Methods and compositions for treating CTG repeat expansion diseases

Abstract

The present disclosure provides a double-stranded RNA comprising: a) a first strand that hybridizes to a target CUG repeat region of a CUG repeat-containing RNA. The present disclosure provides a recombinant nucleic acid comprising: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold; the present disclosure also provides a recombinant expression vector comprising a nucleotide sequence encoding such a recombinant nucleic acid. The present disclosure provides a DNA molecule comprising a nucleotide sequence encoding a recombinant nucleic acid comprising: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold; the present disclosure also provides a recombinant expression vector comprising such a DNA molecule. The present disclosure provides viral and non-viral delivery vehicles comprising a recombinant expression vector of the present disclosure; and pharmaceutical compositions comprising such delivery vehicles. The present disclosure provides methods for treating CUG repeat expansion-associated diseases.

Description

METHODS AND COMPOSITIONS FOR TREATING CTG REPEAT EXPANSION DISEASES CROSS REFERENCE

[0001] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 614,210, filed December 22, 2023, which application is incorporated herein by reference in its entirety.INCORPORATION-BY-REFERENCE OF MATERIAL ELECTRONICALLY SUB ITTED

[0002] A Sequence Listing is provided herewith as a Sequence Listing XML, “IRIS-004 WO_SEQ_LIST” created on December 20, 2024 and having a size of 680,200 bytes. The contents of the Sequence Listing XML are incorporated by reference herein in their entirety.INTRODUCTION

[0003] Repeat expansion disorders are genetic disorders caused by expansion of DNA repeats. DNA repeats may be composed of single nucleotides to dodecamers or longer. The threshold at which repeat expansions become symptomatic varies with the particular disease. There are over 50 distinct diseases caused by repeat expansions. Repeat expansions may occur in coding or non-coding regions of genes. Repeat expansions may cause defects in a protein encoded by a gene; change the regulation of gene expression; produce a toxic RNA, or lead to chromosome instability.

[0004] Expanded CTG repeats has been implicated in various disorders, including Huntington diseaselike 2, myotonic dystrophy type 1 (DM1), Fuchs endothelial corneal dystrophy (FECD), and Spinocerebellar ataxia type 8. DM1 is caused by a CTG expansion in the 3’ untranslated region (UTR) of the dystrophia myotonica protein kinase (DMPK) gene on chromosome 19ql 3. The expanded repeatcontaining RNAs may form ribonuclear foci that sequester and disrupt the normal activities of RNA binding proteins. The CTG trinucleotide repeat (TNR) expansion in Transcription Factor 4 (TCF4) intron 3 is the main cause of FECD. An expansion of a CTG TNR, located in an alternative promoter region between TCF4 exons 3 and 4 (known as CTG 18.1), upstream of TCF4 5' exons 4a, 4b and 4c causes FECD.

[0005] There is a need in the ait for compositions and methods of treating CTG repeat expansion disorders.SUMMARY

[0006] The present disclosure provides a double-stranded RNA comprising: a) a first strand that hybridizes to a target CUG repeat region of a CUG repeat-containing RNA, where the first strand comprises: i) a first mismatch to the target CUG repeat region; and ii) at least a second mismatch to thetarget CUG repeat region. The present disclosure provides a DNA molecule comprising a nucleotide sequence encoding the first strand of the double-stranded RNA, where the nucleotide sequence is operably linked to a promoter that is functional in a eukaryotic cell. The present disclosure provides a recombinant nucleic acid comprising: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold; the present disclosure also provides a recombinant expression vector comprising a nucleotide sequence encoding such a recombinant nucleic acid. The present disclosure provides a DNA molecule comprising a nucleotide sequence encoding a recombinant nucleic acid comprising: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold; the present disclosure also provides a recombinant expression vector comprising such a DNA molecule. The present disclosure provides viral and non-viral delivery vehicles comprising a recombinant expression vector of the present disclosure; and pharmaceutical compositions comprising such delivery vehicles. The present disclosure provides methods for selectively reducing translation and / or accumulation of a disease-associated CUG repeat-containing RNA. The present disclosure provides methods for treating CUG repeat expansion- associated diseases.BRIEF DESCRIPTION OF THE DRAWINGS

[0007] FIG. 1 provides examples of guide sequences of small binding RNAs (sbRNAs) of the present disclosure. Provided are the sequences of the guide strand (SEQ ID NOs: 7-20, respectively), and reverse complement of the guide strand (SEQ ID NOs: 21-34, respectively), the number of mismatches, the position of the mismatches, and the type of mismatch.

[0008] FIG. 2 provides examples of guide sequences of sbRNAs of the present disclosure. Provided are the sequences of the guide strand (SEQ ID NOs: 35-84, respectively), and reverse complement of the guide strand (SEQ ID NOs: 85-134, respectively), the number of mismatches, the position of the mismatches, and the type of mismatch.

[0009] FIG. 3 provides examples of guide sequences of sbRNAs of the present disclosure. Provided are the sequences of the guide strand (SEQ ID NOs: 135-241, respectively), and reverse complement of the guide strand (SEQ ID NOs: 242-348, respectively), the number of mismatches, the position of the mismatches, and the type of mismatch.

[0010] FIG. 4A-4B provide examples of nucleotide sequences of DNA encoding miRNA scaffolds comprising sbRNAs (SEQ ID NOs: 349-515, respectively). SEQ ID NOs:349-515 are the combined sequences presented in FIG. 4A-4B.

[0011] FIG. 5 depicts knock-down of protein translation from CTG repeat-containing RNA using sbRNAs.

[0012] FIG. 6 depicts knock-down, expressed as the ratio of GFP intensity for the sbRNA relative to scramble control, following transfection with guide sequences set out in Table 1.

[0013] FIG. 7A-7C provide schematic depictions of tandem scaffolds with 2 sbRNAs targeting two distinct target sequences (FIG. 7A) and a recombinant expression vector comprising nucleotide sequences encoding tandem scaffolds in single-stranded (FIG. 7B) and self-complementary (FIG. 7C) AAV genome configurations.

[0014] FIG. 8 provides nucleotide sequences of 5’ flanking polynucleotides (5’ arm), 3’ flanking polynucleotides (3’ arm), and loop polynucleotides for miRlOl (hsa-mir-101-2) and miR126 (hsa-mir- 126); and provides nucleotide sequences of a 5 ’-flanking polynucleotide and a 3’ flanking polynucleotide for miR451 (hsa-mir-451).

[0015] FIG. 9A and 9B provide nucleotide sequences of sbRNAs that target a CAG repeat-containing RNA. Sequences of a first strand of two different sbRNAs are provided in column labeled “RNA Guide strand Sequence 5’-3' in Fig. 9A. The column labeled “Passenger strand sequence 5’-3'” in Fig. 9A provide sequences of the second strand. Sequences of a first strand of three different sbRNAs are provided in column labeled “miRNA guide in Fig. 9B and sequences of the second strand are provided in column labeled “reverse complement of miRNA” in Fig. 9B. A sbRNA comprising a first strand and the corresponding second strand may be administered to a subject in need thereof.

[0016] FIG. 10A-10D provide examples of nucleotide sequences for tandem recombinant nucleic acids; sequences of dual miR33 scaffold guides targeting CAG and CTG are presented (SEQ ID NOs:545-619, respectively). SEQ ID NOs:545-619 are the combined sequences presented in FIG. 10A-10D. A sbRNA comprising a first strand and the corresponding second strand may be administered to a subject in need thereof. The first strand of a sbRNA may comprise the sequence of Guide 1 in FIG. 10A or Guide 2 in FIG. 10C, where T is replaced with U.

[0017] FIG. 11A-11D provide examples of nucleotide sequences for tandem recombinant nucleic acids; sequences of dual guides in miR33 and miRlOl scaffolds targeting CAG and CTG are presented (SEQ ID NOs:620-694, respectively). SEQ ID NOs:620-694 are the combined sequences presented in FIG.11 A-l ID. A sbRNA comprising a first strand and the corresponding second strand may be administered to a subject in need thereof. A first strand of a sbRNA may comprise the sequence of Guide 1 in FIG. 11 A or Guide 2 in FIG. 10C, where T is replaced with U.

[0018] FIG. 12 depicts a dendrimer conjugated to a sbRNA.DEFINITIONS

[0019] As used herein, the term “nucleic acid” or “polynucleotide” refer to any nucleic acid polymer composed of covalently linked nucleotide subunits, such as polydeoxyribonucleotides or polyribonucleotides. Examples of nucleic acids include RNA and DNA.

[0020] As used herein, “RNA” refers to a molecule comprising one or more ribonucleotides and includes double-stranded RNA, single-stranded RNA, isolated RNA, synthetic RNA, recombinant RNA, as well as modified RNA that differs from naturally-occurring RNA by the addition, deletion, substitution, and / or alteration of one or more nucleotides. Nucleotides of RNA molecules may comprise standard nucleotides or non-standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides.

[0021] As used herein, “DNA” refers to a molecule comprising one or more deoxyribonucleotides and includes double-stranded DNA, single-stranded DNA, isolated DNA, synthetic DNA, recombinant DNA, as well as modified DNA that differs from naturally -occurring DNA by the addition, deletion, substitution, and / or alteration of one or more nucleotides. Nucleotides of DNA molecules may comprise standard nucleotides or non-standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides.

[0022] As used herein, “nucleoside” means a compound comprising a nucleobase moiety and a sugar moiety. Nucleosides include, but are not limited to, naturally occurring nucleosides (as found in DNA and RNA) and modified nucleosides. Nucleosides may be linked to a phosphate moiety.

[0023] As used herein, “nucleotide” means a nucleoside further comprising a phosphate linking group. As used herein, “linked nucleosides” may or may not be linked by phosphate linkages and thus includes, but is not limited to, “linked nucleotides.” As used herein, “linked nucleosides” are nucleosides that are connected in a continuous sequence (i.c. no additional nucleosides arc present between those that ar c linked).

[0024] As used herein, “nucleobase” or “base” means a group of atoms that can be linked to a sugar moiety to create a nucleoside that is capable of incorporation into an oligonucleotide, and wherein the group of atoms is capable of bonding with a complementary naturally occurring nucleobase of another oligonucleotide or nucleic acid. Nucleobases may be naturally occurring or may be modified.

[0025] As used herein, “oligonucleotide” means a compound comprising a plurality of linked nucleosides. In some cases, an oligonucleotide comprises one or more unmodified ribonucleosides (RNA) and / or unmodified deoxyribonucleosides (DNA) and / or one or more modified nucleosides.

[0026] As used herein, “single-stranded” means an oligomeric compound that is not hybridized to its complement and which lacks sufficient self-complementarity to form a stable self-duplex.

[0027] As used herein, “double-stranded” means an oligomeric compound that is partially or completely hybridized to its complement to form a stable duplex molecule. A double-stranded oligomeric compound may be composed of two separate strands of complementary oligomeric compounds hybridized to each other or a single oligomeric compound which has sufficient self-complementari ty to form a stable self-duplex. Stable self-duplexes may contain stem-loop structure(s) and / or bulge(s).

[0028] “Isolated” refers to a substance that has been isolated from its natural environment or artificially produced. As used herein with respect to a cell, “isolated” refers to a cell that has been isolated from its natural environment (e.g., from a subject, organ, tissue, or bodily fluid). As used herein with respect to a nucleic acid, “isolated” refers to a nucleic acid that has been isolated or purified from its natural environment (e.g., from a cell, cell organelle, or cytoplasm), recombinantly produced, amplified, or synthesized. In embodiments, an isolated nucleic acid includes a nucleic acid contained within a vector.

[0029] As used herein, the term “wild-type” or “non-mutant” form of a gene refers to a nucleic acid that encodes a protein associated with normal or non-pathogenic activity (e.g., a protein lacking a mutation, such as a repeat region expansion that results in higher risk of developing, onset, or progression of a neurodegenerative disease).

[0030] As used herein, the term “mutation” refers to any change in the structure of a gene, e.g., gene sequence, resulting in an altered form of the gene, which may be passed onto subsequent generations (hereditary mutation) or not (somatic mutation). Gene mutations include the substitution, insertion, or deletion of a single base in DNA or the substitution, insertion, deletion, or rearrangement of multiple bases or larger sections of genes or chromosomes, including repeat expansions.

[0031] As used herein, a “microRNA” or “miRNA” refers to a small non-coding RNA molecule capable of mediating silencing of a target gene by cleavage of the target mRNA, translational repression of the target mRNA, target mRNA degradation, or a combination thereof. Typically, miRNA is transcribed as a hairpin or stem-loop (e.g., having a self-complementary, single-stranded backbone) duplex structure, referred to as a primary miRNA (pri-miRNA), which is enzymatically processed (e.g., by Drosha, DGCR8, Pasha, etc.) into a pre-miRNA. Pre-miRNA is exported into the cytoplasm, where it is enzymatically processed by Dicer to produce a miRNA duplex with the passenger strand and then a single- stranded mature miRNA molecule, which is subsequently loaded into the RNA-induced silencing complex (RISC). Reference to a miRNA may include synthetic or artificial miRNAs.

[0032] As used herein, a “synthetic miRNA” or “artificial miRNA” or “amiRNA” or “small binding RNA” (sbRNA) refers to a pri-miRNA or pre-miRNA (e.g., miRNA backbone or scaffold) in which the endogenous miRNA guide sequence and passenger sequence within the stem sequence have been replaced with a heterologous guide sequence and a heterologous passenger sequence (see, e.g., Eamens et al. (2014), Methods Mol. Biol. 1062:211-224). In some cases, the nature of the complementarity of theguide and passenger sequences (e.g., number of bases, position of mismatches, types of bulges, etc.) can be similar or different from the nature of complementarity of the guide and passenger sequences in the endogenous miRNA backbone upon which the synthetic miRNA is constructed.

[0033] As used herein, the term “microRNA backbone,” “miR backbone,” “microRNA scaffold,” or “miR scaffold” refers to a pri-miRNA or pre-miRNA scaffold, with the stem sequence replaced by a heterologous RNA of interest, and is capable of producing a functional, mature miRNA that directs RNA silencing at the gene targeted by the miRNA of interest. In some cases, a miR backbone comprises a 5’ flanking region (also referred to herein as a “5’ flanking polynucleotide” or a “5’ leader”), a loop motif region (also referred to herein as a “loop polynucleotide”), and a 3' flanking region (also referred to herein as a “3’ flanking polynucleotide” or a “3’ trailer”). In some cases, a miR backbone comprises a 5’ flanking region and a 3’ flanking region (and does not include a loop motif region). A miR backbone may be derived completely or partially from a wild type miRNA scaffold or be a completely artificial sequence.

