Non-viral nanoparticle formulations for ocular gene delivery

Abstract

Methods for treating a disease or condition of an eye comprising administering to the suprachoroidal space of the eye a particle composition comprising a poly(beta-amino ester) (PBAE) polymer, DNA comprising at least one gene of interest, wherein the polymer to the DNA has a mass ratio between about 10:1 to about 50:1.

Description

[0001] NON-VIRAL NANOPARTICLE FORMULATIONS FOR OCULAR GENE DELIVERY CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 63 / 611,804, filed December 19, 2023, which is incorporated herein by reference in its entirety. STATEMENT OF GOVERNMENTAL INTEREST This invention was made with Government support under grant no. EY031097, awarded by the National Institutes of Health. The Government has certain rights in the invention. SEQUENCE LISTING The text of the computer readable sequence listing filed herewith, titled “JHU_40111_601_SequenceListing.xml”, created December 19, 2024, having a file size of 1,996 bytes, is hereby incorporated by reference in its entirety. BACKGROUND Ocular gene transfer can be achieved by subretinal injection of expression constructs packaged in adeno-associated viral (AAV) vectors or lentiviral vectors. This approach requires an operative procedure including vitrectomy and subretinal injection of the vector, which is invasive and carries a 1% risk of retinal detachment. Campochiaro et al., 2016. Intravitreous injection of lentiviral vectors, however, is not feasible because of poor lentiviral infection of cells lining the vitreous cavity. Intravitreous injection of AAV vectors results in transduction of ganglion cells only in parts of the retina where the internal limiting membrane (ILM) is thin, Vandenberghe et al., 2011, which results in transgene expression several orders of magnitude less than that achieved with subretinal injection of the same amount of AAV vector. Changes in vector capsids can improve transduction after intravitreous injection of AAV vectors, but it is not yet clear if expression will be sufficient for clinical application. Pre-existent serum antibodies to the AAV serotype injected into the vitreous may reduce expression, but does not reduce expression if the AAV vector is injected into the subretinal space. Heier et al., 2017; Li et al., 2008; Kotterman et al., 2014. Limitations of the use of viruses ocular gene transfer also include limited cargo size capacity to deliver large genes, difficult and expensive manufacture, and ineffectiveness of repeated administrations due to immunogenicity. SUMMARY In some aspects, the presently disclosed subject matter provides a method for treating a disease or condition of an eye in a subject in need of treatment thereof, the method comprising administering to the suprachoroidal space of the eye a particle composition comprising: (a) a poly(beta-amino ester) (PBAE) of formula (I) or formula (II): selected from 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; m2 is an integer selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, and 20; q is an integer selected from 0 or 1; wherein –(CH2)m1-(C=C)q-(CH2)m2-CH3comprises a hydrophobic sidechain; R comprises a divalent radical comprising a biodegradable ester linkage and / or a bioreducible disulfide linkage; R’ is hydrophilic sidechain comprising a monovalent radical derived from a hydrophilic amine monomer; R” is monovalent radical derived from an amine-containing end capping group; and pharmaceutically acceptable salts thereof; and (b) DNA comprising at least one gene selected from ABCA4, MYO7A, USH1C, CDH23, PCDH15, SANS, CIB2, USH2A, GPR98, WHRN, CLRN1, TIMP3, PEDF, Prph2, BPDE,Bcl2, FGF-2, CNTF, Mertk, GUCY2D, AIPL1, RPGRIP, RPE65, LCA6, LCA10, a gene encoding an anti-VEGF protein, endostatin, angiostatin, and protein engineered mimetics, antibodies, and protein fragments thereof, and a gene encoding an anti-complement protein and protein engineered mimetics, antibodies, and protein fragments thereof; wherein the polymer to the DNA has a mass ratio between about 10:1 to about 50:1. In some aspects, n and m are each independently an integer having a range from 1 to 10,000, 1 to 1,000, 1 to 100, 1 to 30, 1 to 20, 1 to 15, and 1 to 10, 1 to 5, 1 to 4, 1 to 3, 1 to 2, and 1. In some aspects, R is selected from the group consisting of:

[0002] ( 9); wherein each p1, p2, and t is independently an integer selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. In some aspects, R’ is selected from the group consisting of: In some aspects, R” is selected from the group consisting of:

[0003]

