Adiponectin mRNA compositions and methods of using the same

Abstract

The present invention provides compositions including an adiponectin (APN) mRNA and a nanoparticle. The nanoparticle may be a lipid nanoparticle. The compositions may be incorporated into pharmaceutical compositions. Methods of using the compositions provided herein including methods of treating diabetes, type II diabetes, obesity, insulin resistance, hyperinsulinemia, hyperglycemia, adipokine dysregulation, periodontitis, metabolic syndrome, osteoporosis, non-alcoholic fatty liver disease, bone loss, or neurodegenerative disease.

Description

[0001] ADIPONECTIN mRNA COMPOSITIONS AND METHODS OF USING THE SAME CROSS REFERENCE TO RELATED APPLICATIONS This application claims priority benefit from U.S. Application Ser. No. 63 / 613,022, filed December 20, 2023. The entirety of which is incorporated herein by reference. REFERENCE TO A SEQUENCE LISTING Reference is made in the application to nucleotide and amino acid sequence via a SEQ ID NO: and these sequences are included at the end of the description and prior to the claims. A sequence listing (file name: 166118_01479.xml; size: 50,045 bytes; date generated: December 19, 2024) is hereby incorporated by reference in its entirety. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH This invention was made with government support under grants DK131444, DE26507, and DE30074 awarded by the National Institutes of Health. The government has certain rights in the invention. BACKGROUND The escalation of diabetes prevalence in the United States has reached alarming proportions. According to the 2020 National Diabetes Statistics Report by the Centers for Disease Control and Prevention (CDC), approximately 34.2 million Americans, constituting 10.5% of the population, now grapple with diabetes (1). Moreover, in 2018 alone, over 1.5 million new cases of diabetes were diagnosed in individuals aged 18 years and older in the United States, encompassing more than 210,000 children and teenagers under the age of 20 (2). Globally, an estimated 537 million individuals are affected by diabetes, with most cases attributed to type 2 diabetes (T2D) (2, 3). Key elements in the pathogenesis of T2D include insulin resistance and early hyperinsulinemia, contributing to a gradual decline in the pancreatic β-cells' ability to produce insulin. The intricate interplay between β-cell dysfunction and insulin resistance underscores the complexity of T2D (4). Consequently, T2D emerges as one of the most pervasive metabolic diseases on a global scale. 1    Contrary to their previous perception as passive fat deposits, adipocytes are now acknowledged as dynamic and multifaceted tissues with responsibilities in maintaining energy substrate balance and exhibiting intricate secretory functions linked to nutritional status (5, 6). Over time, these cells have evolved from passive repositories of fat into active endocrine organs (7). Adipokines, bioactive chemicals produced by adipocytes, play a pivotal role in this endocrine activity (8). The altered endocrine activities of adipose tissue have adverse effects on numerous adipocytokines, with adiponectin (APN) standing out as one of the most significant proteins secreted by adipocytes (9). Thus, there exist a need to better understand the role of APN in T2D and metabolic diseases more generally and additional methods of treating these diseases are needed. BRIEF SUMMARY OF THE INVENTION Compositions including adiponectin (APN) RNA and nanoparticles, and methods of using the same, are disclosed herein. In one aspect, a composition including an adiponectin mRNA and a nanoparticle is provided. In some embodiments, the APN mRNA includes SEQ ID NO: 1-2 or a sequence having at least 95% identity to SEQ ID NO: 1-2, or the APN mRNA encodes a polypeptide of SEQ ID NO: 3 or a polypeptide having at least 95% identity to SEQ ID NO: 3. The nanoparticle may be a lipid nanoparticle (LNP). In another aspect, a pharmaceutical composition is provided, in which the pharmaceutical composition includes APN-mRNA, a nanoparticle (optionally an LNP), and a pharmaceutically acceptable carrier. In yet another aspect, a method of treating a condition that could benefit from administering APN is provided. In some embodiments, the condition to be treated is a metabolic disorder. In some embodiments, the condition to be treated is a bone disorder, such as a metabolic bone disorder. In some embodiments, the method can be used to increase weight loss. 2    BRIEF DESCRIPTION OF THE DRAWINGS FIGS. 1A-1I. APN evaluation in vitro, with in vivo measurement of IPGTT, ITT, blood glucose and body weight in vivo. (FIG. 1A) C2C12 myotubes viability was assessed using the CCK8 assay. After transfection with APN-mRNA-LNP, the half maximal inhibitory concentration (IC50) was determined after 24 hours. (FIG. 1B) Relative APN Expression in differentiated Myotubes cell C2C12, (FIG. 1C) Relative APN Expression in Kidney mesangial cell SV40- MES13. APN gene expression was calculated based on the Law of Foldchange, which is 2−ΔΔCT. Fold-change values less than one indicate downregulation, whereas values greater than one indicate upregulation. Both biological and technical triplicates were performed in vitro. Values are mean ± SD. n = 9, student t-test. (FIG.1D) APN protein expression, three separate blot analyzes of the samples were conducted. (FIG. 1E) Optical densitometry was used to semi-quantify the bands, and ImageJ (1.53t) digital imaging processing software was used for analysis. GAPDH has been used as an endogenous control for protein expression. Protein levels are represented as mean ratio values quantified from protein bands of APN versus GAPDH compared to negative control. (n = 3, Mann-Whitney U tests), Significances are shown above bars:††P < 0.01 vs. negative control (NC),**P < 0.01 vs. positive control (PC) “PBS” and##P < 0.01 vs. Empty-LNP. (FIG.1F) IPGTT with AUC of IPGTT, (FIG.1G) ITT curve with AUC of ITT. The IPGTT and insulin ITT were utilized at 23 weeks old, to evaluate glucose tolerance and insulin sensitivity, respectively to depict significant changes between groups, the area under the curve (AUC) of IPGTT and ITT was calculated by the trapezoid method. Values are mean ± SD. n = 5 each group, Mann-Whitney U tests,**P < 0.01 vs. PBS control group, NS; Non-significant. (FIG.1H) Blood glucose levels at different time points were evaluated by glucometer; (FIG.1I) Body weight at different time points. Values are mean ± SD. n = 5 each group, Mann-Whitney U tests,**P < 0.01 vs. PBS control group and##P < 0.01 vs. Empty-LNP group. FIGS. 2A-2B. APN in situ expression. (FIG. 2A) APN gene expression in different tissues. Skeletal muscles; Liver; Kidney; White fats; Brown fats. APN gene expression was calculated based on the Law of Fold-change, which is 2−ΔΔCT. Fold-change values less than one indicate downregulation, whereas values greater than one indicate upregulation. In vivo, a total of five biological samples (n = 5) were collected. Of each sample, three replicates were performed technically.,**P < 0.01 vs. PBS control group and##P <0.01 vs. Empty-LNP group. (FIG. 2B) Immunohistochemical staining for adiponectin in T2D skeletal muscles, liver, and kidney mice in 3    the studied groups. Negative controls were performed by blocking PBS without APN-Ab. Treated groups were performed by blocking with APN-Ab (200X). Labeling index was used to determine APN-Ab percentile expression (the ratio of positively stained cells / total cells × 100). Blinded staining intensity scores were assigned to each specimen based on arbitrary values of 1, 2, or 3 (reflecting weak, intermediate, and bright staining). A total of five biological samples (n = 5) were collected; three sections were taken from each sample. Scale bar= 50 μm. FIG. 3. Summary of the studied gene expression in the different studied tissues. The diagram was built based on the data from the Mouse Genome Database (MGD) and the Gene Expression Database (GXD). informatics.jax.org. FIGS. 4A-4E. Relative gene expression in different tissues. (FIG. 4A) Glut-4 gene in differentiated myotubes cell C2C12, Kidney mesangial cell SV40-MES13, Skeletal muscles, Liver, Kidney, White fats, and Brown fats. For each tissue type the legend from top to bottom is organized in the graph from left to right. (FIG. 4B) DGKd gene in differentiated myotubes cell C2C12, Kidney mesangial cell SV40-MES13, Skeletal muscles, Liver, and Kidney are shown in the graphs from left to right. Within each tissue the legends from top to bottom show the organization of treatments from left to right. (FIG.4C) PKCe gene in differentiated myotubes cell C2C12, Kidney mesangial cell SV40-MES13, Skeletal muscles, Liver, Kidney, White fats, and Brown fats are shown in the graphs from left to right. Within each tissue, the legends from top to bottom show the organization of treatments from left to right. Gene expression was calculated based on the Law of Fold-change, which is 2−ΔΔCT. Fold-change values less than one indicate downregulation, whereas values greater than one indicate upregulation. Both biological and technical triplicates were performed in vitro. Values are mean ± SD. n = 9, student t-test. In vivo, a total of five biological samples (n = 5) were collected. Of each sample, three replicates were performed technically. (FIG.4D) Glut-4, DGKd, and PKCe protein expression, three separate blots for analysis of the samples were conducted. (FIG. 4E) Optical densitometry was used to semi- quantify the bands, and ImageJ (1.53t) digital imaging processing software was used for analysis. GAPDH has been used as an endogenous control for protein expression. Protein levels are represented as mean ratio values quantified from protein bands of the targeted protein versus GAPDH compared to negative control. (n = 3, Mann-Whitney U tests), Significances are shown above bars:††P < 0.01 vs. negative control (NC),**P < 0.01 vs. positive control (PC) “PBS” and##P < 0.01 vs. Empty-LNP. 4    FIGS.5A-5E. Relative insulin receptor (IR) expression in different studied tissues. The legend from top to bottom is shown from left to right in the graphs. (FIG. 5A) Differentiated Myotubes cell C2C12; (FIG. 5B) Kidney mesangial cell SV40-MES13; (FIG. 5C) Skeletal muscles; (FIG.5D) Liver; (FIG.5E) Kidney. IR gene expression was calculated based on the Law of Fold-change, which is 2−ΔΔCT. Fold-change values less than one indicate downregulation, whereas values greater than one indicate upregulation. Both biological and technical triplicates were performed in vitro. Values are mean ± SD. n = 9, student t-test. In vivo, a total of five biological samples (n = 5, student t-test) were collected. Of each sample, three replicates were performed technically. Significances are shown above bars. FIGS. 6A-6B. Pancreas sections in the studied groups. (FIG. 6A) Pancreas sections focusing on islands of Langerhans diameter (H&E stain, 200X & 400X). (FIG. 6B) Islands of Langerhans average diameter; the diameter average was taken from seven fields on the same slide (n = 7, student t-test), Significances are shown above the bars:**P < 0.01 vs. the PBS and##P < 0.01 vs. Empty-LNP. Scale bar= 50 μm. FIGS.7A-7E. EGFR expression in vitro and in vivo. The legends from top to bottom show the treatments in each graph from left to right. (FIG.7A) Relative EGFR Expression in different Differentiated Myotubes cell C2C12; (FIG.7B) Kidney mesangial cell SV40-MES13; (FIG.7C) kidney. EGFR gene expression was calculated based on the Law of Fold-change, which is 2−ΔΔCT. Fold-change values less than one indicate downregulation, whereas values greater than one indicate upregulation. Both biological and technical triplicates were performed in vitro. Values are mean ± SD. n = 9, student t-test. In vivo, a total of five biological samples (n = 5, student t-test) were collected. Of each sample, three replicates were performed technically. Significances are shown above bars. (FIG. 7D) Overall correlation between APN and EGFR gene expression in kidney. (FIG.7E) Light microscopic appearance in kidney tissue section of the studied groups of DIO mice, (thick arrow) indicates Hyperplasia of partial cells in the Bowmans capsule of the glomeruli and (line arrow) indicates mild diffuse mesangial matrix expansion (PAS stain, 1000X). A total of five biological samples (n = 5, student t-test) were collected; three sections were taken from each sample. Scale bar= 50 μm. FIGS. 8A-8E. Relative gene expression of the pro-inflammatory cytokines. (FIG. 8A) TNFα gene in differentiated myotubes cell C2C12, Kidney mesangial cell SV40-MES13, Skeletal muscles, Liver, Kidney, White fats, and Brown fats. The legends from top to bottom represent the 5    treatment groups from left to right. (FIG. 8B) IL-6 gene in differentiated myotubes cell C2C12, Kidney mesangial cell SV40-MES13, Skeletal muscles, Liver, Kidney, White fats, and Brown fats. The legends from top to bottom represent the treatment groups from left to right. (FIG.8C) IL-1β gene in differentiated myotubes cell C2C12, Kidney mesangial cell SV40-MES13, Skeletal muscles, Liver, Kidney, White fats, and Brown fats. The legends from top to bottom represent the treatment groups from left to right. Gene expression was calculated based on the Law of Fold- change, which is 2−ΔΔCT. Both biological and technical triplicates were performed in vitro. Values are mean ± SD. n = 9, student t-test. In vivo, a total of five biological samples (n = 5) were collected. Of each sample, three replicates were performed technically. (FIG. 8D) Glut-4, TNFα and IL-6 protein expression, three separate blot analysis of the samples were conducted. (FIG.8E) Optical densitometry was used to semi-quantify the bands, and ImageJ (1.53t) digital imaging processing software was used for analysis. GAPDH has been used as an endogenous control for protein expression. Protein levels are represented as mean ratio values quantified from protein bands of the targeted protein versus GAPDH compared to negative control. (n = 3, Mann-Whitney U tests), Significances are shown above bars:††P < 0.01 vs. negative control (NC),**P < 0.01 vs. positive control. FIGS.9A-9E. Histopathology results in the studied groups. (FIG.9A) shows longitudinal section of the skeletal muscles of the femur, ranks score were used to represent the marked focal degeneration of the skeletal muscle bundles, which signed with different amount of “+” depending on how many other categories lay between these border parameters “weak” (+), “moderate” (++), “strong” (+++) and their variations. (FIG. 9B) shows liver samples; (FIG. 9C) shows light microscopic appearance in the kidney tissue section (H&E stain, 200X); black arrows indicate fat degenerations, while yellow thicker arrows indicate hydropic degenerations. (FIG.9D) Percentile of steatosis and hydropic degeneration in the liver of the studied mouse groups; (FIG. 9E) Percentile of tubular degeneration in the kidney of the studied mouse groups. The percent of fat degeneration in different samples and / or hydropic degeneration was calculated depending on Labeling index (the ratio of positively stained cells / total cells×100). A total of five biological samples (n = 5, student t-test) were collected; three sections were taken from each sample. Scale bar= 50 μm. FIG. 10. Conclusion based on our hypothesis. The alpha and beta cells of the islet of Langerhans work together to control and regulate glucose uptake, gluconeogenesis, and lipolysis 6    in normal conditions. There are several abnormal features associated with type 2 diabetes, including increased adiposity, inflammation, insulin resistance, and decreased adipose tissue function. Thus, adiponectin (APN) production is reduced. As a result of the inhibition of adiponectin receptors (AdipoR1 / AdipoR2) and subsequent association with adapter proteins, glucose uptake is inhibited by APPL1Rab5 or APPL1-AMP-AMPK-mediated translocation of glucose transporter 4 (GLUT4), resulting in an activation of insulin resistance signaling. Insulin resistance is commonly characterized by decreased GLUT4-dependent glucose absorption in skeletal muscles and adipose tissue. A temporal increase in intracellular diacylglycerol (DAG) mass is associated with glucose-induced insulin resistance. Prolonged elevation of intracellular DAG activates protein kinase C (PKC) isoforms, leading to insulin resistance, intracellular lipid accumulation, and impaired signal transmission. Glucose transport is downregulated due to increased PKC-mediated serine phosphorylation of the insulin receptor (IR) and insulin receptor substrate 1 (IRS-1). Controlling hyperglycemia can reverse the decline in diacylglycerol kinase delta (DGKd) protein and DGK kinase activity. Moreover, insulin resistance and diabetic nephropathy (DN) in T2D are associated with epidermal growth factor receptor (EGFR) activation. This activation increases immune cell infiltration and oxidative stress in the kidney and adipose mass while simultaneously reducing pancreatic insulin synthesis and adipocyte adiponectin production. Inhibition of EGFR decreases the expression of proinflammatory cytokines (iNOS, TNF-α, INF-γ, IL-6). As a result of the administration of APN-mRNA-LNP, we have found that all previous targets have been successfully corrected. The result was improvements in several aspects of diabetes pathogenesis, including glucose uptake, insulin resistance, inflammation, and diabetic complications. FIGS. 11A-11J. Physiochemical properties, transfection evaluations, and intracellular uptake of the nanoparticles. (FIG.11A) A schematic to present the composition of AA3-Dlin in LNPs used in this study for mRNA delivery and a representative TEM image of LNPs (scale bar: 100 nm). (FIG.11B) The physiochemical characterization of APN mRNA-LNPs: including size, polydispersity index (PDI), zeta, and mRNA encapsulation efficacy. (FIG. 11C) The cell transfection efficacy of mCherry and mRNA-LNPs, the cell images were captured by fluorescence microscope at pre-set time points. (FIG.11D). The population summary of mCherry-positive cells, compared to PBS as an empty control group. All experiments were repeated in triplicate and the results were represented as means ± SD. FIGS.11E-11J show characterization of physiochemical 7    properties, transfection evaluations, and intracellular uptake of a different nanoparticle. (FIG. 11E) LNPs size distribution tested by DLS. (FIG. 11F) LNPs transfection efficacy evaluated on Hek 293 cells by delivering mCherry encoded mRNA, the fluorescence images were taken after 2 days post transfection. (FIG. 11G) TEM images of LNPs (scale bar, 100 nm). (FIG. 11H) Physicochemical characterization of LNPs. (FIG. 11I) Cytotoxicity evaluation of LNPs with different dose on Hek 293 cell line. (FIG.11J) mRNA release profile from LNPs. All experiments were repeated in triplicate to generate results and data are shown as mean ± SD. FIGS. 12A-12G. (FIG. 12A) Bioluminescence images of AA3-DLin mLuc-LNPs (n=3) treated BALB / c mice. (FIG. 12B) Comparison of the transfection efficacy of different FDA- approved LNP formulations. The luciferase expression was recorded after 6 h post-administration. (FIG.12C) Western Blot analysis of spike protein expression by AA3-DLin vaccines. (FIG.12D) Immunofluorescent staining of spike protein after transfection by AA3-DLin vaccines. (FIG.12E) AA3-DLin vaccines induced robust SARS-CoV-2 spike-specific antibody endpoint titers in the immunized mice. (FIG.12F) IC50 titers of spike pseudovirus neutralizing antibody. (FIG. 12G) PRNT50 titers of AA3-DLin vaccines in the immunized mouse sera. Data are displayed as means ± SD. A one-way ANOVA with multiple comparison tests and unpaired t-test for comparison of two groups were used to analyze the statistical significance (ns, not significant; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001). FIGS. 13A-13I. Transfection with APN-LNP increased Adiponectin expression and inhibited expression of markers related with adipogenesis in different stages of 3T3-L1. (FIG. 13A) Schematic overview of the synthesis of APN-LNP. Evaluation of cytotoxicity of APN-LNP by CCK8 assay in preadipocytes and mature adipocytes transfected for 24 h. Preadipocytes (FIG. 13B) and mature adipocytes (FIG. 13C) were transfected with APN-LNP (0.25 μg / ml) for 24 h, with empty-LNP as the control. mRNA expression levels of APN and adipogenesis related markers, Pparγ, Hsl and Lpl were evaluated by qPCR and normalized with GAPDH in preadipocytes (FIG.13D) and mature adipocytes (FIG.13E). APN protein expression in cellular lysates (FIG. 13F) and cell culture medium (FIG. 13G) of mature adipocytes was analyzed by western blot. Preadipocytes and mature adipocytes were transfected with APN-LNP for 24 h. Quantitative analysis of protein expression (FIG. 13H) and (FIG. 13I) was shown. Data are expressed at three biological independent experiments. *p < 0.05, **p < 0.01 and ***p < 0.001. 8    FIG.14. Cytotoxicity of APN-LNP on the MC3T3-E1 cell line. MC3T3-E1 cells were transfected with APN-LNP (0.25 and 1.0 μg / ml) for 24 h in OPTI medium and further incubated in AMEM. The empty-LNP was used as a control. Data are expressed as mean ± SD at three biological independent experiments. *p < 0.05, **p < 0.01 and ***p < 0.001. FIGS.15A-15D. Transfection with APN-LNP promoted osteogenesis in MC3T3-E1 and inhibited Mmp9 expression in RANKL-stimulated RAW264.7 cells. (FIG.15A) MC3T3-E1 cells were transfected with APN-LNP (0.25 and 1.0 μg / ml) for 24 h in OPTI medium and further incubated in AMEM. Adiponectin mRNA expression was evaluated at 24 h, 72 h, 120 h and 240 h by qPCR. Osteogenesis related markers Bsp (FIG. 15B) and Ocn (FIG. 15C) expression in MC3T3-E1 were evaluated at 24 h. RAW264.7 cells were transfected with APN-LNP (0.25 μg / ml) for 12 h and further incubated in AMEM stimulated with 100 μg / ml RANKL for 24 h and 72 h respectively. The empty-LNP was used as a control. (FIG. 15D) Adiponectin and Mmp9 gene expression were evaluated respectively by qPCR. Data are expressed at three biological independent experiments. *p < 0.05, **p < 0.01 and ***p < 0.001. FIGS.16A-16D. Schematic representation of (FIG.16A) surgical procedure of 0.25 mm defect using RISystem Internal Fixation System and (FIG. 16B) surgery timeline of the femoral fracture model in male DIO mice. (FIG. 16C) 3D images of the three groups at 4 weeks post- surgery. (FIG.16D) The results of BV / TV (%), Tb. N, Tb. Th, and Tb. Sp. *p < 0.05 and **p < 0.01. n = 4 for all groups. FIGS.17A-17C. Schematic Histopathology results of fractured femurs, body weight and blood glucose. (FIG.17A) H&E staining of femoral defects 4 weeks after surgery. Fasting blood glucose (FIG.17B) and body weight (FIG.17C) of the experimental mice at different timepoints. *p < 0.05 and **p < 0.01. n = 4 for all groups. FIGS. 18A-18C. Histopathology results of liver tissues and gene expression of some markers in different organs of experimental groups 4 weeks after surgery. (FIG. 18A) H&E staining of liver tissues. (FIG. 18B) Gene expression of osteogenic markers Bsp and Runx2 in contralateral femur tissues. (FIG. 18C) Gene expression of anti-inflammatory markers IL-10 as well as proinflammatory markers TNFα in WAT. n = 4 for all groups. FIG.19. Schematic overview of the synthesis and action of APN-LNP. Transfection with APN-LNP inhibited adipogenesis in 3T3-L1 adipocytes and Mmp9 expression in RANKL- stimulated RAW264.7 cells. APN-LNP enhanced osteogenesis in MC3T3-E1 cells. In vivo, the 9    intravenous injection of APN-LNP promoted bone healing in a femoral fracture model of DIO mice. Application of APN-LNP decreased fasting blood glucose and body weight, increased IL- 10 expression in white adipose tissues and inhibited hepatocellular steatosis, which improved obesity, metabolic function and inflammation in the DIO mice. DETAILED DESCRIPTION Compositions including an adiponectin (APN) mRNA packaged in a lipid nanoparticle are provided here. The compositions may be administered to subjects via injection to treat conditions including metabolic syndrome, diabetes, type II diabetes, obesity, insulin resistance, hyperinsulinemia, hyperglycemia, adipokine dysregulation, bone regeneration, or bone repair. The compositions may result in weight loss in the subjects administered the compositions and may allowed for glucose regulation to be restored. The administration of the compositions provided here results in at least one of Glut-4 reactivation, improvement in the Insulin Resistance, increased DGKd, decreased PKCε, insulin receptor activation, activation of insulin secretion through the reactivation of the islets of Langerhans, EGFR inhibition, reduction of inflammatory cytokines (TNF-α, IL-1β, IL-6), decrease blood glucose levels, and reduction of hepatocellular steatosis as compared to a subject not administered the composition. Lipid nanoparticles Lipid nanoparticles are able to deliver therapeutic agents and have been shown to be useful in a variety of systems. For instance, LNPs can be used to deliver mRNA encoding antiviral proteins, such as interferons, or to delivery CRISPR / Cas9 systems for gene editing to target viral genomes to treat viral infections. LNPs can be used to treat a variety of conditions, including viral, bacterial, or fugal infections, neurological disorders, cancer, or regenerative medicine. As used herein, the term “lipid nanoparticle” is a spherical vesicle made of lipids. The lipids can be cationic, ionizable, phospholipids, or