[0034] A “stem-loop structure” refers to a nucleic acid having a secondary structure that includes a region of nucleotides which are known or predicted to form a double strand or self-duplex (stem portion) that is linked on one side by a region of predominantly single-stranded nucleotides (terminal loop portion). The terms “hairpin”, “self-duplex” and “fold-back” structures are also used herein to refer to stem-loop structures. Such structures are well known in the art and the term is used consistently with its known meaning in the art. As is known in the art, the secondary structure docs not require exact basepairing. Thus, the stem can include one or more base mismatches or bulges. Alternatively, the basepairing can be exact, i.e. not include any mismatches.

[0035] As used herein, the term “guide strand sequence” of an inhibitory nucleic acid refers to a sequence that is substantially complementary (e.g., at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary) to a region of about 10-50 nucleotides (e.g., about 15-30, 16- 25, 18-23, or 19-22 nucleotides) of the mRNA or pre-mRNA targeted for silencing. The guide sequence is sufficiently complementary to the target mRNA sequence to direct target-specific silencing, e.g., to trigger the destruction of the target mRNA by the RNAi machinery or process or to reduce translation of the target mRNA. In some cases, the guide strand sequence refers to the mature guide sequence remaining following cleavage by Dicer.

[0036] As used herein, the term “passenger strand sequence” of an inhibitory nucleic acid refers to a sequence that is homologous to the target mRNA or pre-mRNA, and partially or completely complementary to the guide strand sequence of an inhibitory nucleic acid. The guide strand sequence and passenger strand sequence of an inhibitory nucleic acid are hybridized to form a duplex structure (e.g., forming a double-stranded duplex or single-stranded self-annealing duplex structure). In somecases, the guide strand sequence and passenger strand sequence refers to the mature sequences remaining following cleavage by Dicer.

[0037] As used herein, the term “5’ arm” or “5’ stem” refers to a portion of a double stranded RNA (e.g., shRNA, pre-miRNA, pri-mRNA) that comprises the guide strand or passenger strand.

[0038] As used herein, the term “3’ arm” or “3’ stem” refers to a portion of a double stranded RNA that comprises the passenger strand to the 5’ stem's guide strand, or the guide strand to the 5’ stem’s passenger strand.

[0039] As used herein, a “duplex,” when used in reference to an inhibitory nucleic acid, refers to two nucleic acid strands (e.g., a guide strand and passenger strand) hybridizing together to form a duplex structure. A duplex may be formed by two separate nucleic acid strands or by a single nucleic acid strand having a region of self-complementarity (e.g., hairpin or stem-loop).

[0040] As used herein, “target nucleic acid” means a nucleic acid molecule to which an antisense compound hybridizes. A target nucleic acid may be a mRNA (target mRNA) or pre-mRNA (target pre- mRNA) encoded by a target gene.

[0041] As used herein, “targeting” or “targeted to” means the association of an antisense compound to a particular target nucleic acid molecule or a particular region of a target nucleic acid molecule. A doublestranded RNA targets a target nucleic acid if it is sufficiently complementary to the target nucleic acid to allow hybridization under physiological conditions.

[0042] As used herein, the term “complementary” refers to the ability of polynucleotides to form base pairs with each other. Base pairs are typically formed by hydrogen bonds between nucleotide subunits in antiparallel polynucleotide strands or a single, self-annealing polynucleotide strand. Complementary polynucleotide strands can form base pairs in the Watson-Crick manner (e.g., A to T, A to U, C to G), or in any other manner that allows for the formation of duplexes. In some cases, complementary nucleotides include G and U (wobble base pair). As apparent to skilled persons in the art, when using RNA as opposed to DNA, uracil rather than thymine is the base that is considered to be complementary to adenosine. Furthermore, when a “U” is denoted in the context of the present invention, the ability to substitute a “T” is understood, unless otherwise stated. Complementarity also encompasses Watson- Crick base pairing between non-modified and modified nucleobases (e.g., 5-methyl cytosine substituted for cytosine). Full complementarity, perfect complementarity or 100% complementarity between two polynucleotide strands is where each nucleotide of one polynucleotide strand can form hydrogen bond with a nucleotide unit of a second polynucleotide strand. % complementarity refers to the number of nucleotides of a contiguous nucleotide sequence in a nucleic acid molecule that are complementary to an aligned reference sequence (e.g., a target mRNA, passenger strand), divided by the total number of nucleotides and multiplying by 100. In such an alignment, a nucleobase / nucleotide which does not forma base pair is called a mismatch. Insertions and deletions are not permitted in calculating % complementarity of a contiguous nucleotide sequence. It is understood by skilled persons in the art that in calculating complementarity, chemical modifications to nucleobases are not considered as long as the Watson-Crick base pairing capacity of the nucleobase is retained (e.g., 5-methyl cytosine is considered the same as cytosine for the purpose of calculating % complementarity).

[0043] As used herein, “non-complementary” in reference to nucleobases means a pair of nucleobases that do not form hydrogen bonds with one another.

[0044] As used herein, “mismatch” means a nucleobase of a first oligomeric compound that is not capable of pairing with a nucleobase at a corresponding position of a second oligomeric compound, when the first and second oligomeric compound are aligned. Either or both of the first and second oligomeric compounds may be oligonucleotides. Nucleotides that do not base pair include self-pairing nucleotides (A-A, T-T, U-U, C-C, and G-G), A and C, C and U, C and T, A and G. In some cases, a mismatch docs not include G-U wobble base pairs.

[0045] The "percent identity" between two or more nucleic acid sequences refers to the proportion of nucleotides of a contiguous nucleotide sequence in a nucleic acid molecule that are shared by a reference sequence (i.e., % identity = number of identical nucleotides / total number of nucleotides in the aligned region (e.g., the contiguous nucleotide sequence) x 100). Insertions and deletions are not permitted in the calculation of % identity of a contiguous nucleotide sequence. It is understood by skilled persons in the art that in calculating identity, chemical modifications to nucleobases are not considered as long as the Watson-Crick base pairing capacity of the nucleobase is retained (e.g., 5-methyl cytosine is considered the same as cytosine for the purpose of calculating % identity).

[0046] As used herein, the term “hybridizing” or “hybridizes” refers to two nucleic acid strands forming hydrogen bonds between base pairs on antiparallel strands, thereby forming a duplex. While not limited to a particular- mechanism, the most common mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. The strength of hybridization between two nucleic acid strands may be described by the melting temperature (Tm), defined as at a given ionic strength and pH, the temperature at which 50% of a target sequence hybridizes to a complementary polynucleotide.

[0047] As used herein, “heterologous” refers to a nucleic acid that is not found in a native (naturally occurring) nucleic acid. For example, relative to a component of a microRNA (e.g., a 5’ flanking polynucleotide, a loop polynucleotide, a 3’ flanking polynucleotide) a heterologous guide sequence and a heterologous passenger sequence comprises a nucleotide sequence that is not associated with the microRNA in nature. As used herein, the “guide sequence” is interchangeable with “first strand” (or“targeting strand”, where the “targeting strand” hybridizes to a target RNA) of a double-stranded RNA, regardless of the orientation.

[0048] As used herein, “expression cassette” refers to any type of genetic construct containing a nucleic acid (e.g., transgene) in which part or all of the nucleic acid encoding sequence is capable of being transcribed. In some cases, expression includes transcription of the nucleic acid, for example, to generate a biologically-active polypeptide product or inhibitory RNA (e.g., siRNA, shRNA, miRNA) from a transcribed gene. In some cases, the transgene is operably linked to expression control sequences.

[0049] As used herein, the term “transgene” refers to an exogenous nucleic acid that has been transferred naturally or by genetic engineering means into another cell and is capable of being transcribed, and optionally translated.

[0050] As used herein, the term “gene expression” refers to the process by which a nucleic acid is transcribed from a nucleic acid molecule, and often, translated into a peptide or protein. The process can include transcription, post-transcriptional control, post-transcriptional modification, translation, post- translational control, post-translational modification, or any combination thereof. Reference to a measurement of “gene expression” may refer to measurement of the product of transcription (e.g., RNA or mRNA), or the product of translation (e.g., peptides or proteins).

[0051] As used herein, the term “inhibit expression of a gene” means to reduce, down-regulate, suppress, block, lower, or stop expression of the gene. The expression product of a gene can be an RNA molecule transcribed from the gene (e.g., an mRNA) or a polypeptide translated from an mRNA transcribed from the gene. A reduction in the level of an mRNA results in a reduction in the level of a polypeptide translated therefrom. In some cases, inhibition of expression reduces the level of a polypeptide without substantially affecting production of the encoding mRNA. The level of expression may be determined using standard techniques for measuring mRNA or protein.

[0052] As used herein, “vector” refers to a genetic construct that is capable of transporting a nucleic acid molecule (e.g., transgene encoding inhibitory nucleic acid) between cells and effecting expression of the nucleic acid molecule when operably linked to suitable expression control sequences. Expression control sequences may include transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation (poly A) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product. The vector may be a plasmid, phage particle, transposon, cosmid, phagemid, chromosome, artificial chromosome, virus, virion, lipid nanoparticle, etc. Once transformed into a suitable host cell, the vector may replicate and function independently of the host genome, or may, in some instances, integrate into the genome itself.

[0053] As used herein, “host cell” refers to any cell that contains, or is capable of containing a composition of interest, c.g., an inhibitory nucleic acid. In some cases, a host cell is a mammalian cell, such as a rodent cell (e.g., mouse or rat) or primate cell (e.g., monkey, chimpanzee, or human). In some cases, the host cell is a human cell. In embodiments, a host cell may be in vitro or in vivo. In some cases, a host cell may be from an established cell line or primary cells. In some cases, a host cell may be obtained from a patient having or suspected of having a repeat expansion disease or disorder. In embodiments, a host cell is a non-CNS cell, such as a fibroblast. In some cases, a host cell is a cell of the CNS, such as a neuron, a glial cell, an astrocyte, or a microglial cell. In some cases, a host cell is a lung cell, including respiratory muscle cells such as intercostal muscles and / or the muscle cells of the diaphragm, rib cage, or abdomen. In some cases, a host cell is an ocular cell. In some cases, a host cell is a muscle cell (e.g., a skeletal muscle cell or a smooth muscle cell). In some cases, a host cell is cardiac cell (e.g., a cardiomyocyte). In some cases, a host cell is a red blood cell.

[0054] As used herein, “expanded repeat containing gene” or “expanded repeat containingRNA” refers to a mutant gene or RNA molecule (e.g., pre-mRNA or niRNA) encoded by the mutant gene having a base sequence that includes a repeat region (e.g., CTG repeat) where the repeat region is expanded beyond a predetermined number or range of base repeats that are typically present in a “normal” expanded repeat containing gene or RNA encoded by the gene. The presence or length of the repeat region may affect normal processing, function or activity of the RNA or encoded protein and cause a “repeat expansion” or “expanded repeat” disease or disorder. Expanded repeats may be unstable (dynamic) mutations that change size in successive generations. In some cases, a repeat in an RNA is a CUG repeat. In some cases, a repeat in an RNA is a UGC repeat. In some cases, a repeat in an RNA is a GCU repeat.

[0055] A “repeat expansion disease or disorder,” or “expanded repeat disease or disorder,” refers to a disease or disorder caused by the expansion of a base repeat sequence beyond a predetermined number or range of base repeats that are typically present in a “normal” expanded repeat containing gene or RNA encoded by the gene. A repeat expansion disease or disorder may manifest with markedly varied phenotypes depending on the size of the repeat expansion.

[0056] As used herein, “subject,” “patient,” and “individual” are used interchangeably herein and refer to living organisms (e.g., mammals) selected for treatment or therapy. Examples of subjects include human and non-human mammals. Non-human mammals include, e.g., non-human primates (monkey, chimpanzee), cows, horses, sheep, dogs, cats, rats, mice, guinea pigs, pigs, and transgenic species thereof.

[0057] Before the present invention is further described, it is to be understood that this invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

[0058] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

[0059] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited.

[0060] It must be noted that as used herein and in the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a small binding RNA” includes a plurality of such RNAs and reference to “the microRNA scaffold” includes reference to one or more microRNA scaffolds and equivalents thereof known to those skilled in the art, and so forth. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as “solely,” “only” and the like in connection with the recitation of claim elements, or use of a “negative” limitation.

[0061] The use of the terms “a,” “an,” and “the,” and similar referents in the context of describing the disclosure (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms “comprising,” “having,” “including,” and “containing” are to be construed as open-ended terms (i.e., meaning “including, but not limited to,”) unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. For example, if the range 10-15 is disclosed,then 11, 12, 13, and 14 are also disclosed. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”) provided herein, is intended merely to better illuminate the embodiments of the disclosure and does not pose a limitation on the scope of the disclosure unless otherwise claimed.

[0062] As used herein, the term “about” used in connection with an amount indicates that the amount can vary by 10% of the stated amount. For example, “about 100” means an amount of from 90-110. Where about is used in the context of a range, the “about” used in reference to the lower amount of the range means that the lower amount includes an amount that is 10% lower than the lower amount of the range, and “about” used in reference to the higher amount of the range means that the higher amount includes an amount 10% higher than the higher amount of the range. For example, from about 100 to about 1000 means that the range extends from 90 to 1100.

[0063] The term “and / or” as used herein a phrase such as “A and / or B” is intended to include both A and B; A or B; A (alone); and B (alone). Likewise, the term “and / or” as used herein a phrase such as “A, B, and / or C” is intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0064] It is understood that aspects and embodiments of the present disclosure described herein include “comprising,” “consisting,” and “consisting essentially of’ aspects and embodiments.

[0065] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. All combinations of the embodiments pertaining to the invention are specifically embraced by the present invention and are disclosed herein just as if each and every combination was individually and explicitly disclosed. In addition, all sub-combinations of the various embodiments and elements thereof are also specifically embraced by the present invention and are disclosed herein just as if each and every such subcombination was individually and explicitly disclosed herein.

