical modifications as set forth in any one of the rows in Column C of Table 1. In some embodiments, an RNA processing modulator comprising at least 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-109 (e.g., an ASO comprising or consisting of 18 nucleotides, 19 nucleotides, or 20 continuous nucleotides of any one of the nucleic acid sequences shown in Column A of Table 1), wherein one or more of positions comprising a “T” residue is substituted for a “U” residue and wherein the RNA 12155096.1 processing modulator comprises a pattern of chemical modifications as set forth in any one of the rows in Column C of Table 1. In some embodiments, one or more positions in an RNA processing modulator comprising “U” residues comprises an uracil nitrogenous base or a chemically modified uracil nitrogenous base described herein and a deoxyribose sugar or a chemically modified deoxyribose sugar described herein. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprises a gapmer structure, wherein a region of 10 deoxyribonucleotides is flanked by regions each comprising 4 ribonucleotides (thereby totaling 8 ribonucleotides and 10 deoxyribonucleotides). In some embodiments, 1, 2, 3, or 4 ribonucleotides in each of the regions flanking the region of 10 deoxyribonucleotides comprise a 2'-O-methoxyethyl (– OCH2CH2OCH3 (2' MOE)) modification. In some embodiments, 1, 2, 3, or 4 ribose sugars comprised in each region flanking the region of 10 deoxyribonucleotides is linked by a phosphorothioate linkage or a phosphodiester linkage. In some embodiments, 1-10 deoxyribose sugars (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 deoxyribose sugars) comprised in the region of 10 deoxyribonucleotides is linked by a phosphorothioate linkage. In some embodiments, one or more ribose sugars (e.g., 1, 2, 3, or 4 ribose sugars) comprised in each of the regions flanking the region of 10 deoxyribonucleotides is linked by a phosphorothioate linkage. In some embodiments, 16 out of the 18 positions are linked by phosphorothioate linkages. In some embodiments, 16 out of the 18 positions are linked by phosphorothioate linkages, wherein the second position is linked to the third position (relative to the 5' terminal end) by a phosphodiester linkage and the sixteenth position is linked to the seventeenth position (relative to the 5' terminal end) by a phosphodiester linkage. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-109 (see Column A of Table 1). In some embodiments, an RNA processing modulator comprising the gapmer structure reduces the levels of a SPTLC2 mRNA (e.g., a mature mRNA or a pre-mRNA) and / or a SPTLC2 protein by 50% or more (e.g., 50-60%, 60- 70%, 70-80%, 80-90%, 90-95%, or 95-100%) in a cell or one or more tissues, such as a cell or one or more tissues (e.g., cerebrospinal fluid, plasma, and / or a brain tissue) in a subject when the RNA processing modulator or a composition thereof is administered to the subject in an effective amount. In some embodiments, an RNA processing modulator comprising the gapmer structure reduces the levels of one or more lipids (e.g., toxic lipids, such as toxic 12155096.1 deoxysphingolipids) by 50% or more (e.g., 50-60%, 60-70%, 70-80%, 80-90%, 90-95%, or 95- 100%) in a cell or one or more tissues, such as a cell or one or more tissues (e.g., cerebrospinal fluid, plasma, and / or a brain tissue) in a subject when the RNA processing modulator or a composition thereof is administered to the subject in an effective amount. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprises a gapmer structure, wherein a region of 10 deoxyribonucleotides is flanked by regions each comprising 5 ribonucleotides (thereby totaling 10 ribonucleotides and 10 deoxyribonucleotides). In some embodiments, 1, 2, 3, 4, or 5 ribonucleotides in each of the regions flanking the region of 10 deoxyribonucleotides comprise a 2'-O-methoxyethyl (– OCH2CH2OCH3 (2' MOE)) modification. In some embodiments, 1, 2, 3, 4, or 5 ribose sugars comprised in each region flanking the region of 10 deoxyribonucleotides is linked by a phosphorothioate linkage or a phosphodiester linkage. In some embodiments, 1-10 deoxyribose sugars (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 deoxyribose sugars) comprised in the region of 10 deoxyribonucleotides is linked by a phosphorothioate linkage. In some embodiments, one or more ribose sugars (e.g., 1, 2, 3, 4, or 5 ribose sugars) comprised in each of the regions flanking the region of 10 deoxyribonucleotides is linked by a phosphorothioate linkage. In some embodiments, 16 out of the 20 positions are linked by phosphorothioate linkages. In some embodiments, 16 out of the 20 positions are linked by phosphorothioate linkages, wherein the second position and third position (relative to the 5' terminal end), third position and fourth position (relative to the 5' terminal end), seventeenth position and eighteenth position (relative to the 5' terminal end), and eighteenth position and nineteenth position (relative to the 5' terminal end) are each linked by a phosphodiester linkage. In some embodiments, 18 out of the 20 positions are linked by phosphorothioate linkages. In some embodiments, 18 out of the 20 positions are linked by phosphorothioate linkages, wherein the second position and third position (relative to the 5' terminal end) are linked by a phosphodiester linkage and the seventeenth position and eighteenth position (relative to the 5' terminal end) are linked by a phosphodiester linkage. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 20 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-109 (see Column A of Table 1). In some embodiments, an RNA processing modulator comprising the gapmer structure reduces the levels of a SPTLC2 mRNA (e.g., a mature mRNA or a pre-mRNA) and / or a SPTLC2 protein by 50% or more (e.g., 50-60%, 60-70%, 70-80%, 80-90%, 90-95%, or 12155096.1 95-100%) in a cell or one or more tissues, such as a cell or one or more tissues (e.g., cerebrospinal fluid, plasma, and / or a brain tissue) in a subject when the RNA processing modulator or a composition thereof is administered to the subject in an effective amount. In some embodiments, an RNA processing modulator comprising the gapmer structure reduces the levels of one or more lipids (e.g., toxic lipids, such as toxic deoxysphingolipids) by 50% or more (e.g., 50-60%, 60-70%, 70-80%, 80-90%, 90-95%, or 95-100%) in a cell or one or more tissues, such as a cell or one or more tissues (e.g., cerebrospinal fluid, plasma, and / or a brain tissue) in a subject when the RNA processing modulator or a composition thereof is administered to the subject in an effective amount. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 1 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 2 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 3 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 4 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 5 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 6 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 7 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO 12155096.1 after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 8 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 9 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 10 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 11 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 12 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 13 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 14 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 15 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 16 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence 12155096.1 set forth in SEQ ID NO: 17 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 18 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 19 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 20 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 21 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 22 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 23 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 24 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 25 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 26 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated 12155096.1 nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 27 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 28 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 29 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 30 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 31 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 32 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 33 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 34 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 35 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 36 and the following modification 12155096.1 pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 37 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 38 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 39 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 40 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 41 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 42 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 43 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 44 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 45 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an 12155096.1 antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 46 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 47 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 48 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 49 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 50 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 51 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 52 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 53 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 54 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 55 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO 12155096.1 after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 56 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 57 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 