cholesterol. LNPs can be made up of various types of lipids, including but not limited to ionizable lipids, helper or neutral lipids, sterol lipids, cholesterol, and lipids attached to polyethylene glycol (PEG). The lipid composition may comprise proteolipids (e.g., protamine), carrier proteins, and / or small molecules. The lipid composition may comprise a single lipid group or multiple lipid groups. Nonlimiting examples of lipid groups 10    include cationic lipids, anionic lipids, neutral lipids, polyethylene glycol (PEG)ylated lipids, ionizable lipids, helper lipids, stealth lipids, or cholesterols. Nonlimiting examples of lipids include DOSPA 2,3-dioleyloxy-N-[2- (sperminecarboxamido)ethyl]-N,N-dimethyl-1-propanaminium trifluoroacetate, DOTMA 1,2- di- O-octadecenyl-3-trimethyl ammonium propane, DOTAP 1,2-Dioleoyl-3- trimethyalammoniumpropane, and DC-Cholesterol 313-[N-(N',N'-dimethylaminoethane)carbamoyl] cholesterol. Nonlimiting examples of ionizable lipids include SM-1029-Heptadecanyl 8-((2- hydroxyethyl)(6-oxo-6- (undecyloxy)hexyl)amino)octanoate, ALC-0315 4- hydroxybutyl)azanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) Dlin-MC3-DMA, (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,2823icol23htraen-19-yl4-(dimethylamino) butanoate, and DODMA 1,2-Dioleyloxy-3-dimethylamino propane. Nonlimiting examples of helper lipids include cholesterol (1R,3aS,3bS,7 S,9aR,9bS, 11aR)-9a,11a-Dimethyl-1-[(2R)-6- methylheptan-2-yl]- 2,3,3a,3b,4,6,7,8,9,9a,9b,10,11,11a-tetradecahydro -1H- cyclopen23icoll23hrenethren-7-ol DSPC 1,2-distearoyl-sn-glycero-3-phosphocholine, and DOPE 1,2-Dimyristoyl-sn glycerophosphoethanolamine. Nonlimiting examples of stealth lipids include PEGIG (R)-2,3- bis(myristoyloxy)propyl-1-(methoxy poly (ethylene glycol) 2000) carbamate and ALC-0159 2-[(polyethylene glycol)-2000]-N,N- ditetradecylacetamide. In some embodiments, LNPs are made of AA3-Dlin, DOPE, Cholesterol, and DMG-PEG 2000. The molar ratios of the lipids used in lipid nanoparticles may vary. In Example 1, the lipid nanoparticles used comprise a molar ratio of 40:40:25:0.5 (AA3-Dlin: DOPE: Cholesterol: DMG-PEG). Lipid nanoparticles may range in size from approximately 20nm to 500nm, 30 nm to 250 nm, 50nm to 200 nm or any range between those contemplated here. The average size of lipid nanoparticles may be approximately 100 nm or between 90nm and 110nm or between 80nm and 120nm. Lipid nanoparticles can also be characterized by a polydispersity index (PDI), which is a measure of the distribution of the molecular mass in a given polymer sample. Lipid nanoparticles can be further characterized by their zeta potential, which is defined as the electrical potential at its surface. In Example 1, the average size of the LNP is 96.5 nm, the PDI is 0.166, and the zeta potential is -3.5 mV. In Example 2, AA3-DLin LNPs are used, and are fabricated using microfluidic-chip device by mixing the organic phase containing ionizable lipid, DOPE, cholesterol, and DMG-PEG and the water phase of mRNA. The average size of the LNP is 100 11    nm, with PDI of 1.56, and the zeta potential is -4.6 mV. The lipid nanoparticle can be a self- assembly lipid-polymer nanoparticle. Nanoparticles of the present invention may be modified by any means known in the art. In some embodiments, the nanoparticle may be modified to decrease degradation or filtration or to increase evasion, function or targeting. Nanoparticles may also be modified to increase contact, binding or internalization by target cells. Nanoparticles may be modified with a variety of ligands such as small molecules, surfactants, dendrimers, polymers, and biomolecules. LNPs having any such modification are encompassed within the invention. Nanoparticles are not limited to lipid nanoparticles. Other nanoparticles include, but are not limited to, polymer-based nanoparticles, inorganic nanoparticles, and hybrid nanoparticles. Polymer-based nanoparticles, such as polymeric micelles, liposomes, and dendrimers, can be engineered for controlled drug released and improved stability. Inorganic nanoparticles, such as gold nanoparticles, iron oxide nanoparticles, and silica nanoparticles, can be used for various applications including imaging, drug delivery, and therapy. Hybrid nanoparticles combine features of different types of nanoparticles, such as lipid-polymer nanoparticles or inorganic-polymer hybrid nanoparticles, offering unique properties and functionalities. Furthermore, the nanoparticles may be further modified with various functional groups, such as targeting ligands (e.g., antibodies, peptides) to enhance cellular uptake and specificity, or with fluorescent dyes for imaging and tracking purposes. LNPs may be used to deliver therapeutic agents like small molecules, nucleic acids, and proteins such as monoclonal antibodies. They can protect drugs from degradation, increase their solubility, and enable targeted delivery. Lipid nanoparticles can encapsulate mRNA. In some cases, the LNPs are used to transport mRNA. There can be one or more types of mRNA present in an LNP. In some cases, the LNP can encapsulate a reporter gene, such as mCherry, and a therapeutic gene, such as Adiponectin. LNPs containing a therapeutic gene can be referred to as therapeutic LNPs. Lipid nanoparticles can be encapsulated into a lipid nanoparticle or a rapidly eliminating lipid nanoparticle and the lipid nanoparticles or a rapidly eliminating lipid nanoparticle can then be encapsulated into a polymer, hydrogel and / or surgical sealant described herein and / or known in the art. Alternatively, the lipid nanoparticles can be formulated for sustained release (e.g., on the scale of hours, days, weeks, months, or years). Polynucleotides and proteins / peptides 12    The terms "polynucleotide" or "nucleic acid" are used interchangeably herein and refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. Thus, this term includes, but is not limited to, single-, double- or multi-stranded DNA or RNA, genomic DNA, DNA-RNA hybrids, or a polymer comprising purine and pyrimidine bases, or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. These terms also refer to complementary DNA (cDNA), which is DNA synthesized from a single- stranded RNA (e.g., messenger RNA (mRNA) or microRNA (miRNA)) template in a reaction catalyzed by the enzyme reverse transcriptase. The backbone of the polynucleotide can comprise sugars and phosphate groups (as may typically be found in RNA or DNA) or modified or substituted sugar or phosphate groups. Alternatively, the backbone of the polynucleotide can comprise a polymer of synthetic subunits such as phosphoramidates and thus can be an oligodeoxynucleoside phosphoramidate (P--NH2) or a mixed phosphoramidate-phosphodiester oligomer. Other polynucleotide modifications include modified nucleosides such as pseudouridine, N1-methylpseudouridine, 5-methylcytidine, 5-methyluridine, 2’-O-methyluridine, 2-thiouridine, and N6-methyladenosine. In addition, a double-stranded polynucleotide can be obtained from the single stranded polynucleotide product of chemical synthesis either by synthesizing the complementary strand and annealing the strands under appropriate conditions, or by synthesizing the complementary strand de novo using a DNA polymerase with an appropriate primer. Polynucleotide sequences provided herein are provided as the cDNA encoding for the APN-mRNA of interest (SEQ ID NO: 1 (human) and SEQ ID NO: 4 (mice)). APN is a large alternatively spliced protein so other isoforms or alleles found in the same species as the subject may be used in the compositions and methods disclosed here. In some embodiments, specific modifications include substituting cytidine residues with 5-Methylcylidine and uridine residues with pseudouridine. In some embodiments, specific modifications include at least one of a poly(A) tail and a 7-methylguanylate cap. In some embodiments, modifications include substituting cytidine, substituting uridine, a poly(A) tail, and a 7-methylguanylate cap in the same RNA strand. These modifications can decrease anti-RNA immune response and enhance RNA stability. As used herein, the term “encoding” refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined 13    sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA. In the present disclosure, the cDNA sequence (SEQ ID NO: 1 and 4), mRNA sequence (SEQ ID NO: 2 and 5), and protein sequence for Adiponectin (SEQ ID NO: 3 and 6) in human and mice are provided. In some embodiments, an mRNA capable of encoding SEQ ID NO: 3 or SEQ ID NO: 6 are administered to a subject. The term "sequence identity" as used herein refers to the extent that sequences are identical on a nucleotide-by-nucleotide basis or an amino acid-by-amino acid basis over a window of comparison. Nucleic acid and protein sequence identities can be evaluated by using any method known in the art. For example, the identities can be evaluated by using the Basic Local Alignment Search Tool (“BLAST”). The BLAST programs identity homologous sequences by identifying similar segments between a query amino or nucleic acid sequence and a test sequence which is preferably obtained from protein or nuclei acid sequence database. The BLAST program can be used with the default parameters or with modified parameters provided by the user. The term "percentage of sequence identity" is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G) or the identical amino acid residue (e.g., Ala, Pro, Ser, Thr, GIy, VaI, Leu, lie, Phe, Tyr, Trp, Lys, Arg, His, Asp, GIu, Asn, GIn, Cys and Met) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity. The term "substantial identity'' of polynucleotide sequences means that a polynucleotide comprises a sequence that has at least 95% sequence identity to the polynucleotide encoding the polypeptide of interest described herein. Alternatively, percent identity can be any integer from 95% to 100%. In one embodiment, the sequence identity is at least 95%, alternatively at least 99%. More preferred embodiments include at least: 96%, 97%, 98%,99% or 100% compared to a reference sequence using the programs described herein; preferably BLAST using standard 14    parameters, as described. These values can be appropriately adjusted to determine corresponding identity of proteins encoded by two nucleotide sequences by taking into account codon degeneracy, amino acid similarity, reading frame positioning and the like. In some preferred embodiments, the term "substantial identity" of amino acid sequences for purposes of this invention means polypeptide sequence identity of at least 95%, preferably 98%, most preferably 99% or 100%. Preferred percent identity of polypeptides can be any integer from 95% to 100%. More preferred embodiments include at least 96%, 97%, 98%, 99%, or 100%. Thus, the APN mRNAs in the compositions may be SEQ ID NO: 1-2 or a sequence having at least 95% identity to SEQ ID NO: 1-2 or maybe an mRNA encoding a polypeptide of SEQ ID NO: 3 or a polypeptide having at least 95% identity to SEQ ID NO: 3. As used herein, the term “isolated” means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring). For example, a naturally occurring polynucleotide or polypeptide present in a living microorganism is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated. Such polynucleotides could be part of a composition and still be isolated in that such composition is not part of its natural environment. Pharmaceutical Compositions As used herein, “pharmaceutical composition” refers to the combination of an active agent, compound, or ingredient with a pharmaceutically acceptable carrier or excipient, making the composition suitable for diagnostic, therapeutic, or preventive use in vitro, in vivo, or ex vivo. As used herein, “pharmaceutically acceptable carrier or excipient” refers to a carrier or excipient that is useful in preparing a pharmaceutical formulation that is generally safe, non-toxic, and is neither biologically or otherwise undesirable, and includes a carrier or excipient that is acceptable for veterinary use as well as human pharmaceutical use. A “pharmaceutically acceptable carrier or excipient” as used in the specification and claims includes both one and more than one such carrier or excipient. As used herein, “pharmaceutically acceptable salt” refers to any acid or base addition salt whose counter-ions are non-toxic to the subject to which they are administered in pharmaceutical doses of the salts. The term "therapeutic" agent (e.g., a therapeutic polypeptide, nucleic acid, or transgene) is one that provides a beneficial or desired clinical result, such as the exemplary clinical results 15    described in the Examples attached hereto. As such, a therapeutic agent may be used in a treatment as described herein. In some embodiments, the polynucleotide comprises an APN sequence. The terms “treatment”, “treating” and the like are used herein to generally mean obtaining a desired pharmacologic and / or physiologic effect. The effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and / or may be therapeutic in terms of a partial or complete cure for a disease and / or adverse effect attributable to the disease. “Treatment” as used herein covers any treatment of a disease in a mammal and includes: (a) preventing the disease from occurring in a subject which may be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development; or (c) relieving the disease, i.e., causing regression of the disease. The therapeutic agent may be administered before, during or after the onset of disease or injury. The treatment of ongoing disease, where the treatment stabilizes or reduces the undesirable clinical symptoms of the patient, is of particular interest. The subject therapy will desirably be administered during the symptomatic stage of the disease, and in some cases after the symptomatic stage of the disease. In the present disclosure, compositions including adiponectin (APN) mRNA and a lipid nanoparticle are described. The APN-mRNA may be taken up by the lipid nanoparticle to increase stability and ability to administer the APN-mRNA to a subject. The composition of the APN mRNA may include SEQ ID NO: 1-2 or a sequence having at least 95% identify to SEQ ID NO: 1-2 or is capable of encoding SEQ ID NO: 3. APN-mRNA may include at least one nucleotide modification. The composition may further include a pharmaceutically acceptable carrier. Methods of Treatment As used herein, a “subject in need thereof” refers to a subject that may benefit from the administration of the disclosed constructs or compositions, e.g., subjects who have been diagnosed with a metabolic disorder, or subjects with symptoms of a metabolic disorder or those in need of weight loss or bone regeneration. The subject may be a human or a non-human animal, such as a dog or cat. The compositions may be administered once, twice or multiple times. If multiple times, the composition may be administered with a required frequency such as one a week, every other week, once a month, once every other month, once a quarter or annually to tret the condition. The administration amount and schedule may be different depending on the condition being treated in the subject. 16    A “therapeutically effective amount” refers to the amount or dose of the pharmaceutical composition that, upon single or multiple dose administration to the subject, provides the desired effect in the subject under diagnosis or treatment. The disclosed methods may include administering an effective amount of the disclosed compounds to treat or alleviate symptoms of metabolic disorders. The exact dosage is chosen by the individual physician in view of the patient to be treated. Dosage and administration are adjusted to provide sufficient levels of the active agent(s) or to maintain the desired effect. Additional factors which are taken into account include the severity of the disease state, e.g., extent of the condition, history of the condition; age, weight and gender of the patient; diet, time and frequency of administration; drug combinations; reaction sensitivities; and tolerance / response to therapy. For any active agent, the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, usually mice, rabbits, dogs, or pigs. The animal model is also used to determine a desirable concentration range and route of administration. “Therapeutically effective amount” further refers to an amount that does not induce excessive adverse side effects, such as effects (such as toxicity, irritation, and allergic response) commensurate with a reasonable benefit / risk ratio when used in the manner of the present disclosure. In some embodiments, the pharmaceutical compositions of the present disclosure are formulated for administration by subcutaneous injection. In some embodiments, the pharmaceutical compositions of the present disclosure are formulated for administration by intravenous or intramuscular injection. Although not required, the compositions may optionally be supplied in unit dosage form suitable for administration of a precise amount. The administration of the compositions may increase the expression of APN protein after administration of the composition in a tissue selected from the group consisting of muscle, liver, pancreas, kidney and fat. Methods of Treating Metabolic Bone Disorders and Inflammation “Metabolic disorder” refers to a disorder that negatively alters a subject’s metabolic processes. Examples of metabolic disorders include by are not limited to diabetes, type II diabetes, obesity, hyperinsulinemia, hyperglycemia, adipokine dysregulation, and obesity. Symptoms of metabolic disorders include weight loss or weight gain, lethargy, and excessive thirst. Effects of metabolic disorders include but are not limited to dysregulation of insulin receptor activation, dysregulation of insulin secretion, insulin resistance, altered glucose uptake, diabetic nephropathy 17    symptoms, fat (hydropic) degradation in muscles, liver, and kidneys, and increased inflammatory cytokines. Metabolic disorders can also cause chronic inflammation, decline in pancreatic β cell’s ability to produce insulin, and increase of oxidative stress in the kidneys. The administration of the composition may result in at least one of Glut-4 reactivation, improvement in the Insulin Resistance, increased DGKd, decreased PKCε, insulin receptor activation, activation of insulin secretion through the reactivation of the islets of Langerhans, EGFR inhibition, reduction of inflammatory cytokines (TNF-α, IL-1β, IL-6), decrease blood glucose levels, and reduction of hepatocellular steatosis as compared to a subject not administered the composition. In some embodiments, the subject is in need of a treatment for inflammation. Inflammation refers to the release of pro-inflammatory cytokines from immune-related cells and the activation of the innate immune system. The tissue inflammatory response caused by bacteria, trauma, toxins, heat, or other factors, can potentially activate the innate immune responses. Innate immune responses are capable of not only combating infectious microbes but also contributing to pathological situations, such as sepsis, obesity, atherosclerosis, autoimmunity, osteoarthritis, and cancer. In some embodiments, the subject has chronic inflammation. Chronic inflammation refers to a slow, long-term inflammation lasting several months to years. Chronic inflammation may be associated with a number of inflammation-mediated disorders, conditions, or diseases, such as diabetes, cardiovascular disease, artherosclerosis, arthritis and joint diseases, allergies, and chronic obstructive pulmonary disease. Risk factors that contribute to chronic inflammation include, obesity, age, diet, smoking, low sex hormones, stress, and sleep disorders. In other embodiments, the subject has acute inflammation. Tissue damage due to trauma, microbial invasion, or noxious compounds can induce acute inflammation. Acute inflammation may start rapidly, become severe in a short time, and symptoms may last for hours, days, or a few weeks, e.g., 1-6 weeks. In some embodiments, the subject may have an infection, such as a viral or bacterial infection, or suffer from a condition such as sepsis, septic shock, or endotoxemia. In some embodiments, the subject has a bone disorder, which may be caused by metabolic disorders or a subject is in need of bone regeneration or bone healing after a fracture or other bone injury. Adiponectin has been shown to have beneficial effects on bone metabolism, potentially aiding in the treatment of osteoporosis. Obesity can cause chronic inflammation, which inhibits osteogenesis and promotes osteoclastogenesis, which contributes to slow bone healing after injury. 18    Additionally, obesity can alter production of hormones that regulate bone metabolism. After administration, the bone volume to total volume ratio (BV / TV) and trabecular number (Tb.N) may be significantly higher as compared to control subjects not treated with the composition. In some embodiments, a subject is in need of weight loss. For instance, a subject may have or be in the process of developing a metabolic disorder at least partially caused by weight gain. Additionally or alternatively, the subject may have a metabolic disorder that causes weight gain. Methods of Treating Various Conditions and Diseases Given the pleiotropic effects of adiponectin, a variety of conditions can benefit from treatment with APN-mRNA, some of which are listed here. Conditions beyond those explicitly mentioned may benefit from APN-mRNA delivery via LNPs. Non-alcoholic fatty liver disease (NAFLD): Adiponectin has been shown to improve insulin sensitivity and reduce hepatic steatosis in animal models of NAFLD. Cardiovascular diseases: Adiponectin has anti-inflammatory and anti-atherosclerotic properties, suggesting potential benefits in conditions like atherosclerosis, heart failure, and stroke. Metabolic syndrome: Adiponectin deficiency is associated with metabolic syndrome, a cluster of conditions that increase the risk of heart disease, stroke, and type 2 diabetes. Neurodegenerative diseases: some studies suggest a role for adiponectin in neuroprotection and cognitive function. Periodontitis: Adiponectin has anti-inflammatory properties and may help to reduce inflammation and promote tissue repair in periodontal disease. Miscellaneous Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of skill in the art to which the invention pertains. All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the defined terms. The present disclosure is not limited to the specific details of construction, arrangement of components, or method steps set forth herein. The compositions and methods disclosed herein are capable of being made, practiced, used, carried out and / or formed in various ways that will be apparent to one of skill in the art in light of the disclosure that follows. The phraseology and terminology used herein is for the purpose of description only and should not be regarded as limiting to the scope of the claims. 19    Unless otherwise specified or indicated by context, the terms “a”, “an”, and “the” mean “one or more.” For example, “a molecule” should be interpreted to mean “one or more molecules.” As used herein, “about”, “approximately,” “substantially,” and “significantly” will be understood by persons of ordinary skill in the art and will vary to some extent on the context in which they are used. If there are uses of the term which are not clear to persons of ordinary skill in the art given the context in which it is used, “about” and “approximately” will mean plus or minus ≤10% of the particular term and “substantially” and “significantly” will mean plus or minus >10% of the particular term. As used herein, the terms “include” and “including” have the same meaning as the terms “comprise” and “comprising.” The terms “comprise” and “comprising” should be interpreted as being “open” transitional terms that permit the inclusion of additional components further to those components recited in the claims. The terms “consist” and “consisting of” should be interpreted as being “closed” transitional terms that do not permit the inclusion of additional components other than the components recited in the claims. The term “consisting essentially of” should be interpreted to be partially closed and allowing the inclusion only of additional components that do not fundamentally alter the nature of the claimed subject matter. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”) provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention. All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein. Preferred aspects of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those preferred aspects may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect a person having ordinary skill in the art to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited 20    in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context. The following examples are meant only to be illustrative and are not meant as limitations on the scope of the invention or of the appended claims. EXAMPLES Example 1: Adiponectin mRNA conjugated with lipid nanoparticles targets pathogenesis of Type 2 diabetes APN, also known as Acrp30, AdipoQ, ApM1, and GBP28 [9], is a 30 kDa monomeric protein encoded by the ADIPOQ gene on chromosome 3q27, spanning approximately 15.8 kb. This protein is associated with a susceptibility locus for cardiovascular disease, type 2 diabetes, and metabolic syndrome