[0066] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.DETAILED DESCRIPTION

[0067] The present disclosure provides a double-stranded RNA comprising: a) a first strand that hybridizes to a target CUG repeat region of a CUG repeat-containing RNA, where the first strand comprises: i) a first mismatch to the target CUG repeat region; and ii) at least a second mismatch to the target CUG repeat region. The present disclosure provides a DNA molecule comprising a nucleotide sequence encoding the first strand of the double-stranded RNA, where the nucleotide sequence is operably linked to a promoter that is functional in a eukaryotic cell. The present disclosure provides a recombinant nucleic acid comprising: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold; the present disclosure also provides a recombinant expression vector comprising a nucleotide sequence encoding such a recombinant nucleic acid. The present disclosure provides a DNA molecule comprising a nucleotide sequence encoding a recombinant nucleic acid comprising: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold; the present disclosure also provides a recombinant expression vector comprising such a DNA molecule. The present disclosure provides viral and non-viral delivery vehicles comprising a recombinant expression vector of the present disclosure; and pharmaceutical compositions comprising such delivery vehicles. The present disclosure provides methods for selectively reducing translation and / or accumulation of a disease-associated CUG repeat-containing RNA. The present disclosure provides methods for treating CUG repeat expansion- associated diseases.DOUBLE-STRANDED RNAS

[0068] The present disclosure provides a double-stranded RNA. A double-stranded RNA (ds RNA) of the present disclosure targets the repeat region of a repeat-containing target RNA (e.g., an mRNA or a pre-mRNA), and contain from 2 to 7 (e.g., 2, 3, 4, 5, 6, or 7) mismatches relative to the repeat region in the target RNA. In some cases, the ds RNA contains only 2 mismatches to the target repeat region. In some cases, the ds RNA contains only 3 mismatches to the target repeat region. In some cases, the ds RNA contains only 4 mismatches to the target repeat region. In some cases, the ds RNA contains only 5 mismatches to the target repeat region. In some cases, the ds RNA contains only 6 mismatches to the target repeat region. In some cases, the ds RNA contains only 7 mismatches to the target repeat region. A ds RNA of the present disclosure is also referred to as a small binding RNA (sbRNA).

[0069] In some cases, a double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CUG repeat region of a CUG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target CUG repeat region; and ii) at least a second mismatch to the target CUG repeat region. In some cases, the first mismatch is at position 8 based on the numbering of SEQ ID NO:1, 2, or 3; when the firstmismatch is a position 8 based on the numbering of CAGCAGCAGCAGCAGCAGCAG (SEQ ID NO:1), AGCAGCAGCAGCAGCAGCAGC (SEQ ID NO:2), or GCAGCAGCAGCAGCAGCAGCA (SEQ ID NO:3), the second mismatch is from 1 to 13 bases 3’ of the first mismatch. In some cases, the first mismatch is at position 9 based on the numbering of SEQ ID NO:1, 2, or 3; when the first mismatch is at position 9 based on the numbering of SEQ ID NO:1, 2, or 3, the second mismatch is from 1 to 12 bases 3’ of the first mismatch. In some cases, the first mismatch is at position 10 based on the numbering of SEQ ID NO:1, 2, or 3; when the first mismatch is at position 10 based on the numbering of SEQ ID NO:1, 2, or 3, the second mismatch is from 1 to 11 bases 3’ of the first mismatch. In some cases, the first mismatch is at position 11 based on the numbering of SEQ ID NO:1, 2, or 3; when the first mismatch is at position 11 based on the numbering of SEQ ID NO:1, 2, or 3, the second mismatch is from 1 to 10 bases 3’ of the first mismatch.

[0070] Each mismatch is independently generated by a substitution that is independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a C with an A, a U, or a G; and c) a substitution of an A with a U, a C, or a G. In some cases, the first strand comprises no more than 2 mismatches with the target CUG repeat region of a CUG repeat-containing RNA. In some cases, the first strand comprises no more than 3 mismatches with the target CUG repeat region of a CUG repeat-containing RNA. In some cases, the first strand comprises no more than 4 mismatches with the target CUG repeat region of a CUG repeat-containing RNA. In some cases, the first strand comprises no more than 5 mismatches with the target CUG repeat region of a CUG repeat-containing RNA. In some cases, the first strand comprises no more than 6 mismatches with the target CUG repeat region of a CUG repeat-containing RNA. In some cases, the first strand comprises no more than 7 mismatches with the target CUG repeat region of a CUG repeat-containing RNA. In some cases, the mismatches are all within nucleotides 8-12, based on the numbering of any one of SEQ ID NOs:l-3. In some cases, the mismatches are all within nucleotides 8-10, based on the numbering of any one of SEQ ID NOs:l-3. In some cases, the mismatches are all within nucleotides 9-12, based on the numbering of any one of SEQ ID NOs:l-3. In some cases, the mismatches are all within nucleotides 10-12, based on the numbering of any one of SEQ ID NOs:l-3. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNAhas a length of from 13 nucleotides to 35 nucleotides (e.g., from 13 nucleotides to 15 nucleotides, from 15 nucleotides to 17 nucleotides, from 17 nucleotides to 19 nucleotides, from 19 nucleotides to 21 nucleotides, from 21 nucleotides to 25 nucleotides, from 25 nucleotides to 30 nucleotides, or from 30 nucleotides to 35 nucleotides). In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the double-stranded RNA has a length of 24 nucleotides. In some cases, the double-stranded RNA has a length of 25 nucleotides.

[0071] The double-stranded RNA of the present disclosure may comprise a single-stranded overhang on at least one of the termini, e.g., 3' and / or 5' overhang(s) of 1-10 nucleotides in length, for instance, an overhang of 1, 2, 3, 4, 5, or 6 nucleotides. In some embodiments, both strands have at least one stretch of 1-5 (e.g., 1, 2, 3, 4, or 5) single- stranded nucleotides in the double stranded region. In one embodiment, the single-stranded overhang is 1 , 2, or 3 nucleotides in length. In some embodiments, the double-stranded RNA may also have a blunt end, located at the 5 '-end of the antisense strand (or the 3'- end of the sense strand), or vice versa. In one embodiment, the double-stranded RNA may comprise a 3' overhang at the 3 '-end of the antisense strand, and optionally a blunt end at the 5 '-end of the antisense strand. In one embodiment, the double-stranded RNA may have a 5' overhang at the 5'-end of the sense strand, and optionally a blunt end at the 5 '-end of the antisense strand. In one embodiment, the doublestranded RNA may have two blunt ends at both ends of the dsRNA duplex.

[0072] In one embodiment, the sense strand of the double-stranded RNA is 21 -nucleotides in length, and the antisense strand is 23-nucleotides in length, wherein the strands form a double-stranded region of 21 consecutive base pairs having a 2-nucleotide long single-stranded overhangs at the 3'-end.

[0073] As used herein, in the context of a double stranded RNA, the terms “first strand,” “guide,” and “anti-sense strand” are used interchangeably.

[0074] An sbRNA of the present disclosure may comprise a first strand and the second strand, where in the first strand, the 3’ nucleotide or the two 3’ nucleotides form an overhang with reference to the 5’ end of the second strand. The overhang may facilitate separation of the two strands in vivo for binding of the first strand to the target repeat region. The sbRNA may not include an overhang at the 5’ end (i.e., the 5’ end of the first strand). Thus, the sbRNA may have a blunt 5’ end and an overhang at the 3’ end. For example, the first strand may include an A, AA, U, UU, etc. at the 3’ end while the second strand does not include any nucleotide at the corresponding position. In one example, the first strand may be 23 nts and the second strand may be 21 nts long where the last two 3’ nucleotides form an overhang with reference to the 5’ end of the second strand when the two strands are hybridized. For example, the first strand may be 22 nts and the second strand may be 20 nts long where the last two 3’ nucleotidesform an overhang with reference to the 5’ end of the second strand when the two strands are hybridized; the first strand may be 21 nts and the second strand may be 19 nts long where the last two 3’ nucleotides form an overhang with reference to the 5’ end of the second strand when the two strands are hybridized; or the first strand may be 20 nts and the second strand may be 18 nts long where the last two 3' nucleotides form an overhang with reference to the 5’ end of the second strand when the two strands are hybridized.

[0075] The overhang may not be complementary to the target repeat region. However, in the context of the mismatches described based on the numbering of any one of SEQ ID NOs:l-12, the non- complementary overhang is not counted as a mismatch. In other words, the first strand of the dsRNA described herein may have mismatches described based on the numbering of any one of SEQ ID NOs:l- 6 and may further comprise: none or one mismatch in a seed region (e.g., nt 1-7 based on the numbering of any one of SEQ ID NOs:l-6); a 5’U in the first strand; and / or a 3’ A, AA, U, UU, etc. in the first strand.

[0076] In one embodiment, the dsRNA may comprise mismatch(es) with the target, within the duplex formed by hybridization the first and second strands, or combinations thereof. The mismatch can occur in the overhang region or the duplex region.

[0077] A base pair can be ranked on the basis of their propensity to promote dissociation or melting (e.g., on the free energy of association or dissociation of a particular pairing, the simplest approach is to examine the pairs on an individual pair basis, though next neighbor or similar analysis can also be used). In terms of promoting dissociation: A:U is preferred over G:C; G:U is preferred over G:C; and I:C is preferred over G:C (l=inosine). Mismatches, e.g., non-canonical or other than canonical pairings (as described in USPN12.005,074) are preferred over canonical (A:T, A:U, G:C) pairings; and pairings which include a universal base are preferred over canonical pairings. In one embodiment, the dsRNA may comprise at least one of the first 1, 2, 3, 4, or 5 base pairs within the duplex regions from the 5'-end of the antisense strand can be chosen independently from the group of: A:U, G:U, I:C, and mismatched pairs, e.g., non-canonical or other than canonical pairings or pairings which include a universal base, to promote the dissociation of the antisense strand at the 5'-end of the duplex.

[0078] In one embodiment, the nucleotide at the 1 position within the duplex region from the 5'- end in the antisense strand is selected from the group consisting of A, dA, dU, U, and dT. Alternatively, at least one of the first 1, 2 or 3 base pair within the duplex region from the 5 '-end of the antisense strand is an AU base pah. For example, the first base pair within the duplex region from the 5'-end of the antisense strand is an AU base pair.

[0079] In some cases, where the first strand comprises 2 mismatches (e.g., only 2 mismatches), the second mismatch is within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-12. In some cases, where the first strand comprises 2 mismatches (e.g., only 2 mismatches), the second mismatch is not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-12 (e.g., the second mismatch is 3' of nucleotide 11).

[0080] In some cases, where the first strand comprises 3 mismatches (e.g., only 3 mismatches), the second and the third mismatches are within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-3. In some cases, where the first strand comprises 3 mismatches (e.g., only 3 mismatches), the second mismatch is within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-3 and the third mismatch is not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-3 (e.g., the third mismatch is 3’ of nucleotide 11). In some cases, where the first strand comprises 3 mismatches (e.g., only 3 mismatches), the second and the third mismatches not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-3 (e.g., the second and third mismatches are 3’ of nucleotide 11.

[0081] In some cases, where the first strand comprises 4 mismatches (e.g., only 4 mismatches), the second, third, and fourth mismatches are within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-3. In some cases, where the first strand comprises 4 mismatches (e.g., only 4 mismatches), the second and third mismatches are within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-3, and the fourth mismatch is not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-3 (e.g., the fourth mismatch is 3’ of nucleotide 11). In some cases, where the first strand comprises 4 mismatches (e.g., only 4 mismatches), the second mismatch is within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-3, and the third and fourth mismatches are not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-3 (e.g., the third and fourth mismatches are 3’ of nucleotide 11). In some cases, where the first strand comprises 4 mismatches (e.g., only 4 mismatches), the second, third, and fourth mismatches are not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-3 (e.g., the second, third, and fourth mismatches are 3’ of nucleotide 11).

[0082] In some embodiments, a dsRNA of the present disclosure may include a 5’ U or a 5’ A. A U or A at the first (i.e., the 5') nucleotide in the first strand can be included to favor its incorporation into the Argonaute protein during RISC formation and / or to favor its incorporation relative to the passenger strand. In such embodiments, while the 5’ U or the 5’ A present in the first strand (e.g., the guide strand) is a mismatch to the target CUG repeat region of a CUG repeat-containing RNA, this mismatch is not counted in the total number of mismatches present in the first RNA relative to the target CUG repeat region. For example, when the first strand that binds to the repeat region of a repeatcontaining target RNA includes a 5’ U or a 5’ A and includes a first mismatch and a second mismatch 3’ to the first mismatch, the total number of mismatches is indicated as 2. This is because the 5’ U or a 5’ A is an optional feature that is not present in every embodiment of dsRNA disclosed herein. Accordingly,the first strand (e.g., guide strand) that has 2, 3, 4, 5, 6, or 7 mismatches relative to the repeat region in the target RNA has 2+1, 3+1, 4+1, 5+1, 6+1, or 7+1 mismatches relative to the repeat region in the target RNA when the first strand includes a 5' U or a 5’ A, where the 2, 3, 4, 5, 6, or 7 mismatches are spaced as described herein and the +1 mismatch is the 5' U or a 5’ A. Thus, the present disclosure also encompasses dsRNA that includes a first mismatch and additional mismatch(es) 3’ to the first mismatch and an additional mismatch 5’ to the first mismatch where the additional mismatch 5’ to the first mismatch is the U or A. In certain embodiments, a dsRNA of the present disclosure may comprise a sequence as disclosed herein and may further include a 5’ A or a 5’ U. For example, the first strand may further include a 5’ U in addition to the sequences disclosed herein. In the same vein, the first strand may also include one or two nucleotides at the 3 ’end which are not complementary to the repeat region in the target RNA. These nucleotides may not be counted as a mismatch. The one or two nucleotides at the 3 ’end of the first strand which are not complementary to the repeat region in the target RNA may be any nucleotide. For example, the one or two nucleotides may be A or U.

[0083] The first strand may comprise a seed sequence, which has perfect or near-perfect (e.g., 1 non-complementary nucleotide) Watson-Crick complementarity to the target mRNA sequence, located at positions 1-7, 2-7, 1-8, or 2-8, of the first strand relative to the first 5’ nucleotide of the first strand. The seed region is important for efficient gene silencing by double stranded RNAs.