[0004] In some aspects, –(CH2)m1-(C=C)q-(CH2)m2-CH3is selected from the group consisting of: In some aspects, the particle composition further comprises lipid-polyethylene glycol (PEG). In certain aspects, the lipid-PEG is selected from the group consisting of 1,2- dimyristoyl-rac-glycero-3-methoxypolyethylene glycol 2000 (DMG-PEG2k) and C18- PEG2k. In particular aspects, the particle composition comprises a mass percent of lipid PEG from about 2 wt% to about 10 wt%, including about 2, 3, 4, 5, 6, 7, 8, 9, and 10 wt%. In some aspects, the method comprises administering to the suprachoroidal space of the eye a particle composition comprising: (a) a poly(beta-amino ester) (PBAE) polymer of formula (I): (I); wherein: n is an integer from 1 to 10,000; R is selected from ; R’ is selected from ( ), ( ), and (S4); R” is selected from (E6) and (E7); and pharmaceutically acceptable salts thereof; and (b) DNA comprising at least one gene selected from ABCA4, MYO7A, USH1C, CDH23, PCDH15, SANS, CIB2, USH2A, GPR98, WHRN, CLRN1, TIMP3, PEDF, Prph2, BPDE,Bcl2, FGF- 2, CNTF, Mertk, GUCY2D, AIPL1, RPGRIP, RPE65, LCA6, LCA10, a gene encoding an anti-VEGF protein, endostatin, angiostatin, and protein engineered mimetics, antibodies, and protein fragments thereof, and a gene encoding an anti-complement protein and protein engineered mimetics, antibodies, and protein fragments thereof; wherein the PBAE to DNA has a mass ratio between about 10:1 to about 50:1. In some aspects, the anti-VEGF protein is selected from VEGFR1 / sFLT-1, VEGFR2, and VEGFR3. In some aspects, the DNA is selected from a minicircle plasmid DNA, a nanoplasmid DNA, and a close ended DNA. In certain aspects, the DNA is: (a) substantially free of bacterial elements; (b) about 1-4kbp, without the gene included; and / or, (c) substantially free of unmethylated CpG sequences. In some aspects, the DNA includes a CAG promoter and one or more repeats of the 72-bp region, ggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaacca (SEQ ID NO: 1), of an SV40 enhancer. In certain aspects, the method comprises two or more repeats of the 72-bp region, ggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaacca (SEQ ID NO: 1), of an SV40 enhancer. In particular aspects, the DNA comprises a nanoplasmid comprising a gene of interest driven by a CAG promoter and one or more repeats of the 72- bp region, ggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaacca (SEQ ID NO: 1), of an SV40 enhancer, wherein the DNA is substantially free of bacterial genetic elements and unmethylated CpG sequences. In some aspects, the PBAE of formula (I) is 457. . In some aspects, the PBAE of formula (I) is 447: . In some aspects, the PBAE of formula (I) or formula (II) has a molecular weight having a range selected from between about 5,000 to about 40,000 Da, between about 5,000 to about 10,000 Da, between about 10,000 Da to about 20,000 Da, between about 20,000 Da to about 30,000 Da, and about 10,000 Da. In some aspects, the particle composition has a size having a range selected from between about 50 nm to about 800 nm, about 100 nm to about 500 nm, about 100 nm to about 300 nm, and about 200 nm. In some aspects, a mass ratio of the polymer to the DNA has a range between about 10:1 to about 50:1, about 15:1 to about 40:1, between about 20:1 to about 30:1, about 20:1, about 25:1, and about 30:1. In some aspects, the particle composition is administered to the suprachoroidal space of the eye of the subject using a specialized insertion tip, which may range from about 1-5 mm and the gauge may be about 25-35 G, with or without injection pumps. In some aspects, the particle composition is administered to the suprachoroidal space of the eye of the subject via more than one injection at one or more injection sites. In certain aspects, the more than one injections are administered during a single session. In certain aspects, the single session comprises an outpatient visit. In certain aspects, the method further comprises a waiting period between the more than one injections. In certain aspects, the more than one injections are made via an autoinjector or injection pump. In some aspects, the DNA has a concentration having a range between about 0.1 mg / mL to about 2.0 mg / mL, between about 0.2 mg / mL to about 1.0 mg / mL, between about 0.2 mg / mL to about 0.5 mg / mL, and between about 0.3 mg / mL to about 0.4 mg / mL. In some aspects, the method comprises an administration volume to the suprachoroidal space having a range between about 20 µL to 500 µL, between about 50 µL to 300 µL, and between about 50 µL to 100 µL. In some aspects, the particle composition further comprises one or more of a sugar, a sugar alcohol, a salt, MgCl2, a buffer, a cryoprotectant, an excipient, and combinations thereof. In certain aspects, the sugar is selected from the group consisting of glucose, fructose, sorbitol, mannitol, sucrose, trehalose, and raffinose. In particular aspects, the sugar is selected from sucrose and trehalose. In certain aspects, the one or more sugar alcohols comprise sorbitol. In some aspects, the disease or condition of an eye is selected from the group consisting of Stargardt Disease, Usher Syndrome, Neovascular AMD, and other diseases that cause choroidal neovascularization, Diabetic retinopathy, Retinal vein occlusion, Retinitis pigmentosa, Leber congenital amaurosis, and Geographic atrophy. Certain aspects of the presently disclosed subject matter having been stated hereinabove, which are addressed in whole or in part by the presently disclosed subject matter, other aspects will become evident as the description proceeds when taken in connection with the accompanying Examples and Figures as best described herein below. BRIEF DESCRIPTION OF THE FIGURES The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. Having thus described the presently disclosed subject matter in general terms, reference will now be made to the accompanying Figures, which are not necessarily drawn to scale, and wherein: FIG.1A, FIG. 1B, and FIG. 1C show examples of the characterization of the presently disclosed PBAE nanoparticles (NP). PBAE NPs were prepared by being lyophilized, stored at −20°C, and then resuspended in sterile water as they were for in vivo studies. (FIG.1A) NPs were assessed for hydrodynamic diameter (particle size) and zeta potential (ZP) (surface charge) in aqueous conditions via DLS. Bars represent the mean ± SE of the z-average diameter and the zeta potential from three independently prepared batches. (FIG.1B) NP size and shape were visualized via TEM. (FIG.1C) Gel electrophoresis showed complete binding of DNA in the NPs; FIG.2A, FIG. 2B, and FIG. 2C demonstrate suprachoroidal injection of poly(beta- amino ester) (PBAE) nanoparticles (NPs) containing a green fluorescent protein (GFP) expression plasmid in minipigs causes widespread expression of GFP in photoreceptors. (FIG.2A) Schematic showing the manner in which transverse sections were used to localize expression relative to the equator of the eye. (FIG. 2B) Two weeks after suprachoroidal injection of 50 µL of PBAE NPs containing 19.2 µg of pCAG-GFP-Z1 in a Göttingen minipig, transverse ocular sections 2.87-mm anterior to the equator, at the equator, or 8.12-mm posterior to the equator each showed GFP fluorescence around the entire circumference of the eye. (FIG. 2C) At higher magnification, immunofluorescent staining for GFP demonstrated that the fluorescence is due to expression of GFP in photoreceptor inner and outer segments; FIG.3A, FIG. 3B, FIG. 3C, FIG. 3D, FIG.3E, and FIG.3F show a comparison of GFP expression two weeks after suprachoroidal injection of 50, 100, or 200 µL of NP containing pCAG-GFP-Z1. Yucatan minipigs were given a suprachoroidal injection of 50, 100, or 200 µL of PBAE NP containing 0.38-µg / µL pCAG-GFP-Z1. Two weeks after injection of each of the volumes, GFP fluorescence was seen around the entire circumference of the eye sections at the equator and those posterior to the equator; FIG.4A, FIG. 4B, FIG. 4C, and FIG. 4D show GFP protein levels in different regions of retina after a single suprachoroidal injection of 50 µL of NP containing 19.2-µg pCAG-GFP-Z1. Three Yucatan minipigs were given a suprachoroidal injection of 50 µL of PBAE NP containing pCAG-GFP-Z1. Two weeks after injection, GFP protein was measured by ELISA in punches of retina. The level of GFP in pg / mg total protein is shown at sample locations in each of the three eyes injected (FIG. 4A-FIG.4C). A dot plot of all values in each eye shows the mean and illustrates in-eye and between-eye variability (FIG. 4D). ND = not detectable; NC = not collected; FIG.5A, FIG. 5B, FIG. 5C, FIG. 5D, FIG.5E, and FIG.5F show a comparison of GFP expression at two and twelve weeks after suprachoroidal injection of 50, 100, or 200 µL containing pCAG-GFP-Z1. Yucatan minipigs were given a suprachoroidal injection of 50, 100, or 200 µL of PBAE NP containing 0.38 µg / µL of pCAG-GFP-Z1. At two weeks (three eyes for each volume) or twelve weeks (two eyes for each volume) after injection of 50 µL (FIG.5A and FIG. 5B), 100 µL (FIG.5C and FIG.5D), or 200 µL (FIG. 5E and FIG. 5F) of PBAE NP, GFP protein was measured by ELISA in punches of retina (FIG.5A, FIG. 5C, FIG. 5E) or RPE / choroid (FIG. 5B, FIG. 5D, FIG.5F) at locations designated in key. Dot plots of all measurements at each dose / time point tested illustrate the trend toward higher mean GFP protein with less variability in retina (FIG. 5E) and RPE / choroid (FIG.5F) twelve weeks after injection of 200 µL of PBAE NP containing 76.8-µg pCAG-GFP-Z1; FIG.6A, FIG. 6B, FIG. 6C, FIG. 6D, FIG.6E, and FIG.6F show the effect of minimizing CpG bacterial sequences in GFP expression plasmid. Yucatan minipigs (n=3) were given a suprachoroidal injection of 50 µL of PBAE NP containing 19.2 µg pCAG- GFP-nP in which bacterial sequences had been minimized. Two weeks after injection, one eye of each pig was used for localization of GFP expression in serial ocular frozen sections and the fellow eyes were used to measure GFP expression by ELISA in retina and RPE / choroid at seven locations. A representative ocular section anterior to the equator showed GFP fluorescence around the entire circumference of the eye (FIG.6A) and high magnification showed GFP expression in cells of the inner retina, as well as in photoreceptors (FIG.6B). A section 7.49-mm posterior to the equator also showed GFP fluorescence around the entire circumference of the eye (FIG.6C) and high magnification showed GFP fluorescence predominantly in photoreceptors, but also in some inner retinal cells (FIG. 6D). The mean level of GFP protein in the retina (FIG.6E) or the RPE choroid (FIG.6F) calculated from seven measurements in each of three eyes was 219.2- and 649.8- pg / mg total protein after injection of pCAG-GFP-nP compared with 51.2- and 68.2-pg / mg after injection of pCAG-GFP-Z1. Due to variability, differences were not statistically significant. *p=0.26; **p=0.08 by linear mixed effects models; FIG.7A, FIG. 7B, FIG. 7C, FIG. 7D, FIG.7E, and FIG.7F demonstrate that three suprachoroidal injections PBAE NPs containing pCAG-GFP-nP at different locations reduces variability of GFP expression throughout retina and RPE / choroid. The level of GFP protein (pg / mg total protein) measured at seven locations in the retina (FIG.7A) and RPE choroid (FIG.7B) two weeks after a single suprachoroidal injection at 12:00 of 50 µL of PBAE NPs containing 19.2-µg pCAG-GFP-nP in three eyes is compared with the level of GFP protein measured at the same seven locations in the retina (FIG.7C) and RPE choroid (FIG.7D) two weeks after three injections (one superiorly, one temporally and one inferiorly) of 50 µL of PBAE NPs containing 19.2-µg pCAG-GFP-nP. Dot plots of all GFP protein levels at all locations in each eye, show that compared with eyes given a single injection, those given a triple injection had a marked reduction in coefficient of variation (CV) of GFP levels in retina (FIG.7E) and RPE / choroid (FIG. 7F); FIG.8 is a graph demonstrating in vivo suprachoroidal gene delivery in rats using PBAEs having different structures (i.e., comprising different combinations of monomers). Transfection (expressed as GFP transgene measured in pg per mg of total protein) is high for only two PBAEs evaluated, e.g., 4-5-7 and 4-4-7. In contrast, transfection was low in all other PBAEs tested, including two PBAEs that differ only with respect to the number of carbon atoms between the acrylate groups in the backbone monomer and between the amine and alcohol groups of the sidechain monomer, e.g., 5-3-7, or a difference in the identity of the end group, e.g., 4-5-6. Data from rats; FIG.9 demonstrates that non-viral in vivo gene delivery transfection via suprachoroidal injection of 4-5-7 nanoparticles was found to be superior head-to-head vs. subretinal injection and intravitreal injection. This example importantly demonstrates that the PBAE-based nanoparticles of the instant Application penetrate through the choroid and retinal pigment epithelium (RPE) to reach photoreceptors in the retina, where they have robust expression (as measured by transgene GFP). This observation was unexpected as it was previously thought that non-viral nanoparticles were not able to penetrate through the retina, leading to intracellular delivery to photoreceptors and delivery to the nucleus in these non-dividing cells to achieve the exogenous transgene expression observed. Data from rats; FIG.10 shows that labeled PBAE 4-5-7 nanoparticles were found to quickly penetrate through the RPE and retina following suprachoroidal injection (images are 6-12 hours after injection). The nanoparticles quickly leave the suprachoroidal space to pass through the choroid and RPE to reach photoreceptors. They are then taken up the photoreceptors for subsequent intracellular release of the encapsulated DNA and downstream gene expression. Cy3-labeled DNA demonstrates red fluorescence where it has been carried and delivered by the PBAE-based nanoparticles. Data from rats; FIG.11 shows that suprachoroidal injection of PBAE 4-5-7 nanoparticles leads to surprisingly robust gene delivery transfection and expression of the GFP transgene through the choroid and RPE to reach all the way around the retina, 360 degrees, and reaching to the posterior retina. Data from large mini pig eyes. Repeated doses (top) of the PBAE nanoparticles also are well tolerated. This characteristic of the PBAE nanoparticles of the instant Application is in contrast to viral transfection in which repeated dosing can lead to toxicity; FIG.12 shows suprachoroidal injection of free Cy3 dye labeled plasmid DNA (top) compared to suprachoroidal injection of the same dose of nanoparticle (NP)-encapsulated Cy3 dye labeled plasmid DNA (bottom). The DNA encapsulated by NPs is able to show: (i) penetration into the retina, rather than just residing in the suprachoroidal space and (ii) durability in the retina, rather than being quickly cleared away. The free DNA molecule in the suprachoroidal space (such as by a direct injection or release from a device) is not able to achieve what the combination of suprachoroidal injection plus PBAE-based