[0010] . Similar to leptin

[0011] , monomeric APN is primarily produced and released in white adipose tissue. Glycosylation and hydroxylation play a critical role in controlling its activity and receptor binding

[0012] . In the context of obesity, adiponectin levels have an inverse relationship with adipose tissue. In normal-weight individuals, adiponectin levels are typically between 2 and 30 ng / ml

[0013] . As seen in individuals with balanced body composition, adipocytes, and immune cells, APN levels are negatively correlated with insulin resistance and BMI [8, 14]. Obesity-related adipose tissue growth triggers an inflammatory profile that lowers adiponectin secretion and levels [7]. Chronic inflammatory diseases such as T2D, obesity, and atherosclerosis are associated with decreased serum APN concentrations [8, 15, 16]. There is also evidence that adiponectin deficiency plays a role in T2D pathogenesis [17, 18]. There are numerous interacting pathways involved in type 2 Diabetes (T2D), and the present study focuses on these pathways. The activation of adiponectin receptors (AdipoR1 / AdipoR2) and subsequent association with adapter proteins facilitate glucose uptake through APPL1Rab5 or APPL1-AMP-AMPK-mediated translocation of glucose transporter 4 (GLUT4), resulting in the suppression of insulin signaling

[0036] . Subsequent impairment of adiponectin signaling mechanisms, particularly GLUT4 translocation, impedes cellular glucose uptake for energy production

[0037] . Insulin resistance is commonly characterized by decreased GLUT4-dependent glucose absorption in skeletal muscles and adipose tissue

[0038] . 21    A temporal increase in intracellular diacylglycerol (DAG) mass is associated with glucose- induced insulin resistance

[0039] . Prolonged elevation of intracellular DAG activates protein kinase C (PKC) isoforms, leading to insulin resistance, intracellular lipid accumulation, and impaired signal transmission [40, 41]. Glucose transport is downregulated due to increased PKC-mediated serine phosphorylation of the insulin receptor (IR) and insulin receptor substrate 1 (IRS-1) [42, 43]. Chibalin et al.

[0043] , in their study, suggest that controlling hyperglycemia can reverse the decline in diacylglycerol kinase delta (DGKd) protein and DGK kinase activity. This could provide pharmacological strategies that target DAG and PA metabolism through DGKd modulation, potentially preventing and controlling insulin resistance in metabolic disorders

[0043] . Moreover, insulin resistance and diabetic nephropathy (DN) in T2D are associated with epidermal growth factor receptor (EGFR) activation. This activation increases immune cell infiltration and oxidative stress in the kidney and adipose mass while simultaneously reducing pancreatic insulin synthesis and adipocyte adiponectin production

[0044] . Inhibition of EGFR decreases the expression of proinflammatory cytokines (iNOS, TNF-α, INF-γ, IL-6) [45, 46]. The present study aims to assess whether a APN-mRNA-LNP composition (a delivery system comprising adiponectin mRNA conjugated with lipid nanoparticles (LNP)), can stimulate endogenous production of APN and examine downstream signaling cascades associated with T2D. Results The cytotoxicity of APN-mRNA-LNP in In-vivo study The cytotoxicity of APN-mRNA-LNP on C2C12 myotubes was investigated at various concentrations (ranging from 0 to 64 µg / ml) over a 24-hour period. Notably, no cytotoxic effects were observed at a concentration of 32 µg / ml. The calculated IC50 after 24 hours was determined to be 42.56 mg / ml (FIG.1A). Increased APN expression in APN-mRNA-LNP treated C2C12 and SV40-MES13 cells Expression of the APN gene significantly increased over time upon exposure to 1 μg / ml APN-mRNA-LNP in C2C12 myotubes (FIG.1B) and SV40-MES13 kidney mesangial cells (FIG. 1C) after 24, 48, and 72 h of transfection, as compared with the PC and Empty-LNP groups. Western blot analysis was used to assess APN protein expression, and the results showed that the PC and Empty-LNP groups had considerably lower levels of APN protein expression than the NC group (p < 0.001). On the other hand, both C2C12 myotubes and SV40-MES13 kidney mesangial 22    cells showed significantly higher APN protein expression after 24, 48, and 72 h of transfection as compared with the PC and Empty-LNP groups (p < 0.001) (FIGS.1D-1E). APN-mRNA-LNP Administration Leads to Reduction in Blood Glucose Levels and Attenuated Body Weight Gain in DIO Mice Mice were fed with a high-fat diet (HFD) and tested at 23 weeks of age using the insulin tolerance test (ITT) and the intraperitoneal glucose tolerance test (IPGTT). These tests aimed to assess glucose tolerance and insulin sensitivity before the administration of APN-mRNA-LNP. Conducting these tests before injection ensured a comparable baseline among the groups. The area under the curve (AUC) for both IPGTT and ITT was calculated using the trapezoid method. No significant differences in glucose tolerance were observed, as the AUC of IPGTT did not differ significantly as compared with the PBS control mice (FIG.1F). Similar results were also observed for ITT, with no significant differences in insulin resistance between groups indicated by the AUC of ITT (FIG.1G). At 25 weeks of age, male C57BL / 6J mice on a high fat diet (HFD) received intravenous administration of 0.3 mg / kg (~10 µg / mouse) APN-mRNA-LNP. No significant differences in blood glucose levels were observed between groups until the third day after injection. However, one week after the injection, a notable decline in blood glucose levels occurred. The blood glucose level reached 207.9±31.3 mg / dl, which was significantly lower than the PBS control group (372.3±69.0 mg / dl, p < 0.001) and the Empty-LNP group (368.3±28.9 mg / dl, p < 0.001). It is worthy of note that blood glucose levels further decreased to 180.0±18.2 mg / dl two weeks after injection, as compared with 271.3±38.0 mg / dl for the PBS control group and 301.0±42.6 mg / dl for the Empty-LNP group (FIG.1H). In addition, body weight was measured during the two-week period before and after injection. No significant difference was observed between 2 weeks before injection and 3 days after injection. However, a decrease in body weight was seen one week after injection, reaching 47.2±2.5 gm; this difference was statistically significant (p = 0.014) when compared to Empty-LNP (52.6±3.8 gm). After two weeks, the body weight further decreased to 46.1±1.7 gm, with a p value of 0.05 when compared with the PBS control group (50.6±3.5 gm) and Empty-LNP group (54.3±1.7 gm) with a p value of 0.001 (FIG.1I). The administration of APN-mRNA-LNP increased APN expression in situ Regarding gene expression, the evaluation of APN expression in the studied groups was performed after three days, one week, and two weeks of injection. After three days of injections, 23    APN expression significantly increased (p < 0.001) by 8.31-fold as compared with the PBS and Empty-LNP groups. This increase persisted after one week (6.93-fold) and further intensified after two weeks, reaching 24.18-fold changes in skeletal muscle tissue samples (FIG.2A). Similar trend was observed in liver tissue, where APN increased by 3.38-fold after three days, 6.36-fold after one week, and 24.75-fold changes after two weeks (p < 0.001) as compared with the PBS and Empty-LNP groups (FIG.2A). While APN expression was slightly higher in kidney and pancreas samples, there were 2.88- and 2.55-fold changes after three days, respectively. In addition, there were 2.59- and 3.11-fold changes after one week, and 3.27- and 3.13-fold changes after two weeks (FIG.2A), respectively, with a significance level of p < 0.01 when compared with the PBS and Empty-LNP groups. In adipose tissues, especially in white fat tissues (W. fats), APN showed remarkable overexpression after three days, reaching 71.21, 40.80 after one week and 26.11-fold changes after two weeks (p < 0.001) when compared with the PBS and Empty- LNP groups (FIG.2A). In brown fats (B. fats), APN increased gradually after three days to 4.68, 6.53 after one week, and reached 23.33 after two weeks (p value < 0.001) when compared with the PBS and Empty-LNP groups (FIG.2A). In the untreated groups (PBS and Empty-LNP), the adiponectin protein was not expressed in muscle, liver, and kidney samples. However, following 3 days, one week, and two weeks of APN-mRNA-LNP administration, skeletal muscles showed a significant increase in adiponectin expression (5, 70, and 40%), along with comparable intensity scores (1, 3, and 2). In kidney tissue, adiponectin expression increased gradually (40, 50, and 70%) with intensity scores (2, 3, and 3), respectively. In liver tissue, adiponectin was expressed after two weeks of injection (60% with a score of 3 on the intensity scale). The administration of APN-mRNA-LNP resulted in in situ adiponectin expression in the muscles, kidney, and liver of DIO mice (FIG.2B). APN-mRNA-LNP treatment affects T2D pathways following increased APN expression The present study hypothesis focused on the analyzes of seven axes directly associated with Type 2 Diabetes (T2D), including Glut-4 reactivation, improvement in the Insulin Resistant Pathway (DGKd and PKCε), IR activation, activation of insulin secretion through the reactivation of the island of Langerhans EGFR Pathway Inhibition, Reduction of Inflammatory Cytokines (TNF-α, IL-Ib, IL-6), and Reduction in Fatty Changes. The expected gene expression in various studied tissues is summarized in FIG.3, utilizing information from the Mouse Genome Database (MGD) and the Gene Expression Database (GXD). 24    We investigated the correlation between APN overexpression and targeted 7-axis pathways by evaluating mRNA and protein expression in SV40MES13 and C2C12 cell lines. In addition, in vivo effects were observed 3 days, 1 week, and 2 weeks after APN mRNA-LNP administration. 1. Glut-4 reactivation (glucose uptake improvement): In vitro, the results showed a significant increase in Glut4 gene expression after APN- mRNA-LNP transfection for 24, 48, and 72 h in C2C12 myotubes (p < 0.001 at all timepoints) and SV40-MES13 kidney mesangial cells (p < 0.001, 0.001, and 0.01, respectively), as compared with the PC and Empty-LNP groups. In vivo, Glut-4 gene expression showed significant improvement in skeletal muscles, liver, kidney, W. fat, and B. fat tissues after 3 days, 1 week, and 2 weeks of APN-mRNA-LNP injections as compared with the PBS and Empty-LNP groups (FIG.4A). For Glut-4 protein expression, it was significantly lower in the PC and Empty-LNP groups as compared with the NC group (p < 0.001). However, when the treated groups were compared with the PC and Empty-LNP groups, Glut-4 protein expression was significantly higher after 24, 48, and 72 h of transfection in C2C12 myotubes (p < 0.001 at all timepoints) and in SV40-MES13 kidney mesangial cells, exhibiting a significant gradual increase (p < 0.001) at all timepoints (FIGS.4D-4E). These findings indicate that both in the examined cell line and the diabetic mouse model, the injection of APN-mRNA-LNP improves Glut-4 expression in situ, leading to an improvement in glucose uptake 2. Improvement of the Insulin resistant pathway (DGKd & PKCε) DGKd: In vitro: The results showed a significant downregulation of DGKd gene expression in the untreated group (EmptyLNP) as compared with the NC group. However, after APN-mRNA-LNP transfection for 24, 48, and 72 h, DGKd gene expression significantly increased in C2C12 myotubes at all timepoints and in SV40-MES13 kidney mesangial cells when compared with the PC and EmptyLNP groups. In vivo: The results showed a significant upregulation of DGKd gene expression in skeletal muscles, liver, and kidney after 3 days, 1 week, and 2 weeks of APN-mRNA-LNP injections as compared with the PBS and EmptyLNP groups (FIG.4B). Regarding DGKd protein expression, the results showed a significant reduction in the PC and Empty-LNP groups (p < 0.001) when compared with the NC group. However, when the treated 25    groups were compared with the PC and Empty-LNP groups, DGKd protein expression significantly increased after 24, 48, and 72 h of transfection in C2C12 myotubes (p < 0.001, 0.001, and 0.01, respectively) and in SV40-MES13 kidney mesangial cells, exhibiting a significant gradual increase (p < 0.001) at all timepoints (FIGS.4D-4E). This indicates that the injection of APN-mRNA-LNP results in an increase in DGKd expression in the diabetic mouse model. PKCε: In vitro: The results showed a significant upregulation of PKCε gene expression in the untreated group (PBS and Empty-LNP) as compared with the NC group. However, after APN- mRNA-LNP transfection for 24, 48, and 72 h, PKCε gene expression significantly decreased in C2C12 myotubes at all timepoints and in SV40-MES13 kidney mesangial cells when compared with the PC and EmptyLNP groups. In vivo: The findings indicated a significant downregulation of PKCε gene expression in skeletal muscles, liver, kidney, W. fat, and B. fat tissues after 3 days, 1 week, and 2 weeks of APN- mRNA-LNP injections as compared with the PBS and Empty-LNP groups, as illustrated in FIG. 4C. In terms of PKCε protein expression, the PC and Empty-LNP groups showed a significant increase (p< 0.001) as compared with the NC group. However, after 24, 48, and 72 h of transfection in C2C12 myotubes (p < 0.001 at all timepoints) and in SV40-MES13 kidney mesangial cells, PKCε protein expression significantly and gradually decreased (p < 0.001) at all timepoints (FIGS. 4D-4E). in the treated groups as compared with the PC and Empty-LNP groups (FIGS. 4D-4E). These results indicate that the injection of APN-mRNA-LNP results in the inhibition of PKCε activation in the diabetic mouse model. 3. Insulin receptor (IR) activation and the histological changes of pancreas In vitro: The results showed a significant downregulation of IR gene expression in the untreated group (EmptyLNP) as compared with the NC group. However, after APN-mRNA-LNP transfection for 24, 48, and 72 h, IR gene expression significantly increased in C2C12 myotubes in all timepoints (FIG. 5A), as well as in SV40MES13 kidney mesangial cells (FIG. 5B), when compared with the PC and Empty-LNP groups. Thus, the injection of APN-mRNA-LNP results in IR activation in the diabetic mouse model. In vivo: The results showed a gradual and significant upregulation of IR gene expression in skeletal muscles (FIG. 5C). In liver and kidney, the levels increased significantly after 3 days 26    and 1 week, but decreased after 2 weeks of APN mRNA-LNP injections as compared with the PBS and Empty-LNP groups (as shown in FIGS. 5D-5E). This indicates that injection of APN- mRNA-LNP results in IR activation in the diabetic mouse model. 4. Insulin secretion activation through the reactivation of the pancreatic islets To assess the correlation between APN overexpression and the improvement of insulin secretion within the islets of Langerhans, pancreas specimens were collected and fixed in a 10% buffered formaldehyde solution for 24 h for subsequent histological examinations. A comparison of the islet diameter before and after injection at various time points was conducted. The results showed that pancreatic tissue sections from the PBS and Empty-LNP groups exhibited large-sized islets of Langerhans with average diameters of 283 and 258.3 μM, respectively. On the other hand, the diameter slightly decreased in the APN-mRNA-LNP group after three days (136 μM) and one week (121.25 μM). Notably, the diameter of the islets of Langerhans significantly decreased in the APNmRNA-LNP group after two weeks, reaching 73.33 μM (FIGS.6A-6B). 5. EGFR pathway inhibition The fifth factor in our research focuses on EGFR activity, which directly contributes to insulin resistance and diabetic nephropathy. Therefore, we sought to confirm the relationship between APN overexpression and the inhibition of EGFR activity. In vitro: The results showed a significant upregulation of EGFR gene expression in the untreated group (PBS and Empty-LNP) as compared with the NC group. However, after APN- mRNA-LNP transfection for 24, 48, and 72 h, EGFR gene expression significantly decreased in C2C12 myotubes at all timepoints (FIG. 7A), as well as in SV40MES13 kidney mesangial cells (FIG.7B), when compared with the PC and Empty-LNP groups. In vivo: The findings showed a significant decrease in EGFR gene expression in the kidney after 3 days and 1 week of APN-mRNA-LNP injection as compared with the Empty-LNP groups. Remarkably, there was a significant further decrease after two weeks of injection as compared with the PBS and Empty-LNP groups (FIG.7C). Additionally, the overall correlation study between APN and EGFR expression in kidney tissue showed a significantly negative correlation (r = -0.978, p = 0.022) (FIG.7D), indicating that the injection of APN-mRNA-LNP leads to EGFR inhibition in the diabetic mouse model. The evidence of the relationship between APN overexpression and EGFR inhibition prompted the investigation into the potential impact of APN-mRNA-LNP injections on other 27    pathological conditions related to diabetic nephropathy. As a result, kidney specimens were collected, fixed in a 10% buffered formaldehyde solution for 24 h, and then cut into 3 μM-thick sections for PAS staining. Pathological findings showed that, in both the treated and untreated groups (PBS and Empty-LNP), there was persistent hyperplasia of partial cells in the Bowman's capsule of the glomeruli, even after three days. However, in most of the fields displayed, hyperplasia started to decrease after 1 week of injection and completely disappeared after 2 weeks (FIG.7E; yellow arrows). Furthermore, mild mesangial matrix expansion diffusion was observed in the PBS and Empty-LNP groups but completely disappeared in the treated groups at different time points (FIG.7E, black arrows). 6. Inhibition of Inflammatory cytokine production Proinflammatory cytokines have been found to decrease with diabetes treatment, and EGFR inhibition has also been demonstrated to reduce the production of these cytokines (46). Therefore, we sought to verify this relationship by examining the common proinflammatory cytokines directly related to T2D (TNF-α, IL-6, and IL1β). In vitro: Results demonstrated that TNF-α, IL-6, and IL1b gene expression were significantly upregulated in the untreated group (PBS and Empty-LNP) compared to the NC group. However, gene expression in SV40MES13 renal mesangial cells and C2C12 myotubes decreased significantly at all time points following APN-mRNA-LNP transfection. In vivo: Results showed that TNF-α gene expression was significantly downregulated in skeletal muscles, liver, W. fats, and B. fat tissues after 1 week and 2 weeks of APN-mRNA-LNP injections as compared with the PBS and Empty-LNP groups. Marginally significant differences were observed at different time points in the kidney when compared with the Empty-LNP groups (FIG.8A-8C). After receiving APN-mRNA-LNP injections for 1 week and 2 weeks, the kidney, W. fat, and B. fat tissues showed a significant downregulation of IL-6 gene expression as compared with the PBS and Empty-LNP groups. Slightly significant differences were observed at different time points in the skeletal muscles, while a significant difference was noted in the liver after 2 weeks of injections. Following 1 week and 2 weeks of APN-mRNA-LNP injections, IL-1β gene expression was significantly reduced in skeletal muscles, liver, kidney, W. fat, and B. fat tissues as compared with the PBS and Empty-LNP groups (FIGS.8A-8C). In terms of TNF-α and IL-6 protein expression, the PC and Empty-LNP groups showed considerably higher levels (p < 0.001) than the NC group. TNF-α and IL-6 protein expression in 28    the treated groups was significantly lower than that of the PC and Empty-LNP groups after 24, 48, and 72 h of transfection, similar to the normal negative control group in C2C12 myotubes (p < 0.001) at all timepoints, as well as in SV40-MES13 kidney mesangial cells (p < 0.001) at all timepoints (FIG. 8D-8E). This suggests that the injection of APN-mRNA-LNP leads to the inhibition of inflammatory cytokine activation in the diabetic mouse model. 7. Fatty changes reduction. The invasion of adipose tissue is pathologically associated with obesity, insulin resistance, and diabetes through the generation of cytokines and chemokines by immune cells (B cells and T cells) and macrophages