[0084] When nucleotide sequences encoding a double-stranded RNA is provided as a DNA sequence, it is understood that the same sequence (e.g., the guide strand) can also be used as a doublestranded RNA without the 5’arm and 3’arm, e.g., the double-stranded RNA can have the sequence of the guide strand where any T in the guide strand is a U in the double-stranded RNA.First mismatch at position 8; 2 mismatches

[0085] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CUG repeat region of a CUG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target CUG repeat region, where the first mismatch is at position 8 based on the number of any one of SEQ ID NOs: 1 -3; and ii) a second mismatch to the target CUG repeat region, where the second mismatch is from 1 to 13 bases 3’ of the first mismatch. In some cases, the second mismatch is 1 base 3’ of the first mismatch. In some cases, the second mismatch is 2 bases 3' of the first mismatch. In some cases, the second mismatch is 3 bases 3' of the first mismatch. In some cases, the second mismatch is 4 bases 3’ of the first mismatch. In some cases, the second mismatch is 5 bases 3’ of the first mismatch. In some cases, the second mismatch is 6 bases 3’ of the first mismatch. In some cases, the second mismatch is 7 bases 3’ of the first mismatch. In some cases, the second mismatch is 8 bases 3’ of the first mismatch. In some cases, the second mismatch is 9 bases 3’ of the first mismatch. In some cases, the second mismatch is 10bases 3’ of the first mismatch. In some cases, the second mismatch is 11 bases 3’ of the first mismatch. In some cases, the second mismatch is 12 bases 3’ of the first mismatch. In some cases, the second mismatch is 13 bases 3' of the first mismatch. Each mismatch is independently generated by a substitution that is independently selected from a) a substitution of a G with an A, a U, or a C; b) a substitution of a C with an A, a U, or a G; and c) a substitution of an A with a U, a C, or a G. n some cases, the first strand comprises no more than 2 mismatches with the target CUG repeat region. In some cases, the first strand comprises no more than 3 mismatches with the target CUG repeat region. In some cases, the first strand comprises no more than 4 mismatches with the target CUG repeat region. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the doublestranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the double-stranded RNA has a length of 24 nucleotides.

[0086] Non-limiting examples of first strand sequences are presented in FIG. 1 in the column labeled guide strand. As noted herein, the first strand may include a 5’ U or A (U / A). The first strand may include an overhang at the 3’ end:5’ U / A CAGCAGCAGCCGCAUCAGCAG (N)m3’ 1ststrand (SEQ ID NO:709)3' A / U GUCGUCGUCGGCGUAGUCGUC 5’ 2ndstrand (SEQ ID NO:710)Where the ‘5 UA base pair is present or absent and the overhang (N)mat the 3’end is present or absent, and where m=l or 2 and N =A, U, or G. The first mismatch “C” at position 11 and second mismatch “U” at position 15, based on numbering of SEQ ID NO: 1, are shown in bold.First mismatch at position 8; 3 mismatches

[0087] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CUG repeat region of a CUG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target CUG repeat region, where the first mismatch is at position 8 based on the number of any one of SEQ ID NOs:l-3; ii) a second mismatch to the target CUG repeat region, where the second mismatch is from 1 to13 bases 3’ of the first mismatch; and iii) a third mismatch to the target CUG repeat region, where the third mismatch is from 1 to 13 bases 3’ of the first mismatch; and b) a second strand that hybridizes to the first strand.

[0088] For example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 8, 10, and 11, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 8, 10, and 12, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 8, 10, and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 8, 11, and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 8, 12, and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 8, 10, and 15, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 8, 10, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 8, 10, and 11, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 8, 11, and 12 respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 8, 11, and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 8, 12, and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 8, 9, and 11, respectively, based on the numbering of any one of SEQ ID NOs:l-3.

[0089] Each mismatch is independently generated by a substitution that is independently selected from a) a substitution of a G with an A, a U, or a C; b) a substitution of a C with an A, a U, or a G; and c) a substitution of an A with a U, a C, or a G. In some cases, the first strand comprises no more than 3 mismatches with the target CUG repeat region. In some cases, the first strand comprises no more than 4 mismatches with the target CUG repeat region. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases,the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the doublestranded RNA has a length of 24 nucleotides.

[0090] Non-limiting examples of first strand sequences are presented in FIG. 2 in the column labeled guide strand.First mismatch at position 8; 4 mismatches

[0091] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CUG repeat region of a CUG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target CUG repeat region, where the first mismatch is at position 8 based on the number of any one of SEQ ID NOs:l-3; ii) a second mismatch to the target CUG repeat region, where the second mismatch is from 1 to 13 bases 3’ of the first mismatch; iii) a third mismatch to the target CUG repeat region, where the third mismatch is from 1 to 13 bases 3’ of the first mismatch; and iv) a fourth mismatch to the target CUG repeat region, where the fourth mismatch is from 1 to 13 bases 3’ of the first mismatch; and b) a second strand that hybridizes to the first strand.

[0092] For example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 8, 10, 11, and 16, respectively, based on the numbering of any one of SEQ ID NOs: 1-3. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 8, 10, 12, and 16, respectively, based on the numbering of any one of SEQ ID NOs: 1 -3. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 8, 10, 15, and 17, respectively, based on the numbering of any one of SEQ ID NOs: 1-3. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 8, 11, 12, and 16, respectively, based on the numbering of any one of SEQ ID NOs: 1-3. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 8, 9, 10, and 12, respectively, based on the numbering of any one of SEQ ID NOs: 1-3.

[0093] Each mismatch is independently generated by a substitution that is independently selected from a) a substitution of a G with an A, a U, or a C; b) a substitution of a C with an A, a U, or a G; and c) a substitution of an A with a U, a C, or a G. In some cases, the first strand comprises no more than 4 mismatches with the target CUG repeat region. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the doublestranded RNA has a length of 24 nucleotides.

[0094] Non-limiting examples of first strand sequences are presented in FIG. 3 in the column labeled guide strand.First mismatch at position 8; 5 mismatches

[0095] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CUG repeat region of a CUG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target CUG repeat region, where the first mismatch is at position 8 based on the number of any one of SEQ ID NOs:l-3; ii) a second mismatch to the target CUG repeat region, where the second mismatch is from 1 to 13 bases 3’ of the first mismatch; iii) a third mismatch to the target CUG repeat region, where the third mismatch is from 1 to 13 bases 3’ of the first mismatch; iv) a fourth mismatch to the target CUG repeat region, where the fourth mismatch is from 1 to 13 bases 3’ of the first mismatch; and v) a fifth mismatch to the target CUG repeat region, where the fifth mismatch is from 1 to 13 bases 3’ of the first mismatch; and b) a second strand that hybridizes to the first strand.

[0096] Each mismatch is independently generated by a substitution that is independently selected from a) a substitution of a G with an A, a U, or a C; b) a substitution of a C with an A, a U, or a G; and c) a substitution of an A with a U, a C, or a G. In some cases, the first strand comprises no more than 5 mismatches with the target CUG repeat region. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches(e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the doublestranded RNA has a length of 24 nucleotides.First mismatch at position 9; 2 mismatches

[0097] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CUG repeat region of a CUG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target CUG repeat region, where the first mismatch is at position 9 based on the number of any one of SEQ ID NOs:l-3; and ii) a second mismatch to the target CUG repeat region, where the second mismatch is from 1 to 12 bases 3’ of the first mismatch. In some cases, the second mismatch is 1 base 3’ of the fust mismatch. In some cases, the second mismatch is 2 bases 3' of the first mismatch. In some cases, the second mismatch is 3 bases 3' of the first mismatch. In some cases, the second mismatch is 4 bases 3’ of the first mismatch. In some cases, the second mismatch is 5 bases 3’ of the first mismatch. In some cases, the second mismatch is 6 bases 3’ of the first mismatch. In some cases, the second mismatch is 7 bases 3’ of the first mismatch. In some cases, the second mismatch is 8 bases 3’ of the first mismatch. In some cases, the second mismatch is 9 bases 3’ of the first mismatch. In some cases, the second mismatch is 10 bases 3' of the fust mismatch. In some cases, the second mismatch is 11 bases 3’ of the first mismatch. In some cases, the second mismatch is 12 bases 3’ of the first mismatch.

[0098] For example, in some cases, the first mismatch and the second mismatch are at positions 9 and 10, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, the first mismatch and the second mismatch are at positions 9 and 12, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, the first mismatch and the second mismatch are at positions 9 and 13, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch and the second mismatch are at positions 9 and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in somecases, the first mismatch and the second mismatch are at positions 9 and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-3.

[0099] Each mismatch is independently generated by a substitution that is independently selected from a) a substitution of a G with an A, a U, or a C; b) a substitution of a C with an A, a U, or a G; and c) a substitution of an A with a U, a C, or a G. In some cases, the first strand comprises no more than 2 mismatches with the target CUG repeat region. In some cases, the first strand comprises no more than 3 mismatches with the target CUG repeat region. In some cases, the fust strand comprises no more than 4 mismatches with the target CUG repeat region. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the doublestranded RNA has a length of 24 nucleotides.

[0100] Non-limiting examples of first strand sequences are presented in FIG. 1 in the column labeled guide strand.First mismatch at position 9; 3 mismatches

[0101] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CUG repeat region of a CUG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target CUG repeat region, where the first mismatch is at position 9 based on the number of any one of SEQ ID NOs:l-3; ii) a second mismatch to the target CUG repeat region, where the second mismatch is from 1 to 12 bases 3’ of the first mismatch; and iii) a third mismatch to the target CUG repeat region, where the third mismatch is from 1 to 12 bases 3’ of the first mismatch; and b) a second strand that hybridizes to the first strand.

[0102] For example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 9, 10, and 11, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, and the thirdmismatch are at positions 9, 10, and 12, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 9, 11, and 12, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 9, 11, and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-32. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 9, 11, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 9, 12, and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 9, 12, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 9, 16, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 9, 10, and 14, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 9, 10, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-3.

[0103] Each mismatch is independently generated by a substitution that is independently selected from a) a substitution of a G with an A, a U, or a C; b) a substitution of a C with an A, a U, or a G; and c) a substitution of an A with a U, a C, or a G. In some cases, the first strand comprises no more than 3 mismatches with the target CUG repeat region. In some cases, the first strand comprises no more than 4 mismatches with the target CUG repeat region. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides.In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the doublestranded RNA has a length of 24 nucleotides.

[0104] Non-limiting examples of first strand sequences are presented in FIG. 2 in the column labeled guide strand..First mismatch at position 9; 4 mismatches

[0105] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CUG repeat region of a CUG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target CUG repeat region, where the first mismatch is at position 9 based on the number of any one of SEQ ID NOs:l-3; ii) a second mismatch to the target CUG repeat region, where the second mismatch is from 1 to 12 bases 3’ of the first mismatch; iii) a third mismatch to the target CUG repeat region, where the third mismatch is from 1 to 12 bases 3’ of the first mismatch; and iv) a fourth mismatch to the target CUG repeat region, where the fourth mismatch is from 1 to 12 bases 3’ of the first mismatch; and b) a second strand that hybridizes to the first strand.

[0106] For example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 9, 10, 12, and 16, respectively, based on the numbering of any one of SEQ ID NOs: 1-3. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 9, 10, 17, and 18, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 9, 10, 11, and 12, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 9, 10, 11, and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 9, 11, 12, and 16, respectively, based on the numbering of any one of SEQ ID NOs: 1-3. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 9, 11, 12, and 17, respectively, based on the numbering of any one of SEQ ID NOs: 1 -3. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 9, 11, 16, and 18, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 9, 12, 16, and 17, respectively, based on the numbering of any one of SEQ ID NOs: 1-3. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 9, 11, 12, and 15, respectively, based on the numbering of any one of SEQ ID NOs: 1-3. As another example, in some cases, the first mismatch, thesecond mismatch, the third mismatch, and the fourth mismatch are at positions 9, 10, 13, and 14, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 9, 10, 13, and 18, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 9, 10, 16, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-3.

[0107] Each mismatch is independently generated by a substitution that is independently selected from a) a substitution of a G with an A, a U, or a C; b) a substitution of a C with an A, a U, or a G; and c) a substitution of an A with a U, a C, or a G. In some cases, the first strand comprises no more than 4 mismatches with the target CUG repeat region. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the doublestranded RNA has a length of 24 nucleotides.

[0108] Non-limiting examples of first strand sequences are presented in FIG. 3 in the column labeled guide strand..First mismatch at position 9; 5 mismatches

[0109] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CUG repeat region of a CUG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target CUG repeat region, where the first mismatch is at position 9 based on the number of any one of SEQ ID NOs:l-3; ii) a second mismatch to the target CUG repeat region, where the second mismatch is from 1 to 12 bases 3’ of the first mismatch; iii) a third mismatch to the target CUG repeat region, where the third mismatch is from 1 to 12 bases 3’ of the first mismatch; iv) a fourth mismatch to the target CUG repeat region, where the fourth mismatch is from 1 to 12 bases 3’ of the first mismatch; and v) a fifth mismatchto the target CUG repeat region, where the fifth mismatch is from 1 to 12 bases 3’ of the first mismatch; and b) a second strand that hybridizes to the first strand.

[0110] Each mismatch is independently generated by a substitution that is independently selected from a) a substitution of a G with an A, a U, or a C; b) a substitution of a C with an A, a U, or a G; and c) a substitution of an A with a U, a C, or a G. In some cases, the first strand comprises no more than 5 mismatches with the target CUG repeat region. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the doublestranded RNA has a length of 24 nucleotides.First mismatch at position 10; 2 mismatches

[0111] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CUG repeat region of a CUG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target CUG repeat region, where the first mismatch is at position 10 based on the number of any one of SEQ ID NOs:l-3; and ii) a second mismatch to the target CUG repeat region, where the second mismatch is from 1 to 11 bases 3' of the fust mismatch. In some cases, the second mismatch is 1 base 3’ of the first mismatch. In some cases, the second mismatch is 2 bases 3’ of the first mismatch. In some cases, the second mismatch is 3 bases 3’ of the first mismatch. In some cases, the second mismatch is 4 bases 3’ of the first mismatch. In some cases, the second mismatch is 5 bases 3’ of the first mismatch. In some cases, the second mismatch is 6 bases 3’ of the first mismatch. In some cases, the second mismatch is 7 bases 3’ of the first mismatch. In some cases, the second mismatch is 8 bases 3’ of the first mismatch. In some cases, the second mismatch is 9 bases 3’ of the first mismatch. In some cases, the second mismatch is 10 bases 3’ of the first mismatch. In some cases, the second mismatch is 11 bases 3’ of the first mismatch.

[0112] For example, in some cases, the first mismatch and the second mismatch are at positions 10 and 11, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example,the first mismatch and the second mismatch are at positions 10 and 12, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, the first mismatch and the second mismatch are at positions 10 and 15, respectively, based on the numbering of any one of SEQ ID NOs:l- 3. As another example, the first mismatch and the second mismatch are at positions 10 and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, the first mismatch and the second mismatch are at positions 10 and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, the first mismatch and the second mismatch are at positions 10 and 18, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, the first mismatch and the second mismatch are at positions 10 and 19, respectively, based on the numbering of any one of SEQ ID NOs:l-3.