nanoparticles is able to achieve as shown here, a combination of penetration and durability. These data show that naked plasmid is seen in the suprachoroidal space, but not within cells, one hour after injection and very faintly three hours after injection and not at six or twenty-four hours after injection. The labeled DNA in PBAE-based nanoparticles is already within photoreceptors and RPE one hour after injection and remains in the photoreceptors for at least twenty-four hours (longest time point analyzed); FIG.13A, FIG.13B, FIG. 13C, FIG. 13D, FIG.13E, and FIG. 13F show appearance of the retina was unchanged after suprachoroidal injection of PBAE nanoparticles containing GFP expression plasmids. Fundus photos were obtained prior to and 2 weeks after suprachoroidal injection of PBAE nanoparticles containing 1 µg of a GFP expression plasmid in a Gottingen minipig (FIG.13A and FIG. 13B) or a Yucatan minipig (FIG.13C and FIG. 13D). Two weeks after suprachoroidal injection of PBAE nanoparticles containing 1 µg of a GFP expression plasmid, an ocular section showed artifactual separation of the retina from the retinal pigmented epithelium (RPE) and both the retina and RPE appear normal (FIG. 13E). Higher magnification shows normal retinal structure and no evidence of inflammatory cells (FIG. 13F); FIG.14A, FIG.14B, FIG. 14C, FIG. 14D, FIG.14E, and FIG. 14F show a collection of retina and RPE / choroid samples for measurement of GFP protein. (FIG.14A and FIG. 14B) Schematics showing the numbering system used to identify the location of samples: 1 posterior nasal, 2 posterior temporal, 3 temporal, 4 superior nasal, 5 superior temporal, 6 inferior nasal, 7 inferior temporal. (FIG. 14C) A minipig eyecup with the anterior segment and vitreous removed appears black due to the pigment of the RPE seen through the translucent retina. (FIG. 14D) Minipig eyecup after removal of 7 retinal samples with a 7- mm trephine showing the remaining darkly pigmented RPE. (FIG.14E and FIG. 14F) Right and left minipig eyecups after removal of RPE / choroid samples shows the remaining sclera; FIG.15A and FIG. 15B demonstrate that plasmid cargo in nanoparticles is quantifiable via nanoparticle-tracking analysis (NTA). (FIG. 15A) the number-weighted nanoparticle size distribution was measured by NTA. (FIG.15B) from the corresponding calculated volumetric distribution, the number of plasmids per particle was quantified using previously described methods. Bhise et al., 2012. Nanoparticle-tracking analysis (NTA) showed that particles had a number-weighted average diameter of 100 ± 10 nm (mean ± SEM of three replicates) and a volume-weighted diameter of 140 ± 20 nm. This measurement corresponds to an average of 250 ± 20 kbp encapsulated in each particle, or 80 ± 5 plasmids of 3151 bp; and FIG.16A and FIG. 16B demonstrates the fluorescence observed 2 weeks after suprachoroidal injection of 50 μL of PBAE NP containing 19.2 μg pCAG-GFP-nP is due to expressions of GFP and not autofluorescence. Sections from the same eye shown in FIG. 6 were immunohistochemically stained for GFP. The fluorescence seen in retina (FIG.16A) corresponds to the staining for GFP (FIG.16B). DETAILED DESCRIPTION The presently disclosed subject matter now will be described more fully hereinafter with reference to the accompanying Figures, in which some, but not all embodiments of the inventions are shown. Like numbers refer to like elements throughout. The presently disclosed subject matter may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein; rather, these embodiments are provided so that this disclosure will satisfy applicable legal requirements. Indeed. many modifications and other embodiments of the presently disclosed subject matter set forth herein will come to mind to one skilled in the art to which the presently disclosed subject matter pertains having the benefit of the teachings presented in the foregoing descriptions and the associated Figures. Therefore, it is to be understood that the presently disclosed subject matter is not to be limited to the specific embodiments disclosed and that modifications and other embodiments are intended to be included within the scope of the appended claims. In some embodiments, the presently disclosed subject matter provides non-viral biodegradable polymer nanoparticles capable of high levels of exogenous gene expression, wide biodistribution throughout the retina, long durability of action, ability to be re-dosed with additive effect on efficacy, and general safety in the eye and other tissues. Shen et al., 2020. In certain embodiments, these effects are achieved through suprachoroidal injections. In other embodiments, other routes of administration, such as subretinal injection, are used. Suprachoroidal injections provide a new route of delivery of drugs to the retina. Patel et al., 2011; Patel et al., 2012. The suprachoroidal space is actually a potential space that is expanded when fluid is injected just internal to the sclera. Suprachoroidal injections may have potential advantages over intravitreous injections for some drugs because they may increase delivery to the retina and minimize delivery to anterior structures of the eye. The superiority of suprachoroidal injection for ocular gene transfer is demonstrated, for example, in FIG.9 of the instant application. Particular embodiments of the presently disclosed nanoparticle formulations include: (1) design of biodegradable polymer(s) and biomaterials that form the nanoparticle; (2) design of gene(s) of interest to be expressed as treatment corresponding to particular ocular diseases; (3) design of DNA vectors, including the promoter / enhancer to drive expression; (4) design of excipients that can improve the transport, transfection, and / or stability of the nanoparticle formulations; and (5) modes of administration, including a device used for administration. In particular embodiments, the presently disclosed subject matter includes: (1) Design of biodegradable polymer(s) and biomaterials that form the nanoparticle In certain embodiments, linear cationic end-modified poly(beta-amino ester)s (PBAEs), including B4-S5-E7 and B4-S4-E7, are used at weight ratios between about 10 to about 50 mass polymer to mass DNA (mass polymer:mass DNA). In other embodiments, other linear or branched PBAEs can be used. In certain embodiments, lipophilic hybrid PBAEs that have both hydrophobic alkyl side chains of at least eight carbons and hydrophilic side chains that contain at least one oxygen atom in the hydrophilic side chain can be used. In some embodiments, a mixture of polymeric materials is utilized. In some embodiments, a PEGylated polymer or PEGylated lipid is added to the nanoparticle formulation. More particularly, in some embodiments, the presently disclosed subject matter provides non-viral biodegradable polymer nanoparticles capable of high levels of exogenous gene expression, wide biodistribution throughout the retina, long durability of action, ability to be re-dosed with additive effect on efficacy, and general safety in the eye and other tissues. Shen et al., 2020. As used herein, “biodegradable” polymers and / or nanoparticles are those that, when introduced into cells, are broken down by the cellular machinery or by hydrolysis into components that the cells can either reuse or dispose of without significant toxic effect on the cells (i.e., fewer than about 20% of the cells are killed when the components are added to cells in vitro). Such components preferably do not induce inflammation or other adverse effects in vivo. In some instances, the chemical reactions relied upon to break down the biodegradable compounds are uncatalyzed. In certain embodiments, the biodegradable polymers and / or nanoparticles comprise a chemical moiety having one or more degradable linkages, such as an ester linkage, a disulfide linkage, an amide linkage, an anhydride linkage, and a linkage susceptible to enzymatic degradation. Representative degradable linkages include, but are not limited to: . In some embodiments, the biodegradable polymer and / or nanoparticle comprises a poly(beta-amino ester) (PBAE). Exemplary PBAEs suitable for use with the presently disclosed subject matter include those disclosed in: U.S. Patent No.9,884,118 for Multicomponent Degradable Cationic Polymers, to Green et al., issued February 6, 2018; U.S. Patent No.9,802,984 for Biomimetic Peptide and Biodegradable Delivery Platform for the Treatment of Angiogenesis- and Lymphangiogenesis-Dependent Diseases, to Popel et al., issued October 31, 2017; U.S. Patent No.9,717,694 for Peptide / Particle Delivery Systems, to Green et al., issued August 1, 2017; U.S. Patent No.8,992,991 for Multicomponent Degradable Cationic Polymers, to Green et al., issued March 31, 2015; U.S. Patent Application Publication No. 20180256745 for Biomimetic Artificial Cells: Anisotropic Supported Lipid Bilayers on Biodegradable Micro and Nanoparticles for Spatially Dynamic Surface Biomolecule Presentation, to Meyer et al., published September 13, 2018; U.S. Patent Application Publication No. 20180112038 for Poly(Beta-Amino Ester)- Co-Polyethylene Glycol (PEG-PBAE-PEG) Polymers for Gene and Drug Delivery, to Green et al., published April 26, 2018; U.S. Patent Application Publication No. 20170216363 for Nanoparticle Modification of Human Adipose-Derived Mesenchymal Stem Cells for Treating Brain Cancer and other Neurological Diseases, to Quinones-Hinojosa and Green, published August 3, 2017; U.S. Patent Application Publication No. 20150273071 for Bioreducible Poly (Beta- Amino Ester)s For siRNA Delivery, to Green et al., published October 1, 2015; U.S. Patent No.8,287,849 for Biodegradable Poly(beta-amino esters) and Uses Thereof, to Langer, et al., issued October 16, 2012; International PCT Patent Application Publication No. WO2016154622 for Poly(beta- Amino Ester)-Co-Polyethylene Glycol (PEG-PBAE-PEG) Polymers for Gene and Drug Delivery, to Green et al., published September 29, 2016; International PCT Patent Application Publication No. WO2019070727 for Nonviral Gene Transfer to the Suprachoroidal Space, to Campochiaro et al., published April 11, 2019; International PCT Patent Application Publication No. WO2020077159 for Poly(Beta-Amino Ester) Nanoparticles for the Non-Viral Delivery of Plasmid DNA for Gene Editing and Retinal Gene Therapy, to Green et al., published April 16, 2020; International PCT Patent Application Publication No. WO2020198145 for Gene Delivery Particles to Induce Tumor-Derived Antigen Presenting Cells, to Green, published October 1, 2020; International PCT Patent Application Publication No. WO / 2022 / 067249 for Polymers and Nanoparticle Formulations for Systemic Nucleic Acid Delivery, to Green et al., published March 31, 2022; International PCT Patent Application Publication No. WO / 2022 / 159855 for Photo- Crosslinked Bioreducible Polymeric Nanoparticles for Enhanced RNA Delivery, to Green et al., July 28, 2022; International PCT Patent Application Publication No. WO / 2023 / 056293 for Polymeric Nanoparticle Genetic Vaccines, to Green et al., published April 6, 2023; and International PCT Patent Application Publication No. WO / 2023 / 077150 for Polymers and Nanoparticles for Intramuscular Nucleic Acid Delivery, to Green et al., published May 4, 2023; each of which is incorporated by reference in their entirety. Generally, the presently disclosed multicomponent degradable cationic polymers include a backbone derived from a diacrylate monomer (designated herein below as “B”), an amino-alcohol hydrophilic side-chain monomer (designated herein below as “S”), a hydrophobic side-chain monomer, and an amine-containing endcapping monomer (designated herein below as “E”). The endcapping group structures are distinct and separate from the polymer backbone structures and the side chain structures of the intermediate precursor molecule for a given polymeric material. The presently disclosed PBAE compositions can be designated, for example, as B5- S4-E7 or 547, in which R is B5, R' is S4, and R'' is E7, and the like, where B is the backbone and S is the side chain, followed by the number of carbons in their hydrocarbon chain, e.g., S4 comprises 4 alkylene groups. Endcapping monomers, E, are sequentially numbered according to similarities in their amine structures. Further, in some embodiments, the presently disclosed PBAE includes a hydrophobic side-chain, which is designated SC-XX, with XX being the number of carbon atoms in the chain. In certain embodiments, the presently disclosed subject matter provides a method for treating a disease or condition of an eye in a subject in need of treatment thereof, the method comprising administering to the suprachoroidal space of the eye a particle composition comprising a poly(beta-amino ester) (PBAE) of formula (I): ( ); wherein: n is an integer from 1 to 10,000; Ris selected from ; ;R’ is selected from R” is selected from ( ) ( ); and pharmaceutically acceptable salts thereof. In particular embodiments, the PBAE of formula (I) is 457. In particular embodiments, the PBAE of formula (I) is 447: In some embodiments, other PBAEs can be used. PBAEs suitable for use with the presently disclosed methods can be prepared by condensing acrylate monomers with amine- containing side chain monomers. In some embodiments, the side chain monomers comprise a primary amine, but, in other embodiments, the side chain monomers comprise secondary and tertiary amines. Side chain monomers may further comprise a C1 to C8 linear or branched alkylene, which is optionally substituted. Illustrative substituents include hydroxyl, alkyl, alkenyl, thiol, amine, carbonyl, and halogen. In certain embodiments, the linear and / or branched PBAE polymer has a molecular weight from about 5 kDa to about 50 kDa, in some embodiments, from about 5 kDa to about 40 kDa, in some embodiments, from about 5 kDa to about 30 kDa, in some embodiments, from about 5 kDa to about 25 kDa, in some embodiments, from about 5 kDa to about 20 kDa, in some embodiments, from about 5 kDa to 15 kDa, and in some embodiments, from about 5 kDa to 10 kDa. In some embodiments, the presently disclosed subject matter provides a nanoparticle comprising a PBAE of formula (I) or formula (II): wherein: m and n are each independently an integer from 1 to 10,000; m1 is an integer selected from 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; m2 is an integer selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, and 20; q is an integer selected from 0 or 1; wherein –(CH2)m1-(C=C)q-(CH2)m2-CH3comprises a hydrophobic sidechain; R comprises a divalent radical comprising a biodegradable ester linkage and / or a bioreducible disulfide linkage; R’ is hydrophilic sidechain comprising a monovalent radical derived from a hydrophilic amine monomer; R” is monovalent radical derived from an amine-containing end capping group; and pharmaceutically acceptable salts thereof. In certain embodiments, n and m are each independently an integer having a range from 1 to 10,000, 1 to 1,000, 1 to 100, 1 to 30, 1 to 20, 1 to 15, and 1 to 10, 1 to 5, 1 to 4, 1 to 3, 1 to 2, and 1. In certain embodiments, R is selected from the group consisting of:

[0005] wherein each p1, p2, and t is independently an integer selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. In certain embodiments, R’ is selected from the group consisting of:

[0006] .In certain embodiments, R” is selected from the group consisting of:

[0007]

[0008]

[0009] E E E E E E E E . In certain embodiments, –(CH2)m1-(C=C)q-(CH2)m2-CH3is selected from the group consisting of: . In particular embodiments, R is selected from the group consisting of: ; wherein each p1, p2, and t is independently an integer selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. In particular embodiments, R’ is selected from the group consisting of: . In particular embodiments, R” is selected from the group consisting of:

[0010] . In particular embodiments, –(CH2)m1-(C=C)q-(CH2)m2-CH3is selected from the group consisting of: . In more particular embodiments, the compound of formula (II) comprises a combination of: (a) an R group selected from the group consisting of B5, B7, B9, and BR6; (b) an R’ group selected from the group consisting of S3, S4, S90, and S91; (c) an R” group selected from the group consisting of E1, E6, E7, E27, E31, E33, E39, E49, E56, E58, E63, and E65; and (d) an –(CH2)m1-(C=C)q-(CH2)m2-CH3moiety selected from the group consisting of Sc12, Sc14, Sc16, and Sc18. In particular embodiments, R is:

[0011] . In particular embodiments, R” is: . In particular embodiments, –(CH2)m1-(C=C)q-(CH2)m2-CH3is Sc12. In some embodiments, the nanoparticle further comprises one or more additional compounds selected from formula (I) or formula (II) and / or lipid-polyethylene glycol (PEG). In certain embodiments, the lipid-PEG is selected from the group consisting of 1,2- dimyristoyl-rac-glycero-3-methoxypolyethylene glycol 2000 (DMG-PEG2k) and C18- PEG2k. In particular embodiments, the lipid-PEG comprises DMG-PEG2k. In certain embodiments, the nanoparticle comprises a mass percent of lipid PEG from about 2 wt% to about 10 wt%, including about 2, 3, 4, 5, 6, 7, 8, 9, and 10 wt%. In certain embodiments, a zeta-potential of the nanoparticle varies with a weight percent of lipid-PEG, wherein the zeta-potential has a range of -12 mV to +18 mV, including about -12, -11, -10, -9, -8, -7, -6, -5, -4, -3, -2, -1, 0, +1, +2, +3, +4, +5, +6, +7, +8, +9, +10, +11, +12, +13, +14, +15, +16, +17, and +18 mV, and in some embodiments between -5 mV to +5 mV, including about -5, -4, -3, -2, -1, 0, +1, +2, +3, +4, and +5 mV. In some embodiments, the zeta-potential is measured under an aqueous condition, for example, in 150 mM Phosphate Buffered Saline (PBS). In certain embodiments, the nanoparticle comprises a plurality of nanoparticles having a polydispersity of less than about 0.2, including about 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, and 0.20. In certain embodiments, the particle composition further comprises one or more of a sugar, a salt, a buffer, an excipient, and combinations thereof. In certain embodiments, the one or more excipients include one or more cryoprotectants, one or more sugars or sugar alcohols, MgCl2, and combinations thereof. In particular embodiments, the one or more cryoprotectants comprise a sugar. In more particular embodiments, the sugar is selected from the group consisting of glucose, fructose, sorbitol, mannitol, sucrose, trehalose, and raffinose. In particular embodiments, the one or more sugar alcohols comprise sorbitol. In particular embodiments, the sugar is selected from sucrose and trehalose. In certain embodiments, the nanoparticle is lyophilized. In certain embodiments, the nanoparticle comprises a storable powder. In some embodiments, the nanoparticle has at least one dimension in the range of about 50 nm to about 500 nm, or from about 50 to about 200 nm. Exemplary nanoparticles may have an average size (e.g., average diameter) of about 50, about 75, about 100, about 125, about 150, about 200, about 250, about 300, about 400 or about 500 nm. In some embodiments, the nanoparticle has an average diameter of from about 50 nm to about 500 nm, from about 50 nm to about 300 nm, or from about 50 nm to about 200 nm, or from about 50 nm to about 150 nm, or from about 70 to 100 nm. In embodiments, the nanoparticle has an average diameter of from about 200 nm to about 500 nm. In embodiments, the nanoparticle has at least one dimension, e.g., average diameter, of about 50 to about 100 nm. Nanoparticles are usually desirable for in vivo applications. For example, a nanoparticle of less than about 200 nm will better distribute to target tissues in vivo. In certain embodiments, the nanoparticle has a size between about 100 nm to about 150 nm in diameter, including 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, and 150 nm in diameter. In certain embodiments, the presently disclosed subject matter provides a pharmaceutical formulation comprising one or more nucleic acids and a poly(beta-amino ester) (PBAE) of formula (I) or formula (II) in a pharmaceutically acceptable carrier. As used herein, “pharmaceutically acceptable carrier” is intended to include, but is not limited to, water, saline, dextrose solutions, human serum albumin, liposomes, hydrogels, microparticles and nanoparticles. The use of such media and agents for pharmaceutically active compositions is well known in the art, and thus further examples and methods of incorporating each into compositions at effective levels need not be discussed here. In some embodiments, the presently disclosed subject matter provides a kit comprising one or more of: one or more compounds of formula (I) or formula (II), one or more nucleic acids of interest, optionally one or more lipid PEGs, one or more reagents as necessary, and instructions for use. In certain embodiments, the disclosed kits comprise one or more containers, including, but not limited to a vial, tube, ampule, bottle and the like, for containing the pharmaceutical composition including one or more compounds of formula (I) or formula (II). The compounds of formula (I) or formula (II) may be solvated, in suspension, or powder form, and may then be reconstituted in the pharmaceutically acceptable carrier to provide the pharmaceutical composition. The one or more containers also can be carried within a suitable carrier, such as a box, carton, tube or the like. Such containers can be made of plastic, glass, laminated paper, metal foil, or other materials suitable for holding medicaments. In certain embodiments, the container can hold a pharmaceutical composition and may have a sterile access port (for example the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle). Alternatively, or additionally, the article of manufacture may further include a second (or third) container including a pharmaceutically-acceptable buffer, such as bacteriostatic water for injection (BWFI), phosphate-buffered saline, Ringer's solution and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, and syringes. (2) Design of gene(s) of interest to be expressed as treatment corresponding to particular ocular diseases The following important target diseases for suprachoroidal nonviral gene transfer have been identified, including: (a) Stargardt Disease; (b) Usher Syndrome; (c) Neovascular AMD and other diseases that cause choroidal neovascularization; (d) Diabetic retinopathy; (e) Retinal vein occlusion; (f) Retinitis pigmentosa; (g) Leber congenital amaurosis; and (h) Geographic atrophy. The encoded genes within the non-viral polymeric nanoparticles for ocular injection may include: ABCA4; MYO7A; USH1C; CDH23; PCDH15; SANS; CIB2; USH2A; GPR98; WHRN; CLRN1; anti-VEGF proteins, such as VEGFR1 / sFLT-1, VEGFR2, VEGFR3, endostatin, angiostatin, and protein engineered mimetics, antibodies, and protein fragments; TIMP3; PEDF; Prph2; BPDE; Bcl2; FGF-2; CNTF; Mertk; GUCY2D; AIPL1; RPGRIP; RPE65; LCA6; LCA10; a gene encoding an anti-VEGF protein, endostatin, angiostatin, and protein engineered mimetics, antibodies, and protein fragments thereof, and a gene encoding anti-complement proteins and protein engineered mimetics, antibodies, and protein fragments thereof. In certain embodiments, the DNA is selected from a minicircle plasmid DNA, a nanoplasmid DNA, and a close ended DNA. In certain embodiments, the DNA is: (a) substantially free of bacterial elements; (b) about 1-4kbp, including 1 kbp, 2 kbp, 3 kbp, and 4 kbp, without the gene included; and / or, (c) substantially free of unmethylated CpG sequences. As used herein, the term “substantially free” means less than 5%, including less than 4%, less than 3%, less than 2%, and preferably less than 1%, including less than 0.9%, less than 0.8%, less than 0.7%, less than 0.6%, less than 0.5%, less than 0.4%, less than 0.3%, less than 0.2%, and less than 0.1%. In some embodiments, the polymer to the DNA has a mass ratio between about 10:1 to about 50:1. In certain embodiments, the mass ratio of the polymer to the DNA has a range between about 15:1 to about 40:1, between about 20:1 to about 30:1, about 20:1, about 25:1, and about 30:1. In certain embodiments, the DNA has a concentration having a range between about 0.1 mg / mL to about 2.0 mg / mL, between about 0.2 mg / mL to about 1.0 mg / mL, between about 0.2 mg / mL to about 0.5 mg / mL, and between about 0.3 mg / mL to about 0.4 mg / mL. (3) Design of DNA vectors including the promoter / enhancer to drive expression (i) In certain embodiments, it has been found that small DNA vectors with minimal vector backbone, including Z1 plasmids, are preferred, with the number of base pairs of backbone being between about 1 to 4 kbp rather than greater than 4kbp. Other small sized nucleic acid constructs, such as minicircle plasmids, also are effective with the presently disclosed approach. To facilitate this approach, a PCR-based technique has been developed for generation of minicircle plasmids. Further reduction of plasmid size including minimizing size and eliminating bacterial sequences also is important. (ii) Ubiquitous promoters appear to provide better transfection efficiency than photoreceptor-specific promoters and that, in some embodiments, the CAG promoter is the preferred lead promoter to be included in the DNA backbone. The 72-bp repeats of the SV40 enhancer also appear to help the presently disclosed nanoparticles have effective ocular transfection. (iii) In certain embodiments, the DNA includes a CAG promoter and a 72-bp region of an SV40 enhancer, especially the sequence ggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaacca (SEQ ID NO: 1). In particular embodiments, the DNA comprises a nanoplasmid comprising a gene of interest driven by a CAG promoter and comprising a single or repeat 72-bp region of an SV40 enhancer, wherein the DNA is substantially free of bacterial genetic elements and unmethylated CpG sequences. (4) Design of excipients that can improve the transport, transfection, and / or stability of the formulations. Sugars, such as sucrose and trehalose, enhance the stability of the nanoparticle formulations for ocular injection. Other sugars, salts, buffers, carrier polymers, and excipients can be used to improve the stability of the nanoparticles when frozen or lyophilized and also can improve the convective transport when the formulations are suprachoroidally injected. (5) Mode of administration including device used for administration The current approach for gene replacement of eye diseases and conditions is subretinal injection of viral vectors. Suprachoroidal injection of nonviral vectors, however, has the following advantages. Subretinal injection of viral vectors results in detachment of the photoreceptors from the RPE, while suprachoroidal injection of nonviral vectors does not result in such detachment. This characteristic is a major advantage of suprachoroidal injection over subretinal injection because detaching the photoreceptors from the RPE is damaging to photoreceptors, particularly in eye conditions in which the photoreceptors are already compromised. Further, unlike subretinal injection, which must be done in the operating room as part of an operation called vitrectomy, suprachoroidal nonviral gene transfer can be done in an outpatient clinic. Vitrectomy causes cataract in a high percentage of patients and there is a 1- 2% risk of retinal detachment. As a result, suprachoroidal injections are safer, less expensive, and more convenient than subretinal injections. Also, spread of vector in the suprachoroidal space is greater than spread in the subretinal space, thereby allowing treatment of a larger portion of the retina with a single injection. This characteristic means more photoreceptors can have the defective gene replaced and salvaged, which should translate into better visual outcomes. Unlike injection viral vectors, which cause an immune response and can only be done once, nonviral gene transfer does not cause an immune response and can be repeated. Thus, if the initial response is insufficient, it can be boosted by repeated injection. Finally, the nanoparticles used for nonviral gene transfer have much greater capacity than AAV vectors and therefore can be used to replace larger genes or can be used to incorporate multiple genes. This characteristic is particularly useful for replacement of the Stargardt Disease gene, which is very large. Accordingly, suprachoroidal delivery is preferable with these nanoparticle formulations than other routes of ocular delivery. As used herein, the suprachoroidal space refers to the area between the sclera and the choroid. This area may be expanded upon administration of a composition. In some embodiments, suprachoroidal injection is performed using a specialized insertion tip with or without injection pumps. The specialized injection tip may range from about 1-5 mm and the gauge may be about 25-35 G. Repeated suprachoroidal injections of PBAE NP vectors increase transgene expression and are part of the presently disclosed methods. In certain embodiments, the particle composition is administered to the suprachoroidal space of the eye of the subject via more than one injection at one or more injection sites. In certain embodiments, the more than one injections are administered during a single session. In particular embodiments, the single session comprises an outpatient visit. In certain embodiments, the method further comprises a waiting period between the more than one injections. In certain embodiments, the more than one injections are made via an autoinjector or injection pump. The composition may be administered a varying amount of times depending on the subject, disease, and the like. For example, the composition may be administered 1 to 4 times daily for a period of, for example 1 to 10 years, at any suitable interval. The composition may also be administered over a period of 1 day, 10 days, 1 month, 6 months, 12 months, 5 years, or 10 years, at any suitable interval that can allow for an accurate analysis of the subject. For example the composition may be administering 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more times over 1 day, 1 week, 4 weeks, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months 9 months, 10 months, 11 months, 12 months, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, or 10 years. During the time frame that the method is being performed, the step of observing and / or quantifying the delivery of the therapeutic agent in the subject's eye can be performed any suitable number of times. For example, in embodiments the method is performed for at least 6 months, the step of observing and / or quantifying the therapeutic agent can be performed once daily, twice daily, once every 2 days, once every 3 days, and the like. In certain embodiments, the method comprises an administration volume to the suprachoroidal space having a range, in some embodiments, between about 20 mL to 500 mL, in some embodiments, between about 50 mL to 300 mL, and in some embodiments, between about 50 mL to 100 mL. As used herein, the term “treating” can include reversing, alleviating, inhibiting the progression of, preventing or reducing the likelihood of the disease, disorder, or condition to which such term applies, or one or more symptoms or manifestations of such disease, disorder or condition. Preventing refers to causing a disease, disorder, condition, or symptom or manifestation of such, or worsening of the severity of such, not to occur. Accordingly, the presently disclosed compounds can be administered prophylactically to prevent or reduce the incidence or recurrence of the disease, disorder, or condition. As used herein, the term “inhibit,” and grammatical derivations thereof, refers to the ability of a presently disclosed compound, e.g., a presently disclosed composition of formula (I) or formula (II), to block, partially block, interfere, decrease, or reduce the severity of the disease state. Thus, one of ordinary skill in the art would appreciate that the term “inhibit” encompasses a complete and / or partial decrease in the severity of a disease state, e.g., a decrease by at least 10%, in some embodiments, a decrease by at least 20%, 30%, 50%, 75%, 95%, 98%, and up to and including 100%. The “subject” treated by the presently disclosed methods in their many embodiments is desirably a human subject, although it is to be understood that the methods described herein are effective with respect to all vertebrate species, which are intended to be included in the term “subject.” Accordingly, a “subject” can include a human subject for medical purposes, such as for the treatment of an existing condition or disease or the prophylactic treatment for preventing the onset of a condition or disease, or an animal subject for medical, veterinary purposes, or developmental purposes. Suitable animal subjects include mammals including, but not limited to, primates, e.g., humans, monkeys, apes, and the like; bovines, e.g., cattle, oxen, and the like; ovines, e.g., sheep and the like; caprines, e.g., goats and the like; porcines, e.g., pigs, hogs, and the