[0055] . One of the negative consequences of insulin resistance in T2D is the breakdown of fat in the muscles, liver, and kidneys, which in severe cases, can spread to the brain. Studies have shown a correlation between the downregulation of fat degeneration (hydropic degeneration) and APN overexpression. Skeletal muscles from the femur, liver, and kidney samples were used to evaluate this relationship. Pathological findings showed that in the longitudinal sections (LS) of the skeletal muscle tissue of mice in the BPS and LNP-Empty groups, the focal degeneration of the skeletal muscle bundles was marked with (++) (black arrow). In APN- mRNA-LNP, focal degeneration at 3 days was slightly less than in the previous groups (+). It is worthy of note that the focal degeneration of the skeletal muscle bundle was almost absent in APN- mRNA-LNP after 1 week and 2 weeks (FIG.9A). Sections of liver tissue from PBS and Empty-LNP showed almost identical features and percentages of clearly distributed hepatocellular fatty changes (steatosis) in approximately 60– 80% and 70–80% of hepatocytes, respectively (black arrow). On the other hand, sections of liver tissue from the APN-mRNA-LNP groups after 3 days, 1 week, or 2 weeks showed a significant reduction in hepatocellular steatosis, affecting almost 10-20%, 10-20%, and 5-10% of cells in a descending order, respectively. Interestingly, the proportion of hepatocellular hydropic degeneration appeared simultaneously with intervals of 80–90%, 60–80%, and 90–100%, respectively, following 3 days, 1 week, and 2 weeks of injection (FIG.8B, FIG.8D). Light microscopy of kidney tissue sections from PBS and Empty-LNP mice showed almost identical features, with an average of 60–70% and 50–60%, respectively (black arrow). Sections of kidney tissue from the APN-mRNA-LNP groups after 3 days, 1 week, or 2 weeks had a significant decrease in tubular degeneration, with tubular cells in a descending route: 30–35%, 15– 25%, and 10-15%, respectively (FIG.8C, FIG.8E). 29    Discussion T2D is characterized by a malfunction in the body's capacity to regulate and utilize glucose as an energy source. This chronic condition results in elevated blood sugar levels. Over time, high blood sugar can lead to complications affecting various systems and major organs including the liver, kidney, heart, and brain. There are two main issues associated with T2D: insufficient insulin production by the pancreas, and reduced sensitivity of cells to insulin, leading to poor sugar uptake. As a result, the present study was conducted to address these issues by promoting in situ production of adiponectin, APN, a protein closely involved in the insulin resistance pathways. Through the application of APN-mRNA-LNP, we successfully increased the direct production of insulin, boosted the uptake of glucose into cells, and decreased inflammation associated with uncontrolled hyperglycemia. The results of the present study showed that the APN-mRNA-LNP treatment resulted in a significant increase in the expression of both APN protein and gene, both in vitro and in vivo. Moreover, this treatment had a direct impact on reducing body weight and blood glucose levels. To function in vivo, for mRNAs function in vivo, it requires reliable, efficient, and robust delivery mechanisms that protect nucleic acids from degradation and allow cellular uptake and mRNA release. The stability and safety of employing APN-mRNA-LNP in both in vivo and in vitro settings were supported by our results. These findings highlight the potential of APN mRNA- LNP as a novel therapeutic agent to prevent and treat various diseases. The present study evaluated the Glut-4 gene expression at both gene or protein level in the C2C12 myotubes and SV40-MES13 kidney mesangial cells, as well as in the skeletal muscles, liver, kidney, W. fat, and B. fat tissues. Significantly elevated levels of Glut-4 expression were observed in these tissues. Consequently, an improvement in glucose uptake was observed. These results are in line with previous findings that globular adiponectin enhances glucose absorption in skeletal muscle cells via GLUT4 translocation, which slows the rate of glycogen formation and causes a shift in glucose metabolism toward lactate generation

[0056] . These effects align with the enhanced AMP kinase, acetyl-CoA carboxylase phosphorylation, and fatty acid oxidation brought on by globular adiponectin. In our mechanistic study, after injection with APN mRNA-LNP, the DGKd was significantly upregulated in C2C12 and SV40-MES13 cell lines, as well as in the skeletal muscles, the liver, and the kidney of DIO mice. The preceding relationship is in line with similar studies 30    [57-59] that have shown that ectopic lipids are associated with insulin resistance in liver and skeletal muscle. Improvements in liver and muscle sensitivity to adiponectin were associated with a 50% reduction in TAG and PM-associated DAG content in liver and muscle

[0060] . As a precursor of triglycerides and phospholipids, DAG contributes to the metabolism of lipids, and functions as a second messenger in cellular signaling. A temporal increase in intracellular DAG mass is associated with glucose-induced insulin resistance in animals

[0039] . DAG is also phosphorylated to produce phosphatidic acid (PA), which is needed for it to act as a lipid second messenger and regulate signals related to metabolic and mitogenic responses

[0061] . A disruption in the equilibrium between intracellular DAG and PA levels might harm cellular metabolism. DGKd is a class of enzymes important for reducing DAG signaling and catalyzing the phosphorylation of DAG to PA

[0062] . Peripheral insulin resistance and moderate obesity are implicated in decreased DGKd protein expression. Skeletal muscle DGKd is downregulated in those with poorly managed blood sugar levels

[0043] . A persistent upturn in intracellular DAG promotes aberrant signal transduction and intracellular lipid accumulation through the initiation of PKC isoforms and insulin resistance [40, 41]. In the present study, DGKd showed significantly downregulated gene and / or protein expression in C2C12, SV40-MES13 cells, even in the skeletal muscles, liver, kidney, W. fat, and B. fat tissues of DIO mice after being injected with APN-mRNA-LNP. This indicates that APN-mRNA inhibits PKCε activity. Li et al.

[0061] report that the amounts of sn-1,2-DAG associated with the plasma membranes of the liver and muscles decreased due to adiponectin activation. This resulted in decreased PKCε activity in the liver and PKCε and PKCθ activity in the muscles. In these tissues, insulin signaling, and action were heightened as a result. Decreased PM DAG content in the organs was linked to reduced PKCε translocation in the liver and reduced PKCε and PKCθ translocation in the skeletal muscles. This resulted in an increase in insulin-stimulated insulin receptor tyrosine1162 phosphorylation, IRS-1 / IRS- 2associated PI3-kinase activity, and Akt-serine phosphorylation

[0060] . Based on this mechanism, the results of the present study showed a significant increase in IR gene after injection of APN- mRNA-LNP in DIO mouse’s skeletal muscle, liver, kidney, and C2C12 and SV40-MES13 cell lines. 31    The present study showed that APN-mRNA-LNP injection significantly reduced the diameter of the islets of Langerhans in the pancreas of DIO mice. It is well known that diet- induced mouse islet hyperplasia is often linked to the persistent elevation of insulin levels, a risk factor for T2D and metabolic disorders. This phenomenon is characterized by a compensatory expansion of the functional mass of beta-cells, notably observed in individuals with obesity

[0063] Our study showed that APN mRNA-LNP administration successfully reduced islet size in HFD- fed mice, which is associated with enhancement of insulin secretion. This evidence supports our finding that APN-mRNA-LNP administration improving diet-induced dysregulation of pancreas function by averting islet hyperplasia. While the diameter in the untreated groups (BPS and Empty-LNP) showed a huge size (283 and 258.3 μM, respectively), it decreased after two weeks of injection to 73.33 μM; meanwhile, the mature normal pancreas of mice contains numerous islets of Langerhans, which are held up by a mass of branching exocrine tissue. While the observed reduction in islet size might seem counterintuitive, it could potentially improve beta cell function by enhancing cell-to-cell contact and facilitating blood flow within the islets. Future studies employing immunocytochemical analysis of beta cell mass would be valuable to further explore this aspect. In addition, the apparent shrinkage of the islet is beneficial as it loses penetration of exocrine tissue

[0064] . The islets vary greatly in size; on average, they have a diameter of between 50 and 200 μM. Insulin secretion is activated in DIO mice injected with APN-mRNA-LNP, based on the concept that island size and insulin production are correlated irreversibly

[0065] . Following APN-mRNA-LNP injection, the expression of the EGFR gene was significantly downregulated in the kidneys of DIO mice, as well as in the C2C12 and SV40-MES13 cell lines. It is worthy of note that a clear negative correlation was observed between APN and EGFR gene expression in the kidney (r = -0.978, p = 0.022) (FIG. 7D). Moreover, unexpected results were observed, as certain features of the moderate mesangial matrix expansion diffusion and hyperplasia of cells in the Bowman's capsule of the glomeruli appeared to reduce in the APN-mRNA-LNP injected groups when compared with the untreated groups. These indicate that the administration of APN-mRNA-LNP results in the inhibition of EGFR, which is consistent with the pathway proposed by Li et al.

[0044] . In their study, they used both pharmacological and genetic EGFR inhibition to investigate the possible role of EGFR activation to the development of DN in the eNOS / db / db model of accelerated T2D. The key conclusions from their study include: 1) 32    Erlotinib's ability to inhibit the activity of the EGFR tyrosine kinase slowed the course of DN; 2) Erlotinib reduced oxidative stress and renal macrophage and lymphocyte infiltration; 3) Erlotinib therapy increased glucose tolerance, insulin sensitivity, and pancreatic insulin expression while decreasing body weight growth, adipose tissue mass, and fasting blood sugar; 4) Adiponectin was shown to be more abundant in the blood after taking erlotinib; and 5) lower F2isoprostanes in the urine showed that erlotinib reduced systemic oxidative stress

[0044] . These findings provide additional support for the potential therapeutic effects of APN-mRNA-LNP and its impact on EGFR activity in the context of diabetes-related complications such as DN. The expression of pro-inflammatory cytokines is reduced by EGFR inhibition

[0046] . Based on the results of the present study, the C2C12 and SV40-MES13 cell lines showed significantly reduced gene and protein expression of TNF-α and IL-6, as well as IL-1β gene expression, following APN-mRNA-LNP transfection at different time periods. However, TNF-α gene expression was shown to be significantly reduced in skeletal muscles, liver, W. fat, and B. fat tissues, but not in the kidney, following 1 and 2 weeks of APN-mRNA-LNP injection. These in vivo results were more selective. Similarly, IL-6 levels significantly decreased in the kidney, W. fat, and B. fat tissues after 1 and 2 weeks of APN-mRNA-LNP injection, while no significant changes were observed in skeletal muscles and liver IL-6 levels. Notably, following 1 and 2 weeks of APN-mRNA-LNP injection, the expression of the IL-1β gene significantly decreased in all examined organs, including skeletal muscles, the liver, kidney, W. fat, and B. fat tissues. Therefore, it can be said that APN mRNA-LNP treatment resulted in a reduction of proinflammatory cytokines (IL-1b, IL-6, and TNF-α). Most of the organs were studied in vivo after two weeks, suggesting that the lack of decrease in some organs after this period may be attributed to changes in the organ's response to reduced inflammation. Our results indicate that the use of APN-mRNA compensates for the negative effects of LNPs on cytokines, which is a drawback of LNPs. These results are in line with earlier studies that pro-inflammatory cytokine production was decreased in adiponectin-knockout animals following renal ischemia-reperfusion

[0066] . The accumulated W. fat, especially around the trunk, upper body or abdomen, appears to be the main source of inflammatory indicators in T2D, and it also serves as a platform for the development of inflammation in individuals with diabetes. It produces cytokines and a wide range of other bioactive substances involved in the inflammatory pathways, including TNF-α, IL-1, IL-6, IL-10, chemokines, serum amyloid protein, leptin, adiponectin, resistin, and many other substances 33    generally referred to as adipokines [67–70]. Obesity, insulin resistance, and diabetes are pathologically associated with the production of several cytokines and chemokines due to increased infiltration of macrophages and immune cells (B cells and T cells) into adipose tissue

[0055] . In the present study, histopathological examination of skeletal muscle, liver, and kidney in treated DIO mice showed significant recovery from fatty degeneration 3 days and 1 or 2 weeks after APN-mRNA-LNP injection. The results suggest that APN-mRNA has positive benefits in reducing inflammation associated with metabolic disorders caused by lipid accumulation and insulin resistance. These results are in line with reports that interrelated processes of lipotoxicity and glucotoxicity result in IR impairment and reduced insulin secretion

[0066] . Furthermore, ATP- citrate lyase (ACL), fatty acid synthase (FAS), and stearoyl-CoA desaturase (SCD)-1 are genes that are activated by chronically elevated plasma glucose levels via two different mechanisms: directly, by increasing the citric acid (TCA) cycle activity and synthesis of Acyl CoA, which serves as a substrate for both gluconeogenesis and de novo lipogenesis (DNL)

[0071] ; and indirectly, by activating the expression of carbohydrate response element binding protein (ChREBP) and liver X receptor α (LXRα), which in turn promotes ACL, FAS, and SCD-1 gene transcription

[0072] . Moreover, glucotoxicity increases lipotoxicity and activates ChREBP in the kidney, skeletal muscles, and pancreas, decreasing insulin production (pancreas) and aggravating IR in these tissues. ChREBP expression is decreased in adipocytes by regulating the release of specific adipokines and lipid species, which may exacerbate the condition of IR

[0072] . The results of the present study show that APN-mRNA-LNP stimulates the formation of endogenous APN in muscles, liver, kidney, pancreas, and fat cells. APN-mRNA-LNP, after being administered, was proven to be safe for experimental animals because it quickly disappears from the body and does not integrate into the genome. As a result of the improvement in APN, 1) glucose uptake was improved through Glut-4 activation. 2) Insulin resistance was attenuated by DGKd activation, which was related to DAG and PKCε inhibition. 3) Insulin receptor activation by inhibiting the PKCε. 4) Inhibition (TNF-α, IL-1β, IL-6), leading to inflammation Reactivation of Langerhans islands to stimulate insulin reduction.7) Alleviation of fat accumulation in muscles, secretion.5) EGFR pathway blocking, which results in the liver, and kidney. All this led to a reduction in body alleviation of DN markers.6) Pro-inflammatory cytokines, decreased weight and an improvement in glucose synthesis (FIG.10). 34    In conclusion, our findings indicate that APN mRNA-LNP effectively addresses multiple aspects of T2D pathogenesis, including glucose uptake, insulin resistance, inflammation, and diabetic complications. The mRNA-LNP-based nucleic acid therapy emerges as a promising and efficient approach for targeting the underlying mechanisms of T2D. Materials and Methods Cell culture C2C12: Mouse C2C12 muscle cells were obtained from the American Type Culture Collection (ATCC CRL1772) (Manassas, VA). The myoblasts were seeded in Dulbecco’s modified Eagle medium (DMEM, No.2492921, Gibco) as growth medium (GM), which contained D-glucose (HG, 4.5 g / l) and L-Glutamine, supplemented with 10% fetal bovine serum (FBS) and 1% (100 U / ml) penicillin / streptomycin (P / S) under humidified atmospheric conditions at 37^C and 5% CO2. Subculturing was done by trypsinization, and cells were diluted to 2 x 105cells / ml and seeded in plates. To induce C2C12 differentiation (myotubes) a day after the cells reached 70% confluence, the medium was changed to differentiation medium (DM) (DMEM with 2% horse serum and 1% P / S) and maintained in DM thereafter. The differentiation media was changed every 48 hours, and up until the fifth day of differentiation induction, the establishment of polynucleotide myotubes was evaluated microscopically