[0113] Each mismatch is independently generated by a substitution that is independently selected from a) a substitution of a G with an A, a U, or a C; b) a substitution of a C with an A, a U, or a G; and c) a substitution of an A with a U, a C, or a G. In some cases, the first strand comprises no more than 2 mismatches with the target CUG repeat region. In some cases, the first strand comprises no more than 3 mismatches with the target CUG repeat region. In some cases, the first strand comprises no more than 4 mismatches with the target CUG repeat region. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the doublestranded RNA has a length of 24 nucleotides.

[0114] Non-limiting examples of first strand sequences are presented in FIG. 1 in the column labeled guide strand.First mismatch at position 10; 3 mismatches

[0115] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CUG repeat region of a CUG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the targetCUG repeat region, where the first mismatch is at position 10 based on the number of any one of SEQ ID NOs:l-3; ii) a second mismatch to the target CUG repeat region, where the second mismatch is from 1 to 11 bases 3’ of the first mismatch; and iii) a third mismatch to the target CUG repeat region, where the third mismatch is from 1 to 11 bases 3’ of the first mismatch; and b) a second strand that hybridizes to the first strand.

[0116] For example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 10, 11, and 12, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 10, 11, and 15, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 10, 12, and 15, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 10, 12, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 10, 12, and 14, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 10, 15, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 10, 16, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 10, 11, and 18, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 10, 13, and 18, respectively, based on the numbering of any one of SEQ ID NOs:l-3.

[0117] Each mismatch is independently generated by a substitution that is independently selected from a) a substitution of a G with an A, a U, or a C; b) a substitution of a C with an A, a U, or a G; and c) a substitution of an A with a U, a C, or a G. In some cases, the first strand comprises no more than 3 mismatches with the target CUG repeat region. In some cases, the first strand comprises no more than 4 mismatches with the target CUG repeat region. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the doublestranded RNA has a length of 24 nucleotides.

[0118] Non-limiting examples of first strand sequences arc presented in FIG. 2 in the column labeled guide strand.First mismatch at position 10; 4 mismatches

[0119] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CUG repeat region of a CUG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target CUG repeat region, where the first mismatch is at position 10 based on the number of any one of SEQ ID NOs:l-3; ii) a second mismatch to the target CUG repeat region, where the second mismatch is from 1 to 11 bases 3’ of the first mismatch; iii) a third mismatch to the target CUG repeat region, where the third mismatch is from 1 to 11 bases 3’ of the first mismatch; and iv) a fourth mismatch to the target CUG repeat region, where the fourth mismatch is from 1 to 11 bases 3’ of the first mismatch; and b) a second strand that hybridizes to the first strand.

[0120] For example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 10, 11, 17, and 18, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 10, 12, 13, and 15, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 10, 12, 15, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 10, 12, 15, and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch arc at positions 10, 15, 16, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 10, 16, 17, and 18, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 10, 11, 12, and 15, respectively, based on the numbering of any one of SEQ ID NOs:l-3. Asanother example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 10, 11, 12, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 10, 11, 12, and 19, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 10, 11, 13, and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 10, 11, 15, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 10, 11, 16, and 19, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 10, 13, 15, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-3.

[0121] Each mismatch is independently generated by a substitution that is independently selected from a) a substitution of a G with an A, a U, or a C; b) a substitution of a C with an A, a U, or a G; and c) a substitution of an A with a U, a C, or a G. In some cases, the first strand comprises no more than 4 mismatches with the target CUG repeat region. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the doublestranded RNA has a length of 24 nucleotides.

[0122] Non-limiting examples of first strand sequences are presented in FIG. 3 in the column labeled guide strand.First mismatch at position 10; 5 mismatches

[0123] In some eases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CUG repeat region of a CUG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target CUG repeat region, where the first mismatch is at position 10 based on the number of any one of SEQ ID NOs:l-3; ii) a second mismatch to the target CUG repeat region, where the second mismatch is from 1 to 11 bases 3’ of the first mismatch; iii) a third mismatch to the target CUG repeat region, where the third mismatch is from 1 to 11 bases 3’ of the first mismatch; iv) a fourth mismatch to the target CUG repeat region, where the fourth mismatch is from 1 to 11 bases 3’ of the first mismatch; and v) a fifth mismatch to the target CUG repeat region, where the fifth mismatch is from 1 to 11 bases 3’ of the first mismatch; and b) a second strand that hybridizes to the first strand.

[0124] Each mismatch is independently generated by a substitution that is independently selected from a) a substitution of a G with an A, a U, or a C; b) a substitution of a C with an A, a U, or a G; and c) a substitution of an A with a U, a C, or a G. In some cases, the first strand comprises no more than 5 mismatches with the target CUG repeat region. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the doublestranded RNA has a length of 24 nucleotides.First mismatch at position 11; 2 mismatches

[0125] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CUG repeat region of a CUG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target CUG repeat region, where the first mismatch is at position 11 based on the number of any one of SEQ ID NOs:l-3; and ii) a second mismatch to the target CUG repeat region, where the second mismatch is from 1 to 10 bases 3’ of the first mismatch. In some cases, the second mismatch is 1 base 3’ of the fustmismatch. In some cases, the second mismatch is 2 bases 3’ of the first mismatch. In some cases, the second mismatch is 3 bases 3" of the first mismatch. In some cases, the second mismatch is 4 bases 3’ of the first mismatch. In some cases, the second mismatch is 5 bases 3’ of the first mismatch. In some cases, the second mismatch is 6 bases 3' of the first mismatch. In some cases, the second mismatch is 7 bases 3' of the first mismatch. In some cases, the second mismatch is 8 bases 3’ of the first mismatch. In some cases, the second mismatch is 9 bases 3’ of the first mismatch. In some cases, the second mismatch is 10 bases 3’ of the first mismatch.

[0126] Each mismatch is independently generated by a substitution that is independently selected from a) a substitution of a G with an A, a U, or a C; b) a substitution of a C with an A, a U, or a G; and c) a substitution of an A with a U, a C, or a G. In some cases, the first strand comprises no more than 2 mismatches with the target CUG repeat region. In some cases, the first strand comprises no more than 3 mismatches with the target CUG repeat region. In some cases, the first strand comprises no more than 4 mismatches with the target CUG repeat region. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the doublestranded RNA has a length of 24 nucleotides.First mismatch at position 11; 3 mismatches

[0127] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CUG repeat region of a CUG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target CUG repeat region, where the first mismatch is at position 11 based on the number of any one of SEQ ID NOs:l-3; ii) a second mismatch to the target CUG repeat region, where the second mismatch is from 1 to 10 bases 3’ of the first mismatch; and iii) a third mismatch to the target CUG repeat region, where the third mismatch is from 1 to 10 bases 3’ of the first mismatch; and b) a second strand that hybridizes to the first strand.

[0128] For example, in some cases, the first mismatch, the second mismatch, and the third mismatch arc at positions 11, 12, and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 11, 12, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 11, 12, and 15, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 11, 15, and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 11, 16, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, and the third mismatch are at positions 11, 13, and 14, respectively, based on the numbering of any one of SEQ ID NOs:l-3.

[0129] Each mismatch is independently generated by a substitution that is independently selected from a) a substitution of a G with an A, a U, or a C; b) a substitution of a C with an A, a U, or a G; and c) a substitution of an A with a U, a C, or a G. In some cases, the first strand comprises no more than 3 mismatches with the target CUG repeat region. In some cases, the first strand comprises no more than 4 mismatches with the target CUG repeat region. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the fir st strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the doublestranded RNA has a length of 24 nucleotides.First mismatch at position 11; 4 mismatches

[0130] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CUG repeat region of a CUG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the targetCUG repeat region, where the first mismatch is at position 11 based on the number of any one of SEQ ID NOs:l-3; ii) a second mismatch to the target CUG repeat region, where the second mismatch is from 1 to 10 bases 3’ of the first mismatch; iii) a third mismatch to the target CUG repeat region, where the third mismatch is from 1 to 10 bases 3' of the first mismatch; and iv) a fourth mismatch to the target CUG repeat region, where the fourth mismatch is from 1 to 10 bases 3’ of the first mismatch; and b) a second strand that hybridizes to the first strand.

[0131] For example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 11, 12, 13, and 14, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 11, 12, 16, and 21, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 11, 12, 17, and 21, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 11, 12, 13, and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 11, 12, 15, and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 11, 13, 14, and 16, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 11, 15, 16, and 17, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 11, 12, 18, and 19, respectively, based on the numbering of any one of SEQ ID NOs:l-3. As another example, in some cases, the first mismatch, the second mismatch, the third mismatch, and the fourth mismatch are at positions 11, 13, 16, and 19, respectively, based on the numbering of any one of SEQ ID NOs:l-3.

[0132] Each mismatch is independently generated by a substitution that is independently selected from a) a substitution of a G with an A, a U, or a C; b) a substitution of a C with an A, a U, or a G; and c) a substitution of an A with a U, a C, or a G. In some cases, the first strand comprises no more than 4 mismatches with the target CUG repeat region. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strandcomprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the doublestranded RNA has a length of 24 nucleotides.First mismatch at position 11; 5 mismatches

[0133] In some cases, a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CUG repeat region of a CUG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target CUG repeat region, where the first mismatch is at position 11 based on the number of any one of SEQ ID NOs:l-3; ii) a second mismatch to the target CUG repeat region, where the second mismatch is from 1 to 10 bases 3’ of the first mismatch; iii) a third mismatch to the target CUG repeat region, where the third mismatch is from 1 to 10 bases 3’ of the first mismatch; iv) a fourth mismatch to the target CUG repeat region, where the fourth mismatch is from 1 to 10 bases 3’ of the first mismatch; and v) a fifth mismatch to the target CUG repeat region, where the fifth mismatch is from 1 to 10 bases 3’ of the first mismatch; and b) a second strand that hybridizes to the first strand.

[0134] Each mismatch is independently generated by a substitution that is independently selected from a) a substitution of a G with an A, a U, or a C; b) a substitution of a C with an A, a U, or a G; and c) a substitution of an A with a U, a C, or a G. In some cases, the first strand comprises no more than 5 mismatches with the target CUG repeat region. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides.In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the doublestranded RNA has a length of 24 nucleotides.Chemical modifications

[0135] A nucleic acid of the present disclosure (e.g., an sbRNA, a nucleic acid comprising an sbRNA of the present disclosure, or a nucleic acid encoding both strands of an sbRNA of the present disclosure) can comprise one or more of the following: i) one or more chemically modified nucleobases; ii) one or more chemically modified sugars; and iii) one or more chemically modified internucleoside or internucleotide linkages). In some cases, the one or more modifications provide for increased nuclease resistance, compared to the nucleic acid not comprising the one or more modifications.

[0136] In some embodiments, an RNA of the present disclosure (e.g., an sbRNA) comprises one or more modifications (e.g., a base modification, a backbone modification, a sugar modification). In some embodiments, a DNA of the present disclosure (e.g., a DNA comprising a nucleotide sequence encoding an RNA (e.g., a dsRNA) of the present disclosure) comprises one or more modifications (e.g., a base modification, a backbone modification, a sugar modification). A nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base. The two most common classes of such heterocyclic bases are the purines and the pyrimidines. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2', the 3', or the 5' hydroxyl moiety of the sugar. In forming oligonucleotides, the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn, the respective ends of this linear polymeric compound can be further joined to form a circular compound, however, linear compounds are suitable. In addition, linear compounds may have internal nucleotide base complementarity and may therefore fold in a manner as to produce a fully or partially double-stranded compound. Within oligonucleotides, the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide. The normal linkage or backbone of RNA and DNA is a 3' to 5' phosphodiester linkage.

[0137] Suitable nucleic acid modifications include, but are not limited to: 2’O-methyl modified nucleotides, 2’ -Fluoro modified nucleotides, 2’-O-(2-methoxyethyl) modified nucleotides, locked nucleic acid (LNA) modified nucleotides, peptide nucleic acid (PNA) modified nucleotides, nucleotides with phosphorothioatc linkages, and a 5’ cap (e.g., a 7-mcthylguanylatc cap (m7G)). Additional details and additional modifications are described below.

[0138] A 2'-O-Methyl modified nucleotide (also referred to as 2'-O-Methyl RNA) is a naturally occurring modification of RNA found in tRNA and other small RNAs that arises as a post-transcriptional modification. Oligonucleotides can be directly synthesized that contain 2'-O-Methyl RNA. This modification increases Tm of RNA:RNA duplexes but results in only small changes in RNA:DNAstability. It is stable with respect to attack by single-stranded ribonucleases and is typically 5 to 10-fold less susceptible to DNases than DNA.

[0139] 2' -Fluoro modified nucleotides (e.g., 2' Fluoro bases) have a fluorine modified ribose which increases binding affinity (Tm) and also confers some relative nuclease resistance when compared to native RNA. These modifications improve stability in serum or other biological fluids.

[0140] 2'-O-(2-methoxyethyl) modified nucleotides have a 2 -methoxy ethyl modified ribose which increases pairing stability and also confers some relative nuclease resistance when compared to native RNA. These modifications improve stability in serum or other biological fluids.

[0141] LNA bases have a modification to the ribose backbone that locks the base in the C3'-endo position, which favors RNA A-type helix duplex geometry. This modification significantly increases Tm and is also very nuclease resistant. Multiple LNA insertions can be placed in an oligo at any position except the 3'-end.

[0142] The phosphorothioate (PS) bond (i.e., a phosphorothioate linkage) substitutes a sulfur atom for a non-bridging oxygen in the phosphate backbone of a nucleic acid (e.g., an oligo). This modification renders the internucleotide linkage resistant to nuclease degradation. Phosphorothioate bonds can be introduced between the last 3-5 nucleotides at the 5’- or 3’-end of the oligo to inhibit exonuclease degradation. Including phosphorothioate bonds within the oligo (e.g., throughout the entire oligo) can help reduce attack by endonucleases as well.

[0143] In some cases, a subject nucleic acid has one or more nucleotides that are 2'-O-Methyl modified nucleotides. In some cases, a subject nucleic acid has one or more 2’ Fluoro modified nucleotides. In some cases, a subject nucleic acid has one or more LNA bases. In some cases, a subject nucleic acid has one or more nucleotides that are linked by a phosphorothioate bond (i.e., the subject nucleic acid has one or more phosphorothioate linkages). In some cases, a subject nucleic acid has a 5’ cap (e.g., a 7-methylguanylate cap (m7G)). In some cases, a subject nucleic acid has a combination of modified nucleotides. For example, a subject nucleic acid can have a 5’ cap (e.g., a 7-methylguanylate cap (m7G)) in addition to having one or more nucleotides with other modifications (e.g., a 2'-O-Methyl nucleotide and / or a 2’ Fluoro modified nucleotide and / or a LNA base and / or a phosphorothioate linkage).Modified backbones and modified internucleoside linkages

[0144] In some cases, a nucleic acid of the present disclosure includes a modified backbone or one or more non-natural internucleoside linkages. Nucleic acids having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone.