58 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 59 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 60 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 61 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 62 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 63 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 64 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence 12155096.1 set forth in SEQ ID NO: 65 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 66 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 67 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 68 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 69 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 70 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 71 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 72 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 73 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 74 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated 12155096.1 nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 75 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 76 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 77 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 78 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 79 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 80 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 81 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 82 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 83 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 84 and the following modification 12155096.1 pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 85 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 86 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 87 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 88 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 89 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 90 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 91 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 92 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 93 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an 12155096.1 antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 94 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 95 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 96 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 97 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 98 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 99 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 100 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 101 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 102 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 103 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 12155096.1 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 104 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 105 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 106 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 107 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 108 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 109 and the following modification pattern: 20mer, Gapmer 5-10-5, PO after 2nd base from 5' end, PO after 3rd base from 3' end. In any of the foregoing embodiments: positions comprising “T” residues comprise a thymine (T) nitrogenous base bonded to the 1' carbon of either ribose or deoxyribose; isolated nucleic acids comprising a gapmer structure are indicated by structures denoted “(X)-(Y)-(X)”, wherein “(X)” refers to regions comprising an ‘X’ number of nucleotide positions having ribose and which flank a region referred to as “(Y)” comprising a ‘Y’ number of nucleotide positions having deoxyribose; isolated nucleic acids comprising a skipmer structure (alternatively referred to herein as skippers) are indicated by the lack of notation reciting “(X)-(Y)-(X)” and each nucleotide position comprises ribose; “2'MOE” refers to the 2' carbon of ribose bonded to an oxygen atom which is bonded to a methoxyethyl group; “#mer” refers to the number of nucleotide positions; and “PO” refers to nucleotide positions, wherein the 3' carbon of ribose comprises a phosphodiester bond which links the nucleotide position to an immediately adjacent nucleotide position in the 3' direction, wherein nucleotide 12155096.1 positions comprising a PO group (e.g., a position referred to as 2nd or 3rd from a 5’ or 3' terminal end) at the 3' carbon of ribose is indicated by the location of the PO group which is referred to either as being “at” or “after”. Pharmaceutical Compositions In some embodiments of the disclosure, RNA processing modulators (e.g., antisense oligonucleotides) are assembled into compositions for therapeutic purposes. In some embodiments, the compositions are designed to enhance the therapeutic effect of the RNA processing modulators, for example by increasing biocompatibility, targeting the RNA processing modulator to a site of interest in vivo, reducing clearance of an isolated nucleic acid (e.g., an antisense oligonucleotide) in vivo, increasing the stability of an isolated nucleic acid (e.g., an antisense oligonucleotide) in vivo, increasing uptake of an isolated nucleic acid (e.g., an antisense oligonucleotide) in target cells, or amplifying the intended effect of an isolated nucleic acid (e.g., an antisense oligonucleotide) in vivo. In some embodiments, the RNA processing modulator (e.g., antisense oligonucleotide) is provided in combination with a pharmaceutically acceptable carrier. A “pharmaceutically acceptable carrier” means a pharmaceutically acceptable material, composition or carrier, such as a liquid or solid filler, stabilizer, dispersing agent, suspending agent, diluent, excipient, thickening agent, solvent or encapsulating material, involved in carrying or transporting a compound useful within the invention within or to the patient such that it may perform its intended function. Additional ingredients that may be included in the pharmaceutical compositions used in the practice of the invention are known in the art and described, for example in Remington's Pharmaceutical Sciences (Genaro, Ed., Mack Publishing Co., 1985, Easton, PA), which is incorporated herein by reference. In some embodiments, a composition comprising an RNA processing modulator (e.g., antisense oligonucleotide) comprises sterile artificial cerebrospinal fluid (CSF). In some embodiments, artificial CSF comprises a pH of about 6.8 to about 7.8. In some embodiments, the pH is between 6.9 and 7.7, between 7.0 and 7.6, or between 7.1 and 7.5. In some embodiments, artificial CSF comprises sodium phosphate buffer. In some embodiments, the sodium phosphate buffer is at a concentration of between 0.5 mM and 2.0 mM, such as 0.5-0.75 mM, 0.75-1.0 mM, 1.25-1.5 mM, 1.5-1.75 mM, or 1.75-2.0 mM. In some embodiments, the sodium phosphate buffer comprises a pH of about 6.90, 6.95, 7.00, 7.05, 7.10, 7.15, 7.20, 7.25, 12155096.1 or 7.30. In some embodiments, artificial CSF comprises sodium chloride. In some embodiments, the concentration of sodium chloride is between 50 mM and 300 mM, such as between 75 mM and 250 mM, between 100 mM and 225 mM, or between 125 mM and 200 mM. In some embodiments, artificial CSF comprises potassium chloride. In some embodiments, the concentration of potassium chloride is between 0.5 mM and 5 mM, such as between 1 mM and 5 mM or between 2 mM and 5 mM. In some embodiments, artificial CSF comprises calcium chloride dihydrate. In some embodiments, the concentration of calcium chloride dihydrate is between 1.0 mM and 2.0 mM, such as between 1.1 mM and 1.9 mM, between 1.2 mM and 1.8 mM, or between 1.3 mM and 1.7 mM. In some embodiments, artificial CSF comprises magnesium chloride hexahydrate. In some embodiments, the concentration of magnesium chloride hexahydrate is between 0.1 mM and 1.5 mM, such as between 0.3 mM and 1.2 mM, 0.4 mM and 1.1 mM, or between 0.5 mM and 1.0 mM. In some embodiments, artificial CSF is a sterile aqueous solution comprising any combination of sodium phosphate buffer, sodium chloride, potassium chloride, calcium chloride dihydrate, and magnesium chloride hexahydrate. In some embodiments, a composition comprising an RNA processing modulator (e.g., antisense oligonucleotide) comprises a total volume of about 5 mL to about 30 mL. In some embodiments, the total volume is about 10 mL, 15 mL, 20 mL, or about 25 mL. In some embodiments, the total volume of the composition is comprised in a vial, such as a glass vial. In some embodiments, the composition is prepared using sterile filtration and filling under aseptic processing. The disclosure also provides compositions comprising RNA processing modulators (e.g., antisense oligonucleotides) at a concentration of about 1 mg / mL to 20 mg / mL. In some embodiments, the concentration of RNA processing modulators (e.g., antisense oligonucleotides) in a composition is between 1 mg / mL and 15 mg / mL, between 3 mg / mL and 15 mg / mL, or between 5 mg / mL and 15 mg / mL. In some embodiments, the concentration of RNA processing modulators (e.g., antisense oligonucleotides) in a composition is greater than 5 mg / mL and less than 10 mg / mL. Methods and Medical Uses Aspects of the disclosure relate to methods of modulating a transcription, splicing, translation, function, or activity of genes associated with L-serine biosynthesis or lipid biosynthesis (e.g., sphingolipid biosynthesis) in a cell or subject. Also provided is an RNA 12155096.1 processing modulator (e.g., antisense oligonucleotide) described by the disclosure for use as a medicament. The RNA processing modulators (e.g., antisense oligonucleotides) may be used in methods of modulating transcription, translation, function, or activity of genes associated with with L-serine biosynthesis or lipid biosynthesis (e.g., sphingolipid biosynthesis), e.g. in a cell or subject. In some embodiments, the methods comprise administering a composition comprising one or more RNA processing modulators (e.g., 1, 2, 3, 4, 5, or more RNA processing modulators, for example 1, 2, 3, 4, 5, or more antisense oligonucleotides) to a cell or subject. In some embodiments, administration of the compositions (e.g., RNA processing