[0047] . SV40 MES13: Mouse mesangial glomerulus SV40MES13 kidney cells were obtained from the American Type Culture Collection (ATCC CRL-1927) (Manassas, VA). SV40 MES13 were cultured in 3:1 mixture of ATCC-formulated Dulbecco’s Modified Eagle’s medium (DMEM, No. 30-2002, ATCC) and F12 contained GlutaMAX-1 Ham (Nutrition Mixture, No. 2193045, GIBCO), supplemented with 5% FBS and 1% (100 U / ml) P / S under humidified atmospheric conditions at 37^C and 5% CO2. The complete medium was replaced every 48 h and subcultured at a ratio of 1:5

[0048] . All the cell experiments were performed below passage number 10 (C2C12) or 7 (SV40 MES13) in a humidified environment at 37°C and 5% CO2. High glucose (HG) stress: The cells were grown to subconfluency until they reached the required cell number for the experimental setup. 3.5 × 105differentiated C2C12 cells on day 6 and 2.0 × 106SV40 MES13 were seeded into 6- well plates after 24 hours, when cells had reached approximately 70% confluence. Thereafter, the cells were assigned into the two study groups, negative control group and positive group, which were cultured with high glucose 10 g / l (55 mM) 35    (D-glucose, No. A24940-01, GIBCO, (sigmaaldrich.com / US / en / technical-documents) for 72 hours without medium changes

[0049] . APN mRNA Modification and encapsulation in LNP Both the formulation and the APN messenger RNA were subjected to chemical modification (cmRNA). Briefly, T7 RNA polymerase in vitro transcription produced cmRNA encoding APN (IVT). The full-length mRNA for APN (NM 009605) was produced (BioSynthesis, Inc., USA). The mRNA APN was chemically altered by ribonucleotide substitution, in which uridine residues were replaced with pseudouridine and cytidine residues with 5-methylcylidine to increase RNA stability while reducing the anti-RNA immune response. To ensure effective translation by the intended cells, a poly(A) tail (extending to 120 nucleotides) and a 7- methylguanylate cap (at the 3 and 5 ends, respectively) were also added. The quantity and quality of cmRNA APN was assessed using the NanoDrop 2000C (Thermo Fisher Scientific, USA). The purity and size were confirmed by automated capillary electrophoresis using a Fragment Analyzer (Advanced Analytical, USA). High-performance liquid chromatography was used to analyze the nucleotides (BioSynthesis, Inc., USA). To generate APN mRNA contained in LNPs given by the Co-I Dr. Xu's lab, a reliable self-assembly approach was used in our experimentation [50, 51]. Briefly, AA3-DLin LNPs with a molar ratio of 40:40:25:0.5 (AA3-DLin: DOPE: Cholesterol: DMG-PEG) were used to deliver APN mRNA for the following studies. The preparation and characterization of AA3-DLin LNPs used in this study were well-established and evaluated in previous publications [51-53]. In addition, the mCherry encoded mRNA purchased from Trilink was encapsulated into AA3-DLin LNPs to transfect Hek 293 cells. The mCherry positive cells were then observed under a fluorescent microscope for intracellular uptake investigation. The physicochemical properties, transfection evaluations, and intracellular uptake of the nanoparticles are shown in FIGS. 11A-11D. FIGS. 11E-11J show physiochemical properties, transfection evaluations, intracellular uptake, and cell survival of a different but highly similar nanoparticle. APN-mRNA-LNP Cytotoxicity Cytotoxicity of APN-mRNA-LNP was assessed by cell viability assay in C2C12 differentiated myotubes. C2C12 cells were harvested after 6 days of differentiation and seeded in 96-well plates at a density of 7.0 × 104. The myotube cells were treated with APN-mRNA-LNP at various concentrations (0-64) µg / ml for 24 h in blank medium, in parallel with blank wells, and in an EmptyLNP well. Cell viability assays were determined using the manufacturer’s protocol of 36    Cell Counting Kit-8 (CCK8) (No. TS511, Dojindo, Japan). Briefly, 10 ml of WST-8 were added to each treated cell and incubated for 3 h at 37°C. Thereafter, absorbance was measured at 450 nm. The half maximal inhibitory concentration (IC50) for APN-mRNA-LNP was calculated depending on the readings of the CCK-8 test using the AAT Bioquest online tools. APN-mRNA-LNP administration In vitro: For APN-mRNA-LNP transfection, cells were cultured in high-glucose media “HG stress 10 g / L (55mM D-glucose)” for 72 h, then the media were replaced with blank media. One µg / ml APN-mRNA-LNP was added to three treated plates (24, 48, and 72 h), as well as to parallel plates containing PBS as a control, a negative control (seeded in normal media) and a positive control (PC) (seeded in HG media), and an Empty-LNP group (seeded in HG media). Cells were extracted after 24 h of transfection for gene and protein expression analysis. Experimental Animals: All in vivo procedures were approved by the Institutional Animal Care and Use Committee (IACUC) at Tufts University. DIO (C57BL / 6J) male mice (Strain #:380050, RRID: IMSRJAX: 380050), were purchased from The Jackson Laboratory (600 Main Street Bar Harbor, ME USA 04609) at 6 weeks of age. Starting at 6 weeks-old, the mice were fed a high-fat diet (HFD) (D12492, Research Diets, NJ. USA) containing 60 kcal / g of fat for approximately 19– 21 weeks. Mice were maintained at constant temperature (23 ± 2 °C), humidity (45–55%), and a 12-h light / dark cycle with ad libitum access to water and food. Blood glucose and body weight were assessed weekly to ensure that the rats had acclimated for at least 2 weeks prior to the start of the study. Glucose and insulin tolerance tests At 23 weeks, the mice were assigned randomly into the different study groups (n=5) based on random selection via "lottery design" in an unbiased, "without prejudice"manner. The intraperitoneal glucose tolerance test (IPGTT) and insulin tolerance test (ITT) were carried out to assess insulin sensitivity and glucose tolerance, respectively, in order to prevent significant variations between groups. After 12 hours of fasting, the IPGTT was used to evaluate glucose tolerance (21:00–9:00). Blood samples were obtained from the mice's tails at 0, 30, 60, 90, and 120 min following an intraperitoneal injection of 50% D-Glucose solution 200 g / l (No.2423423, GIBCO) at a dose of 2 g / kg. Thereafter, a blood glucose test was performed

[0054] . Insulin sensitivity was evaluated using an ITT. Because insulin rapidly lowers blood glucose levels, mice were fasted for only 6 h (7:00– 37    13:00) prior to ITT. The mice were weighed prior to receiving an intraperitoneal injection of 0.75 IU / kg body weight of isophane insulin suspension 100 U / ml (No.0002-8315, Lilly). At 0, 30, 60, 90, and 120 min, blood was drawn from the tail and the blood glucose level was assessed