[0145] Suitable modified oligonucleotide backbones containing a phosphorus atom therein include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters,aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates, 5'- alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, phosphorodiamidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3' to 3', 5' to 5' or 2' to 2' linkage. Suitable oligonucleotides having inverted polarity comprise a single 3' to 3' linkage at the 3'-most internucleotide linkage i.e. a single inverted nucleoside residue which may be a basic (the nucleobase is missing or has a hydroxyl group in place thereof). Various salts (such as, for example, potassium or sodium), mixed salts and free acid forms are also included.

[0146] In some cases, a subject nucleic acid comprises one or more phosphorothioate and / or heteroatom internucleoside linkages, in particular -CH2-NH-O-CH2-, -CH2-N(CH3)-O-CH2- (known as a methylene (methylimino) or MMI backbone), -CH2-O-N(CHJ)-CH2-, -CH2-N(CH3)-N(CH3)-CH2- and - O-N(CH3)-CH2-CH2- (wherein the native phosphodiester internucleotide linkage is represented as -O- P(=O)(OH)-O-CH2-). MMI type internucleoside linkages are disclosed in the above referenced U.S. Pat. No. 5,489,677, the disclosure of which is incorporated herein by reference in its entirety. Suitable amide internucleoside linkages are disclosed in U.S. Pat. No. 5,602,240, the disclosure of which is incorporated herein by reference in its entirety.

[0147] Also suitable arc nucleic acids having morpholino backbone structures as described in, c.g., U.S. Pat. No. 5,034,506. For example, in some cases, a subject nucleic acid comprises a 6-membered morpholino ring in place of a ribose ring. In some of these embodiments, a phosphorodiamidate or other non-phosphodiester internucleoside linkage replaces a phosphodiester linkage.

[0148] Suitable modified polynucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; riboacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and mcthylcnchydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts.Mimetics

[0149] A subject nucleic acid can be a nucleic acid mimetic. The term "mimetic" as it is applied to polynucleotides is intended to include polynucleotides wherein only the furanose ring or both the furanose ring and the internucleotide linkage are replaced with non-furanose groups, replacement of onlythe furanose ring is also referred to in the art as being a sugar surrogate. The heterocyclic base moiety or a modified heterocyclic base moiety is maintained for hybridization with an appropriate target nucleic acid. One such nucleic acid, a polynucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA, the sugar-backbone of a polynucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleotides are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.

[0150] One polynucleotide mimetic that has been reported to have excellent hybridization properties is a peptide nucleic acid (PNA). The backbone in PNA compounds is two or more linked aminoethylglycine units which gives PNA an amide containing backbone. The heterocyclic base moieties are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.Representative U.S. patents that describe the preparation of PNA compounds include, but are not limited to: U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, the disclosures of which are incorporated herein by reference in their entirety.

[0151] Another class of polynucleotide mimetic that has been studied is based on linked morpholino units (morpholino nucleic acid) having heterocyclic bases attached to the morpholino ring. A number of linking groups have been reported that link the morpholino monomeric units in a morpholino nucleic acid. One class of linking groups has been selected to give a non-ionic oligomeric compound. The nonionic morpholino-based oligomeric compounds ar c less likely to have undcsircd interactions with cellular proteins. Morpholino-based polynucleotides are non-ionic mimics of oligonucleotides which are less likely to form undesired interactions with cellular proteins (Dwaine A. Braasch and David R. Corey, Biochemistry, 2002, 41(14), 4503-4510). Morpholino-based polynucleotides are disclosed in U.S. Pat. No. 5,034,506, the disclosure of which is incorporated herein by reference in its entirety. A variety of compounds within the morpholino class of polynucleotides have been prepared, having a variety of different linking groups joining the monomeric subunits.

[0152] A further class of polynucleotide mimetic is referred to as cyclohexenyl nucleic acids (CeNA). The furanose ring normally present in a DNA / RNA molecule is replaced with a cyclohexenyl ring. CeNA DMT protected phosphoramidite monomers have been prepared and used for oligomeric compound synthesis following classical phosphoramidite chemistry. Fully modified CeNA oligomeric compounds and oligonucleotides having specific positions modified with CeNA have been prepared and studied (see Wang et aL, J. Am. Chem. Soc., 2000, 122, 8595-8602, the disclosure of which is incorporated herein by reference in its entirety). In general, the incorporation of CeNA monomers into a DNA chain increases the stability of a DNA / RNA hybrid. CeNA oligoadenylates formed complexes with RNA and DNA complements with similar stability to the native complexes. The study of incorporatingCeNA structures into natural nucleic acid structures was shown by NMR and circular dichroism to proceed with easy conformational adaptation.

[0153] A further modification includes Locked Nucleic Acids (LNAs) in which the 2'-hydroxyl group is linked to the 4' carbon atom of the sugar ring thereby forming a 2'-C,4'-C-oxymethylene linkage thereby forming a bicyclic sugar moiety. The linkage can be a methylene (-CH2-), group bridging the 2' oxygen atom and the 4' carbon atom wherein n is 1 or 2 (Singh et al., Chem. Commun., 1998, 4, 455-456, the disclosure of which is incorporated herein by reference in its entirety). LNA and LNA analogs display very high duplex thermal stabilities with complementary DNA and RNA (Tm=+3 to +10° C), stability towards 3'-exonucleolytic degradation and good solubility properties. Potent and nontoxic antisense oligonucleotides containing LNAs have been described (e.g., Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 5633-5638, the disclosure of which is incorporated herein by reference in its entirety).

[0154] The synthesis and preparation of the LNA monomers adenine, cytosine, guanine, 5-methyl- cytosine, thymine and uracil, along with their oligomerization, and nucleic acid recognition properties have been described (e.g., Koshkin et al., Tetrahedron, 1998, 54, 3607-3630, the disclosure of which is incorporated herein by reference in its entirety). LNAs and preparation thereof are also described in WO 98 / 39352 and WO 99 / 14226, as well as U.S. applications 20120165514, 20100216983, 20090041809, 20060117410, 20040014959, 20020094555, and 20020086998, the disclosures of which are incorporated herein by reference in their entirety.Modified sugar moieties

[0155] A subject nucleic acid can also include one or more substituted sugar moieties. Suitable polynucleotides comprise a sugar substituent group selected from: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C.sub.l to Cw alkyl or C2 to Cw alkenyl and alkynyl. Particularly suitable are O((CH2)nO) mCH3, O(CH2)nOCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2, and O(CH2)nON((CH2)nCH3)2, where n and m are from 1 to about 10. Other suitable polynucleotides comprise a sugar substituent group selected from: Ci to C10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intcrcalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties. A suitable modification includes 2'-methoxyethoxy (2'-O-CH2 CH2OCH3, also known as 2'-O-(2-methoxyethyl) or 2'-M0E) (Martin et al., Helv. Chim. Acta, 1995, 78, 486-504, the disclosure of which is incorporated herein by reference in its entirety) i.e., an alkoxy alkoxy group. A further suitable modification includes 2'-dimethylaminooxyethoxy, i.e., a O(CH2)2ON(CHI)2 group, also known as 2'-DMA0E, as described in examples hereinbelow, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethyl- amino-ethoxy-ethyl or 2'-DMAE0E), i.e., 2'-O-CH2-O-CH2-N(CH3)2-

[0156] Other suitable sugar substituent groups include methoxy (-O-CH3), aminopropoxy (-O CH2 CH2NH2), allyl (-CH2-CH=CH2), -O-allyl (-0- CH2 — CH=CH2) and fluoro (F). 2'-sugar substituent groups may be in the arabino (up) position or ribo (down) position. A suitable 2'-arabino modification is 2'-F. Similar modifications may also be made at other positions on the oligomeric compound, particularly the 3' position of the sugar on the 3' terminal nucleoside or in 2'-5' linked oligonucleotides and the 5' position of 5' terminal nucleotide. Oligomeric compounds may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar.Base modifications and substitutions

[0157] A subject nucleic acid may also include nucleobase (often referred to in the art simply as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nuclcobascs include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5 -methylcytosine (5- me-C), 5 -hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2- thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C=C-CH;) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5- uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8- substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8- azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3- deazaadenine. Further modified nucleobases include tricyclic pyrimidines such as phenoxazine cytidine(lH-pyrimido(5,4-b)(l,4)benzoxazin-2(3H)-one), phenothiazine cytidine (lH-pyrimido(5,4- b)(l,4)benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g. 9-(2- aminoethoxy)-H-pyrimido(5,4-(b) (l,4)benzoxazin-2(3H)-one), carbazole cytidine (2H-pyrimido(4,5- b)indol-2-one), pyridoindole cytidine (H-pyrido(3',2':4,5)pyrrolo(2,3-d)pyrimidin-2-one).

[0158] Heterocyclic base moieties may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-dcaza-adcninc, 7-dcazaguanosinc, 2-aminopyridinc and 2-pyridone. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications , pages 289-302, Crooke, S. T. and Lebleu, B., ed., CRC Press, 1993; the disclosures of which areincorporated herein by reference in their entirety. Certain of these nucleobases are useful for increasing the binding affinity of an oligomeric compound. These include 5-substituted pyrimidines, 6- azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2 -aminopropyladenine, 5- propynyluracil and 5-propynylcytosine. 5 -methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.20C. (Sanghvi et al., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278; the disclosure of which is incorporated herein by reference in its entirety) and are suitable base substitutions, e.g., when combined with 2'-O-methoxyethyl sugar modifications.Conjugates

[0159] In some cases, a subject nucleic acid comprises one or more moieties conjugated to the nucleic acid. Thus, the present disclosure provides a conjugate comprising: a) a nucleic acid of the present disclosure, e.g., a double-stranded RNA of the present disclosure; and b) one or more non-nucleic acid moieties conjugated to the nucleic acid, directly or via a linker.

[0160] In some cases, the non-nucleic acid moiety is conjugated to the double-stranded RNA directly. In some cases, the non-nucleic acid moiety is conjugated to the double-stranded RNA via a linker. Suitable linkers can contain an ether, a thioether, urea, carbonate, an amine, an amide, maleimide- thioether, disulfide, phosphodiester, sulfonamide, a product of a click chemistry reaction (e.g., a triazole from an azide-alkyne cycloaddition), or a carbamate.

[0161] In some cases, a moiety conjugated to a subject nucleic acid enhances the activity, stability, cellular distribution, or cellular uptake of the nucleic acid. Suitable moieties include conjugate groups covalently bound to functional groups such as primary or secondary hydroxyl groups. Conjugate groups include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers. Suitable conjugate groups include, but are not limited to, cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance the pharmacodynamic properties include groups that improve uptake, enhance resistance to degradation, and / or strengthen sequence-specific hybridization with the target nucleic acid. Groups that enhance the pharmacokinetic properties include groups that improve uptake, distribution, metabolism or excretion of a subject nucleic acid.

[0162] Suitable conjugate moieties include, but are not limited to, a lipid moiety, such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let.. 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), analiphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49- 54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1 ,2-di-O-hexadecyl-rac- glycero-3-H-phosphonate or hexadecylglycerol (Manoharan et aL, Tetrahedron Lett., 1995, 36, 3651- 3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783); a polyamine or a polyethylene glycol chain (Manoharan et al.. Nucleosides & Nucleotides, 1995, 14, 969-973); adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237); a palmitoyl moiety; an octadecylamine or hexylamino-carbonyl-oxy cholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937); a retinoic acid moiety; a 1 -pyrene butyric acid moiety; a dihydrotestosterone moiety; a geranyloxyhexanol moiety; a borneol moiety; a menthol moiety; a 1,3-propanediol moiety; a heptadecyl group; a myristic acid moiety; an 03- (oleoyl)lithocholic acid moiety; an O3-(oleoyl)cholenic acid moiety; a dimethoxytrityl moiety; and a phenoxazine moiety.

[0163] The present disclosure provides a conjugate comprising: a) a double-stranded RNA of the present disclosure; and b) one or more lipophilic moieties conjugated to one or more internal positions on one or both strands of the double-stranded RNA, where the one or more lipophilic moieties is conjugated to the double-stranded RNA directly or via a linker. In some cases, the one or more lipophilic moieties is a highly hydrophobic lipid, a moderately hydrophobic lipid, or an amphiphilic lipid. Examples of highly hydrophobic lipids include cholesterol and docosanoic acid (DCA). Examples of moderately hydrophobic lipids include unsaturated fatty acid, e.g., eicosapentaenoic acid (EPA). Examples of amphiphilic lipids include dendrimers. An example of a dendrimer that may be conjugated to a doublestranded RNA of the present disclosure is depicted in Fig. 20. In some embodiments, a lipophilic moiety is conjugated to a nucleobase, sugar moiety, a phosphate, or internucleosidic linkage of the doublestranded RNA.

[0164] In some cases, the one or more lipophilic moieties is selected from: a lipid, cholesterol, retinoic acid, cholic acid, adamantane acetic acid, 1 -pyrene butyric acid, dihydrotestosterone, 1,3-bis- O(hexadecyl)glycerol, geranyloxyhexanol, hexadecylglycerol, borneol, menthol, 1,3-propandediol, a heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxy trityl, and phenoxazine. In some cases, the one or more lipophilic moieties is or comprises a palmityl moiety or palmitoyl moiety. In some cases, the one or more lipophilic moieties contains a saturated or unsaturated C4-C30 hydrocarbon chain. Thus, in some cases, a conjugate of the present disclosure comprises: a) a double-stranded RNA of the present disclosure; and b) a lipid comprising a saturated or unsaturated C4-C30 hydrocarbon chain conjugated to one or both strands of the doublestranded RNA directly or via a linker. In some cases, the one or more lipophilic moieties comprises a saturated or unsaturated C4-C30 hydrocarbon chain and a functional group. In some cases, the one ormore lipophilic moieties comprises a saturated or unsaturated hydrocarbon chain having 5 or more carbons and a functional group. Suitable functional groups include, e.g., a hydroxyl, an amine, a carboxylic acid, a sulfonate, a phosphate, a thiol, an azide, and an alkyne. In some cases, the one or more lipophilic moieties is or comprises a Ce-Cis hydrocarbon chain, e.g., Ci6, Cis, C20, or C22 hydrocarbon chain. Thus, in some cases, a conjugate of the present disclosure comprises: a) a double-stranded RNA of the present disclosure; and b) a lipid comprising a saturated or unsaturated Ce-Cis hydrocarbon chain conjugated to one or both strands of the double-stranded RNA directly or via a linker. In some cases, the one or more lipophilic moieties is or comprises a Ci6 hydrocarbon chain. In some cases, the one or more lipophilic moieties is or comprises a C20 saturated or unsaturated hydrocarbon chain. In some cases, the one or more lipophilic moieties is or comprises a C22 saturated or unsaturated hydrocarbon chain. Thus, in some cases, a conjugate of the present disclosure comprises: a) a double-stranded RNA of the present disclosure; and b) a lipid comprising a saturated or unsaturated Ci6 hydrocarbon chain conjugated to one or both strands of the double-stranded RNA directly or via a linker. In some cases, the lipophilic moiety is conjugated, directly or via a linker, to a nucleobase in the double-stranded RNA. In some cases, the lipophilic moiety is conjugated, directly or via a linker, to a sugar- moiety, e.g., 2’0, in the doublestranded RNA. In some cases, the lipophilic moiety is conjugated, directly or via a linker, to an internucleoside linkage in the double-stranded RNA.