modulators) results in alteration of lipid (e.g., sphingolipid) biosynthesis in the cell or subject. The cell may be in vivo, ex vivo, or in vitro. For example, in some embodiments, administration of an RNA processing modulator (e.g., an antisense oligonucleotide) targeting SPTLC2 mRNA results in an increase in production of sphingolipids (which utilize L-serine as a precursor molecule) in the cell or subject. In some embodiments, administration of an RNA processing modulator (e.g., an antisense oligonucleotide) targeting SPTLC2 mRNA results in a decrease in production of deoxy- sphingolipids (which result from mutations in certain genes involved in L-serine biosynthesis and / or lipid biosynthesis, for example SPTLC2) in the cell or subject. The disclosure is based, in part, on the recognition that contacting a cell or subject with an RNA processing modulator that decreases a level, transcription, splicing, translation, function or activity of SPTLC2 protein results, in some embodiments, in decreased deoxy-sphingolipid production in the subject. Accordingly, in some aspects, the disclosure provides a method for increasing sphingolipid biosynthesis in a cell or subject, the method comprising administering an isolated nucleic acid as described herein to a subject in need thereof. In some embodiments, the isolated nucleic acid comprises an antisense oligonucleotide comprising the sequence set forth in any one of SEQ ID NOs: 1-109 (provided in Column A of Table 1, optionally comprising one or more modifications in Column C of Table 1, and optionally wherein the sequence in Column A and the chemistry in Column C are provided in the same row of Table 1). Generally, it is desirable to increase sphingolipid levels (or reduce deoxy-sphingolipids) in certain subjects (e.g., subjects having low serine, for example subjects having retinal diseases (e.g., MacTel2 and Age-related macular degeneration (AMD) such as AMD with geographic atrophy), HSAN1 (e.g., HSAN1(a)), diabetic retinopathy, a peripheral neuropathy (e.g., motor neuropathy, sensory neuropathy, autonomic nerve neuropathy, combination neuropathies, 12155096.1 inherited or acquired peripheral neuropathies, such as diabetic neuropathy, chemotherapy- induced neuropathy or other forms of toxic peripheral neuropathy, etc.), neurodegeneration (e.g., Parkinson’s disease (PD), Friedreich’s ataxia, motor neuron disease, Alzheimer’s disease (AD), amyotrophic lateral sclerosis (ALS), etc.), spastic paraplegia, or a psychiatric disorder (e.g., resistant depression, treatment resistant depression, schizophrenia, and / or treatment resistant schizophrenia)). However, it should be appreciated that, in some embodiments, the disclosure provides a method for decreasing sphingolipid biosynthesis (or increasing deoxy-sphingolipid biosynthesis) in a cell or subject, the method comprising administering an isolated nucleic acid as described herein to a subject in need thereof. In some embodiments, the isolated nucleic acid comprises an antisense oligonucleotide comprising the sequence set forth in any one of SEQ ID NOs: 1-109 (provided in Column A of Table 1, optionally comprising one or more modifications in Column C of Table 1, and optionally wherein the sequence in Column A and the chemistry in Column C are provided in the same row of Table 1). In some aspects, RNA processing modulators (e.g., antisense oligonucleotides) described by the disclosure are useful for treating a disease or disorder associated with dysregulation of L- serine biosynthesis. Thus, provided herein are RNA processing modulators (e.g., antisense oligonucleotides) described by the disclosure for use in a method of treating a disease or disorder associated with dysregulation of L-serine biosynthesis. A disease or disorder associated with dysregulation of L-serine biosynthesis refers to a disease or disorder in which the subject (e.g., patient) is 1) characterized as having low serine, and / or 2) has one or more mutations in one or more genes associated with L-serine biosynthesis, and / or 3) has one or more mutations in one or more genes that are involved in a metabolic pathway that utilizes serine (e.g., sphingolipid biosynthesis, which relies upon SPTLC2). A disease or disorder associated with dysregulation of L-serine biosynthesis refers to a disease or disorder in which the subject (e.g., patient) is characterized as having one or more mutations one or more genes associated with lipid (e.g., sphingolipid) biosynthesis, for example SPTLC2, or as having low serine that results in increased production of toxic deoxy-sphingolipids. Methods of measuring serine levels in a subject are known in the art, for example as described by Méneret et al. Arch Neurol.2012;69(7):908–911. In some embodiments, an L- serine level of a subject is determined by measuring the concentration of L-serine in a biological sample obtained from the subject, for example a blood sample, serum sample, cerebrospinal fluid (CSF) sample, etc. In some embodiments, a subject having “low serine” refers to a subject 12155096.1 having a plasma serine level of below 0.66 mg / dL and / or a cerebrospinal fluid (CSF) serine level of below 0.21 mg / dL. Examples of genes associated with L-serine biosynthesis include PHGDH, Phosphoserine aminotransferase (PSTAT1), and Phosphoserine phosphatase (PSPH). In some embodiments, a subject having a disease or disorder associated with dysregulation of L-serine biosynthesis comprises one or more mutations in a gene selected from PHGDH, PSTAT1, and PSPH. In some embodiments, a subject has one or more mutations in a PHGDH gene. In some embodiments, a subject having one or more mutations in a PHGDH gene has (or is at risk of developing) MacTel2. Methods of detecting mutations in a subject’s genes are known in the art and include, for example DNA sequencing, RNA sequencing, microarray analysis, etc. In some embodiments, a subject has a disease or disorder associated with dysregulation of lipid (e.g., sphingolipid) biosynthesis, and comprises one or more mutations in one or more genes that are involved in a metabolic pathway that utilizes serine (e.g., L-serine or D-serine). For example, L-serine is utilized in the production of sphingolipids by condensation of L-serine with palmitoyl-CoA by the enzyme serine palmitoyl transferase (SPT). One subunit of SPT is provided by the SPTLC2 gene in humans which fulfills autoregulatory roles in the enzymatic activity of SPT. Autosomal dominant mutations in SPTLC2 result in atypical production of sphingolipids and are implicated in hereditary sensory neuropathy (HSAN1) (including HSAN1(a)) resulting from condensation of palmitoyl-CoA with alanine to form cytotoxic deoxysphingolipids. HSAN1 results in a peripheral neuropathy (e.g., motor neuropathy, sensory neuropathy, autonomic nerve neuropathy, combination neuropathies, inherited or acquired peripheral neuropathies, such as diabetic neuropathy, chemotherapy-induced neuropathy or other forms of toxic peripheral neuropathy, etc.) manifesting as, in some instances, severe loss of sensation to temperature, pressure and pain. In some instances, long-term cases of HSAN1 leads to painless injuries, chronic skin ulcers, bone destruction, bone infections, amputation of digits, and motor dysfunction. In some embodiments, a subject having one or more mutations in a gene encoding an SPT subunit may benefit from being administered an RNA processing modulator that increases transcription, translation, function, or activity of SPTLC2. Without wishing to be bound by any particular theory increased SPTLC2 levels or activity may result in restoration of proper spingolipid:deoxy-sphingolipid levels in the subject. Measurement of sphingolipid and deoxy-sphingolipid levels in a subject is known, for example as described by Johnson et al. Nature Communications volume 11, Article number: 2471 (2020), Weiss et al. Hum Mol Genet. 12155096.1 2021 Feb 25;29(24):3945-3953. doi: 10.1093 / hmg / ddaa248, and Clark et al. (2020) FEBS Lett, 594: 3579-3582. Deoxy-sphingolipid production as a result of reduced SPT activity and an ensuing metabolic shift toward alanine utilization over L-serine is seen in other diseases and disorders. In some instances, diabetic neuropathy as a result of type 2 diabetes is associated with overproduction of deoxysphingolipids. In some instances, amyotrophic lateral sclerosis (ALS) is associated with over production of deoxysphingolipids. Accordingly, in some aspects, the disclosure provides a method for treating a disease or disorder associated with dysregulation of lipid (e.g., sphingolipid) biosynthesis, the method comprising administering an isolated nucleic acid as described herein to a subject in need thereof. Also provided is an RNA processing modulator (e.g., antisense oligonucleotide) described by the disclosure for use in a method of treating a disease or disorder associated with dysregulation of lipid (e.g., sphingolipid) biosynthesis. The method may comprise administering an isolated nucleic acid as described herein to a subject in need thereof. In some embodiments, the isolated nucleic acid comprises an antisense oligonucleotide comprising the sequence set forth in any one of SEQ ID NOs: 1-109 (provided in Column A of Table 1, optionally comprising one or more modifications in Column C of Table 1, and optionally wherein the sequence in Column A and the chemistry in Column C are provided in the same row of Table 1). In some embodiments, the disease is selected from retinal diseases (e.g., MacTel2 and Age- related macular degeneration (AMD) such as AMD with geographic atrophy), HSAN1 (e.g., HSAN1(a)), diabetic retinopathy, a peripheral neuropathy (e.g., motor neuropathy, sensory neuropathy, autonomic nerve neuropathy, combination neuropathies, inherited or acquired peripheral neuropathies, such as diabetic neuropathy, chemotherapy-induced neuropathy or other forms of toxic peripheral neuropathy, etc.), neurodegeneration (e.g., Parkinson’s disease (PD), Friedreich’s ataxia, motor neuron disease, Alzheimer’s disease (AD), amyotrophic lateral sclerosis (ALS), etc.), spastic paraplegia, or a psychiatric disorder (e.g., resistant depression, treatment resistant depression, schizophrenia, and / or treatment resistant schizophrenia). As used herein “treat” or “treating” refers to preventing or delaying disease onset, reducing or preventing the development of symptoms associated with a disease, reducing the severity of a disease, and / or preventing the worsening of symptoms associated with a disease. Accordingly, in some aspects, the disclosure provides a method for treating a subject having or suspected of having a disease caused by dysregulated L-serine biosynthesis or dysregulated lipid 12155096.1 biosynthesis (e.g., sphingolipid biosynthesis). Treatment of a subject involves administration of a composition to the subject (e.g., an RNA processing modulator, such as an antisense oligonucleotide) as described herein. As used herein, the term “treating” refers to the application or administration of a composition (e.g., an RNA processing modulator, such as an antisense oligonucleotide as described herein) to a subject who has a disease or disorder associated with low levels of serine, or with dysregulation of L-serine biosynthesis or with dysregulation of lipid biosynthesis, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve, or affect the disorder, the symptom of the disease, or the predisposition toward a disease associated with dysregulation of L-serine biosynthesis. Alleviating a disease associated with dysregulation of L-serine biosynthesis includes delaying the development or progression of the disease, or reducing disease severity. Alleviating the disease does not necessarily require curative results. As used therein, "delaying" the development of a disease (such as a disease associated with dysregulation of L-serine biosynthesis or a disease associated with dysregulation of lipid biosynthesis) means to defer, hinder, slow, retard, stabilize, and / or postpone progression of the disease. This delay can be of varying lengths of time, depending on the history of the disease and / or individuals being treated. A method that "delays" or alleviates the development of a disease, or delays the onset of the disease, is a method that reduces probability of developing one or more symptoms of the disease in a given time frame and / or reduces extent of the symptoms in a given time frame, when compared to not using the method. Such comparisons are typically based on clinical studies, using a number of subjects sufficient to give a statistically significant result. "Development" or "progression" of a disease means initial manifestations and / or ensuing progression of the disease. Development of the disease can be detectable and assessed using standard clinical techniques as well known in the art. However, development also refers to progression that may be undetectable. For purpose of this disclosure, development or progression refers to the biological course of the symptoms. "Development" includes occurrence, recurrence, and onset. As used herein "onset" or "occurrence" of a disease associated with low serine levels and / or dysregulation of L-serine biosynthesis and / or dysregulation of lipid biosynthesis. A subject may be a human, a mouse, a rat, a pig, a dog, a cat, or a non-human primate. In some embodiments, a subject has or is suspected of having a disease or disorder associated 12155096.1 with low serine levels and / or dysregulation of L-serine biosynthesis and / or dysregulation of lipid biosynthesis. In some embodiments, a subject having a disease or disorder associated with low serine levels and / or dysregulation of L-serine biosynthesis and / or dysregulation of lipid biosynthesis comprises at least one SPTLC2 allele having a mutation, such as a loss of function mutation, or a mutation that changes substrate specificity of an SPT protein comprising the mutant SPTLC2 subunit to have a preference for alanine over serine. In some embodiments, an SPTLC2 allele having a mutation comprises a frameshift mutation, a splice site mutation, a missense mutation, a truncation mutation or a nonsense mutation. A subject may have two SPTLC2 alleles having the same mutations (homozygous state) or two SPTLC2 alleles having different mutations (compound heterozygous state). The optimal course of administration or delivery of the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure may vary depending upon the desired result and / or on the subject to be treated. As used herein “administration” refers to contacting cells with an RNA processing modulator and can be performed in vitro or in vivo. Compositions (e.g., pharmaceutical compositions) provided herein can be administered a number of routes including, but not limited to, by oral administration, intravenous administration (e.g., systemic intravenous injection / administration), administration to the brain and / or spinal cord, intracerebral injection, intraventricular injection, intracisternal injection, intraparenchymal injection, intrathecal injection, and any combination of the foregoing. In some embodiments, administration comprises administration to cerebral spinal fluid, and / or direct administration to an affected site (e.g., a target tissue, for example eye tissue, central nervous system (CNS) tissue, or peripheral nervous system (PNS) tissue). In general, the most appropriate route of administration will depend upon a variety of factors including the nature of the agent (e.g., its stability in the environment of the gastrointestinal tract), and / or the condition of the subject (e.g., whether the subject is able to tolerate oral administration, injection, etc.). In certain embodiments, a compound or pharmaceutical composition described herein is suitable for topical administration to the eye of a subject. In some embodiments, administration (e.g., injection) of a compound or pharmaceutical composition is performed on a patient in a Trendelenburg position. In some embodiments, compositions are administered to a subject through only one administration route. In some embodiments, multiple administration routes may be exploited (e.g., serially, or simultaneously) for administration of the composition to a subject. 12155096.1 In some embodiments, it may be desirable to deliver the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure to the CNS of a subject. By “CNS” is meant all cells and tissue of the brain and spinal cord of a vertebrate. Thus, the term includes, but is not limited to, neuronal cells, glial cells, astrocytes, cerebrospinal fluid (CSF), interstitial spaces, bone, cartilage and the like. RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure may be delivered directly to the CNS or brain by injection into, e.g., the ventricular region, as well as to the striatum (e.g., the caudate nucleus or putamen of the striatum), spinal cord and neuromuscular junction, or cerebellar lobule, with a needle, catheter or related device, using neurosurgical techniques known in the art, such as by stereotactic injection (see, e.g., Stein et al., J Virol 73:3424-3429, 1999; Davidson et al., PNAS 97:3428-3432, 2000; Davidson et al., Nat. Genet.3:219-223, 1993; and Alisky and Davidson, Hum. Gene Ther. 11:2315-2329, 2000). In some embodiments, RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are administered by intravenous injection. In some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are administered by intracerebral injection. In some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are administered by intracerebroventricular injection. In some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are administered by intrathecal injection. In some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are administered by lumbar intrathecal injection. In some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are administered by intrastriatal injection. In some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are delivered by intracranial injection. In some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are delivered by cisterna magna injection. In some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are delivered by cerebral lateral ventricle injection. The skilled artisan will also recognize that the foregoing administration routes may be combined in a single subject (e.g., a subject may be administered RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure using a combination of two or more of the foregoing techniques). In some embodiments, administration of RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure results in delivery of RNA processing modulators (e.g., 12155096.1 antisense oligonucleotides) to ocular tissue. Delivery of the RNA processing modulators (e.g., antisense oligonucleotides) to a mammalian subject may be by, for example, intraocular injection, subretinal injection, topical administration (e.g., an eye drop), or by injection into the eye of the mammalian subject to ocular tissues (e.g., intravitreal injection). As used herein, “ocular tissues” refers to any tissue derived from or contained in the eye. Non-limiting examples of ocular tissues include neurons, retina (e.g., photoreceptor cells), sclera, choroid, retina, vitreous body, macula, fovea, optic disc, lens, pupil, iris, aqueous fluid, cornea (e.g., keratocytes, corneal endothelial cells, corneal basal cells, corneal wing cells, and corneal squamous cells), conjunctiva ciliary body, and optic nerve. The retina is located in the posterior of the eye and comprises photoreceptor cells. These photoreceptor cells (e.g., rods, cones) confer visual acuity by discerning color, as well as contrast in the visual field. In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA) is administered to a subject. In some embodiments, an effective amount of an RNA processing modulator (e.g., antisense oligonucleotide) is an amount sufficient to increase transcription, translation, function, or activity of a target mRNA. In some embodiments, an effective amount of an RNA processing modulator (e.g., antisense oligonucleotide) is an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA. The effective amount will depend primarily on factors such as the species, age, weight, health of the subject, and the tissue to be targeted, and may thus vary among animal and tissue. In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) is 1 ng-100 mg. In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) is 1-1000 ng. In some embodiments, an effective amount of (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) is 1-10, 10-50, 50-100, 100- 200, 200-300, 300-500, 500-750, or 750-1000 ng. In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a 12155096.1 target mRNA) is 0.1 μg-100.0 μg. In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) 0.1-1.0, 1.0-5.0, 5.0-20.0, 20.0-50.0, or 50.0-100.0 μg. In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) is 1 μg-1000 μg. In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) 100-250, 250-500, 500-750, or 750-1000 μg. In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) 0.1-1.0, 1.0-5.0, 5.0-20.0, 20.0-50.0, or 50.0-100.0 mg. In some embodiments, an effective amount is administered from a composition comprising a concentration of RNA processing modulator (e.g., antisense oligonucleotide) of about 1 mg / mL to 20 mg / mL. In some embodiments, the concentration of RNA processing modulators (e.g., antisense oligonucleotides) in the composition is between 1 mg / mL and 15 mg / mL, between 3 mg / mL and 15 mg / mL or between 5 mg / mL and 15 mg / mL. In some embodiments, the concentration of RNA processing modulators (e.g., antisense oligonucleotides) in the composition is greater than 5 mg / mL and less than 10 mg / mL. In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) is 0.1-1.0, 1.0-20.0, 20.0-50.0, 50.0-200.0, or 200.0-500.0 mg. In some embodiments, an effective amount is administered from a composition comprising a concentration of RNA processing modulator (e.g., antisense oligonucleotide) of about 1 mg / mL to 50 mg / mL. In some embodiments, the concentration of RNA processing modulators (e.g., antisense oligonucleotides) in the composition is between 1 mg / mL and 45 mg / mL, between 10 mg / mL and 45 mg / mL or between 15 mg / mL and 45 mg / mL. During the course of treatment, administration of the composition may be altered or adjusted accordingly. For example, expression of the protein encoded by the nucleic acid targeted by the isolated nucleic acid of the pharmaceutical composition may be monitored to 12155096.1 inform methods of use of the composition. Expression information may be obtained, for example, through measuring changes in the levels of the protein or RNA products of the target nucleic acid. Alternatively, sequencing analyses of the target nucleic acid may be employed to determine if expression changes include alterations in the structure or sequence of the protein or RNA product of the target nucleic acid sequence. The amount of the composition will vary depending on a number of factors such as, but not limited to, clinical features (e.g., disease severity, rate of disease progression, physical characteristics, etc.) of a subject and the mode of administration. Accordingly, the composition may, in certain instances, be administered once or more than one to a single subject. In certain instances, the composition may be administered to the same subject through different modes or routes at different times during the treatment process. In some embodiments, the composition is administered to a subject more than once. In some embodiments, the composition is administered twice, three times, four times, or more to a subject. In some embodiments, the composition is administered to a subject less than twelve times in a 12-month period. In some embodiments, the time between each administration of the composition is days, weeks, or months. In some embodiments, the time between each administration is 1-2 weeks, 2-4 weeks, or 1-4 months. In some embodiments, the time between each administration of the composition is the same. In other embodiments, the time between each administration of the composition can be different. In some embodiments, the time between a first administration and a second administration of the composition is 1-2 weeks. In some embodiments, the time between a second administration of the compositions and a third administration of the composition is 1-3 months. EXAMPLES Example 1: RNA Processing Modulators (RPMs) This example describes the use of RNA Processing Modulators (RPMs) for modulating translation of one or more mRNA transcripts in a cell or subject. RPMs function by binding to a target-specific mRNA sequence and altering (e.g., upregulating or down-regulating) translation of protein of the mRNA sequence. In some embodiments, an RPM is an antisense oligonucleotide (ASO). Antisense oligonucleotides (ASOs) typically range from about 10 to 30 nucleotides in length, and may comprise a non-natural sugar-phosphate backbone (e.g., phosphorodiamidate morpholino 12155096.1 backbone, phosphorothioate backbone, etc.) and / or one or more modified sugar moieties (e.g., 2′-O-methoxyethyl ribose (2′-O-MOE) modifications, etc.). In some embodiments, an RPM (e.g., an ASO) targets a structural element of an mRNA transcript, for example an untranslated region (UTR) to modulate the expression of the target (e.g., the target gene encoding the mRNA transcript) by increasing or decreasing transcription and / or translation of the protein encoded by the mRNA transcript (alternatively referred to as modulating expression in the up or the down direction). In another example, an RPM (e.g., an ASO) may target a regulatory region (and thus interfere with protein binding, such as ribosomal protein binding) of a UTR region to modulate the expression of the target in the up or the down direction. Alternatively, an RPM (e.g., an ASO) may target a splice site (e.g., a splice acceptor site or a splice donor site or one or more nucleotide positions thereof in a UTR region) to modulate the expression of the target in the up or the down direction (and thus generating novel protein variants). Additional examples of structural elements that can be targeted by RPMs (e.g., ASOs) include, but are not limited to, intronic regulatory sites, exonic regulatory sites, exon- intron boundaries, antisense binding sites of a target mRNA transcript, long-non-coding RNA (LncRNA) binding sites of a target gene, and a retained exon of a canonical mRNA. Non-limiting examples of ASOs targeting various structural elements of an mRNA are show in FIG.1. Composition “A” represents an ASO that binds to the 5’ untranslated region (5’ UTR) of an RNA. Composition “B” represents an ASO that binds to an intron of an RNA. Composition “C” represents an ASO that binds to a splice boundary (e.g., a splice junction) between an exon and intron of an RNA. Composition “D” represents an ASO that binds to an exon (e.g., protein coding region) of an RNA. Composition “E” represents a combination of an ASO binding to a 3’ UTR of an RNA, alone or with a trans-regulator. Composition “F” represents a “gapmer” ASO that binds to an exon (e.g., a protein coding region) of an RNA and mediates RNaseH decay. Composition “G” represents a “gapmer” ASO that binds to a 3’ UTR of an RNA, alone or with a trans-regulator, and mediates RNaseH decay. In some embodiments, ASOs binding to an RNA result in translation of a truncated protein that has a dominant negative effect on the wild-type, full-length protein. Example 2: L-Serine and Lipid Biosynthesis 12155096.1 This example describes diseases and disorders that area associated with L-serine biosynthesis, particularly diseases and disorders associated with dysregulation of L-serine biosynthesis in the central nervous system (CNS). L-serine is typically classified as a non-essential amino acid. However, in the CNS, an external supply of L-serine is essential for the synthesis of sphingolipids and phosphatidylserine (PS), and for survival of neurons. In astrocytes, L-serine is normally synthesized from metabolism of glucose by several enzymes, including phosphoglycerate dehydrogenase (PHGDH). L-serine then interacts with serine palmitoyltransferase (SPT) to produce certain lipids (e.g., sphingolipids) that are exported to neurons for use in cellular membrane biosynthesis. L-serine also interacts with serine racemase to produce D-serine, which is exported to neurons. Dysregulation of L-serine biosynthesis (e.g., caused by a mutation in PHGDH, or SPTLC2, a gene encoding an SPT subunit) has been shown to cause accumulation of toxic deoxysphingolipids (deoxy-SLs), which can lead to inflammation and is also associated with certain CNS diseases and disorders. Broad lipidomics profiling has been useful in pointing to biomarkers associated with L- serine synthesis dysregulation and may provide means for detection of disease states associated with L-serine biosynthesis problems. Recent data indicates that in the context of macular telangiectasia type 2 (MacTel2), PHGDH loss of function mutations (e.g., haploinsufficiency) and variants are an “allelic series” correlating reduction in enzyme level / activity with disease impact. Remarkably, even MacTel2 patients without severe PHGDH mutations have been observed to have low L-serine levels. These low serine levels have been observed to cause high deoxy-SLs through an established SPT pathway. Briefly, in the presence of low serine levels, the SPT enzyme is left to utilize alanine, rather than serine, to make complex sphingolipids (SLs), leading to production of deoxy-SLs. Interestingly, SPT mutations have also been observed to cause MacTel2. For example, dominant mutations in SPT genes SPTLC1 or SPTLC2 have been observed to lead to preferential use of alanine, and also cause rare familial MacTel2. Low serine is also associated with oxidative stress. To this point, serine biosynthesis is an important antioxidant in the macula region of the eye and reduced PHGDH function leads to oxidative stress and reduced glutathione. SPT mutations additionally have been observed to cause Hereditary sensory neuropathy type 1 (HSAN1) (including HSAN1(a)), and a subset of these HSAN1 patients get 12155096.1 both diseases. In HSAN1 patients, levels of various toxic deoxy-SLs are elevated, such as 1- deoxysphinganine, 1-deoxysphingosine, and 1-deoxyceramide. Rare mutations in SPT have been observed to cause early onset ALS and to be associated with Alzheimer’s disease. Adult onset diabetes mellitus has also been observed to lead to reduced serine levels, perhaps due perhaps to excessive liver uptake. Moreover, in ALS patients, the levels of various non-deoxy-SLs are elevated, such as sphinganine, sphingosine, and ceramide. Thus, accumulation of