[0054] . A Clarity Plus Blood Glucose Meter was used to measure the blood sugar (Clarity Diagnosis; China). APN-mRNA-LNP Injection Male C57BL / 6J mice on a high-fat diet (HFD) received 0.3 mg / kg (~10 ug / mouse) of APN- mRNA-LNP intravenously once at 25 weeks of age. The control group received the same dose of phosphate buffered saline (PBS), while the second positive LNP group received Empty-LNP at the same time. To avoid any noticeable variations in blood glucose levels or body weight prior to the evaluation, measurements taken before to the baseline day (APN-mRNA-LNP injection) were compared to measurements taken 2 weeks, 1 week, or 3 days prior to and after injection. After 3 days, 1 week, and 2 weeks of APN-mRNA-LNP injection, mice were anesthetized with ketamine / xylazine 10 mg / kg intraperitoneally. For the target engagement study, the liver, skeletal muscles, kidney, pancreas, W. fat, and B. fat tissues were collected and directly placed in liquid nitrogen before being stored at -80⁰C for mRNA analysis. The kidney, pancreas, liver, and skeletal muscles were weighed for the efficacy study and thereafter preserved in formalin according to the protocol outlined below for HE staining. Gene expression evaluation After transfection in the studied cell lines, total RNA was extracted using Quick-RNA Miniprep Kit (ZYMO Research, Irvine, CA, USA). However, Trizol reagent (Ambion, Life technology, CA, USA) was used to extract the total RNA from tissue samples. One μg of total RNA was subjected to reverse transcription using the M-MLV Reverse Transcriptase (Thermo Scientific, Waltham, MA, USA) according to the manufacturer’s protocol. Using primers of the investigated genes, PowerUp SYBR Green Master Mix (Thermo Scientific) was utilized for real- time quantitative PCR (qRT-PCR), which was carried out on a Bio-Rad iQ5 thermal cycler (Bio- Rad Laboratories, Hercules, CA, USA) (Table 1). Differences in expression were evaluated by the comparative cycle threshold method using Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as a control. SEQ ID PRIMER SEQUENCE GENE NO: 7 Forward 5′- GCACTGGCAAGTTCTACTGCAA -3′ APN 8 Reverse 5′- GTAGGTGAAGAGAACGGCCTTGT -3′ 38    9 Forward 5′- GTAACTTCATTGTCGGCATGG -3′ Glut-4 10 Reverse 5′- AGCTGAGATCTGGTCAAACG -3′ 11 Forward 5′-GCAGCAATAGAGTTGGGTTAG-3′ PKCε 12 Reverse Reverse 5′- CAGGTTGTTCCGGATGTCC-3′ 13 Forward 5′- GTGGTGATCTCATCAGCC -3′ DGK-d 14 Reverse 5′- TCTTCTCAGATTCAGAGAGG -3′ 15 Forward 5′- GGAGGAAAAGAAAGTCTGCC -3′, EGFR 16 Reverse 5′- ATCG- CACAGCACCA ATCAGG -3′ 17 Forward 5′-GAGAGGATGTGAGACGACG-3′ IR 18 Reverse 5′-AAGGTGTTAGGCAAAGGCAG-3′ 19 Forward 5′-TCTCATGCACCACCATCAAGGACT-3′ TNF-α 20 Reverse 5′-ACCACTCTCCCTTTGCAGAACTCA-3′ 21 Forward 5′-AAGGGCTGCTTCCAAACCTTTGAC-3′ IL-1b 22 Reverse 5′-ATACTGCCTGCCTGAAGCTCTTGT-3′ 23 Forward 5′-ATCCAGTTGCCTTCTTGGGACTGA-3′ IL-6 24 Reverse 5′-TAAGCCTCCGACTTGTGAAGTGGT-3′ Table 1: Primer sequences of the studied genes in Example 1. Western Blot After transfection, the cells were collected directly in 100 μl protein sample buffer (#2463560, Invitrogen) and then denatured at 90°C for 10 min. Individual samples of 15 μl were loaded in each lane. Thereafter, western blotting was performed according to standard protocols. The primary antibodies used were APN (#2789, Cell signaling), Glut4 (#PA5-80022, Invitrogen), DGK-d (#PA5-75256, Invitrogen), PKCε (#PA5-32715, Invitrogen), TNF-α (#11948, Cell signaling) and IL-6 (#12912, Cell signaling). An anti-rabbit IgG (HRP-linked antibody) was used as a secondary antibody (#7074S, Cell Signaling). Three separate blot analysis of the samples were conducted. Optical densitometry was used to semiquantify the bands, and ImageJ digital imaging processing software was used for analysis (ImageJ 1.53t, National Institutes of Health, Bethesda, MD, USA). GAPDH was used as an endogenous control to normalize the expression of each protein under investigation. Histopathological studies The target tissues (liver, kidney, skeletal muscles, and pancreas) were obtained from the experimental animals after sacrifice and fixed in a 10% buffered formaldehyde solution for 24 h to perform histological examinations. The tissues were sectioned using a rotary microtome following graded alcohol dehydration, cleaning, and embedding. 39    Hematoxylin and Eosin (H&E) were used to stain the acquired sections, and an Olympus DP73 microscope with objective powers of 20, 40, and 100 were used to analyze the results. Periodic Acid Schiff (PAS) Stain: The kidney was fixed in paraffin and 3-μM-thick sections were prepared for PAS staining. PAS was performed using PAS-IFU Stain Kit Modified Lillie’s (ScyTek Laboratories, INC., West Logan, UT, USA) following the manufacturer’s recommendations. Immunohistochemistry (IHC) IHC was generated from 5-M-thick sections of paraffin embedded liver, skeletal muscles, and kidney tissues. The Histostain-SP Kit (Life Technologies, Waltham, MA, USA) was used according to the manufacturer's instructions for IHC. It includes the LABSA method, which uses an affinity-purified and biotinylated secondary antibody that binds specifically to the primary antibody. Protein Tech supplied the adiponectin primary antibody (1:400), (#21613-1-AP, Rosemont, IL, USA). Stained tissues were captured digitally with an Olympus DP73 microscope. Statistical Analysis A statistical package for social sciences (SPSS) version 29.0.1.1 (244) of IBM SPSS statistics was used for the analysis of the data. Data were presented as mean SD with a 95% confidence interval; a p value 0.05 was considered statistically significant. In order to determine the normality of the data, the Shapiro-Wilk normality test was performed (n > 6). In vitro samples were biologically and technically triplicated (n=3x3=9). Based on power analysis, the number of animals required per group was derived, and although technically triplicated, the total number of in vivo samples was (n =3x5=15). To compare the means of normally distributed variables between groups, Student's (t) tests were used. For non-parametric variables, Mann-Whitney U tests were used (n<6). Using the Pearson correlation coefficient (r), a correlation coefficient was calculated. The area under the curve (AUC) was calculated as an accuracy metric in order to evaluate the IPGTT and ITT sensitivity of selected tests calculated using the trapezoid method. Western blots were done to evaluate the protein expression in the samples. Three separate blot analyses were performed on each sample. A semi-quantitative analysis of the bands was conducted using optical densitometry and ImageJ (1.53t) software for digital imaging processing. Protein expression has been controlled by GAPDH as an endogenous control. Levels of protein are expressed as mean ratios between protein bands of targeted protein and GAPDH in comparison with a negative control. 40    References for Example 1 1) Ahmad E, Lim S, Lamptey R, Webb DR, Davies MJ (2022). Type 2 diabetes. Lancet, 400(10365):1803-1820. 2) Ogurtsova K, Guariguata L, Barengo NC, Ruiz PL, Sacre JW, Karuranga S, et al (2022). IDF diabetes Atlas: Global estimates of undiagnosed diabetes in adults for 2021. Diabetes Res Clin Pract, 183:109118. 3) Sun H, Saeedi P, Karuranga S, Pinkepank M, Ogurtsova K, Duncan BB, et al (2022). IDF Diabetes Atlas: Global, regional and country-level diabetes prevalence estimates for 2021 and projections for 2045. Diabetes Res Clin Pract, 183:109119. 4) Chatterjee S, Khunti K, Davies MJ (2017). Type 2 diabetes. Lancet, 389(10085):2239-2251. 5) NCD Risk Factor Collaboration (NCD-RisC) (2016). Worldwide trends in diabetes since 1980: a pooled analysis of 751 population-based studies with 4.4 million participants. Lancet, 387(10027):1513-1530. 6) Galic S, Oakhill JS, Steinberg GR (2010). Adipose tissue as an endocrine organ. Mol Cell Endocrinol, 316(2):12939. 7) Di Zazzo E, Polito R, Bartollino S, Nigro E, Porcile C, Bianco A, et al (2019). Adiponectin as Link Factor between Adipose Tissue and Cancer. Int J Mol Sci, 20(4):839. 8) Arita Y, Kihara S, Ouchi N, Takahashi M, Maeda K, Miyagawa J, et al (1999). Paradoxical decrease of an adipose-specific protein, adiponectin, in obesity. Biochem Biophys Res Commun, 257(1):79-83. 9) García-Miranda A, Garcia-Hernandez A, CastañedaSaucedo E, Navarro-Tito N, Maycotte P (2022). Adipokines as Regulators of Autophagy in ObesityLinked Cancer. Cells, 11(20):3230. 10) Bermúdez VJ, Rojas E, Toledo A, Rodríguez-Molina D, Vega K, Suárez L, et al (2013). Single-nucleotide polymorphisms in adiponectin, AdipoR1, and AdipoR2 genes: insulin resistance and type 2 diabetes mellitus candidate genes. Am J Ther, 20(4):414-21. 11) Trayhurn P, Beattie JH (2001). Physiological role of adipose tissue: white adipose tissue as an endocrine and secretory organ. Proc Nutr Soc, 60(3):329-39. 12) Kim Y, Park CW (2019). Mechanisms of Adiponectin Action: Implication of Adiponectin Receptor Agonism in Diabetic Kidney Disease. Int J Mol Sci, 20(7):1782. 41    13) Fang H, Judd RL (2018). Adiponectin Regulation and Function. Compr Physiol, 8(3):1031- 1063. 14) Yamauchi T, Kamon J, Waki H, Terauchi Y, Kubota N, Hara K, et al (2001). The fat-derived hormone adiponectin reverses insulin resistance associated with both lipoatrophy and obesity. Nat Med, 7(8):941-6. 15) Chiarugi P, Fiaschi T (2010). Adiponectin in health and diseases: from metabolic syndrome to tissue regeneration. Expert Opin Ther Targets, 14(2):193-206. 16) Nigro E, Scudiero O, Monaco ML, Palmieri A, Mazzarella G, Costagliola C, et al (2014). New insight into adiponectin role in obesity and obesity-related diseases. Biomed Res Int, 2014:658913. 17) Achari AE, Jain SK (2017). Adiponectin a Therapeutic Target for Obesity, Diabetes, and Endothelial Dysfunction. Int J Mol Sci, 18(6):1321. 18) Wang Y, Meng RW, Kunutsor SK, Chowdhury R, Yuan JM, Koh WP, et al (2018). Plasma adiponectin levels and type 2 diabetes risk: a nested case-control study in a Chinese population and an updated meta-analysis. Sci Rep, 8(1):406. 19) Sahin U, Karikó K, Türeci Ö (2014). mRNA-based therapeutics--developing a new class of drugs. Nat Rev Drug Discov, 13(10):759-80. 20) Guan S, Rosenecker J (2017). Nanotechnologies in delivery of mRNA therapeutics using nonviral vectorbased delivery systems. Gene Ther, 24(3):133-143. 21) Hajj K, Whitehead K (2017). Tools for translation: nonviral materials for therapeutic mRNA delivery. Nat Rev Mater, 2(10):1-17. 22) Pardi N, Hogan MJ, Porter FW, Weissman D (2018). mRNA vaccines - a new era in vaccinology. Nat Rev Drug Discov, 17(4):261-279. 23) Xiong Q, Lee GY, Ding J, Li W, Shi J (2018). Biomedical applications of mRNA nanomedicine. Nano Res, 11(10):5281-5309. 24) Kowalski PS, Rudra A, Miao L, Anderson DG (2019). Delivering the Messenger: Advances in Technologies for Therapeutic mRNA Delivery. Mol Ther, 27(4):710-728. 25) Li B, Zhang X, Dong Y (2019). Nanoscale platforms for messenger RNA delivery. Wiley Interdiscip Rev Nanomed Nanobiotechnol, 11(2):e1530. 26) Zhao W, Hou X, Vick OG, Dong Y (2019). RNA delivery biomaterials for the treatment of genetic and rare diseases. Biomaterials, 217:119291. 42    27) Uchida S, Perche F, Pichon C, Cabral H (2020). Nanomedicine-Based Approaches for mRNA Delivery. Mol Pharm, 17(10):3654-3684. 28) Weng Y, Li C, Yang T, Hu B, Zhang M, Guo S, et al (2020). The challenge and prospect of mRNA therapeutics landscape. Biotechnol Adv, 40:107534. 29) Gebre MS, Brito LA, Tostanoski LH, Edwards DK, Carfi A, Barouch DH (2021). Novel approaches for vaccine development. Cell, 184(6):1589-1603. 30) Kim J, Eygeris Y, Gupta M, Sahay G (2021). Selfassembled mRNA vaccines. Adv Drug Deliv Rev, 170:83-112. 31) Akinc A, Maier MA, Manoharan M, Fitzgerald K, Jayaraman M, Barros S, et al (2019). The Onpattro story and the clinical translation of nanomedicines containing nucleic acid-based drugs. Nat Nanotechnol, 14(12):1084-1087. 32) Akinc A, Maier MA, Manoharan M, Fitzgerald K, Jayaraman M, Barros S, et al (2019). The Onpattro story and the clinical translation of nanomedicines containing nucleic acid-based drugs. Nat Nanotechnol, 14(12):1084-1087. 33) Polack FP, Thomas SJ, Kitchin N, Absalon J, Gurtman A, Lockhart S, et al (2020). C4591001 Clinical Trial Group. Safety and Efficacy of the BNT162b2 mRNA Covid-19 Vaccine. N Engl J Med, 383(27):2603-2615. 34) Baden LR, El Sahly HM, Essink B, Kotloff K, Frey S, Novak R, et al (2021). COVE Study Group. Efficacy and Safety of the mRNA-1273 SARS-CoV-2 Vaccine. N Engl J Med, 384(5):403-416. 35) Hou X, Zaks T, Langer R, Dong Y (2021). Lipid nanoparticles for mRNA delivery. Nat Rev Mater, 6(12):1078-1094. 36) Hadley JT, Ryu J, Dong LQ (2021). Adiponectin and Adiponectin Signaling. In: Alfredo Ulloa-Aguirre, YaXiong Tao, editors. Cellular Endocrinology in Health and Disease. (Second Edition). Academic Press, 261287.ISBN 9780128198018. 37) Alam F, Islam MA, Khalil MI, Gan SH (2016). Metabolic Control of Type 2 Diabetes by Targeting the GLUT4 Glucose Transporter: Intervention Approaches. Curr Pharm Des, 22(20):3034-49. 38) Mu W, Cheng XF, Liu Y, Lv QZ, Liu GL, Zhang JG, et al (2019). Potential Nexus of Non- alcoholic Fatty Liver Disease and Type 2 Diabetes Mellitus: Insulin Resistance Between Hepatic and Peripheral Tissues. Front Pharmacol, 9:1566. 43    39) Kraegen EW, Saha AK, Preston E, Wilks D, Hoy AJ, Cooney GJ, et al (2006). Increased malonyl-CoA and diacylglycerol content and reduced AMPK activity accompany insulin resistance induced by glucose infusion in muscle and liver of rats. Am J Physiol Endocrinol Metab, 290(3):E471-9. 40) Montell E, Turini M, Marotta M, Roberts M, Noé V, Ciudad CJ, et al (2001). DAG accumulation from saturated fatty acids desensitizes insulin stimulation of glucose uptake in muscle cells. Am J Physiol Endocrinol Metab, 280(2):E229-37. 41) Itani SI, Ruderman NB, Schmieder F, Boden G(2002). Lipid-induced insulin resistance in human muscle is associated with changes in diacylglycerol, protein kinase C, and IkappaB- alpha. Diabetes, 51(7):2005-11. 42) Yu C, Chen Y, Cline GW, Zhang D, Zong H, Wang Y, et al (2002). Mechanism by which fatty acids inhibit insulin activation of insulin receptor substrate-1 (IRS-1)associated phosphatidylinositol 3-kinase activity in muscle. J Biol Chem, 277(52):50230-6. 43) Chibalin AV, Leng Y, Vieira E, Krook A, Björnholm M, Long YC, et al (2022). Downregulation of Diacylglycerol Kinase Delta Contributes to Hyperglycemia-Induced Insulin Resistance. Cell, 185(2):397-398. 44) Li Z, Li Y, Overstreet JM, Chung S, Niu A, Fan X, et al (2018). Inhibition of Epidermal Growth Factor Receptor Activation Is Associated with Improved Diabetic Nephropathy and Insulin Resistance in Type 2 Diabetes. Diabetes, 67(9):1847-1857. 45) Abu-Khudir R, Badr GM, Abd El-Moaty HI, Hamad RS, Al Abdulsalam NK, Abdelrahem ASA, et al (2023). Garden Cress Seed Oil Abrogates Testicular Oxidative Injury and NF-kB- Mediated Inflammation in Diabetic Mice. Int J Mol Sci, 24(20):15478. 46) Harris RC (2022). The Role of the Epidermal Growth Factor Receptor in Diabetic Kidney Disease. Cells, 11(21):3416. 47) Clemente CF, Corat MA, Saad ST, Franchini KG (2005). Differentiation of C2C12 myoblasts is critically regulated by FAK signaling. Am J Physiol Regul Integr Comp Physiol, 289(3):R862-70. 48) Chen Q, Ren D, Liu L, Xu J, Wu Y, Yu H, et al (2022). Ginsenoside Compound K Ameliorates Development of Diabetic Kidney Disease through Inhibiting TLR4 Activation Induced by Microbially Produced Imidazole Propionate. Int J Mol Sci, 23(21):12863. 44    49) Buranasin P, Mizutani K, Iwasaki K, Pawaputanon Na Mahasarakham C, Kido D, Takeda K, et al (2018). High glucose-induced oxidative stress impairs proliferation and migration of human gingival fibroblasts. PLoS One, 13(8):e0201855. 50) Chen Q, Gao M, Li Z, Xiao Y, Bai X, Boakye-Yiadom KO, et al (2020). Biodegradable nanoparticles decorated with different carbohydrates for efficient macrophagetargeted gene therapy. J Control Release, 323:179-190. 51) Li Z, Zhang XQ, Ho W, Li F, Gao M, Bai X, et al (2022). Enzyme-Catalyzed One-Step Synthesis of Ionizable Cationic Lipids for Lipid Nanoparticle-Based mRNA COVID-19 Vaccines. ACS Nano, 16(11):18936-18950. 52) Li F, Zhang XQ, Ho W, Tang M, Li Z, Bu L, et al (2023). mRNA lipid nanoparticle- mediated pyroptosis sensitizes immunologically cold tumors to checkpoint immunotherapy. Nat Commun, 14(1):4223. 53) Li Z, Zhang XQ, Ho W, Bai X, Jaijyan DK, Li F, et al (2022). Lipid-Polymer Hybrid "Particle-in-Particle" Nanostructure Gene Delivery Platform Explored for Lyophilizable DNA and mRNA COVID-19 Vaccines. Adv Funct Mater, 32(40):2204462. 54) Huang Z, Tang J, Ji K (2021). Exercise prevents HFDinduced insulin resistance risk: involvement of TNF-α level regulated by vagus nerve-related anti-inflammatory pathway in the spleen. Diabetol Metab Syndr, 13(1):124. 55) Nikolajczyk BS, Jagannathan-Bogdan M, Shin H, Gyurko R (2011). State of the union between metabolism and the immune system in type 2 diabetes. Genes Immun, 12(4):239-50. 56) Ceddia RB, Somwar R, Maida A, Fang X, Bikopoulos G, Sweeney G (2005). Globular adiponectin increases GLUT4 translocation and glucose uptake but reduces glycogen synthesis in rat skeletal muscle cells. Diabetologia, 48(1):132-9. 57) Randle PJ, Garland PB, Hales CN, Newsholme EA (1963). The glucose fatty-acid cycle. Its role in insulin sensitivity and the metabolic disturbances of diabetes mellitus. Lancet, 1(7285):785-9 58) Cline GW, Petersen KF, Krssak M, Shen J, Hundal RS, Trajanoski Z, et al (1999). Impaired glucose transport as a cause of decreased insulin-stimulated muscle glycogen synthesis in type 2 diabetes. N Engl J Med, 341(4):240-6. 45    59) Dresner A, Laurent D, Marcucci M, Griffin ME, Dufour S, Cline GW, et al (1999). Effects of free fatty acids on glucose transport and IRS-1-associated phosphatidylinositol 3-kinase activity. J Clin Invest, 103(2):253-9. 60) Li X, Zhang D, Vatner DF, Goedeke L, Hirabara SM, Zhang Y, et al (2020). Mechanisms by which adiponectin reverses high fat diet-induced insulin resistance in mice. Proc Natl Acad Sci U S A, 117(51):32584-32593. 61) Avila-Flores A, Santos T, Rincón E, Mérida I (2005). Modulation of the mammalian target of rapamycin pathway by diacylglycerol kinase-produced phosphatidic acid. J Biol Chem, 280(11):10091-9. 62) Kanoh H, Yamada K, Sakane F (2002). Diacylglycerol kinases: emerging downstream regulators in cell signaling systems. J Biochem, 131(5):629-33. 63) Biondi G, Marrano N, Borrelli A, Rella M, Palma G, Calderoni I, et al (2022). Adipose Tissue Secretion Pattern Influences β-Cell Wellness in the Transition from Obesity to Type 2 Diabetes. Int J Mol Sci, 23(10):5522. 64) Fiona MD, Holger AR (2019). Cell–Cell Interactions Driving Differentiation of Adult Pancreatic Stem Cells. In: Rui LR, Editor. Encyclopedia of Tissue Engineering and Regenerative Medicine, Academic Press, 367-374. ISBN 9780128137000. 65) Jo J, Choi MY, Koh DS (2007). Size distribution of mouse Langerhans islets. Biophys J, 93(8):2655-66. 66) Jin X, Chen J, Hu Z, Chan L, Wang Y(2013). Genetic deficiency of adiponectin protects against acute kidney injury. Kidney Int, 83(4):604-14. 67) Kanda H, Tateya S, Tamori Y, Kotani K, Hiasa K, Kitazawa R, et al (2006). MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity. J Clin Invest, 116(6):1494-505. 68) Shoelson SE, Herrero L, Naaz A (2007). Obesity, inflammation, and insulin resistance. Gastroenterology, 132(6):2169-80. 69) Antoniades C, Antonopoulos AS, Tousoulis D, Stefanadis C (2009). Adiponectin: from obesity to cardiovascular disease. Obes Rev, 10(3):269-79. 70) Antonopoulos AS, Margaritis M, Coutinho P, Shirodaria C, Psarros C, Herdman L, et al (2015). Adiponectin as a link between type 2 diabetes and vascular NADPH oxidase activity 46    in the human arterial wall: the regulatory role of perivascular adipose tissue. Diabetes, 64(6):220719. 71) Saponaro C, Gaggini M, Carli F, Gastaldelli A (2015). The Subtle Balance between Lipolysis and Lipogenesis: A Critical Point in Metabolic Homeostasis. Nutrients, 7(11):9453-74. 72) Abdul-Wahed A, Guilmeau S, Postic C (2017). Sweet Sixteenth for ChREBP: Established Roles and Future Goals. Cell Metab, 26(2):324-341. Example 2: mRNA-LNP compositions for delivery The LNPs are clinically advanced non-viral mRNA delivery platforms and hold great potential for gene therapeutics. A series of cationic lipid molecules to facilitate nucleic acids nanoparticle encapsulation are provided here, which can efficiently deliver mRNA and siRNA in vitro and in vivo. FIGS. 11E-11J show physiochemical properties, transfection evaluations, intracellular uptake, and cell survival of a set of nanoparticles. The developed AA3-DLin LNPs are fabricated using microfluidic-chip device by mixing the organic phase containing ionizable lipid, DOPE, cholesterol, and DMG-PEG and the water phase of mRNA. The obtained LNPs present ~100 nm size with narrow distribution (PDI=0.156) and -4.6 mV zeta potential test by dynamic light scattering (DLS) (FIG.11E and FIG.11H). The TEM image showed uniform spherical shape of LNPs around 100 nm size which is consistent with DLS results (FIG.11G). FIG.11F shows the transfection efficacy of LNPs evaluated by delivering mCherry encoded mRNA on Hek 293 cells. The fluorescence images (taken after 2 days post transfection) showed the LNPs have excellent transfection efficacy as well as remarkable cell viability compared to commercial lipofectamine 3000 (FIG. 11I). Additionally, the mRNA release profile was evaluated (FIG. 11J), the results showed the LNPs could release out 80% encapsulated mRNA after 2 days (FIG.11J). More importantly, the AA3-DLin LNPs successfully delivered the luciferase-encoded mRNA (mLuc-LNPs) in vivo. The mLuc-LNPs were intramuscularly injected into BALB / c mice and generated strong luciferase expression at 2.35*108total flux (p / s) at 6 h post-injection (FIG. 12A). The comparison studies were performed with FDA-approved MC3 LNPs and ALC-0315 LNPs through intramuscular injection of luciferase mRNA under same preparation conditions. The total flux was recorded at 6 h post-injection and the results demonstrated that the AA3-DLin LNP formulations outperformed these commercial FDA-approved LNP formulations (FIG. 12B). 47    Furthermore, the full-length wild-type spike protein encoded mRNA was formulated into AA3- DLin LNPs to develop a new kind of AA3-DLin mRNA-LNP COVID-19 vaccines. The AA3- DLin vaccines delivered spike mRNA efficiently in the Hek 293 cells with strong spike protein expression demonstrated by Western Blot and immunofluorescence analysis. The AA3-DLin vaccine transfected lysates exhibited clear full-length spike protein bands at ~180 kDa with GAPDH as the loading control (FIG. 12C). Additionally, the expressed spike protein was also probed by fluorescence-labeled antibodies (FIG.12D). Next, groups of BALB / c mice (n=5) were intramuscularly injected with different mRNA dosages (2 μg and 10 μg) of AA3-DLin vaccines with the empty LNP group as the placebo group. A prime / boost manner of vaccination was applied to each group two weeks apart. The spike-specific IgG antibody evaluation, pseudovirus neutralization, and real virus changeling studies were performed accordingly. The results showed that the antibodies increased significantly after booster injections with a dose-dependent relationship exemplified by endpoint titers, IC50 titers, and PRNT50 titers (FIGS.12E-12G). The AA3-DLin LNPs successfully deliver the spike-encoded mRNA in vitro and in vivo, and strong immunogenicity was detected in the vaccinated mice groups (ACS Nano, 2022, 16, 11, 18936– 18950). Similar LNPs will be used with the mRNAs described herein for delivery. APN mRNA-loaded lipid nanoparticle (LNP) preparation We employ a robust, self-assembly method to prepare nucleic acids (APN, EGFP and Luc mRNAs) encapsulated in LNPs as described above. The AA3-DLin LNPs were fabricated using a microfluidic-chip device by mixing the organic phase containing ionizable lipid, DOPE, cholesterol, and DMG-PEG and the water phase of mRNA. The LNP size and zeta potential were determined by using a ZetaPALS dynamic light-scattering detector. The mRNA in the LNPs were analyzed by using the Quant-iT RiboGreen assay. We optimized the LNPs to achieve particles with a diameter less than 100 nm and capability of encapsulating APN mRNA. The LNPs were used fresh or kept at −80°C to use later. According to the above formulation, DMG-PEG were replaced partially or completely by DMG-PEG-Mannose to obtain NPs with targeting moieties. Example 3: Effects of modified messenger RNA of adiponectin delivered by lipid nanoparticles on adipogenesis and bone metabolism in vitro and in vivo Introduction 48    Obesity is a chronic disease characterized by excessive accumulation of body fat. It is a major risk factor for many diseases, among them type 2 diabetes, cardiovascular disease, and bone disorders [1–3]. In obesity, the levels of pro-inflammatory cytokines are elevated, leading to chronic inflammation in the body [4–7]. First, the chronic inflammation inhibits osteogenesis and promotes osteoclastogenesis, which contributes to delayed bone healing during the bone remodeling process after bone injury [8]. Second, obesity can alter the production of hormones that regulate bone metabolism, such as adiponectin (APN) and leptin [9]. Third, obesity can lead to mechanical stress on bones, which can increase the risk of fractures [8,10]. Studies have shown that APN can promote osteogenesis and inhibit osteoclastogenesis, suggesting that it may be a potential therapeutic target for obesity-related bone disorders [18–20]. Messenger RNA (mRNA) therapy is a new and promising approach to treating diseases [21–23]. It involves delivering mRNA into cells, where it can be translated into proteins. mRNA therapy has several advantages over traditional protein therapy, including higher efficiency, lower toxicity, and greater specificity. Multiple delivering systems such as lentiviral vectors, adeno-associated virus and exosomes are developed to transport mRNA into the body

[0027] . Among these, lipid nanoparticles (LNPs) are a type of nanoparticle that can encapsulate and protect mRNA molecules from rapid clearance by the body by effectively delivering mRNA into cells [28–30]. LNPs are non-viral vectors, which means that they do not insert their DNA into the host genome. LNPs are also biocompatible, have low immunogenicity and cytotoxicity, and can effectively deliver mRNA to a variety of tissues [25,31]. Based on these advancements, we chemically modified the APN mRNA and encapsulated it within LNPs. This study aimed to explore the effects of LNPs delivery of modified APN mRNA on adipogenesis and bone metabolism in vitro and in a femoral fracture model of male mice with diet-induced obesity (DIO). Materials and Methods Synthesis of APN-LNP We chemically modified the APN messenger RNA (cmRNA) and the formulation. Briefly, cmRNA encoding APN was generated by in vitro transcription using T7 RNA polymerase. APN full-length mRNA (NM_009605) was synthesized (BioSynthesis). To decrease anti-RNA immune response and enhance RNA stability, the mRNA was chemically 49    modified using ribonucleotide substitution, in which 5-Methylcylidine substitutes cytidine residues and pseudouridine substitutes uridine residues. Additionally, a 7-methylguanylate cap was incorporated at the 5’ end, and a poly(A) tail, extended to 120 nucleotides, was added at the 3’ end to ensure efficient translation in target cells. The quality, concentration, purity, and size of APN cmRNAs were evaluated as described in previous reports

[0032] . In addition, nucleotide analysis was performed. LNPs preparation: We employed a robust, self-assembly method to prepare APN mRNA encapsulated LNPs provided by the Co-I Dr. Xu’s lab (FIG.13A) [32, 33]. The LNP formulation, LNP preparation methods, LNP characterization and optimization studies, has been extensively characterized and optimized in our previous studies