[0165] The lipophilic moiety may be conjugated to one or both terminal positions and / or one or more internal positions on at least one strand of the double-stranded RNA. The lipophilic moiety may be conjugated to one or more internal positions on at least one strand, which include all positions except the terminal three positions from each end of the strand.

[0166] Two or more of the lipophilic moieties may be conjugated to one or both terminal positions and / or one or more internal positions on at least one strand of the double-stranded RNA. Two or more of the lipophilic moieties may be conjugated to one or more internal positions on at least one strand, which include all positions except the terminal three positions from each end of the strand.Target nucleic acids and target cells

[0167] The double stranded RNAs of the present disclosure may be targeted to any gene or nucleic acid construct containing the targeted repeat region. In some cases, the targeted repeat region comprises a repeat of CUG, UGC, or GCU in a ribonucleic acid. In some cases, the targeted repeat region comprises a repeat of CAG, AGC, or GCA in a ribonucleic acid. In some cases, a target RNA is an antisense RNA. In some cases, a target RNA is a sense RNA. In some cases, the target RNA is present in a target cell having an expanded CTG repeat in Transcription Factor 4 (TCF4) intron 3; e.g., where the target cell is in an individual having FECD. In some cases, the target RNA is present in a target cell having an expanded CTG repeat in the 3’ untranslated region (UTR) of the dystrophia myotonica protein kinase (DMPK) gene on chromosome 19ql3; e.g., where the target cell is in an individual having DM1.

[0168] In some cases, where the target RNA is in a target cell having an expanded CTG repeat in TCF4 intron 3, the target repeat region has more than 40 CUG repeats (sense transcript) or more than 40 CAG repeats (antisense transcript). In some cases, where the target RNA is in a target cell having an expanded CTG repeat in TCF4 intron 3, the target repeat region has more than 50 CUG repeats (sense transcript) or more than 50 CAG repeats (antisense transcript). In some cases, where the target RNA is in a target cell having an expanded CTG repeat in TCF4 intron 3, the target repeat region has more than 100 CUG repeats (sense transcript) or more than 100 CAG repeats (antisense transcript). In some cases, where the target RNA is in a target cell having an expanded CTG repeat in TCF4 intron 3, the target repeat region has more than 250 CUG repeats (sense transcript) or more than 250 CAG repeats (antisense transcript). In some cases, where the target RNA is in a target cell having an expanded CTG repeat in TCF4 intron 3, the target repeat region has more than 1000 CUG repeats (sense transcript) or more than 1000 CAG repeats (antisense transcript).

[0169] In some cases, where the target RNA is in a target cell having an expanded CTG repeat in TCF4 intron 3, the target repeat region has from 40 to 4000 CUG repeats (sense transcript) or from 40 to 4000 CAG repeats (antisense transcript). In some cases, where the target RNA is in a target cell having an expanded CTG repeat in TCF4 intron 3, the target repeat region has from 40 to 100 CUG repeats (sense transcript) or from 40 to 100 CAG repeats (antisense transcript). In some cases, where the target RNA is in a target cell having an expanded CTG repeat in TCF4 intron 3, the target repeat region has from 100 to 1000 CUG repeats (sense transcript) or from 100 to 1000 CAG repeats (antisense transcript). In some cases, where the target RNA is in a target cell having an expanded CTG repeat in TCF4 intron 3, the target repeat region has from 250 to 4000 CUG repeats (sense transcript) or from 250 to 4000 CAG repeats (antisense transcript).

[0170] In some cases, where the target RNA is in a target cell having an expanded CTG repeat in the 3' untranslated region (UTR) of the dystrophia myotonica protein kinase (DMPK) gene on chromosome 19ql3, the target repeat region has more than 35 CUG repeats (sense transcript) or more than 35 CAG repeats (antisense transcript). In some cases, where the target RNA is in a target cell having an expanded CTG repeat in the 3’ UTR of the DMPK gene on chromosome 19ql3, the target repeat region has more than 50 CUG repeats (sense transcript) or more than 50 CAG repeats (antisense transcript). In some cases, where the target RNA is in a target cell having an expanded CTG repeat in the 3’ UTR of the DMPK gene on chromosome 19ql3, the target repeat region has more than 200 CUG repeats (sense transcript) or more than 200 CAG repeats (antisense transcript). In some cases, where the target RNA is in a target cell having an expanded CTG repeat in the 3’ UTR of the DMPK gene on chromosome 19ql 3, the target repeat region has more than 400 CUG repeats (sense transcript) or more than 400 CAG repeats (antisense transcript). In some cases, where the target RNA is in a target cell having an expanded CTG repeat in the 3’ UTR of the DMPK gene on chromosome 19ql3, the targetrepeat region has more than 600 CUG repeats (sense transcript) or more than 600 CAG repeats (antisense transcript). In some cases, where the target RNA is in a target cell having an expanded CTG repeat in the 3' UTR of the DMPK gene on chromosome 19ql3, the target repeat region has more than 800 CUG repeats (sense transcript) or more than 800 CAG repeats (antisense transcript). In some cases, where the target RNA is in a target cell having an expanded CTG repeat in the 3’ UTR of the DMPK gene on chromosome 19ql3, the target repeat region has more than 1000 CUG repeats (sense transcript) or more than 1000 CAG repeats (antisense transcript).

[0171] In some cases, where the target RNA is in a target cell having an expanded CTG repeat in the 3’ UTR of the DMPK gene on chromosome 19ql3, the target repeat region has from 38 to 50 CUG repeats (sense transcript) or from 38 to 50 CAG repeats (antisense transcript). In some cases, where the target RNA is in a target cell having an expanded CTG repeat in the 3’ UTR of the DMPK gene on chromosome 19ql3, the target repeat region has from 50 to 200 CUG repeats (sense transcript) or from 50 to 200 CAG repeats (antisense transcript). In some cases, where the target RNA is in a target cell having an expanded CTG repeat in the 3’ UTR of the DMPK gene on chromosome 19ql 3, the target repeat region has from 200 to 400 CUG repeats (sense transcript) or from 200 to 400 CAG repeats (antisense transcript). In some cases, where the target RNA is in a target cell having an expanded CTG repeat in the 3’ UTR of the DMPK gene on chromosome 19ql3, the target repeat region has from 400 to 600 CUG repeats (sense transcript) or from 400 to 600 CAG repeats (antisense transcript). In some cases, where the target RNA is in a target cell having an expanded CTG repeat in the 3’ UTR of the DMPK gene on chromosome 19ql 3, the target repeat region has 600 to 800 CUG repeats (sense transcript) or from 600 to 800 CAG repeats (antisense transcript). In some cases, where the target RNA is in a target cell having an expanded CTG repeat in the 3’ UTR of the DMPK gene on chromosome 19q 13 , the target repeat region has 800 to 1000 CUG repeats (sense transcript) or from 800 to 1000 CAG repeats (antisense transcript).

[0172] Target cells having a CTG repeat expansion have a normal (wild-type) allele and a disease-associated allele, where the disease-associated allele has the expanded CTG repeat. Target cells include, but are not limited to, ocular cells (e.g., corneal endothelial cells, retinal cells), muscle cells (e.g., skeletal muscle cells, smooth muscle cells, heart cells), skeletal muscle cells (e.g. a myoblast, a myosatellite cell, a skeletal myofiber), heart cells (e.g., cardiomyocytes), lung cells, red blood cells, and central nervous system (CNS) cells. CNS cells include, e.g., neurons, glial cells, astrocytes, and microglial cells.NUCLEIC ACIDS, EXPRESSION CASSETTES, AND RECOMBINANT EXPRESSION VECTORS

[0173] The present disclosure provides a recombinant nucleic acid (e.g., a recombinant RNA) comprising a double-stranded RNA of the present disclosure in a microRNA (miR) scaffold. The present disclosure provides a DNA molecule comprising a nucleotide sequence encoding a recombinant RNAcomprising a double-stranded RNA of the present disclosure present in a miR scaffold. The present disclosure provides a recombinant expression vector comprising a nucleotide sequence encoding a recombinant RNA comprising a double-stranded RNA of the present disclosure present in a miR scaffold. In some cases, a double stranded RNA of the disclosure is encoded by a nucleic acid molecule, for example a DNA molecule. Double stranded RNAs provided herein can be converted to DNA format by replacing each uracil base “U” with a thymine “T” base.

[0174] In some cases, a nucleic acid molecule (e.g., DNA) encoding the double stranded RNA is contained within an expression cassette. In some cases, the expression cassette further comprises one or more expression control sequences (regulatory sequences) operably linked with the transgene.“Operably linked” sequences include expression control sequences that are contiguous with the transgene or act in trans or at a distance from the transgene to control its expression. Examples of expression control sequences include transcription initiation sequences, termination sequences, promoter sequences, enhancer sequences, repressor sequences, splice site sequences, polyadenylation (poly A) signal sequences, or any combination thereof.

[0175] The present disclosure provides a DNA molecule comprising a nucleotide sequence encoding the first strand of a dsRNA of the present disclosure, where the nucleotide sequence is operably linked to a promoter that is functional in a eukaryotic cell. The present disclosure provides a recombinant nucleic acid comprising: a) a dsRNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide, a loop polynucleotide, and a 3’ flanking polynucleotide. The present disclosure comprises a DNA molecule encoding such a recombinant nucleic acid. The present disclosure comprises a recombinant expression vector comprising the DNA molecule.

[0176] In some cases, a dsRNA of the disclosure is encoded by a nucleic acid molecule, for example a DNA molecule. Double stranded RNA sequences provided herein can be converted to DNA format by replacing each uracil base “U” with a thymine “T” base.

[0177] In some cases, nucleic acid molecule (e.g., DNA) encoding the double stranded RNA is contained within an expression cassette or a recombinant expression vector.

[0178] In some cases, the expression cassette further comprises one or more expression control sequences (regulatory sequences) operably linked with the transgene. “Operably linked” sequences include expression control sequences that are contiguous with the transgene or act in trans or at a distance from the transgene to control its expression. Examples of expression control sequences include transcription initiation sequences, termination sequences, promoter sequences, enhancer sequences, repressor sequences, splice site sequences, polyadenylation (poly A) signal sequences, or any combination thereof.

[0179] In some cases, a promoter is an endogenous promoter, synthetic promoter, hybrid promoter, constitutive promoter, inducible promoter, tissue-specific promoter (e.g., central nervous system (CNS)-specific), or cell-specific promoter (neurons, glial cells, or astrocytes). Examples of constitutive promoters include, Rous sarcoma virus (RSV) long terminal repeat (LTR) promoter (optionally with the RSV enhancer), cytomegalovirus (CMV) promoter (optionally with the CMV enhancer), SV40 promoter, and dihydrofolate reductase promoter. Examples of inducible promoters include zinc -inducible sheep metallothionine (MT) promoter, dexamethasone (Dex) -inducible mouse mammary tumor virus (MMTV) promoter, T7 polymerase promoter system, the ecdysone insect promoter, tetracycline -repressible system, tetracycline-inducible system, RU486-inducible system, and the rapamycin-inducible system. Further examples of promoters that may be used include, for example, chicken beta-actin promoter (CBA promoter), a CAG promoter, an Hl promoter, a CD68 promoter, a JeT promoter, synapsin promoter, RNA pol II promoter, or an RNA pol III promoter (e.g., U6, Hl, etc.).

[0180] In some cases, a promoter is an RNA pol II promoter. Examples of pol II promoters include PGK, CBA, Ul, CMV, EIFla, EFla, CAG, or synaptophysin promoters. In some cases, the promoter is a tissue-specific RNA pol II promoter. In some cases, the tissue-specific RNA pol II promoter is derived from a gene that exhibits neuron-specific expression. In some cases, an expression cassette comprises a pol II promoter and a poly(A) tail, e.g., with the DNA sequence encoding the double stranded RNA flanked on the 5’ end by the pol II promoter and on the 3’ end by the poly(A) tail.

[0181] In some cases, a promoter is a neuron specific promoter. Examples of neuron-specific promoters include those from neuron specific enolase (NSE), human synapsin 1, human synapsin 2 promoter, caMK kinase, and tubulin.

[0182] In some cases, a promoter is an RNA pol III promoter. Examples of pol III promoters include U6, Hl, 7SK, Y, RPR, MRP, and selenocysteine tRNA. In some cases, an expression cassette comprises a pol III promoter and a poly(T) tail, e.g., with the DNA sequence encoding the double stranded RNA flanked on the 5’ end by the pol III promoter and on the 3’ end by the poly(T) tail.

[0183] In some cases, a promoter is an RNA pol I promoter. In some cases, an expression cassette comprises a pol I promoter and a 3’-box, e.g. with the DNA sequence encoding the double stranded RNA flanked on the 5’ end by the pol I promoter and on the 3’ end by the 3 ’-box.

[0184] Expression cassettes for double stranded RNAs are known in the art, see, e.g., ter Brake et al. Mol. Ther. (2008) 16:557; Maczuga et al., BMC Biotechnol. (2012) 12:42; and Bofill-De Ros and Gu (2016) 103:157.

[0185] In some cases, the DNA sequence encoding the double stranded RNA of the disclosure is positioned in an untranslated region of an expression cassette. In some cases, the sequence encoding the inhibitory nucleic acid of the present disclosure is positioned in an intron, a 5' untranslated region (5’UTR), or a 3' untranslated region (3'UTR) of the expression cassette. In some cases, the sequence encoding the inhibitory nucleic acid of the present disclosure is positioned in an intron downstream of the promoter and upstream of an expressed gene.