like; equines, e.g., horses, donkeys, zebras, and the like; felines, including wild and domestic cats; canines, including dogs; lagomorphs, including rabbits, hares, and the like; and rodents, including mice, rats, and the like. An animal may be a transgenic animal. In some embodiments, the subject is a human including, but not limited to, fetal, neonatal, infant, juvenile, and adult subjects. Further, a “subject” can include a patient afflicted with or suspected of being afflicted with a condition or disease. Thus, the terms “subject” and “patient” are used interchangeably herein. The term “subject” also refers to an organism, tissue, cell, or collection of cells from a subject. In general, the “effective amount” of an active agent or drug delivery device refers to the amount necessary to elicit the desired biological response. As will be appreciated by those of ordinary skill in this art, the effective amount of an agent or device may vary depending on such factors as the desired biological endpoint, the agent to be delivered, the makeup of the pharmaceutical composition, the target tissue, and the like. The term “combination” is used in its broadest sense and means that a subject is administered at least two agents, more particularly a compound of formula (I) or formula (II) described herein and at least one other therapeutic agent, such as a protein-targeted modulator therapy. More particularly, the term “in combination” refers to the concomitant administration of two (or more) active agents for the treatment of a, e.g., single disease state. As used herein, the active agents may be combined and administered in a single dosage form, may be administered as separate dosage forms at the same time, or may be administered as separate dosage forms that are administered alternately or sequentially on the same or separate days. In one embodiment of the presently disclosed subject matter, the active agents are combined and administered in a single dosage form. In another embodiment, the active agents are administered in separate dosage forms (e.g., wherein it is desirable to vary the amount of one but not the other). The single dosage form may include additional active agents for the treatment of the disease state. Further, the compositions described herein can be administered alone or in combination with adjuvants that enhance stability of the compositions alone or in combination with one or more therapeutic agents, facilitate administration of pharmaceutical compositions containing them in certain embodiments, provide increased dissolution or n dispersion, increase inhibitory activity, provide adjunct therapy, and the like, including other active ingredients. Advantageously, such combination therapies utilize lower dosages of the conventional therapeutics, thus avoiding possible toxicity and adverse side effects incurred when those agents are used as monotherapies. The timing of administration of a composition of formula (I) or formula (II) described herein and at least one additional therapeutic agent can be varied so long as the beneficial effects of the combination of these agents are achieved. Accordingly, the phrase “in combination with” refers to the administration of a composition of formula (I) or formula (II) described herein and at least one additional therapeutic agent either simultaneously, sequentially, or a combination thereof. Therefore, a subject administered a combination of a composition of formula (I) or formula (II) described herein and at least one additional therapeutic agent can receive a and at least one additional therapeutic agent at the same time (i.e., simultaneously) or at different times (i.e., sequentially, in either order, on the same day or on different days), so long as the effect of the combination of both agents is achieved in the subject. When administered sequentially, the agents can be administered within 1, 5, 10, 30, 60, 120, 180, 240 minutes or longer of one another. In other embodiments, agents administered sequentially, can be administered within 1, 5, 10, 15, 20 or more days of one another. Where the described herein and at least one additional therapeutic agent are administered simultaneously, they can be administered to the subject as separate pharmaceutical compositions, each comprising either a composition of formula (I) or formula (II) or at least one additional therapeutic agent, or they can be administered to a subject as a single pharmaceutical composition comprising both agents. When administered in combination, the effective concentration of each of the agents to elicit a particular biological response may be less than the effective concentration of each agent when administered alone, thereby allowing a reduction in the dose of one or more of the agents relative to the dose that would be needed if the agent was administered as a single agent. The effects of multiple agents may, but need not be, additive or synergistic. The agents may be administered multiple times. In some embodiments, when administered in combination, the two or more agents can have a synergistic effect. As used herein, the terms “synergy,” “synergistic,” “synergistically” and derivations thereof, such as in a “synergistic effect” or a “synergistic combination” or a “synergistic composition” refer to circumstances under which the biological activity of a combination of an miR-described herein and at least one additional therapeutic agent is greater than the sum of the biological activities of the respective agents when administered individually. Synergy can be expressed in terms of a “Synergy Index (SI),” which generally can be determined by the method described by F. C. Kull et al., Applied Microbiology 9, 538 (1961), from the ratio determined by: Qa / QA+ Qb / QB= Synergy Index (SI) wherein: QAis the concentration of a component A, acting alone, which produced an end point in relation to component A; Qa is the concentration of component A, in a mixture, which produced an end point; QBis the concentration of a component B, acting alone, which produced an end point in relation to component B; and Qb is the concentration of component B, in a mixture, which produced an end point. Generally, when the sum of Qa / QAand Qb / QBis greater than one, antagonism is indicated. When the sum is equal to one, additivity is indicated. When the sum is less than one, synergism is demonstrated. The lower the SI, the greater the synergy shown by that particular mixture. Thus, a “synergistic combination” has an activity higher that what can be expected based on the observed activities of the individual components when used alone. Further, a “synergistically effective amount” of a component refers to the amount of the component necessary to elicit a synergistic effect in, for example, another therapeutic agent present in the composition. Throughout this specification and the claims, the terms “comprise,” “comprises,” and “comprising” are used in a non-exclusive sense, except where the context requires otherwise. Likewise, the term “include” and its grammatical variants are intended to be non- limiting, such that recitation of items in a list is not to the exclusion of other like items that can be substituted or added to the listed items. Following long-standing patent law convention, the terms “a,” “an,” and “the” refer to “one or more” when used in this application, including the claims. Thus, for example, reference to “a subject” includes a plurality of subjects, unless the context clearly is to the contrary (e.g., a plurality of subjects), and so forth. For the purposes of this specification and appended claims, unless otherwise indicated, all numbers expressing amounts, sizes, dimensions, proportions, shapes, formulations, parameters, percentages, quantities, characteristics, and other numerical values used in the specification and claims, are to be understood as being modified in all instances by the term “about” even though the term “about” may not expressly appear with the value, amount, or range. Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached claims are not and need not be exact, but may be approximate and / or larger or smaller as desired, reflecting tolerances, conversion factors, rounding off, measurement error and the like, and other factors known to those of skill in the art depending on the desired properties sought to be obtained by the presently disclosed subject matter. For example, the term “about,” when referring to a value can be meant to encompass variations of, in some embodiments, ±100% in some embodiments ±50%, in some embodiments ±20%, in some embodiments ±10%, in some embodiments ±5%, in some embodiments ±1%, in some embodiments ±0.5%, and in some embodiments ±0.1% from the specified amount, as such variations are appropriate to perform the disclosed methods or employ the disclosed compositions. Further, the term “about” when used in connection with one or more numbers or numerical ranges, should be understood to refer to all such numbers, including all numbers in a range and modifies that range by extending the boundaries above and below the numerical values set forth. The recitation of numerical ranges by endpoints includes all numbers, e.g., whole integers, including fractions thereof, subsumed within that range (for example, the recitation of 1 to 5 includes 1, 2, 3, 4, and 5, as well as fractions thereof, e.g., 1.5, 2.25, 3.75, 4.1, and the like) and any range within that range. EXAMPLES The following Examples have been included to provide guidance to one of ordinary skill in the art for practicing representative embodiments of the presently disclosed subject matter. In light of the present disclosure and the general level of skill in the art, those of skill can appreciate that the following Examples are intended to be exemplary only and that numerous changes, modifications, and alterations can be employed without departing from the scope of the presently disclosed subject matter. The synthetic descriptions and specific examples that follow are only intended for the purposes of illustration, and are not to be construed as limiting in any manner to make compounds of the disclosure by other methods. EXAMPLE 1 Suprachoroidal Gene Transfer with Nonviral Nanoparticles in Large Animal Eyes 1.1 Overview Suprachoroidal nonviral gene therapy with biodegradable poly(β-amino ester) nanoparticles (NPs) provides widespread expression in photoreceptors and retinal pigmented epithelial (RPE) cells and therapeutic benefits in rodents. In this Example, we show in a human-sized minipig eye that suprachoroidal injection of 50 μL of NPs containing 19.2 μg of GFP expression plasmid caused GFP expression in photoreceptors and RPE throughout the entire eye with no toxicity. Two weeks after injection of 50, 100, or 200 μL, there was considerable within-eye and between- eye variability in expression that was reduced 3 months after injection of 200 μL and markedly reduced after three suprachoroidal injections at diferent locations around the eye. Reduction of bacterial CpG sequences in the expression plasmid resulted in a trend toward higher expression. These data indicate that nonviral suprachoroidal gene therapy with optimized polymer, expression plasmid, and injection approach has potential for treating photo- receptors throughout the entire retina of a human- sized eye. 1.2 Introduction Considerable progress in ocular gene therapy has been made using adeno-associated viral (AAV) vectors. Subretinal injection of an AAV2 vector expressing Rpe65 improved mobility in some patients with retinal degeneration due to biallelic mutations in Rpe65, Russell, et al., 2017, which has led to approval of voretigene Neparvovec-rzyl by the FDA. Since that approval, however, some patients treated with subretinal injection of voretigene Neparvovec-rzyl have developed perifoveal chorioretinal atrophy. Gange et al., 2022. The mechanism of this toxicity is not known, but the delayed onset and nature of the changes suggest the possibility of a late immune response. While it is necessary to continue to study the long-term benefits and risks of viral ocular gene transfer and find ways to minimize the latter, it is prudent to develop nonviral ocular gene transfer approaches. Poly(β-amino ester)s (PBAEs) with primary, secondary, and tertiary amines and ester bonds can compact expression plasmid DNA into nanoparticles (NPs) that enter cells by endocytosis, Green et al., 2007, and are hydrolytically degradable. A substantial number of the NPs escape from endosomes and degrade within minutes to hours allowing expression plasmids to enter the nucleus and begin transgene expression. Sunshine et al., 2012; Guerrero-Cazares et al., 2014; Rui et al., 2022. Relatively fast degradability of new biocompatible gene delivery materials is especially important for retinal gene therapy as recent studies have highlighted potential toxicity concerns of conventional materials, such as lipid nanoparticles, for application in the retina. Herrerra-Barrera et al., 2023; Drag et al., 2023. Suprachoroidal injections of PBAE NPs containing a GFP expression plasmid result in widespread expression of GFP in photoreceptors and retinal pigmented epithelial (RPE) cells of rats, Shen et al., 2020; however, it is important to know the extent and level of GFP expression that occurs after suprachoroidal injection of PBAE NPs in eyes that are closer in size to human eyes and that may have more substantial transport limitations. Minipig eyes were selected for the experiments provided in this Example because, in addition to being closer in size to human eyes, the minipig retina is similar to the human retina in that it is holangiotic and has an area centralis with a high density of cone photoreceptors analogous to the primate macula. Vrolyk et al., 2020. 1.3 Results 1.3.1 Nanoparticle (NP) characterization Following NP fabrication, lyophilization, storage at −20°C, and resuspension in sterile water, NP properties were evaluated. Assessment of NP size and surface charge revealed a z-average hydrodynamic diameter of 443 nm and a zeta potential of +29.4 mV (FIG.1A). Transmission electron microscopy (TEM) showed that morphology was spherical for the electrostatically formed polyplex NPs and that dried particle size was similar to hydrated particle size (FIG.1B). Gel electrophoresis studies demonstrated that the NPs had complete binding and encapsulation of DNA in the NPs (FIG.1C). The size of these electrostatically formed NPs and the complete encapsulation of DNA plasmids allows high DNA loading per particle, calculated as 250 ± 20 kilo–base pair (kbp) DNA encapsulated in each particle on average, or 80 ± 5 plasmids of 3151 bp (FIG.15), which may be advantageous for in vivo gene therapy. The discrepancy in the particle size as measured by dynamic light scattering (DLS), TEM, and NP tracking analysis (NTA; FIG. 15) is due to the polydispersity of the particle population; while most of the particles, counted as a number average as by TEM and NTA, are relatively small (< 200 nm), the less common larger particles bias the z-average calculated via intensity-averaged size by DLS. 1.3.2 Retinal appearance after suprachoroidal injection of PBAE NPs containing a GFP expression plasmid Experiments were done in Göttingen and Yucatan minipigs. Fundus photographs were taken before and after suprachoroidal injection of PBAE NPs. Representative before and after fundus photographs of Göttingen and Yucatan minipigs are shown in FIG. 13. Indirect ophthalmoscopy was performed at baseline prior to and after injection and prior to euthanasia to observe the entire extent of the retina. No visible changes in the retina were observed on fundus photographs or by indirect ophthalmoscopy at two or twelve weeks after suprachoroidal injections. 1.3.3 Distribution of GFP expression after suprachoroidal injection of PBAE NPs containing pCAG-GFP-Z1 expression plasmid in minipig eyes In previously reported experiments, Shen et al., 2020, suprachoroidal injections were done with a commercially available 4733-bp GFP expression plasmid, pEGFP-N1, in which the CMV promoter drives expression of GFP. In this Example, the 4021-bp pCAG-GFP-Z1 was generated by substituting the CMV promoter for the CAG promoter and excising extraneous bacterial sequences but maintaining those allowing propagation and selection in bacteria. Two weeks after suprachoroidal injection of 50 µL containing 19.2-µg of pCAG- GFP-Z1 DNA in PBAE NPs 4.5-mm posterior to the limbus, minipig eyes were fixed, run through a sucrose gradient, and frozen in embedding media. Starting at the anterior-most part of the eyecup, 35-µm transverse sections were cut proceeding as far posterior as possible. The section through the equator, which has the largest diameter, was identified and then the distance anterior or posterior to the equator was determined for all other sections ( FIG.2A). FIG. 2B shows fluorescence microscopy of a section at the equator, and sections 2.87-mm anterior to the equator and 8.12-mm posterior to the equator. The fluorescence extends around the entire circumference of the eye at each of the three locations. Higher magnification of the equatorial section immunohistochemically stained with anti-GFP antibody shows that the fluorescence is due to GFP expression predominantly in photoreceptor inner and outer segments (FIG.2C). This observation indicates that two weeks after a single anterior suprachoroidal injection of 50 µL of PBAE NPs containing 19.2 µg of pCAG-GFP-Z1, GFP expression occurs in photoreceptors around the entire circumference of the eye and extends as far posterior as can be determined by this technique. Staining of these sections with hematoxylin and eosin showed normal-appearing retina with no inflammatory cells (FIG.13E and FIG. 13F). 