[0032] . This formulation has demonstrated effective mRNA delivery in vitro and desirable properties such as for in vivo applications. Cell culture and transfection with APN-LNP 3T3-L1 cell line from ATCC (CL-173) was cultured in Dulbecco’s modified eagle medium with 4.5 g / L D-glucose (DMEM, Gibco) supplemented with 10% newborn calf serum (Gibco) and 1% penicillin-streptomycin (Gibco). Passage 3-8 was used for experiment. Cells were seeded on 6 well plate at a density of 4 × 104cells / ml and allowed to grow for 2 days to reach 100% cell confluent (D0). Then cells were induced in Adipogenic Induction medium (AIM), containing 10 μg / ml insulin (Sigma-Aldrich), 1 μM dexamethasome (Sigma-Aldrich), and 0.5 mM isobutylmethylxanthine (IBMX) (Sigma-Aldrich) in complete DMEM medium for 72 hours (D1-D3). After that, the medium was changed into Adipogenic Differentiation Medium (ADM) including 10 μg / ml insulin for 48 hours (D4-D5). Finally, cells were maintained in DMEM medium for another 2 days (D6-D7). Adipocytes in different differentiation stages were transfected with APN-LNP. Briefly, for the preadipocyte model, cells were transfected at D0 with 1.0 μg / ml APN-LNP for 24 h in Opti medium. For the mature adipocyte model, cells were transfected at D8 with 1.0 μg / ml APN-LNP for 24 h in Opti medium. Then cells were harvested for analysis. The empty-LNP group was used as a control. MC3T3-E1 cell line was purchased from ATCC (CRL-2593) and maintained in Alpha MEM (AMEM) (Gibco) supplemented with 10% fetal bovine serum (FBS) (Gibco) and 1% penicillin / streptomycin. MC3T3-E1 cells were seeded on a 6-well plate at a density of 2 × 105cells / ml in α-MEM containing 50 μg / ml vitamin C and incubated for 2 days. Transfection was 50    then performed with APN-LNP (0.25 and 1.0 μg / ml) for 24 hours in Opti medium. The empty- LNP group served as a control. The RAW264.7 cell line from ATCC (TIB-71) was cultured in complete DMEM. Cells at passages 3–8 were used for the experiments. They were seeded onto a 6-well plate at a density of 2.5 × 105cells / ml. Transfection was carried out using 0.25 μg / mL APN-LNP for 12 hours in Opti-MEM. After transfection, the medium was replaced with AMEM containing 100 μg / mL receptor activator of nuclear factor-kappa B ligand (RANKL) (Pepro Tech Inc) and incubated for 48 hours. Cells were collected at 24 and 72 hours post-transfection for further analysis. Cytotoxicity assays 3T3-L1 cells were induced in AIM and in ADM as described above. Transfection with APN-LNP in Opti medium was conducted on days 0, 3 and 7. The empty-LNP group was used as a control. Cytotoxicity was evaluated using the Cell Counting Kit-8 (CCK-8, Dojindo), with absorbance measured at 450 nm using a microplate reader. The cytotoxic effects of APN-LNP on MC3T3-E1 cells were assessed following the same protocol used for 3T3-L1 cells. RNA extraction and qPCR After transfection, total RNA was extracted with Quick-RNA Miniprep Kit (R1055). cDNA was synthesized using M-MLV Reverse Transcriptase (Promega). qPCR was performed with PowerUP SYBR Green Master Mix (Thermo Scientific) on a Bio-Rad iQ5 thermal cycler (Bio-Rad Laboratories) (Table 2). The fold changes were evaluated using 2-ΔΔCt method, with GAPDH serving as the internal control. SEQ ID PRIMER SEQUENCE GENE NO: 7 Forward 5′- GCACTGGCAAGTTCTACTGCAA -3′ APN 8 Reverse 5′- GTAGGTGAAGAGAACGGCCTTGT -3′ 25 Forward 5′- GAAAGACAACGGACAAATCACC-3′ Ppary 26 Reverse 5′- GGGGGTGATATGTTTGAACTTG-3′ 27 Forward 5′- GGACGGTAACGGGAATGTATGA-3′ Lpl 28 Reverse 5′- TGACATTGGAGTCAGGTTCTCTCT-3′ 29 Forward 5′- AGACCACATCGCCCACA-3′ Hsl 30 Reverse 5′- CCTTTATTGTCAGCTTCTTCAAGG-3′ 31 Forward 5′- CAGGGAGGCAGTGACTCTTC-3′ Bsp 32 Reverse 5′- AGTGTGGAAAGTGTGGCGTT-3′ 33 Forward 5′- GCCGGAGTCTGCTCACTACC-3′ Ocn 34 Reverse 5′- GCGCTCTGTCTCTCTGACCT-3′ 35 Forward 5′- GCAGAGGCATACTTGTACCG-3′ 51    36 Reverse 5′- TGATGTTATGATGGTCCCACTTG-3′ Mmp9 37 Forward 5′- GCTCTTACTGACTGGCATGAG-3′ IL-10 38 Reverse 5′- CGCAGCTCTAGGAGCATGTG-3′ 39 Forward 5′- TGTCCCTTTCACTCACTGGC-3′ TNF-α 40 Reverse 5′- CATCTTTTGGGGGAGTGCCT-3′ 41 Forward 5′- AGGTCGGTGTGAACGGATTTG-3′ Gapdh 42 Reverse 5′- TGTAGACCATGTAGTTGAGGTCA-3′ Table 2: Primer sequences used in qRT-PCP experiments in Example 3. Western Blot Total cellular protein was extracted using RIPA Lysis (Santa Cruz Biotechnology) and protein concentration was determined using PierceTMBCA Protein Assay Kit (Thermo Fisher Scientific). The samples were then denatured at 95 °C 10 min. The collected cell culture medium was concentrated using Amicon Ultra -5,000 MWCO Centrifugal Filter Devices ((Merck Millipore) under the manufacturer’s instructions. Briefly, the medium was first centrifuged at 8000 rpm for 5 minutes to remove cellular debris. Next, 3 ml medium from each group was concentrated to 0.2 ml at 4000 g for 25 min using the Amicon devices. The samples were then resuspended in PBS and concentrated again under the same conditions. This process was repeated for 3 times to fully reconstitute the samples in PBS. Protease inhibitors were added at a ratio of 1:100. All steps were performed at 4 °C. The protein concentration was quantified, and the samples were denatured as previously described. The proteins from cells and culture medium were separated by BoltTM 4-12% Bis-Tris Plus sodium dodecyl sulphate-polyacrylamide gel (SDS-PAGE) (Thermo Fisher Scientific) and electrophoretically transferred to PVDF membranes (Merck Millipore). Primary antibodies against adiponectin (Millipore AB3269P) (1:1000) and GAPDH (Cell Signaling Technology) (1:3000) were used. The bands were visualized with ECL chemiluminescence substrate (Thermo Fisher Scientific). The density of all bands was evaluated using ImageJ software (13.0.6). Femoral fracture model in male diet-induce obese (DIO) mice) 17-19-week-old DIO (Jax#380050) male mice were purchased from the Jackson Laboratory (Bar Harbor). A femoral fracture model with fracture gap size 0.25 mm was generated using RISystem Internal Fixation System (RISystem). APN-LNP was delivered by intravenous injection (IV). 52    Briefly, ketamine and xylazine (100 mg / kg and 10 mg / kg, respectively) were used to anesthetize the mice. Buprenorphine (1 mg / kg) was administered subcutaneously prior to the surgical procedure. An incision was made along the femur and the underlying muscle was carefully split along the intermuscular boundary to expose the femur. The initial hole was drilled using the Accu Pen 3V, followed by the insertion of the first screw. The MouseFix Drill- & Saw guide was then positioned on the plate, facilitating the drilling of three additional holes with the Accu Pen 3V. A 0.25 mm full-thickness osteotomy was performed in the mid-femur using a 0.22 mm Gigli saw. Muscles were sutured with 6-0 absorbable sutures, whereas the skin was closed using 6-0 non-absorbable monofilament sutures. On day 3 post-surgery, APN-LNP (10 μg in 120 μl LNP buffer) was administered via intravenous injection. Subsequent IV injections were conducted biweekly, totally two doses of 10 μg APN-LNP each. Matched empty-LNP or PBS served as controls. Fasting weight and blood glucose test As shown in the experimental timeline, fasting body weight and blood glucose were recorded at each timepoint. Briefly, 4 days before surgery，the mice were fasted for 6 h. Then fasting body weight and blood glucose was recorded (T0).2 days after drug administration (T1 and T2), these data were recorded again. Animal toxicity test For safety consideration of the APN-LNP, livers of all mice were collected and processed to histological analysis for H&E staining. μCT Analysis The collected femurs were scanned using Bruker’s Skyscan 1172 (Bruker) at 9.0-μm- voxel resolution at Tufts Medical Center. A 0.5 mm aluminum (Al) X-ray filter was used, and the X-ray settings were 50 kV and 500 μA. Scans were performed in 0.3° rotation steps. Projections were acquired at a nominal resolution of 10 μm, with each slice consisting of 1224 × 820 pixels.3D reconstructions were visualized with CTvox 3.3.0 (Bruker) and analyzed with CTAn 1.19 (Bruker). The regions of interest were confined to the area between two medial screws, as previously described

[0033] . H&E staining of femoral defects After decalcification in 10% EDTA, the femurs were processed into paraffin-embedded sections. HE Staining was performed as we previously described

[0034] . 53    RNA isolation from organs and qPCR analysis Total RNA from organs excluding bone was extracted using TRIzolTMReagent (Invitrogen) under the manufacturer’s instructions. For the contralateral femur, RNA was isolated using a combination of TRI Reagent and RNeasy Mini Kit columns (Qiagen). Statistical analysis Statistical differences among the experimental groups were evaluated with one-way ANOVA followed by Turkey post hoc analysis. For comparisons between two groups, unpaired Student’s t-test was used. All statistical analyses were performed with Graphpad Prism Version 9.0 (Graphpad software). A p value < 0.05 was considered statistically significant. Results were presented as mean ± SD. Results Cytotoxicity of APN-LNP on 3T3-L1 cell line As APN is one kind of adipokine mainly secreted by adipose tissue, we first evaluated the effect of APN-LNP in 3T3-L1 cell line. We performed the transfection in two stages of 3T3- L1 to verify the effectiveness of APN-LNP. The cytotoxicity of APN-LNP on 3T3-L1 at different concentrations was determined using CCK-8 assay. No obvious cytotoxicity was found for APN- LNP up to 4 μg / ml in preadipocytes and mature adipocytes (FIGS.13B-13C). mRNA and protein expression of APN after transfection with APN-LNP We then evaluated the expression of APN after transfection by qPCR. The results showed significantly increased APN levels in either preadipocytes or mature adipocytes (FIGS. 13D-13E). The fold change of APN in APN-LNP transfected preadipocytes was more than 11,000-fold compared with empty-LNP. In mature adipocytes, APN was about 2-fold higher compared with control group. Compared with preadipocytes, mature adipocytes seem more difficult to be successfully transfected. So, we next checked whether transfection with APN- LNP could increase APN protein production in mature adipocytes by Western Blot (FIGS.13F- 13G). It was shown that protein level of APN from both the cellular extracts and cell culture medium increased significantly after transfection for 24 h (FIGS.13H-13I). Transfection with APN-LNP inhibited expression of adipogenesis related genes in 3T3-L1 Since transfection with APN-LNP altered APN expression, we further investigated whether transfection affected other adipogenesis-related genes expression by qPCR. Peroxisome proliferator-activated receptor gamma (PPARγ) is an important regulator of adipogenesis. In 54    pre-adipocyte and mature adipocyte, the expression of Pparγ, lipoprotein lipase (Lpl) and hormone sensitive lipase (Hsl) were significantly reduced after transfection, which meant transfection with APN-LNP could inhibit adipogenesis during different stages of adipocytes (FIGS.13D-13E). Several studies have reported that APN could promote osteogenesis and inhibit osteoclastogenesis in murine cell lines [19,20]. We further investigated the APN-LNP transfection in MC3T3-E1 and RAW 264.7 cells. MC3T3-E1 Cell survival We determined the cytotoxicity of APN-LNP on MC3T3-E1 cells at different concentrations using CCK-8 assay. No obvious cytotoxicity was found for APN-LNP up to 2 μg / ml when transfection was performed (FIG.14). Compared with empty-LNP group, transfection with 4 μg / ml APN-LNP significantly decreased MC3T3-E1 cell numbers. Transfection with APN-LNP promotes expression of APN and osteogenic markers in MC3T3- E1 cells We transfected MC3T3-E1 cells using two concentrations of APN-LNP: 0.25 and 1.0 μg / ml. APN mRNA expression was significantly upregulated at 24, 72, and 120 hours post- transfection (FIG.15A). Among the timepoints, the highest APN expression levels were found at 24 hours. At 24 hours, APN expression in the 1.0 μg / ml group increased more than 28,000- fold compared to the empty-LNP control, while in the 0.25 μg / ml group, the fold change exceeded 800-fold. In the 0.25 μg / ml group, elevated APN levels persisted for 120 hours, and in the 1.0 μg / ml group, APN expression remained high for up to 240 hours. With the stimulation of ascorbic acid, MC3T3-E1 cells were differentiated into osteoblasts. In differentiated-MC3T3-E1 cells, transfection with APN-LNP promoted the expression of bone sialoprotein (Bsp) and osteocalcin (Ocn) dose-dependently (FIGS.15B-15C). Higher Bsp and Ocn mRNA level were observed in the 1.0 μg / ml APN-LNP group. Transfection in RAW 264.7 cells We transfected RAW 264.7 cells with APN-LNP and evaluated gene expression of matrix metalloproteinases 9 (Mmp9). Results showed that APN-LNP decreased Mmp9 expression at 24 and 72 h after transfection (FIG.15D). Fasting blood glucose, body weight and μCT analysis of femoral fracture mice administered APN-LNP 55    We established a femoral fracture model with 0.25 mm fracture gap using RISystem Internal Fixation System in male DIO mice (FIG.13A). Systemic IV injection of APN-LNP was performed on the third day after surgery (FIG.16B). Totally two doses of APN-LNP were administered. And the second dose was given two weeks after the first administration. At 4 weeks after surgery, we evaluated bone healing in the fracture site. Micro-CT analysis revealed that the bone volume to total volume ratio (BV / TV) and trabecular number (Tb.N) were significantly higher in the APN-LNP group compared to the empty-LNP and PBS groups, whereas no obvious differences was found among the three groups in regarding to trabecular thickness (Tb.Th) and trabecular separation (Tb.Sp) (FIGS.16C-16D). The bone healing in the femoral fracture site was also shown in HE staining (FIG.17A). To evaluate whether the administration of APN-LNP could influence fasting blood glucose and body weight, timepoints T1 and T2 were set up two days after each administration of APN-LNP. At baseline, there was no significant difference among the three experimental groups in body weight or fasting blood glucose. At T1, 2 days after the first dose of administration, blood glucose and body weight decreased in all groups. At T2, 2 days after the second dose of administration, blood glucose and body weight in the IV-APN group significantly decreased, compared with IV-empty and IV-PBS group (FIGS.17B-17C). H&E staining of liver tissues We also studied the systemic toxicity of APN-LNP and empty-LNP through histological analysis of liver. H&E staining of liver tissues in all the groups showed no obvious damage (FIG. 18A). Osteogenic markers Bsp and Runx2 expression in contralateral femurs of the experimental mice After detecting the contralateral femur tissues, osteogenic markers Bsp and Runx2 mRNA expression were significantly higher in the APN-LNP group compared to the empty-LNP and control group (FIG.18B). Inflammation related markers TNFα and IL-10 in white adipose tissues (WAT) Additionally, we assessed the influence of APN-LNP on the expression of inflammatory cytokines in WAT. We found that APN-LNP administration increased the mRNA levels of anti- inflammatory marker IL-10 (Figure.5C). Nevertheless, no differences were found regarding gene expression of pro-inflammatory marker TNFα (FIG.18C). Discussion 56    During the past decades, gene therapy has been rapidly developed

[0027] . Since the COVID- 19 pandemic, the application of mRNA therapy delivered by LNPs has triggered researchers’ interests in treating cancer and infectious diseases [22–26,35]. Metabolic diseases, such as diabetes and obesity, have become major health problems worldwide. Although traditional treatment methods are effective in general, there are still some limitations. APN is a very important adipokine. It functions through improving insulin resistance, regulating lipid metabolism, promoting osteogenesis, and inhibiting osteoclastogenesis [18–20,36]. Despite the promising usage of protein APN, its clinical application is hindered by some disadvantages, including the high dosage required in treatment, different isoforms of APN and constant IV injection to obtain beneficial effects. Our studies modified the APN messenger RNA and packaged the mRNA with LNPs to form the APN-LNP. We aimed to explore the effects of this APN-LNP on adipogenesis and bone metabolism in vitro and in vivo. APN is primarily secreted by adipose tissue. In this study, we showed that APN-LNP could transfect 3T3-L1 adipocytes and upregulate APN gene and protein expression in this cell line. Moreover, increased APN protein levels were detected in the cellular extracts and cell culture supernatant in transfected mature adipocytes, which indicated that modified APN-LNP mRNA delivered by LNPs can be translated into protein transcripts in vitro as expected. We further found that APN-LNP inhibited expression of adipogenesis-related markers such as Pparγ, Lpl and Hsl in two adipocyte cell stages at gene levels. Several studies revealed that Pparγ is an important regulator in promoting adipogenesis and lipid accumulation [37–39]. Overall, our data implied that APN-LNP transfection increased gene and protein expression of APN, further leading to decreased adipogenic genes expression, which may exert an anti-adipogenic effect in 3T3-L1 cells. In agreement with our data, one recently published study revealed that overexpression of APN suppressed adipogenesis in cultured bone marrow mesenchymal stem cells