toxic deoxy-SLs is seen across several disease indications. Dysregulated deoxy-SL production is associated with other conditions. For instance, in contrast to the role that dysregulated L-serine synthesis plays in the development of MacTel2 and HSAN1, upregulation of toxic deoxy-SLs may be a treatment approach for cancer. For instance, inhibition of PHGDH increases sensitivity of primary cultures of muller glia from cadaveric eyes to oxidative stress conditions. This suggests that increased deoxy-SLs is cytotoxic and makes cells from sensitive to other stresses. Separately, inhibition of SPT function is associated with reduced markers of atherosclerosis. Existing drugs that inhibit SPT –e.g., myriocin and, reportedly, cycloserine–are likely not specific enough to mediate a therapeutic effect, and myriocin may have some toxicity associated with its use. Example 3: Modulation of L-Serine and Lipid Biosynthesis In some embodiments, an isolated nucleic acid described herein is capable of modulating the levels of one or more non-deoxy-SLs (e.g., sphinganine, sphingosine, and / or ceramide) and / or one or more deoxy-SLs (e.g., deoxy-sphinganine and / or deoxy-ceramide) in a cell, such as a cell in a subject (e.g., a human subject). In some embodiments, modulating the levels of one or more non-deoxy-SLs and / or one or more deoxy-SLs comprises modulating the expression of a gene associated with L-serine biosynthesis and / or lipid biosynthesis using an isolated nucleic acid described herein. In some embodiments, modulating the expression of a gene associated with L-serine biosynthesis and / or lipid biosynthesis comprises increasing or decreasing the transcription and / or translation of an mRNA encoded by the gene using an isolated nucleic acid (e.g., an RNA-processing modulator) described herein. In some embodiments, a gene associated with L-serine biosynthesis and / or lipid biosynthesis is a mutant SPTLC2 gene. In some embodiments, a mutant SPTLC2 gene comprises 12155096.1 one or more nucleotide substitutions, insertions, and / or deletions relative to a wild type SPTLC2 gene (or mRNA encoded by a wild type SPTLC2 gene, such as one comprising a sequence set forth in SEQ ID NO: 110). In some embodiments, a mutant SPTLC2 gene comprises a c.203T>G mutation resulting in presence of an arginine at amino acid position 68 in SPTLC2 (e.g., a SPTLC2 M68R mutant). In some embodiments, the c.203T>G mutation is a heterozygous mutation. In some embodiments, a mutant SPTLC2 gene comprises a c.529A > G mutation resulting in presence of an aspartate at amino acid position 177 in SPTLC2 (e.g., a SPTLC2 N117D mutant). In some embodiments, the c.529A > G mutation is a heterozygous mutation. In some embodiments, a mutant SPTLC2 gene comprises a c.544G>C mutation resulting in presence of a proline at amino acid position 182 in SPTLC2 (e.g., a SPTLC2 A182P mutant). In some embodiments, a mutant SPTLC2 gene comprises a c.547C>T mutation resulting in presence of a tryptophan at amino acid position 183 in SPTLC2 (e.g., a SPTLC2 R183W mutant). In some embodiments, a mutant SPTLC2 gene comprises a c.778G>A mutation resulting in presence of a lysine at amino acid position 260 in SPTLC2 (an SPTLC2 E260K mutant). In some embodiments, the c.778G>A mutation is a heterozygous mutation. In some embodiments, a mutant SPTLC2 gene comprises a c.1075G>A mutation resulting in presence of a methionine at amino acid position 359 in SPTLC2 (e.g., a SPTLC2 V359M mutant). In some embodiments, the c.1075G>A mutation is a heterozygous mutation. In some embodiments, a mutant SPTLC2 gene comprises a c.1145G>T mutation resulting in presence of a valine at amino acid position 382 in SPTLC2 (e.g., a SPTLC2 G382V mutant). In some embodiments, the c.1145G>T mutation is a heterozygous mutation. In some embodiments, a mutant SPTLC2 gene comprises a c.1510A>T mutation resulting in presence of a phenylalanine at amino acid position 510 in SPTLC2 (e.g., a SPTLC2 I510F mutant). In some embodiments, the c.1510A>T mutation is a heterozygous mutation. In some embodiments, a mutant SPTLC2 gene is associated with a disease or disorder described herein including, but not limited to, retinal diseases (e.g., MacTel2 and Age-related macular degeneration (AMD) such as AMD with geographic atrophy), HSAN1 (e.g., HSAN1(a)), diabetic retinopathy, a peripheral neuropathy (e.g., motor neuropathy, sensory neuropathy, autonomic nerve neuropathy, combination neuropathies, inherited or acquired peripheral neuropathies, such as diabetic neuropathy, chemotherapy-induced neuropathy or other forms of toxic peripheral neuropathy, etc.), neurodegeneration (e.g., Parkinson’s disease (PD), Friedreich’s ataxia, motor neuron disease, Alzheimer’s disease (AD), amyotrophic lateral 12155096.1 sclerosis (ALS), etc.), spastic paraplegia, or a psychiatric disorder (e.g., resistant depression, treatment resistant depression, schizophrenia, and / or treatment resistant schizophrenia). In some embodiments, a mutant SPTLC2 gene is associated with PD, AD, ALS, or HSAN-1. In some embodiments, a mutant SPTLC2 gene comprises one or more nucleotide substitutions, insertions, and / or deletions relative to a wild type SPTLC2 gene (or mRNA encoded by a wild type SPTLC2 gene) that are associated with ALS in a subject. Amyotrophic lateral sclerosis (ALS) is a fatal, rapidly progressive neurodegenerative disease. In a subject having a mutated SPTLC2 gene, degeneration of upper and lower motor neurons results in spasticity, weakness, muscle atrophy, and eventually death due to involvement of the muscles of respiration. Most cases present with weakness in the limbs, but up to one-third may begin with bulbar symptoms. Cognitive and behavioral symptoms may include pseudobulbar affect and behavioral-variant frontotemporal dementia. In some embodiments, a mutant SPTLC2 gene comprising a c.203T>G mutation is associated with ALS in a subject, such as a juvenile form of ALS. In some embodiments, a mutant SPTLC2 gene comprising a c.778G>A mutation is associated with ALS in a subject, such as a juvenile form of ALS. In some embodiments, a mutant SPTLC2 gene comprises one or more nucleotide substitutions, insertions, and / or deletions relative to a wild type SPTLC2 gene (or mRNA encoded by a wild type SPTLC2 gene) that are associated with HSAN-1 in a subject. In a subject having a mutated SPTLC2 gene, HSAN-1 can result in a peripheral neuropathy (e.g., motor neuropathy, sensory neuropathy, autonomic nerve neuropathy, combination neuropathies, inherited or acquired peripheral neuropathies, such as diabetic neuropathy, chemotherapy- induced neuropathy or other forms of toxic peripheral neuropathy, etc.) which manifests as, in some instances, severe loss of sensation to temperature, pressure and pain. In some instances, long-term cases of HSAN1 leads to painless injuries, chronic skin ulcers, bone destruction, bone infections, amputation of digits, and motor dysfunction. In some embodiments, a mutant SPTLC2 gene comprising a c.529A > G mutation is associated with HSAN-1 in a subject. In some embodiments, a mutant SPTLC2 gene comprising a c.544G>C mutation is associated with HSAN-1 in a subject. In some embodiments, a mutant SPTLC2 gene comprising a c.547C>T mutation is associated with HSAN-1 in a subject. In some embodiments, a mutant SPTLC2 gene comprising a c.1075G>A mutation is associated with HSAN-1 in a subject. In some embodiments, a mutant SPTLC2 gene comprising a c.1145G>T mutation is associated with 12155096.1 HSAN-1 in a subject. In some embodiments, a mutant SPTLC2 gene comprising a c.1510A>T mutation is associated with HSAN-1 in a subject. In some embodiments, an isolated nucleic acid (e.g., an RNA-processing modulator) described herein is administered to a subject (e.g., a mammalian subject, such as a human subject) having or suspected of having one or more mutations in a SPTLC2 gene. In some embodiments, the subject has or is suspected of having a disease or disorder described herein. In some embodiments, the disease or disorder is PD, AD, ALS, or HSAN-1. In some embodiments, administration of an isolated nucleic acid described herein is capable of modulating one or more non-deoxy-SLs (e.g., sphinganine, sphingosine, and / or ceramide) and / or one or more deoxy-SLs (e.g., deoxy-sphinganine and / or deoxy-ceramide) in a subject (e.g., a mammalian subject, such as a human subject). In some embodiments, administration of the isolated nucleic acid to the subject modulates the levels of one or more non-deoxy-SLs (e.g., sphinganine, sphingosine, and / or ceramide) and / or one or more deoxy-SLs (e.g., deoxy-sphinganine and / or deoxy- ceramide) in a biological sample obtained from the subject. In some embodiments, the biological sample is cerebrospinal fluid (CSF), plasma, or spinal cord tissue. Example 4: ASOs targeting SPTLC2 This example describes design of RPMs (e.g., ASOs) that target human SPTLC2. In the context of diseases associated with dysregulation of L-serine biosynthesis, it is desirable to decrease protein levels of SPTLC2 (e.g., mutant SPTLC2), for example by decreasing translation of SPTLC2 mRNA or decreasing activity or function of SPT. In some embodiments, ASOs are designed to target regions of SPTLC2 mRNA that will result in decreased translation of SPTLC2 protein or SPT and / or decreased activity of SPTLC2 protein or SPT. Expression profiling was performed on human Serine palmitoyltransferase long chain base subunit 2 (SPTLC2) (e.g., NCBI Ref. Seq. NM_004863.4). FIG.2A shows bulk tissue gene expression of human SPTLC2. Data indicate SPTLC2 mRNA is ubiquitously expressed. The type and number of SPTLC2 mRNA splice variants was investigated (FIG.2B). Data indicate eight isoforms of SPTLC2 protein are encoded by SPTLC2 splice variants. FIG.2C shows representative data for exon expression analysis of human SPTLC2 splice variants in CNS tissue. Data indicate full length SPTLC2 is the most commonly expressed isoform in brain tissue. FIG.2D shows human SPTLC2 expression in CNS cells in samples from control and Alzheimer’s disease (AD) subjects indicating dysregulated expression of SPTLC2 in brain cells 12155096.1 of AD subjects. Table 1 shows representative RPM (e.g., antisense oligonucleotide) sequences targeting mRNA encoded by SPTLC2. 12155096.1