1.3.4 Effect of increasing the volume / dose and / or time after injection of NPs The eye is a closed compartment and any injection of fluid into the eye results in a transient increase in intraocular pressure, which normalizes as aqueous humor exits through the outflow channels of the eye. In humans, the most common volume of medication injected into the vitreous cavity or suprachoroidal space is 50 µL, but injections of 100 µL are tolerated in most patients unless outflow facility is limited by glaucoma. If the rate of injection is very slow, even larger volumes can be injected without increasing intraocular pressure above ocular perfusion pressure. Similar to the previous experiment, two weeks after suprachoroidal injection of 50 µL of PBAE NP containing 19.2 µg of pCAG-GFP-Z1, GFP fluorescence was seen around the entire circumference of the eye in all transverse sections up to 7-9 mm posterior to the equator, which for technical reasons is about the limit for getting an intact circular section (FIG.3A and FIG.3B). The distribution of GFP expression was similarly widespread two weeks after injection of 100 µL of NPs containing 38.4 µg of pCAG-GFP-Z1 (FIG. 3C and FIG.3D) or 200 µL of NPs containing 76.8 µg of pCAG-GFP-Z1 (FIG. 3E and FIG.3F). Since fluorescence microscopy is very sensitive but not quantitative, these experiments could not determine if there were differences in level of GFP expression after injection of the different volumes of NPs. To quantify and better localize expression, GFP protein levels were measured by enzyme-linked immunosorbent assay (ELISA) in retina and RPE / choroid at several locations throughout the eye. A 7.0-mm trephine was used to collect circular punches of retina and RPE / choroid at the following seven locations: (1) posterior nasal, (2) posterior temporal, (3) temporal, (4) superior nasal, (5) superior temporal, (6) inferior nasal, and (7) inferior temporal (FIG.14A and FIG. 14B). Before trephining, the translucent retina was seen overlying the darkly pigmented RPE (FIG.14C). After removal of retinal samples, the darkly pigmented RPE was seen more clearly in the circles where the retina had been removed (FIG. 14D). After removal of RPE / choroid samples, sclera was seen in the circles (FIG.14E and FIG. 14F). ELISA was used to measure GFP protein / mg total protein in each of the samples. FIG.4A-FIG.4C show GFP protein / mg total protein in each of the seven retinal locations in three eyes at two weeks after suprachoroidal injection of 50 µL of PBAE NP containing 19.2 µg of pCAG-GFP-Z1. The injections were done superiorly in the 11:00 or 12:00 meridians at an anterior location, 4.5-mm posterior to the limbus, and GFP expression was measurable at all locations of the retina except at one location in one of the eyes. The level of expression was not consistently greater in regions of the retina in closest proximity to the injection site and in one eye it was substantially higher in the region of retina furthest from the injection site (FIG.4B). There was no consistent pattern regarding differences in GFP expression at different locations within an eye or between different eyes, but detectable expression occurred in all parts of the retina after a single suprachoroidal injection. Graphical display of each of the data points for each eye provides a better indication of the within-eye and between-eye variability in regional GFP levels (FIG. 4D). In two of the eyes, Eye 1-2w and Eye 3-2w, the means (13.6- and 13.7-pg / mg protein) and range of the seven measurements were similar, despite lack of correspondence between the eyes in values from the same location. Compared with these two eyes, a third eye, Eye 2-2w, showed a mean GFP protein level that was more than 9-fold higher (126.1-pg / mg protein) and higher range of values. Compared with GFP protein levels two weeks after suprachoroidal injection of 50 µL of PBAE NPs (19.2 µg of pCAG-GFP-Z1), those observed twelve weeks after injection were comparable (FIG.5A). In general, there was correlation between GFP levels in retina and those in RPE / choroid because eyes with higher ranges of expression in retina tended to have higher ranges of expression in RPE / choroid (FIG.5A and FIG.5B). FIG. 5C shows GFP protein levels in seven retinal locations two weeks (three eyes) or twelve weeks (two eyes) after injection of 100 µL of PBAE NPs containing 38.4 µg of pCAG-GFP-Z1. Comparing these data to those in FIG. 5A, it appears that doubling the volume and dose of vector did not result in major differences in retinal GFP protein levels, but in two of three eyes there were some locations of RPE / choroid with high levels (FIG. 5D). At this dose, GFP protein levels were similar at two and twelve weeks after injection for both retina and RPE / choroid. Compared with lower doses, there did not appear to be a major boost in GFP protein levels two weeks after suprachoroidal injection of 200 µL of PBAE NPs containing 76.8 µg of pCAG-GFP-Z1, but GFP levels were high at all locations in retina and RPE / choroid twelve weeks after injection (FIG.5E and FIG. 5F). The mean of all GFP levels at all retinal locations two weeks versus twelve weeks after injection of 200 µLof PBAE NPs was 37.0- versus 284.4-pg / mg protein (p=0.07 by linear mixed-effects models) and the comparison for RPE / choroid was 96.7- versus 879.5-pg / mg protein (p<0.0001). 1.3.5 Effect of minimizing bacterial sequences and CpG repeats in expression plasmid The presence of bacterial sequences, particularly unmethylated CpG motifs, in expression plasmids, increases the likelihood of an immune response, Häcker et al., 2002; Kinman et al., 2002; Reyes-Sandoval and Ertl, 2004; Talati et al., 2008; Hyde et al., 2008, and therefore we contracted a commercial vendor (Aldevron, Fargo, ND) to minimize CpG motifs and other bacterial sequences in pCAG-GFP-Z1. This modification resulted in a 3322-bp plasmid (pCAG-GFP-nP). Two weeks after suprachoroidal injection of 50 µL of PBAE NPs containing 19.2-µg pCAG-GFP-nP, transverse sections showed GFP fluorescence around the entire circumference of the eye anterior to the equator (FIG.6A) and high magnification showed GFP expression in cells of the inner retina, as well as in photoreceptors (FIG.6B). Immunohistochemical staining for GFP showed that the fluorescence in the inner and outer retina was due to expression of GFP and not autofluorescence (FIG.16). Sections far posterior to the equator also showed GFP fluorescence around the entire circumference of the eye (FIG.6C) and high magnification showed GFP expression predominantly in photoreceptors, but also in some cells of the inner retina (FIG.6D). There was a trend toward higher GFP protein levels in retina and RPE / choroid but due to substantial variability the differences were not statistically significant (FIG.6E and FIG.6F). 1.3.6 Effect of multiple 50 µL suprachoroidal injections of PBAE NP containing 19.2 µg of pCAG-GFP-nP Examination of GFP protein levels at each of the retinal locations sampled two weeks after a single superior injection of 50 µL of PBAE NPs containing 19.2 µg of CAG- GFP-nP showed considerable regional variability within each of three eyes and between the eyes (FIG. 7A), and the same was true for RPE / choroid (FIG.7B). To test whether non- uniform spread of PBAE NPs in the suprachoroidal space might contribute to this variability in GFP expression, three injections were given at different locations around the circumference of three eyes. One injection of 50 µL of PBAE NPs containing 19.2 µg of pCAG-GFP-nP was given superiorly, one was given temporally and one inferiorly, all 4.5-mm posterior to the limbus with approximately 5 minutes in between injections. Two weeks after injections, there were high levels of GFP protein at all locations sampled in retina (FIG.7C) and RPE / choroid (FIG. 7D) indicating a reduction in within-eye variability. Dot plots of all 21 measurements in the retinas (FIG.7E) and RPE / choroid (FIG. 7F) of the three eyes given one injection versus those given three injections, showed a marked reduction in the co-efficient of variation for GFP protein levels in retina and RPE / choroid after three injections, indicating a substantial reduction in between-eye, as well as within- eye variability. Mean GFP protein levels trended higher after three injections, but the differences were not statistically significant. No toxicity was observed in these eyes or any of the eyes treated with pCAG-GFP-Z1 NPs or pCAG-GFP-nP NPs at any of the dosages evaluated. 1.4 Discussion There are many inherited retinal degenerations that cause substantial visual disability. Many of these degenerations are caused by loss-of-function mutations in genes critical for photoreceptor function and survival. Gene therapy to replace or augment the deficient protein has the potential to cure these blinding conditions if done at an early stage of disease. The most common strategy is subretinal injection of an AAV vector expressing the needed protein. The subretinal injection results in separation of photoreceptors from RPE by the vector-containing fluid causing a small retinal detachment, referred to as a bleb. This approach has the advantage of providing a high concentration of vector in close proximity to photoreceptors and RPE resulting in good transfection efficiency and high expression of the therapeutic protein. A disadvantage of this approach, however, is that there is little expression throughout the remainder of the retina and unless the injection volume is large resulting in a large bleb that involves a large area of retina, most of the retina remains untreated. This issue is a major problem because it means that the gene defect is not corrected in rods throughout a large area of the retina and those rods are destined for degeneration. When a sufficient number of rods degenerate, oxygen utilization is decreased and oxygen levels are increased, Yu et al., 2000; Yu et al., 2004, resulting in oxidative damage to remaining rods and cones causing gradual, progressive degeneration of remaining retina. Shen et al., 2005; Komeima et al; 2006; Komeima et al., 2007; Cideciyan et al., 2013; Jacobson et al., 2015. Therefore, gene replacement should be done early before there is extensive rod degeneration and should target as many rods as possible. Another potential disadvantage of this approach is that separation of photoreceptors from RPE is potentially damaging to photoreceptors. While it is possible for the photoreceptors to recover, that recovery may be incomplete so that a bleb involving the fovea can result in permanent reduction in vision. A third issue is that there is still uncertainty regarding the manner in which the immune system responds to transfection of cells by AAV. There may be initial inflammation after ocular gene therapy with an AAV vector that varies depending upon route of administration and is usually mild and manageable after subretinal injection, but what is more concerning are some signs of possible late immune response in some patients that may cause retinal damage. For example, some patients treated with subretinal injection of voretigene Neparvovec-rzyl, an AAV2 vector expressing RPE65, have developed progressive perifoveal chorioretinal atrophy, Gange et al., 2022, which could be an immune response to late presentation of viral antigens by transfected retinal neurons. Suprachoroidal ocular gene therapy with PBAE polymeric NPs has the potential to address the above issues. We have previously shown that a 3-µL suprachoroidal injection of PBAE NPs containing 1 µg of a GFP expression plasmid in rats resulted in GFP expression in photoreceptors and adjacent RPE throughout the entire retina. Shen et al., 2020. In this Example, we have demonstrated that a 50-µL suprachoroidal injection of PBAE NPs containing 19.2 µg of GFP expression plasmid resulted in widespread GFP expression in photoreceptors and RPE in the minipig eye. Transverse sections extending as far posterior as possible showed detectable GFP expression in photoreceptors and RPE around the entire circumference of the eye even in the posterior-most sections. Quantitative analysis was done by measuring GFP protein levels by ELISA in retinal and RPE / choroid samples obtained from seven locations spanning the entire eyecup. This analysis confirmed that after a single anterior suprachoroidal injection of PBAE NPs containing 19.2 µg of pCAG-GFP-Z1, GFP protein was detectable in all parts of the retina, but with considerable regional variability. Variability in the RPE / choroid was observed with GFP levels low at most locations in most eyes, but higher in some locations. In general, eyes that had higher GFP at some locations in RPE / choroid also tended to have high GFP at some locations in retina. Without wishing to be bound to any one particular theory, it was thought that increasing the volume, which also would increase the amount of plasmid / transgene copies injected, would expand the suprachoroidal space to a greater degree and permit more uniform spread and more uniform and higher GFP expression. Two weeks after injection of higher volumes of NPs, there was still high within-eye and between-eye variability, making it difficult to assess the impact of increasing the dose. Expression of GFP was similar two weeks and twelve weeks after injection of 50 µL or 100 µL of PBAE NPs containing 19.2 or 38.4 µg of pCAG-GFP-Z1, but there was a statistically significant increase in RPE / choroid and a trend toward an increase in retina between two and twelve weeks after injection of 200 µL of PBAE NPs containing 76.8 µg of pCAG-GFP-Z1. This observation suggests that peak expression after injection of higher doses of vector occurs at some point after two weeks. Whether reducing bacterial sequences and CpG sequences in the expression plasmid could increase expression of GFP was evaluated. A trend toward higher GFP levels in retina and RPE / choroid two weeks after injection of PBAE NPs containing the modified plasmid (pCAG-GFP-nP) versus the parent plasmid was observed, but differences were not statistically significant due to within-eye and between-eye variability. Although increasing the volume of injection failed to reduce variability in expression, it was felt that inconsistent spread of vector in the suprachoroidal space might still be responsible for the variability and might be overcome by performing multiple injections at different locations around the circumference of the eye. To this end, suprachoroidal injections of 50 µL of PBAE NPs containing 19.2 µg of pCAG-GFP-nP, were done superiorly, temporally, and inferiorly (inability to obtain good exposure nasally in the pig prevented injection on that side of the eye). Two weeks after this triple injection, there was a substantial reduction in within-eye and between-eye variability demonstrated by a marked reduction in the coefficient of variation compared with that seen after a single injection. This observation confirmed that nonuniform spread of vector in the suprachoroidal space is the cause of variable expression throughout the eye and between eyes given a single injection. No signs of toxicity were observed following administration of the biodegradable PBAE NPs, suggesting that this approach may be a safe non-viral method for ocular gene transfer. Anatomic differences between eyes and technical differences regarding injections, such as needle depth and orientation, and rate of injection might contribute to nonuniform spread of vector in the suprachoroidal space. Compared with experiments in which a large number of rodents are given suprachoroidal injections at a single session providing large experimental numbers, suprachoroidal injections in a pig require general anesthesia and a large team of investigators, and a maximum of only three pigs can be injected per session. These requirements greatly reduce experimental numbers making statistical comparisons difficult. Despite these challenges, the studies described in this Example provide a good indication of the optimal dose and suprachoroidal injection technique of PBAE NPs needed to obtain good reporter gene expression throughout the entire retina and RPE / choroid in a human size eye. These results provide the foundation needed to begin expression studies with therapeutic transgenes in minipigs and provides additional evidence of the feasibility of utilizing nonviral gene transfer for treatment of inherited retinal degenerations. 1.5 Materials and Methods 1.5.1 Experimental Design The study was designed to optimize the level and distribution of GFP expression in retina and RPE / choroid after suprachoroidal injection of PBAE NPs containing a GFP expression plasmid. Expression level was quantified by performing ELISA on samples collected throughout eyes. It was planned to test the effect of increasing plasmid dose by increasing the volume of injection and by doing repeated injections. Experiments were designed to assess the stability of expression over time between 2 and 12 weeks after injection and to assess the effect of reducing bacterial sequences in the expression plasmid. 1.5.3 Polymer synthesis 1,4-butanediol diacrylate (B4), 5-amino-1-pentanol (S5), and 1-(3-aminopropyl)-4- methyl-piperazine (E7) were purchased from Alfar Aesar (Ward Hill, MA). PBAE polymer was synthesized by a two-step reaction. First, acrylate-terminated base polymer (B4S5) was first synthesized by Michael addition reaction of 1,4-butanediol diacrylate (B4) with 5- amino-1-pentanol (S5) at 1.1:1 acrylate:amine monomer molar ratio in the dark under magnetic stirring for 24 hours at 90°C. In the second step, the acrylate-terminated base polymer was end-capped through another Michael addition reaction in the presence of excess of primary amine-containing small molecule 1-(3-aminopropyl)-4-methyl-piperazine (E7). Briefly, the 200 mg / mL polymer was mixed with 0.5 M E7 in anhydrous tetrahydrofuran (THF) at room temperature for two hr. The final polymer (B4S5E7, or 457) was purified by precipitation into diethyl ether and stored in anhydrous DMSO at 100 mg / mL with desiccant at -20°C until use. Polymer molecular weight was assessed via gel permeation chromatography (Agilent, Savage, MD) relative to polystyrene standards, and the number average and weight average molecular weight were 8610 and 43,500 g / mol, respectively. 