[0040] . APN is shown to be expressed in adipocytes, human and murine osteoblasts, and myocytes [41,42]. In our study, to evaluate the APN-LNP transfection effect on bone metabolism, we used MC3T3-E1 osteoblastic cell line and RAW264.7 cell line. The latter could be differentiated into osteoclasts with RANKL stimulation and is usually used for osteoclastic research. They are two commonly used cell lines in studying bone metabolism in vitro. Our results showed that transfection with APN-LNP stimulated MC3T3-E1 cells and upregulated expression of APN for a few days. As the concentration of APN-LNP increased, this effect even persisted 57    longer. We also showed that APN-LNP transfection in MC3T3-E1 osteoblastic cells upregulated the expression of Bsp and Ocn dose dependently, which suggests that APN-LNP may promote osteogenesis. Other researchers have reported that APN treatment can increase cell proliferation and osteogenic markers expression in murine and human osteoblasts, which was consistent with our results [18–20]. Regarding the effect of APN on osteoclasts, various studies reported a negative role of APN on osteoclastogenesis in RAW264.7 cells [18–20]. Our results showed that transfection with APN-LNP significantly inhibited Mmp9 expression level in RANKL-stimulated RAW264.7 cells. High levels of MMP9 produced by osteoclasts are important in extracellular matrix degradation and osteoclastic bone resorption [43,44]. Our findings suggest that APN-LNP may inhibit osteoclastogenesis by inhibiting Mmp9 expression. Although many studies have revealed that APN can inhibit osteoclastogenesis, this is the first report of its inhibitory effect on Mmp9 production in RAW264.7 cells. And further studies will be performed to investigate the underlying mechanisms. In this study, we aimed to explore if APN-LNP could decrease fasting blood glucose and improve femoral fracture healing in male DIO mice. At timepoint T1, we found that the fasting blood glucose and body weight decreased not only in APN-LNP group, but also in empty-LNP and control group. This may be due to the femoral surgery. DIO mice are very sensitive to environment and interventions. The femoral fracture surgery could influence the status of DIO mice obviously. At timepoint T2, APN-LNP decreased fasting blood glucose and body weight significantly, which indicated a beneficial impact of APN-LNP on regulating metabolism. Several in vitro studies have confirmed APN’s positive effect in promoting osteogenesis, which is in accordance with our results. We showed that APN-LNP could partially improve bone healing. The micro-environment of body is very complex. Notably, bone healing process is complex and influenced by many factors, including the type of fracture, the patient's age and health status, as well as any underlying medical conditions. Therefore, it is possible that APN-LNP may be effective in promoting bone healing in certain subsets of fracture healing, but not in others. Our findings are consistent with our previous research, which demonstrated the efficacy of APN-LNP in improving insulin sensitivity and kidney function in diabetic mice. Specifically, both studies revealed the ability of APN-LNP to reduce inflammation, suggesting a common underlying mechanism of action. While the previous study focused on metabolic improvements, 58    the current investigation highlights the treatment of bone disorders. The consistent beneficial effects observed across these distinct disease models underscore the broad therapeutic potential of APN-LNP and warrant further exploration of its mechanisms of action. In conclusion, our results suggest that APN-LNP could inhibit adipogenesis and promote osteogenesis. Moreover, we found that APN-LNP improved bone healing by promoting osteogenesis and reducing inflammation in a femoral fracture model of male DIO mice. Overall, this study provides promising preclinical data on the potential of APN-LNP as a therapeutic agent for bone disorders in obesity (FIG.19). References for Example 3 1. Nagareddy, P.R.; Kraakman, M.; Masters, S.L.; Stirzaker, R.A.; Gorman, D.J.; Grant, R.W.; Dragoljevic, D.; Hong, E.S.; Abdel-Latif, A.; Smyth, S.S.; et al. Adipose Tissue Macrophages Promote Myelopoiesis and Monocytosis in Obesity. Cell Metabo lism 2014, 19, 821–835, doi:10.1016 / j.cmet.2014.03.029. 2. Kusminski, C.M.; Bickel, P.E.; Scherer, P.E. Targeting Adipose Tissue in the Treatment of Obesity-Associated Diabetes. Nat Rev Drug Discov 2016, 15, 639–660, doi:10.1038 / nrd.2016.75. 3. Van Gaal, L.F.; Mertens, I.L.; De Block, C.E. Mechanisms Linking Obesity with Cardiovascular Disease. Nature 2006, 444, 875–880, doi:10.1038 / nature05487. 4. Rohm, T.V.; Meier, D.T.; Olefsky, J.M.; Donath, M.Y. Inflammation in Obesity, Diabetes, and Related Disorders. Immunity 2022, 55, 31–55, doi:10.1016 / j.immuni.2021.12.013. 5. Hotamisligil, G.S.; Murray, D.L.; Choy, L.N.; Spiegelman, B.M. Tumor Necrosis Factor Alpha Inhibits Signaling from the Insulin Receptor. Proc Natl Acad Sci U S A 1994, 91, 4854– 4858, doi:10.1073 / pnas.91.11.4854. 6. Yuan, M.; Konstantopoulos, N.; Lee, J.; Hansen, L.; Li, Z.W.; Karin, M.; Shoelson, S.E. Reversal of Obesity- and Diet-Induced Insulin Resistance with Salicylates or Targeted Disruption of Ikkbeta. Science 2001, 293, 1673–1677, doi:10.1126 / science.1061620. 7. Hotamisligil, G.S.; Erbay, E. Nutrient Sensing and Inflammation in Metabolic Diseases. Nat Rev Immunol 2008, 8, 923–934, doi:10.1038 / nri2449. 8. Cao, J.J. Effects of Obesity on Bone Metabolism. J Orthop Surg Res 2011, 6, 30, doi:10.1186 / 1749-799X-6-30. 59    9. Lindenmaier, L.B.; Philbrick, K.A.; Branscum, A.J.; Kalra, S.P.; Turner, R.T.; Iwaniec, U.T. Hypothalamic Leptin Gene Therapy Reduces Bone Marrow Adiposity in Ob / Ob Mice Fed Regular and High-Fat Diets. Front Endocrinol (Lausanne) 2016, 7, 110, doi:10.3389 / fendo.2016.00110. 10. Rinonapoli, G.; Pace, V.; Ruggiero, C.; Ceccarini, P.; Bisaccia, M.; Meccariello, L.; Caraffa, A. Obesity and Bone: A Complex Relationship. IJMS 2021, 22, 13662, doi:10.3390 / ijms222413662. 11. Achari, A.; Jain, S. Adiponectin, a Therapeutic Target for Obesity, Diabetes, and Endothelial Dysfunction. IJMS 2017, 18, 1321, doi:10.3390 / ijms18061321. 12. Begum, M.; Choubey, M.; Tirumalasetty, M.B.; Arbee, S.; Mohib, M.M.; Wahiduzzaman, M.; Mamun, M.A.; Uddin, M.B.; Mohiuddin, M.S. Adiponectin: A Promising Target for the Treatment of Diabetes and Its Complications. Life 2023, 13, 2213, doi:10.3390 / life13112213. 13. Tilija Pun, N.; Park, P.-H. Adiponectin Inhibits Inflammatory Cytokines Production by Beclin-1 Phosphorylation and B-Cell Lymphoma 2 mRNA Destabilization: Role for Autophagy Induction. Br J Pharmacol 2018, 175, 1066–1084, doi:10.1111 / bph.14144. 14. Thakur, V.; Pritchard, M.T.; McMullen, M.R.; Nagy, L.E. Adiponectin Normalizes LPS- Stimulated TNF-Alpha Production by Rat Kupffer Cells after Chronic Ethanol Feeding. Am J Physiol Gastrointest Liver Physiol 2006, 290, G998-1007, doi:10.1152 / ajpgi.00553.2005. 15. Kim, M.J.; Kim, E.H.; Pun, N.T.; Chang, J.-H.; Kim, J.-A.; Jeong, J.-H.; Choi, D.Y.; Kim, S.-H.; Park, P.-H. Globular Adiponectin Inhibits Lipopolysaccharide-Primed Inflammasomes Activation in Macrophages via Autophagy Induction: The Critical Role of AMPK Signaling. Int J Mol Sci 2017, 18, 1275, doi:10.3390 / ijms18061275. 16. Yosaee, S.; Khodadost, M.; Esteghamati, A.; Speakman, J.R.; Djafarian, K.; Bitarafan, V.; Shidfar, F. Adiponectin: An Indicator for Metabolic Syndrome. Iran J Public Health 2019, 48, 1106–1115. 17. Matsuzawa, Y.; Funahashi, T.; Kihara, S.; Shimomura, I. Adiponectin and Metabolic Syndrome. Arterioscler Thromb Vasc Biol 2004, 24, 29–33, doi:10.1161 / 01.ATV.0000099786.99623.EF. 18. Tu, Q.; Zhang, J.; Dong, L.Q.; Saunders, E.; Luo, E.; Tang, J.; Chen, J. Adiponectin Inhibits Osteoclastogenesis and Bone Resorption via APPL1-Mediated Suppression of Akt1. Journal of Biological Chemistry 2011, 286, 12542–12553, doi:10.1074 / jbc.M110.152405. 60    19. Oshima, K.; Nampei, A.; Matsuda, M.; Iwaki, M.; Fukuhara, A.; Hashimoto, J.; Yoshikawa, H.; Shimomura, I. Adiponectin Increases Bone Mass by Suppressing Osteoclast and Activating Osteoblast. Biochemical and Biophysical Research Communications 2005, 331, 520–526, doi:10.1016 / j.bbrc.2005.03.210. 20. Williams, G.A.; Wang, Y.; Callon, K.E.; Watson, M.; Lin, J.; Lam, J.B.B.; Costa, J.L.; Orpe, A.; Broom, N.; Naot, D.; et al. In Vitro and in Vivo Effects of Adiponectin on Bone. Endocrinology 2009, 150, 3603–3610, doi:10.1210 / en.2008-1639. 21. Korzun, T.; Moses, A.S.; Kim, J.; Patel, S.; Schumann, C.; Levasseur, P.R.; Diba, P.; Olson, B.; Rebola, K.G.D.O.; Norgard, M.; et al. Nanoparticle-Based Follistatin Messenger RNA Therapy for Reprogramming Metastatic Ovarian Cancer and Ameliorating Cancer- Associated Cachexia. Small 2022, 18, e2204436, doi:10.1002 / smll.202204436. 22. Yang, L.; Gong, L.; Wang, P.; Zhao, X.; Zhao, F.; Zhang, Z.; Li, Y.; Huang, W. Recent Advances in Lipid Nanoparticles for Delivery of mRNA. Pharmaceutics 2022, 14, 2682, doi:10.3390 / pharmaceutics14122682. 23. Kim, J.; Eygeris, Y.; Gupta, M.; Sahay, G. Self-Assembled mRNA Vaccines. Adv Drug Deliv Rev 2021, 170, 83–112, doi:10.1016 / j.addr.2020.12.014. 24. De La Vega, R.E.; Van Griensven, M.; Zhang, W.; Coenen, M.J.; Nagelli, C.V.; Panos, J.A.; Peniche Silva, C.J.; Geiger, J.; Plank, C.; Evans, C.H.; et al. Efficient Healing of Large Osseous Segmental Defects Using Optimized Chemically Modified Messenger RNA Encoding BMP-2. Sci. Adv.2022, 8, eabl6242, doi:10.1126 / sciadv.abl6242. 25. Schrom, E.; Huber, M.; Aneja, M.; Dohmen, C.; Emrich, D.; Geiger, J.; Hasenpusch, G.; Herrmann-Janson, A.; Kretzschmann, V.; Mykhailyk, O.; et al. Translation of Angiotensin- Converting Enzyme 2 upon Liver- and Lung-Targeted Delivery of Optimized Chemically Modified mRNA. Molecular Therapy - Nucleic Acids 2017, 7, 350–365, doi:10.1016 / j.omtn.2017.04.006. 26. Zhang, W.; De La Vega, R.E.; Coenen, M.J.; Müller, S.A.; Peniche Silva, C.J.; Aneja, M.K.; Plank, C.; Van Griensven, M.; Evans, C.H.; Balmayor, E.R. An Improved, Chemically Modified RNA Encoding BMP-2 Enhances Osteogenesis In Vitro and In Vivo. Tissue Engineering Part A 2019, 25, 131–144, doi:10.1089 / ten.tea.2018.0112. 27. Dunbar, C.E.; High, K.A.; Joung, J.K.; Kohn, D.B.; Ozawa, K.; Sadelain, M. Gene Therapy Comes of Age. Science 2018, 359, eaan4672, doi:10.1126 / science.aan4672. 61    28. Li, Z.; Ho, W.; Bai, X.; Li, F.; Chen, Y.; Zhang, X.-Q.; Xu, X. Nanoparticle Depots for Controlled and Sustained Gene Delivery. Journal of Controlled Release 2020, 322, 622–631, doi:10.1016 / j.jconrel.2020.03.021. 29. Wang, Z.; Ma, W.; Fu, X.; Qi, Y.; Zhao, Y.; Zhang, S. Development and Applications of mRNA Treatment Based on Lipid Nanoparticles. Biotechnology Advances 2023, 65, 108130, doi:10.1016 / j.biotechadv.2023.108130. 30. Puccetti, M.; Schoubben, A.; Giovagnoli, S.; Ricci, M. Biodrug Delivery Systems: Do mRNA Lipid Nanoparticles Come of Age? IJMS 2023, 24, 2218, doi:10.3390 / ijms24032218. 31. Gao, M.; Tang, M.; Ho, W.; Teng, Y.; Chen, Q.; Bu, L.; Xu, X.; Zhang, X.-Q. Modulating Plaque Inflammation via Targeted mRNA Nanoparticles for the Treatment of Atherosclerosis. ACS Nano 2023, 17, 17721–17739, doi:10.1021 / acsnano.3c00958. 32. El-Araby, R.E.; Tu, Q.; Xie, Y.; Aboushousha, T.; Li, Z.; Xu, X.; Zhu, Z.X.; Dong, L.Q.; Chen, J. Adiponectin mRNA Conjugated with Lipid Nanoparticles Specifically Targets the Pathogenesis of Type 2 Diabetes. Aging and disease 2024, 0, doi:10.14336 / AD.2024.0162. 33. Batoon, L.; Millard, S.M.; Raggatt, L.J.; Sandrock, C.; Pickering, E.; Williams, K.; Sun, L.W.H.; Wu, A.C.; Irvine, K.M.; Pivonka, P.; et al. Treatment with a Long-Acting Chimeric CSF1 Molecule Enhances Fracture Healing of Healthy and Osteoporotic Bones. Biomaterials 2021, 275, 120936, doi:10.1016 / j.biomaterials.2021.120936. 34. Li, X.; Zhu, X.; Wu, H.; Van Dyke, T.E.; Xu, X.; Morgan, E.F.; Fu, W.; Liu, C.; Tu, Q.; Huang, D.; et al. Roles and Mechanisms of Irisin in Attenuating Pathological Features of Osteoarthritis. Front. Cell Dev. Biol.2021, 9, 703670, doi:10.3389 / fcell.2021.703670. 35. Del Pozo-Rodríguez, A.; Solinís, M.Á.; Rodríguez-Gascón, A. Applications of Lipid Nanoparticles in Gene Therapy. European Journal of Pharmaceutics and Biopharmaceutics 2016, 109, 184–193, doi:10.1016 / j.ejpb.2016.10.016. 36. Yamauchi, T.; Kamon, J.; Waki, H.; Terauchi, Y.; Kubota, N.; Hara, K.; Mori, Y.; Ide, T.; Murakami, K.; Tsuboyama-Kasaoka, N.; et al. The Fat-Derived Hormone Adiponectin Reverses Insulin Resistance Associated with Both Lipoatrophy and Obesity. Nat Med 2001, 7, 941–946, doi:10.1038 / 90984. 37. Qiu, Y.; Gan, M.; Wang, X.; Liao, T.; Chen, Q.; Lei, Y.; Chen, L.; Wang, J.; Zhao, Y.; Niu, L.; et al. The Global Perspective on Peroxisome Proliferator-Activated Receptor γ 62    (PPARγ) in Ectopic Fat Deposition: A Review. Int J Biol Macromol 2023, 253, 127042, doi:10.1016 / j.ijbiomac.2023.127042. 38. Siersbæk, R.; Nielsen, R.; Mandrup, S. PPARγ in Adipocyte Differentiation and Metabolism – Novel Insights from Genome‐wide Studies. FEBS Letters 2010, 584, 3242– 3249, doi:10.1016 / j.febslet.2010.06.010. 39. Astapova, O.; Leff, T. Adiponectin and PPARγ. In Vitamins & Hormones; Elsevier, 2012; Vol.90, pp.143–162 ISBN 978-0-12-398313-8. 40. Zhang, J.; Liu, S.; He, Z.; Liu, H.; Liu, Y.; Hu, P.; Li, Z.; Xu, J.; Luo, E. Adiponectin Overexpression Promotes Fracture Healing through Regulating the Osteogenesis and Adipogenesis Balance in Osteoporotic Mice. J Bone Miner Metab 2023, 41, 457–469, doi:10.1007 / s00774-023-01420-3. 41. Delaigle, A.M.; Jonas, J.-C.; Bauche, I.B.; Cornu, O.; Brichard, S.M. Induction of Adiponectin in Skeletal Muscle by Inflammatory Cytokines: In Vivo and in Vitro Studies. Endocrinology 2004, 145, 5589–5597, doi:10.1210 / en.2004-0503. 42. Berner, H.S.; Lyngstadaas, S.P.; Spahr, A.; Monjo, M.; Thommesen, L.; Drevon, C.A.; Syversen, U.; Reseland, J.E. Adiponectin and Its Receptors Are Expressed in Bone-Forming Cells. Bone 2004, 35, 842–849, doi:10.1016 / j.bone.2004.06.008. 43. Guo, J.; Zeng, X.; Miao, J.; Liu, C.; Wei, F.; Liu, D.; Zheng, Z.; Ting, K.; Wang, C.; Liu, Y. MiRNA-218 Regulates Osteoclast Differentiation and Inflammation Response in Periodontitis Rats through Mmp9. Cell Microbiol 2019, 21, e12979, doi:10.1111 / cmi.12979. 44. Gu, J.-H.; Tong, X.-S.; Chen, G.-H.; Liu, X.-Z.; Bian, J.-C.; Yuan, Y.; Liu, Z.-P. Regulation of Matrix Metalloproteinase-9 Protein Expression by 1α,25-(OH) 2 D 3 during Osteoclast Differentiation. J Vet Sci 2014, 15, 133, doi:10.4142 / jvs.2014.15.1.133. 45. Jiang, H.; Wu, Y.; Valverde, P.; Murray, D.; Tang, J.; Yao, Q.; Han, Q.; Zhang, J.; Zhang, L.; Sui, L.; et al. Central Adiponectin Induces Trabecular Bone Mass Partly through Epigenetic Downregulation of Cannabinoid Receptor CB1. Journal Cellular Physiology 2019, 234, 7062–7069, doi:10.1002 / jcp.27460. 46. Luo, E.; Hu, J.; Bao, C.; Li, Y.; Tu, Q.; Murray, D.; Chen, J. Sustained Release of Adiponectin Improves Osteogenesis around Hydroxyapatite Implants by Suppressing Osteoclast Activity in Ovariectomized Rabbits. Acta Biomaterialia 2012, 8, 734–743, doi:10.1016 / j.actbio.2011.10.029. 63    47. Wu, Y.; Tu, Q.; Valverde, P.; Zhang, J.; Murray, D.; Dong, L.Q.; Cheng, J.; Jiang, H.; Rios, M.; Morgan, E.; et al. Central Adiponectin Administration Reveals New Regulatory Mechanisms of Bone Metabolism in Mice. American Journal of Physiology-Endocrinology and Metabolism 2014, 306, E1418–E1430, doi:10.1152 / ajpendo.00048.2014. 48. Yu, L.; Tu, Q.; Han, Q.; Zhang, L.; Sui, L.; Zheng, L.; Meng, S.; Tang, Y.; Xuan, D.; Zhang, J.; et al. Adiponectin Regulates Bone Marrow Mesenchymal Stem Cell Niche Through a Unique Signal Transduction Pathway: An Approach for Treating Bone Disease in Diabetes. Stem Cells 2015, 33, 240–252, doi:10.1002 / stem.1844. 49. Xuan, D.; Han, Q.; Tu, Q.; Zhang, L.; Yu, L.; Murry, D.; Tu, T.; Tang, Y.; Lian, J.B.; Stein, G.S.; et al. Epigenetic Modulation in Periodontitis: Interaction of Adiponectin and JMJD3- IRF4 Axis in Macrophages: EPIGENETIC MODULATION BY ADIPONECTIN IN PERIODONTITIS. J. Cell. Physiol.2016, 231, 1090–1096, doi:10.1002 / jcp.25201. 64

Claims

CLAIMS We claim:

1. A composition comprising an adiponectin (APN) mRNA and a nanoparticle.

2. The composition of claim 1, wherein the APN mRNA comprises SEQ ID NO: 1-2 or a sequence having at least 95% identity to SEQ ID NO: 1-2 or encodes a polypeptide of SEQ ID NO: 3 or a polypeptide having at least 95% identity to SEQ ID NO:

3.

3. The composition of any one of the preceding claims, wherein the APN mRNA comprises at least one nucleotide modification.

4. The composition of claim 3, wherein the modification is selected from the group consisting of a pseudouridine and a 5’methyl cytidine.

5. The composition of any one of the preceding claims, wherein the mRNA comprises a 7- methylguanylate cap on the 5’ end of the mRNA and a poly-A tail on the 3’ end of the mRNA.

6. The composition of any one of the preceding claims, wherein the nanoparticle comprises at least one of an ionized lipid, a DOPE, a cholesterol, and a DMG-PEG.

7. The composition of any one of the preceding claims, wherein the nanoparticles are between 20 and 500 nm in diameter.

8. A pharmaceutical composition comprising the composition of any one of the preceding claims and a pharmaceutically acceptable carrier.

9. A method of treating a metabolic disorder in a subject comprising administering the composition of any one of the preceding claims to the subject in a therapeutically effective amount.

10. The method of claim 9, wherein the metabolic disorder is selected from the group consisting of diabetes, type II diabetes, obesity, insulin resistance, hyperinsulinemia, hyperglycemia, adipokine dysregulation, periodontitis, metabolic syndrome, osteoporosis, non-alcoholic fatty liver disease, bone loss, or neurodegenerative disease.

11. A method of increasing weight loss comprising administering the composition of any one of claims 1-8 to a subject in need of weight loss.

12. The method of any one of claims 9-11, wherein the administration of the composition results in at least one of Glut-4 reactivation, improvement in the Insulin Resistance, increased DGKd, decreased PKCε, insulin receptor activation, activation of insulin 65   secretion through the reactivation of the islets of Langerhans, EGFR inhibition, reduction of inflammatory cytokines (TNF-α, IL-1β, IL-6), decrease blood glucose levels, and reduction of hepatocellular steatosis as compared to a subject not administered the composition.

13. A method of increasing bone regeneration or healing comprising administering the composition of any one of claims 1-8 to a subject in need of bone regeneration or healing.

14. The method of claim 13, wherein the bone volume to total volume ratio (BV / TV) and trabecular number (Tb.N) were significantly higher as compared to control subjects not treated with the composition.

15. The method of any one of claims 9-14, wherein the administration is via injection.

16. The method of claim 15, wherein the injection is an intravenous, subcutaneous or intramuscular injection.

17. The method of any one of claims 9-16, wherein the composition is administered more than one time.

18. The method of any one of claims 9-17, wherein the subject is a human.

19. The method of any one of claims 9-18, wherein the expression of APN protein is increased after administration of the composition in a tissue selected from the group consisting of muscle, liver, pancreas, kidney and fat.

Images