Claims

CLAIMS 1. An isolated nucleic acid that comprises a region of complementarity with a human SPTLC2 mRNA transcript, has at least 60% identity to a nucleic acid the nucleic acid sequence set forth in any one of SEQ ID NOs: 1-109, and upon binding to the mRNA transcript decreases translation of functional SPTLC2 protein from the mRNA transcript.

2. The isolated nucleic acid of claim 1, wherein the isolated nucleic acid comprises RNA.

3. The isolated nucleic acid of claim 1 or 2, wherein the isolated nucleic acid is an antisense oligonucleotide.

4. The isolated nucleic acid of any one of claims 1 to 3, comprising or consisting of between 10 and 40 nucleotides.

5. The isolated nucleic acid of claim 4, wherein the isolated nucleic acid comprises or consists of between 18 and 25 nucleotides.

6. The isolated nucleic acid of any one of claims 1 to 5, wherein the isolated nucleic acid comprises one or more chemical modifications.

7. The isolated nucleic acid of claim 6, wherein the one or more chemical modifications comprise one or more nucleoside modifications and / or one or more sugar-phosphate backbone modifications.

8. The method of claim 7, wherein the one or more nucleoside modifications comprises a 2'- O-methyl (2'-OMe) modification, a 2'-O-MOE modification, a 2'-O-fluoro modification, or a locked nucleic acid (LNA) modification.