1.5.4 Plasmid preparation pEGFP-N1 was obtained from Takara Bio USA, Inc. (Mountain View, CA). pCAG- eGFP-Z1 was prepared to minimize total plasmid length and eliminate unwanted sequences in the parental plasmid constructs. A linear DNA fragment containing a multiple cloning site, bacterial zeocin resistance gene and bacterial origin of replication was first synthesized by Twist Bioscience (South San Francisco, CA) with EcoRI sites at the 5’ and 3’ ends (1397 bp). The linear DNA fragment was then digested with EcoRI and ligated to form an empty plasmid containing the multiple cloning site, bacterial zeocin resistance gene and pUC bacterial origin of replication (1391 bp). The SV40 polyadenylation sequence was introduced from pUNO1-m41BBL (Invivogen, San Diego, CA) using 5’ / 3’ enzyme pair of NheI and EcoRI. The CAG promoter sequence was introduced from pPB-CAG-GFPd2 (Addgene 115665) using SpeI and KpnI 5’ and 3’ restriction enzyme cloning (1726 bp). eGFP was then introduced from eGFP-N1 using restriction enzyme pair 5’ / 3’ of AgeI and XbaI. All restriction enzymes were purchased from New England Biolabs, Ipswich, MA). A GFP expression nanoplasmid with most bacterial and CpG sequences removed, pCAG-GFP- nP, was obtained from Aldevron (Fargo, ND). 1.5.5 Nanoparticle formulation pDNA-carrying NPs were formulated by electrostatic binding of positively charged PBAE polymer and negatively charged expression plasmids (pCAG-GFP-Z1 and pCAG- GFP-nP) as previously described. Shen et al., 2020. Briefly, 457 PBAE polymer in DMSO at 100 mg / mL and pDNA in water were both diluted with 25-mM sodium acetate pH 5 (NaAc) to 5.05 mg / mL and 0.31 mg / mL, respectively. Then, polymer and pDNA solutions were mixed at three to two v / v ratio for 25 w / w ratio of polymer to DNA and incubated for 10 minutes to allow particle complexation. To lyophilize the NPs, the final NP solution was mixed with sucrose as a cryoprotectant to a final concentration of 30 mg / mL, then aliquoted and lyophilized. Lyophilized NPs were stored with desiccant at -20°C until used. Immediately prior to injection, lyophilized NPs were reconstituted with sterile water to a final sucrose concentration of 100 mg / mL. 1.5.6 Nanoparticle Characterization Lyophilized NPs were resuspended in sterile water to a final concentration of 0.38 μg / μL, and 20 μL of NPs was diluted in 1 mL of 0.1× phosphate-buffered saline (PBS). Particle size (hydrodynamic diameter) was assessed by DLS using Malvern Zetasizer Pro (Malvern Panalytical, Malvern, UK). Surface charge (zeta potential) was assessed by electrophoretic mobility using Malvern Zetasizer Pro. Size and surface charge were assessed on n = 3 individually prepared NP replicates. The number-weighted size distribution was also measured by NTA using NanoSight NS300 (Malvern Panalytical) after diluting each of three individually prepared batches of particles 500-fold in 1× PBS. The number of plasmids per particle was calculated by NTA as has been previously described. Bhise et al., 2012. To evaluate the morphology and to confirm the size of the NPs, samples were imaged with a Hitachi 7600 TEM (Hitachi High-Tech, Tokyo, Japan). Lyophilized particles were resuspended in water to a DNA concentration of 0.38 μg / μL. Samples were diluted further to a concentration of 0.001 μg / μL, transferred to a carbon film 400-mesh copper grid (Electron Microscopy Sciences, Hatfield, PA), and allowed to dry for 4 hours. Following this period, 1% uranyl acetate solution (Electron Microscopy Sciences, Hatfield, PA) was added to the copper grid. The grids were then washed with deionized water, dried overnight, and imaged via TEM. To assess NP DNA binding, DNA NPs and naked DNA were loaded into a 1% agarose gel with ethidium bromide (1 μg / mL; 250 ng per lane) and imaged following electrophoresis. 1.5.7 Experimental animals Ten 3–4-month-old Göttingen minipigs (Marshall Bio Resources, North Rose, NY) and fifteen 3–4-month-old Yucatan minipigs (Sinclair Bio Resources, Auxvasse, MO) were treated in accordance with the Association for Research in Vision and Ophthalmology Statement for Use of Animals in Ophthalmic and Vision Research, and protocols were reviewed and approved by the Johns Hopkins University Animal Care and Use Committee. Minipigs were anesthetized using a combination of: (1) ketamine hydrochloride (11-33 mg / kg, IM) for sedation; (2) butorphanol 0.2 mg / kg + midazolam 0.5 mg / kg + acepromazine 0.2 mg / kg combined, IM; (3) ketamine 20-30 mg / kg + xylazine 2-3 mg / kg IM followed by reversal with yohimbine 0.11 mg / kg IM or IV. In all cases, pigs were fasted overnight before anesthesia. Anesthesia was maintained by inhalation of 0.5% to 2.5% isoflurane and 100% O2. During anesthesia, heart rate and O2 saturation were monitored by pulse oximetry. After sedation, the eyes were sterilized with a drop of povidone-iodine solution USP, 10% (Ricca Chemical Company, Arlington, TX) and numbed with a drop or proparacaine hydrochloride ophthalmic solution USP 0.5% (Bausch & Lomb, Bridgewater, NJ). Fundus images were taken before and after suprachoroidal injections. Pupils were dilated with 1% tropicamide (Alcon Labs, Inc., Fort Worth, TX) and phenylephrine hydrochloride 2.5% (Paragon BioTeck, Portland, OR) and both eyes received a drop of ophthalmic hypromellose solution GenTeal (Alcon, Fort Worth, TX). The lens of a RetCam3 fundus camera (Natus, Middleton, WI) was gently touched to the cornea and used to photograph the fundus before and after injections. After suprachoroidal injection, a small amount of triple antibiotic ointment Bacitracin (First Aid Research Corp., Jupiter, FL) was applied to lubricate the eye until the pigs wake up and reduce the minimal chance of infection. At the end of the experiment, euthanasia was performed by giving an overdose of pentobarbital (150 mg / kg IV - Euthasol 390 mg / mL, Virbac, Westlake, TX). 1.5.8 Suprachoroidal injection of NPs Injections were done with sterile instruments under sterile conditions. After minipigs were anesthetized, topical 0.5% proparacaine and 5% povidone iodine eye drops were administered (anesthesia was detailed on experimental animals’ section). A sterile speculum was placed to hold the eyelids open. The retina was visualized with a hand-held RetCam fundus camera and pre-injection fundus photographs were taken. Eyes were visualized with a surgical microscope (Zeiss, Oberkochen, Germany) and the conjunctiva was dissected to expose the sclera near the limbus. A 30-gauge needle on a 1-mL syringe was used to make an oblique, partial-thickness scleral tunnel 4.5-mm posterior to the limbus and then a blunt- tip needle attached to a Hamilton syringe (Hamilton, Reno, NV) was used to enter the suprachoroidal space. A 100-µL Hamilton #710 syringe with an attached 34-gauge 45° beveled blunt needle was used for 50- or 100-µL injections and a Hamilton #1725 syringe and 33-gauge / 11-mm needle (PRE-33013 Acuderm, Inc, FL) was used for 200-µL injections. Ocular massage was used to reduce intraocular pressure prior to 200-µL injections and the injections were done very slowly. After injection, a cotton swab was held over the injection site for about 60 sections prior to removal of the needle. Post-injection fundus photographs were taken with the RetCam and the entire retina was examined with indirect ophthalmoscopy. 1.5.9 Histology and immunohistochemistry After enucleation, minipig eyes were fixed in 10% formalin at room temperature for 4-6 hours, the cornea was removed, the eye was filled with 10% formalin and fixed overnight at 4 °C. The anterior segment was removed under a dissecting microscope and the vitreous cavity was flushed with 10% formalin using a 23-gauge needle to penetrate into the vitreous with the fixative. The eyecup was then incubated at 4 °C in 10% formalin twelve hours, followed by PBS containing 15% sucrose for twelve hours, and then PBS containing 30% sucrose for twelve hours. Under a dissecting microscope, PBS was injected through a 20-gauge needle to gently dissect and remove the remaining vitreous and the eyecup was filled with OCT embedding media and placed in a -80 °C freezer overnight. Thirty-five µm transverse sections were cut starting at the anterior edge of the eyecup and proceeding posteriorly. Slides were dried and examined with a Zeiss fluorescence microscope. Due to the large size of the sections, the entire circumference of the eye could not be obtained in a single image. Therefore, overlapping images were taken around the entire circumference and merged using Photoshop Photomerge function or ImageJ (imagej.nih.gov / ij / download.html). Some sections were immunohistochemically stained for GFP. Nonspecific binding was blocked by a 30-minute incubation in 8% normal rabbit serum at 25°C. The sections were incubated with a polyclonal antibody (1:300) against EGFP conjugated with Alexa-594 (A- 21312, ThermoFisher, Waltham, MA) at 23°C for two hours. After washing with PBS containing 0.05% Tween-20, slides were counterstained with Hoechst 33258 (861405, Sigma, St. Louis, MO) and examined by fluorescence microscopy. 1.5.10 Measurement of GFP protein levels by ELISA After enucleation, eyes were kept on ice and under a dissecting microscope, the anterior segment and vitreous were removed. A 7.0-mm corneal trephine was used to obtain circular punches of retina at seven locations (FIG. 14). The trephine was then used to dissect deeper and obtain circular RPE / choroid samples from the same seven locations. The retina and choroid / RPE samples were placed in 300 μL of phosphate-buffered saline (PBS) containing protease inhibitor cocktail (11836170001, Roche, Mannheim, Germany) and sonicated for 5 s. Samples were centrifuged at 14000 rpm for 15 min, and the protein concentrations were determined by a CCB-G250 binding assay (#5000006, Bio-Rad, Hercules, CA), using BSA as the standard. GFP protein levels were measured using a GFP SimpleStep ELISA kit (ab171581, Abcam, Cambridge, MA). Briefly, 50 μL of sample or GFP standard dilutions was added to duplicate wells of 96-well plates, followed by 50 μL of GFP capture antibody and GFP detect antibody mixture. Plates were incubated at 23°C for 1 hour and washed five times with rinse buffer, and after addition of 100 μL of 3,3’,5,5’- tetramethylbenzidine (TMB) substrate solution, they were incubated at 23°C in the dark for 10 min. After addition of 100 μL of stop solution, absorption was measured at 450 nm with the SpectraMax Plus 384 Microplate Reader. 1.5.11 Data Analysis and Statistics Statistical comparisons for treatment effects in each experiment were determined using general linear mixed models and graphics were done using GraphPad Prism® software v. 5.0. All measurements from either eye of a pig were assumed to be exchangeable when modeling correlation structure and were assumed to be subject to non-error variability. A p- value less than 0.05 was considered significant. REFERENCES All publications, patent applications, patents, and other references mentioned in the specification are indicative of the level of those skilled in the art to which the presently disclosed subject matter pertains. All publications, patent applications, patents, and other references are herein incorporated by reference to the same extent as if each individual publication, patent application, patent, and other reference was specifically and individually indicated to be incorporated by reference. It will be understood that, although a number of patent applications, patents, and other references are referred to herein, such reference does not constitute an admission that any of these documents forms part of the common general knowledge in the art. In case of a conflict between the specification and any of the incorporated references, the specification (including any amendments thereof, which may be based on an incorporated reference), shall control. Standard art-accepted meanings of terms are used herein unless indicated otherwise. Standard abbreviations for various terms are used herein. Campochiaro, P. A.; Lauer, A. K.; Sohn, E. H.; Mir, T. A.; Naylor, S.; Anderton, M. C.; Kelleher, M.; Harrop, R.; Ellis, S.; Mitrophanous, K. Hum. Gene Ther. 2016, 28, (1), 99- 111. Vandenberghe, L. H.; Bell, P.; Maguire, A. M.; Cearley, C. N.; Xiao, R.; Calcedo, R.; Wang, L.; Castle, M. J.; Maguire, A. C.; Grant, R.; Wolfe, J. H.; Wilson, J. M.; Bennett, J. Sci. Trans. Med.2011, 3, (88), 1-9. Heier, J. S.; Kherani, S.; Desai, S.; Dugel, P.; Kaushal, S.; Cheng, S. H.; Delancono, C.; Purvis, A.; Richards, S.; Le-Halpere, A.; Connelly, J.; Wadsworth, S. C.; Varona, R.; Buggage, R.; Scaria, A.; Campochiaro, P. A. The Lancet 2017, 389, May 17. pii: S0140- 6736(17)30979-0. doi: 10.1016 / S0140-6736(17)30979-0. [Epub ahead of print]. Li, Q.; Miller, R.; Han, P. Y.; Pang, J.; Dinculescu, A.; Chiodo, V.; Hauswirth, W. W. Mol. Ther.2008, 14, 1760-1769. Kotterman, M. A.; Yin, L.; Strazzeri, J. M.; Flannery, J. G.; Merigan, W. H.; Schaffer, D. V. Gene Ther. 2014, 22, (12), 116-126. Patel, S. R.; P., L. A. S.; Edelhauser, H. F.; Prausnitz, M. R. Pharm. Res. 2011, 28, (1), 166-176. Patel, S. R.; Berezovsky, D. E.; McCarey, B. E.; Zarnitsyn, V.; Edelhauser, H. F.; Prausnitz, M. R. Invest. Ophthalmol. Vis. Sci.2012, 53, (8), 4433-4441. Russell et al., Efficacy and safety of voretigene neparvovec (AAV2-hRPE65v2) in patients with RPE65-mediated inherited retinal dystrophy: a randomized, controlled, open- label, phase 3 trial. Lancet 390, 849-860 (2017). Gange et al., Perifoveal chorioretinal atrophy after subretinal voretigene Neparvovec-rzyl for RPE65-mediated leber congenital amaurosis. Ophthamol. Retina 6, 58- 64 (2022). Green, J. J., Langer, R., Anderson, D. G., A Combinatorial Polymer Library Approach Yields Insight into Nonviral Gene Delivery. ACC. Chem. Res. 41, 749-759 (2007). Sunshine, J.C., Peng, D. Y., Green, J. J., Uptake and transfection with polymeric nanoparticles are dependent on polymer end-group structure, but largely independent of nanoparticle physical and chemical properties. Mol. Pharm.9, 3375-3383 (2012). Guerrero-Cazares, H., Tzeng, S. Y., Young, N. P., Abutaleb, A. O., Quinones- Hinojosa, A., Green, J. J., Biodegradable polymeric nanoparticles show high efficacy and specificity at DNA delivery to human glioblastoma in vitro and in vivo. ACS Nano 8, 5141- 5153 (2014). Rui, Y., Wilson, D.R., Tzeng, S.Y., Yamagata, H., Sudhakar, D., Conge, M., Berlinicke, C.A., Zack, D.J., Tuesca, A., Green, J.J., High-throughput and high-content bioassay enables tuning of polyester nanoparticles for cellular uptake, endosomal escape, and systemic in vivo delivery of mRNA. Sci. Adv.8, eabk2855 (2022). Herrera-Barrera, M., Ryals, R.C., Gautam, M., Jozic, A., Landry, M., Korzun, T., Gupta, M., Acosta, C., Stoddard, J., Reynaga, R., Tschetter, W., Jacomino, N., Taratula, O., Sun, C., Lauer, A.K., Neuringer, M., Sahay, G., Peptide-guided lipid nanoparticles deliver mRNA to the neural retina of rodents and nonhuman primates. Sci. Adv. 9, eadd4623 (2023). Drag, S., Dotiwala, F., Upadhyay, A.K., Gene therapy for retinal degenerative diseases: Progress, challenges, and future directions. Invest. Ophthalmol. Vis. Sci.64, 39 (2023). Shen, J., Kim, J., Tzeng, S. Y., Ding, K., Hafiz, Z., Long, D., Wang, J., Green, J. J., Campochiaro, P. A., Suprachoroidal gene transfer with nonviral nanoparticles. Sci. Adv. 6, eaba1606 (2020). Vrolyk, V., Desmariais, M.-J., Lambert, D., Haruna, J., Benoit-Biancamano, M., Meonatal and juvenile ocular development in Göttingen minipigs and domestic pigs: a histomorphological and immunohistochemical study. Veterinary Pathol. 57, 889-914 (2020). Shen J., Yang X., Dong A., Petters R. M., Peng Y. W., Wong F., Campochiaro P. A., Oxidative damage is a potential cause of cone cell death in retinitis pigmentosa. J Cell Physiol. 203(3), 457-64 (2005). Komeima K., Rogers B. S., Lu L., Campochiaro P. A., Antioxidants reduce cone cell death in a model of retinitis pigmentosa. Proc Natl Acad Sci U S A. 103(30), 11300-5 (2006). Komeima K., Rogers B. S., Campochiaro P. A., Antioxidants slow photoreceptor cell death in mouse models of retinitis pigmentosa. J Cell Physiol.213(3), 809-15 (2007). Cideciyan et al., Human cone visual pigment deletions spare sufficient photoreceptors to warrant gene therapy. Hum Gene Ther.24(12), 993-1006 (2013). Jacobson et al., Improvement and decline in vision with gene therapy in childhood blindness. N Engl J Med.372(20),1920-6 (2015). Häcker G., Redecke V., Häcker H. Activation of the immune system by bacterial CpG-DNA. Immunology.105(3), 245-51 (2002). Kinman, D.M., Takeshita, F., Fursel, I., Leifer, C., Ishii, K.J., Verthelyi, D., Gursel, M., CpG DNA: Recognition by and activation of monocytes. Micobes Infect.4, 897–901 (2002). Reyes-Sandoval A., Ertl H.C., CpG methylation of a plasmid vector results in extended transgene product expression by circumventing induction of immune responses. Mol Ther.9(2), 249-61 (2004). Talati A. J., Kim H. J., Kim Y. I., Yi A. K., English B. K, Role of bacterial DNA in macrophage activation by group B streptococci. Microbes Infect. 10(10-11):1106-13 (2008). Hyde et al., Nat Biotechnol. 26(5), 549-51 (2008). Yu D. Y., Cringle S. J., Su E. N., Yu P. K., Intraretinal oxygen levels before and after photoreceptor loss in the RCS rat. Invest Ophthalmol Vis Sci. 41(12):3999-4006 (2000). Yu D. Y., Cringle S., Valter K., Walsh N., Lee D., Stone J., Photoreceptor death, trophic factor expression, retinal oxygen status, and photoreceptor function in the P23H rat. Invest Ophthalmol Vis Sci. 45(6), 2013-9 (2004). Bhise, N.S., Shmueli, R.B., Gonzalez, J., Green, J. J., A novel assay for quantifying the number of plasmids encapsulated by polymer nanoparticles. Small 8, 367–373 (2012). Although the foregoing subject matter has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be understood by those skilled in the art that certain changes and modifications can be practiced within the scope of the appended claims.