9. The method of claim 7 or 8, wherein the one or more sugar-phosphate backbone modifications comprises a phosphorothioate backbone modification. 12155096.

110. The isolated nucleic acid of any one of claims 1 to 9, wherein the isolated nucleic acid is fully chemically modified.

11. The isolated nucleic acid of any one of claims 1 to 10, wherein the isolated nucleic acid comprises one or more deoxyribonucleotides, optionally wherein the isolated nucleic acid is a gapmer.

12. The isolated nucleic acid of any one of claims 1 to 11, wherein the region of complementarity is located in an untranslated region (UTR) of the SPTLC2 mRNA transcript.

13. The isolated nucleic acid of claim 12, wherein the untranslated region comprises a 5' UTR, an intron, or a 3' UTR of the SPTLC2 mRNA transcript.

14. The isolated nucleic acid of any one of claims 1 to 11, wherein the region of complementarity is located in a protein coding region of the SPTLC2 mRNA transcript.

15. The isolated nucleic acid of any one of claims 1 to 11, wherein the region of complementarity is located on an intron-exon boundary of the SPTLC2 mRNA transcript.

16. The isolated nucleic acid of any one of claims 1 to 15, wherein the region of complementarity comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleotides of the sequence set forth in SEQ ID NO:

110.

17. The isolated nucleic acid of any one of claims 1 to 16, comprising the nucleotide sequence set forth in any one of the nucleotide sequences set forth in Table 1.

18. A composition comprising the isolated nucleic acid of any one of claims 1 to 17, and a pharmaceutically acceptable excipient.

19. A method for increasing lipid biosynthesis in a cell or subject, the method comprising administering the isolated nucleic acid of any one of claims 1 to 17 or the composition of claim 18 to a subject in need thereof. 12155096.

120. The method of claim 19, wherein the subject is characterized as having low serine.

21. The method of claim 19 or 20, wherein the subject comprises one or more mutations in a gene that is associated with lipid biosynthesis, optionally wherein the gene is SPTLC2.

22. The method of any one of claims 19 to 21, wherein the cell is a human cell, optionally wherein the cell is in a subject.

23. The method of any one of claims 19 to 22, wherein the subject is a human subject.

24. The method of any one of claims 19 to 23, wherein the subject has or is suspected of having a disease or disorder associated with dysregulation of L-serine biosynthesis.

25. The method of claim 24, wherein the disease or disorder is retinal diseases (e.g., MacTel2 and Age-related macular degeneration (AMD) such as AMD with geographic atrophy), HSAN1 (e.g., HSAN1(a)), diabetic retinopathy, a peripheral neuropathy (e.g., motor neuropathy, sensory neuropathy, autonomic nerve neuropathy, combination neuropathies, inherited or acquired peripheral neuropathies, such as diabetic neuropathy, chemotherapy-induced neuropathy or other forms of toxic peripheral neuropathy, etc.), neurodegeneration (e.g., Parkinson’s disease (PD), Friedreich’s ataxia, motor neuron disease, Alzheimer’s disease (AD), amyotrophic lateral sclerosis (ALS), etc.), spastic paraplegia, or a psychiatric disorder (e.g., resistant depression, treatment resistant depression, schizophrenia, and / or treatment resistant schizophrenia).

26. The method of any one of claims 19 to 25, wherein the administration is systemic administration, optionally wherein the systemic administration comprises intravenous injection.

27. The method of any one of claims 19 to 25, wherein the administration comprises direct administration to a target tissue of the subject, optionally wherein the direct administration comprises direct injection to the central nervous system (CNS), direct injection to the peripheral nervous system, or direct administration to the eye. 12155096.

128. The method of claim 27, wherein the administration comprises placing the subject in a Trendelenburg position during the administration.

29. A method for decreasing deoxy-sphingolipid (deoxy-SL) biosynthesis in a cell or subject, the method comprising administering the isolated nucleic acid of any one of claims 1 to 17, or the composition of claim 18, to a subject in need thereof.

30. The method of claim 29, wherein the subject is characterized as having low serine.

31. The method of claim 29 or 30, wherein the subject comprises one or more mutations in a gene that is associated in L-serine biosynthesis, optionally wherein the gene is SPTLC2.

32. The method of any one of claims 29 to 31, wherein the cell or subject is a human cell or subject.

33. The method of any one of claims 29 to 32, wherein the subject has or is suspected of having a disease or disorder associated with dysregulation of L-serine metabolism.

34. The method of claim 33, wherein the disease or disorder is retinal diseases (e.g., MacTel2 and Age-related macular degeneration (AMD) such as AMD with geographic atrophy), HSAN1 (e.g., HSAN1(a)), diabetic retinopathy, a peripheral neuropathy (e.g., motor neuropathy, sensory neuropathy, autonomic nerve neuropathy, combination neuropathies, inherited or acquired peripheral neuropathies, such as diabetic neuropathy, chemotherapy-induced neuropathy or other forms of toxic peripheral neuropathy, etc.), neurodegeneration (e.g., Parkinson’s disease (PD), Friedreich’s ataxia, motor neuron disease, Alzheimer’s disease (AD), amyotrophic lateral sclerosis (ALS), etc.), spastic paraplegia, or a psychiatric disorder (e.g., resistant depression, treatment resistant depression, schizophrenia, and / or treatment resistant schizophrenia).

35. The method of any one of claims 29 to 34, wherein the administration is systemic administration, optionally wherein the systemic administration comprises intravenous injection. 12155096.

136. The method of any one of claims 29 to 34, wherein the administration comprises direct administration to the central nervous system (CNS), optionally wherein the direct administration comprises direct injection to the CNS.

37. The method of claim 36 wherein the administration comprises placing the subject in a Trendelenburg position during the administration.

38. A method for preventing or treating a disease or disorder associated with dysregulation of L-serine biosynthesis in a subject in need thereof, the method comprising administering to the subject the isolated nucleic acid of any one of claims 1 to 17, or the composition of claim 18 to a subject in need thereof.

39. The method of claim 38, wherein the subject is a human.

40. The method of claim 38 or 39, wherein the disease or disorder is retinal diseases (e.g., MacTel2 and Age-related macular degeneration (AMD) such as AMD with geographic atrophy), HSAN1 (e.g., HSAN1(a)), diabetic retinopathy, a peripheral neuropathy (e.g., motor neuropathy, sensory neuropathy, autonomic nerve neuropathy, combination neuropathies, inherited or acquired peripheral neuropathies, such as diabetic neuropathy, chemotherapy-induced neuropathy or other forms of toxic peripheral neuropathy, etc.), neurodegeneration (e.g., Parkinson’s disease (PD), Friedreich’s ataxia, motor neuron disease, Alzheimer’s disease (AD), amyotrophic lateral sclerosis (ALS), etc.), spastic paraplegia, or a psychiatric disorder (e.g., resistant depression, treatment resistant depression, schizophrenia, and / or treatment resistant schizophrenia).

41. The method of any one of claims 38 to 40, wherein the administration comprises direct administration to a target tissue of the subject, optionally wherein the direct administration comprises direct injection to the central nervous system (CNS), direct injection to the peripheral nervous system (PNS), or direct administration to the eye. 12155096.1

Citation Information

Patent Citations

  • Target sequences and methods to identify the same, useful in treatment of neurodegenerative diseases

    US20110105587A1

  • Nucleic acids containing single nucleotide polymorphisms and methods of use thereof

    WO2001047944A2