Claims

THAT WHICH IS CLAIMED:

1. A method for treating a disease or condition of an eye in a subject in need of treatment thereof, the method comprising administering to the suprachoroidal space of the eye a particle composition comprising: (a) a poly(beta-amino ester) (PBAE) of formula (I) or formula (II):wherein: m and n are each independently an integer from 1 to 10,000; m1 is an integer selected from 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; m2 is an integer selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, and 20; q is an integer selected from 0 or 1; wherein –(CH2)m1-(C=C)q-(CH2)m2-CH3comprises a hydrophobic sidechain; R comprises a divalent radical comprising a biodegradable ester linkage and / or a bioreducible disulfide linkage; R’ is hydrophilic sidechain comprising a monovalent radical derived from a hydrophilic amine monomer; R” is monovalent radical derived from an amine-containing end capping group; and pharmaceutically acceptable salts thereof; and (b) DNA comprising at least one gene selected from ABCA4, MYO7A, USH1C, CDH23, PCDH15, SANS, CIB2, USH2A, GPR98, WHRN, CLRN1, TIMP3, PEDF, Prph2, BPDE,Bcl2, FGF-2, CNTF, Mertk, GUCY2D, AIPL1, RPGRIP, RPE65, LCA6, LCA10, a gene encoding an anti-VEGF protein, endostatin, angiostatin, and protein engineeredmimetics, antibodies, and protein fragments thereof, and a gene encoding an anti- complement protein and protein engineered mimetics, antibodies, and protein fragments thereof; wherein the polymer to the DNA has a mass ratio between about 10:1 to about 50:

1.

2. The method of claim 1, wherein n and m are each independently an integer having a range from 1 to 10,000, 1 to 1,000, 1 to 100, 1 to 30, 1 to 20, 1 to 15, and 1 to 10, 1 to 5, 1 to 4, 1 to 3, 1 to 2, and 1.

3. The method of claim 1 or claim 2, wherein R is selected from the group consisting of:wherein each p1, p2, and t is independently an integer selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10.

4. The method of any one of claims 1-3, wherein R’ is selected from the group consisting of:.

5. The method of any one of claims 1-4, wherein R” is selected from the group consisting of:

6. The method of any one of claims 1-5, wherein –(CH2)m1-(C=C)q-(CH2)m2- CH3is selected from the group consisting of:.

7. The method of any one of claims 1-6, wherein the particle composition further comprises lipid-polyethylene glycol (PEG).

8. The method of any one of claims 1-7, wherein the lipid-PEG is selected from the group consisting of 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol 2000 (DMG-PEG2k) and C18-PEG2k.

9. The method of any one of claims 1-8, the particle composition comprises a mass percent of lipid PEG from about 2 wt% to about 10 wt%, including about 2, 3, 4, 5, 6, 7, 8, 9, and 10 wt%.

10. The method of any one of claims 1-9, comprising administering to the suprachoroidal space of the eye a particle composition comprising: (a) a poly(beta-amino ester) (PBAE) polymer of formula (I):( ); wherein: n is an integer from 1 to 10,000; Ris selected fromR’ is selected from;R” is selected frompharmaceutically acceptable salts thereof; and (b) DNA comprising at least one gene selected from ABCA4, MYO7A, USH1C, CDH23, PCDH15, SANS, CIB2, USH2A, GPR98, WHRN, CLRN1, TIMP3, PEDF, Prph2, BPDE,Bcl2, FGF-2, CNTF, Mertk, GUCY2D, AIPL1, RPGRIP, RPE65, LCA6, LCA10, a gene encoding an anti-VEGF protein, endostatin, angiostatin, and protein engineered mimetics, antibodies, and protein fragments thereof, and a gene encoding an anti- complement protein and protein engineered mimetics, antibodies, and protein fragments thereof; wherein the PBAE to DNA has a mass ratio between about 10:1 to about 50:1.

11. The method of any one of claims 1-10, wherein the anti-VEGF protein is selected from VEGFR1 / sFLT-1, VEGFR2, and VEGFR3.

12. The method of any one of claims 1-11, wherein the DNA is selected from a minicircle plasmid DNA, a nanoplasmid DNA, and a close ended DNA.

13. The method of any one of claims 1-12, wherein the DNA is: (a) substantially free of bacterial elements; (b) about 1-4kbp, without the gene included; and / or, (c) substantially free of unmethylated CpG sequences.

14. The method of any one of claims 1-13, wherein the DNA includes a CAG promoter and one or more repeats of the 72-bp region, ggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaacca (SEQ ID NO: 1), of an SV40 enhancer.

15. The method of claim 14, comprising two or more repeats of the 72-bp region, ggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaacca (SEQ ID NO: 1), of an SV40 enhancer.

16. The method of any one of claims 1-15, wherein the DNA comprises a nanoplasmid comprising a gene of interest driven by a CAG promoter and one or more repeats of the 72-bp region, ggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaacca (SEQ ID NO: 1), of an SV40 enhancer, wherein the DNA is substantially free of bacterial genetic elements and unmethylated CpG sequences.

17. The method of any one of claims 1-16, wherein the PBAE of formula (I) is 457..

18. The method of any one of claims 1-17, wherein the PBAE of formula (I) is 447:.

19. The method of any one of claims 1-18, wherein the PBAE of formula (I) or formula (II) has a molecular weight having a range selected from between about 5,000 to about 40,000 Da, between about 5,000 to about 10,000 Da, between about 10,000 Da to about 20,000 Da, between about 20,000 Da to about 30,000 Da, and about 10,000 Da.

20. The method of any one of claims 1-19, wherein the particle composition has a size having a range selected from between about 50 nm to about 800 nm, about 100 nm to about 500 nm, about 100 nm to about 300 nm, and about 200 nm.

21. The method of any one of claims 1-20, wherein a mass ratio of the polymer to the DNA has a range between about 10:1 to about 50:1, about 15:1 to about 40:1, between about 20:1 to about 30:1, about 20:1, about 25:1, and about 30:

1.

22. The method of any one of claims 1 to 21, wherein the particle composition is administered to the suprachoroidal space of the eye of the subject using a specialized insertion tip, which may range from about 1-5 mm and the gauge may be about 25-35 G, with or without injection pumps.

23. The method of any one of claims 1 to 22, wherein the particle composition is administered to the suprachoroidal space of the eye of the subject via more than one injection at one or more injection sites.

24. The method of claim 23, wherein the more than one injections are administered during a single session.

25. The method of claim 24, wherein the single session comprises an outpatient visit.

26. The method of claim 25, further comprising a waiting period between the more than one injections.

27. The method of any one of claims 23 to 26, wherein the more than one injections are made via an autoinjector or injection pump.

28. The method of any one of claims 1-27, wherein the DNA has a concentration having a range between about 0.1 mg / mL to about 2.0 mg / mL, between about 0.2 mg / mL to about 1.0 mg / mL, between about 0.2 mg / mL to about 0.5 mg / mL, and between about 0.3 mg / mL to about 0.4 mg / mL.

29. The method of any one of claims 1, comprising an administration volume to the suprachoroidal space having a range between about 20 µL to 500 µL, between about 50 µL to 300 µL, and between about 50 µL to 100 µL.

30. The method of any one of claims 1 to 29, wherein the particle composition further comprises one or more of a sugar, a sugar alcohol, a salt, MgCl2, a buffer, a cryoprotectant, an excipient, and combinations thereof.

31. The method of claim 30, wherein the sugar is selected from the group consisting of glucose, fructose, sorbitol, mannitol, sucrose, trehalose, and raffinose.

32. The method of claim 31, wherein the sugar is selected from sucrose and trehalose.

33. The method of claim 30, wherein the one or more sugar alcohols comprise sorbitol.

34. The method of any one of claims 1-33, wherein the disease or condition of an eye is selected from the group consisting of Stargardt Disease, Usher Syndrome, Neovascular AMD, and other diseases that cause choroidal neovascularization, Diabetic retinopathy, Retinal vein occlusion, Retinitis pigmentosa, Leber congenital amaurosis, and Geographic atrophy.

Images