[0186] In some cases, the DNA nucleotide sequence encoding a dsRNA of the disclosure is flanked by two AAV inverted terminal repeats (ITRs) (e.g., 5’ ITR and 3’ ITR) within the expression cassette. In some cases, each AAV ITR is a full length ITR (e.g., approximately 145 bp in length, and containing functional Rep binding site (RBS) and terminal resolution site (trs)). In some cases, one of the ITRs is truncated (e.g., shortened or not full- length). In some cases, a truncated ITR lacks a functional terminal resolution site (trs) and is used for production of self-complementary AAV vectors (scAAV vectors).

[0187] In some cases, the expression cassette comprises a nucleotide sequence selected from the nucleotide sequences depicted in FIG. 4 A and 4B, where the sequences in FIG. 4B are contiguous with those in FIG. 4A. In some cases, the cassette docs not include the 3' TTTTTT sequence. FIG. 4A presents the 5’miRNA aim (5’-3 ’), DNA guide strand sequence (5 ’-3 ’ ), loop, and dinucleotide of a cassette; FIG. 4B provides the passenger strand, 3’-miRNA arm (5’-3’), and Pol3 transcription termination (TTTTTT) of the same cassette. In some cases, an expression cassette of the present disclosure comprises the nucleotide sequence set forth in any one of SEQ ID NOs:349-515.

[0188] An expression cassette as set forth in SEQ ID NOs:349-515 (and depicted in FIG. 4A) includes 5’ flanking polynucleotide (5’ miRNA arm), a 3' flanking polynucleotide (3’-miRNA arm), and a loop polynucleotide derived from miR33. Thus, for example, the 5’ flanking polynucleotide of the expression cassettes set forth in SEQ ID NOs: 349-515 (and depicted in FIG. 4A and FIG. 4B) has the nucleotide sequence tgcacacctcctggcgggcagctctg (SEQ ID NO:516); the loop polynucleotide of the expression cassettes set forth in SEQ ID NOs:349-515 (and depicted in FIG. 4A) has the nucleotide sequence tgttctggcaatacctg (SEQ ID NO:517); and the 3’ flanking polynucleotide of the expression cassettes set forth in SEQ ID NOs:349-515 (and depicted in FIG. 4B) has the nucleotide sequence gggaggcctgccctgactgcccac (SEQ ID NO:518).

[0189] In some cases, an expression cassette of the present disclosure includes a 5’ flanking polynucleotide, a loop polynucleotide, and a 3’ flanking polynucleotide from miRlOl. Thus, for example, the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide of any one of the expression cassettes as set forth in SEQ ID NOs:349-515 can be replaced with the 5' flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide of miRlOl depicted in FIG. 8. As another example, the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide of any one of the expression cassettes as set forth in SEQ ID NOs: 349-515 can be replaced with the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide of miR126 depicted in FIG. 8.

[0190] In some cases, a dsRNA described herein is encoded by a recombinant expression vector, such as a plasmid, a non-viral vector, or a viral vector. The use of vectors for expressing doublestranded RNAs of the present disclosure can allow for continual or controlled expression of the doublestranded RNAs in a subject, thus obviating the need for multiple doses of the double-stranded RNAs to be administered to the subject. The present disclosure provides a recombinant vector comprising a nucleotide sequence encoding a double-stranded RNA of the present disclosure. The present disclosure provides a recombinant vector comprising an expression cassette encoding a double-stranded RNA of the present disclosure.

[0191] Suitable viral vectors include, but are not limited to, herpesvirus (HSV) vectors, retroviral vectors, adenoviral vectors, adeno-associated viral (AAV) vectors, lentiviral vectors, baculoviral vectors, and the like.

[0192] In some cases, the vector encoding a dsRNA of the present disclosure is a retroviral vector. In some cases, a retroviral vector is a mouse stem cell virus, murine leukemia virus (e.g., Moloney murine leukemia virus vector), feline leukemia virus, feline sarcoma virus, or avian reticuloendotheliosis virus vector. In some cases, the vector encoding a dsRNA of the present disclosure is a lentivirus or lentiviral based vector. In some cases, a lentiviral vector is a HIV (human immunodeficiency virus, including HIV type 1 and HIV type 2), equine infectious anemia virus, feline immunodeficiency virus (FIV), bovine immune deficiency virus (BIV), and simian immunodeficiency virus (SIV), equine infectious anemia virus, or Maedi-Visna viral vector. Methods for expressing shRNAs using lentivirus engineered cells are known in the art, for example, Stegmeier et al. Proc. Natl. Acad. Sci. USA (2005) 102:13212-13217; Klinghoffer et al. RNA (2010) 16:879-884. Production of replication-incompetent recombinant lentivirus may be achieved, for example, by co-transfection of expression vectors and packaging plasmids using commercially available packaging cell lines, such as TLA-HEK293TM, and packaging plasmids (Thermo Scientific / Open Biosystems, Huntsville, AL).

[0193] In some cases, the vector encoding a dsRNA of the present disclosure is an adeno- associated virus (AAV) vector, such as a recombinant rAAV vector, which is produced by recombinant methods. AAV is a single-stranded, non-enveloped DNA virus having a genome that encodes proteins for replication (rep) and the capsid (Cap), flanked by two ITRs, which serve as the origin of replication of the viral genome. AAV also contains a packaging sequence, allowing packaging of the viral genome into an AAV capsid. In some cases, the AAV vector comprises an expression cassette encoding a dsRNA of the present disclosure flanked by two cis-acting AAV ITRs (5’ ITR and 3’ ITR). Functional ITR sequences are used for the rescue, replication and packaging of the AAV viral particle. Thus, an AAV vector is defined herein to include at least those sequences required in cis for replication and packaging (e.g., one or two functional ITRs and packaging sequence) of the virus. In some cases, each AAV ITR is a full length ITR (e.g., approximately 145 bp in length, and containing functional Rep binding site (RBS)and terminal resolution site (trs)). In some cases, one or both of the ITRs is modified, e.g., by insertion, deletion, or substitution, provided that the ITRs provide for functional rescue, replication, and packaging. In some cases, a modified ITR lacks a functional terminal resolution site (trs) and is used for production of self-complementary AAV vectors (scAAV vectors). In some cases, the ITRs are selected from any one of serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.RhlO, AAV11 and variants thereof. In some cases, the ITRs are from AAV2.

[0194] Other expression control sequences may be present in the rAAV vector operably linked to the DNA sequence encoding the double stranded RNA, including one or more of transcription initiation sequences, termination sequences, promoter sequences, enhancer sequences, repressor sequences, splice site sequences, poly adenylation (poly A) signal sequences, or any combination thereof.

[0195] rAAV vectors may have one or more AAV wild type genes deleted in whole or in part. In some embodiments the rAAV vector is replication defective. In some cases, the rAAV vector lacks a functional Rep protein and / or capsid protein.

[0196] Methods of packaging recombinant AAV vector into AAV capsids using host cell culture are known in the art. In some cases, one or more of the required components for packaging the rAAV vector, (e.g., Rep sequence, cap sequence, and / or accessory functions) may be provided by a stable host cell that has been engineered to contain the one or more required components (e.g., by a vector). Expression of the required components for AAV packaging may be under control of an inducible or constitutive promoter in the host packaging cell. AAV helper vectors are commonly used to provide transient expression of AAV rep and / or cap genes, which function in trans, to complement missing AAV functions that are necessary for AAV replication. In some cases, AAV helper vectors lack AAV ITRs and can neither replicate nor package themselves. AAV helper vectors can be in the form of a plasmid, phage, transposon, cosmid, virus, or virion.

[0197] Recombinant AAV vectors of the present disclosure may be encapsidated by an AAV capsid to form a rAAV particle. A “rAAV particle” or “rAAV virion” refers to an infectious, replication-defective virus including an AAV protein shell, encapsidating a transgene of interest which is flanked on both sides by AAV ITRs. A rAAV particle is produced in a suitable host cell which has sequences specifying a rAAV vector, AAV helper functions and accessory functions introduced therein to render the host cell capable of encoding AAV polypeptides that are required for packaging the rAAV vector (containing the transgene sequence of interest) into infectious rAAV particles for subsequent gene delivery to a target cell.

[0198] In some cases, rAAV particles may be produced using the triple transfection method (see, e.g., U.S. Patent No. 6,001,650, incorporated herein by reference in its entirety). In this approach, the rAAV particles are produced by transfecting a host cell with a rAAV vector (comprising a transgene)to be packaged into rAAV particles, an AAV helper vector, and an accessory function vector. In some cases, the AAV helper function vector supports efficient AAV vector production without generating any detectable wild-type AAV virions (e.g., AAV virions containing functional rep and cap genes). The accessory function vector encodes nucleotide sequences for non- AAV derived viral and / or cellular functions upon which AAV is dependent for replication (e.g., “accessory functions”). The accessory functions include those functions required for AAV replication, including, without limitation, those moieties involved in activation of AAV gene transcription, stage specific AAV mRNA splicing, AAV DNA replication, synthesis of cap expression products, and AAV capsid assembly. Viral-based accessory functions can be derived from any of the known helper viruses such as adenovirus, herpesvirus (other than herpes simplex virus type-1), and vaccinia virus. In some cases, a double transfection method, wherein the AAV helper function and accessory function are cloned on a single vector, is used to generate rAAV particles.

[0199] The AAV capsid is an important element in determining the tissue-specificity of the rAAV particle. Thus, a rAAV particle having a particular capsid tissue specificity can be selected. In some cases, the rAAV particle comprises a capsid selected from an AAV serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.RhlO, AAV11, and variants thereof. In some cases, the AAV capsid is selected from a serotype that is capable of crossing the bloodbrain barrier, e.g., AAV9, AAVrh.10, or a variant thereof. In some cases, the AAV capsid is a chimeric AAV capsid.

[0200] In some cases, the rAAV vector is a mammalian serotype AAV vector (e.g., AAV genome and ITRs derived from mammalian serotype AAV), including a primate serotype AAV vector or human serotype AAV vector. In some cases, the AAV vector is derived from any one of serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.RhlO, AAV11, and variants thereof. In some cases, the AAV vector is a chimeric AAV vector. In some cases, rAAV vectors may be vectors comprising an AAV genome and AAV capsid derived from the same AAV serotype. In some cases, rAAV vectors are pseudotyped, meaning the rAAV vectors comprise an AAV genome derived from one AAV serotype and an AAV capsid derived at least in part from a different AAV serotype.

[0201] In some cases, the rAAV vector is AAV9 serotype. In some cases, the rAAV comprises an AAV9 capsid protein (e.g., SEQ ID NO:2 of US Patent No. 7,198,951), an AAV9 rep protein (e.g., SEQ ID NO:3 of US Patent No. 7,198,951), or both. In some cases, the rAAV comprises: (i) an AAV9 capsid protein (e.g., SEQ ID NO:2 of US Patent No. 7,198,951), and (ii) AAV2 ITRs.

[0202] In some cases, the rAAV particle is capable of transducing cells of the central nervous system (CNS). In some cases, the rAAV particle is capable of transducing non-neuronal cells or neuronal cells of the CNS. In some cases, the CNS cell is a neuron, glial cell, astrocyte, or microglial cell.

[0203] In some cases, the rAAV vector is a self-complementary AAV (scAAV) vector. scAAV vectors contain two complementary DNA strands in the form of a dimeric inverted repeat genome. The two complementary str ands within the dimeric inverted repeat genome anneal together to form one double stranded DNA that is ready for immediate replication and transcription, thus bypassing the requirement for host cell DNA synthesis. Self-complementary AAV vectors are described in U.S. Patent Nos. 7,465,583; 7,790,154; 8,361,457; and 8,784,799.

[0204] The present disclosure also provides host cells transfected with the rAAV comprising a nucleotide sequence encoding a dsRNA of the present disclosure. In some cases, the host cell is a prokaryotic cell or a eukaryotic cell. In some cases, the host cell is a mammalian cell (e.g., HEK293T, COS cells, HeLa cells, KB cells), bacterial cell (Escherichia coll), yeast cell, insect cell (Sf9, Sf21, Drosophila, mosquito), etc. In some cases, the host cell is obtained or derived from a human subject. In some cases, the host cell is a fibroblast. In some cases, the host cell is a neuron.DNA molecule encoding one or both strands of a double-stranded RNA

[0205] The present disclosure provides a DNA molecule comprising a nucleotide sequence encoding the first strand of a double-stranded RNA of the present disclosure. In some cases, the nucleotide sequence encoding the first strand is operably linked to a promoter. In some cases, the nucleotide sequence encoding the first strand is operably linked to a promoter that is functional in a eukaryotic cell. The present disclosure provides a DNA molecule comprising a nucleotide sequence encoding: i) the first strand of a double-stranded RNA of the present disclosure; and ii) the second strand of a double-stranded RNA of the present disclosure. In some cases, the nucleotide sequence encoding the first strand and the second strand is operably linked to a promoter. In some cases, the promoter is a PollI promoter. In some cases, the promoter is a U6 promoter. In some cases, the promoter is a CAG promoter. In some cases, the promoter is a CBA promoter. In some cases, the promoter is a CMV promoter. In some cases, the promoter is an EFla promoter. In some cases, the promoter is an Hl promoter. In some cases, a DNA molecule of the present disclosure comprises a nucleotide sequence that encodes any one of SEQ ID NOs:295-375.Recombinant RNA molecules

[0206] The present disclosure provides a recombinant nucleic acid (e.g., a recombinant RNA; which may be referred to as an “artificial microRNA” or a “small binding RNA” (sbRNA)) comprising: a) a dsRNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide (also referred to herein as a “5’ leader”), a loop polynucleotide, and a 3’ flanking polynucleotide (also referred to herein as a “3’ trailer”), wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the first strand of the double-stranded RNA; iii) the loop polynucleotide; (iv) the second strand of the double-stranded RNA; and iii) the 3’ trailer polynucleotide; and wherein at least one of the 5’ flanking polynucleotide, the loop polynucleotide, and the 3' flankingpolynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA. The present disclosure provides a recombinant nucleic acid (e.g., a recombinant RNA) comprising: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide, a loop polynucleotide, and a 3’ flanking polynucleotide, wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the second strand of the double-stranded RNA; iii) the loop polynucleotide; (iv) the first strand of the double-stranded RNA; and iii) the 3’ flanking polynucleotide; and wherein at least one of the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA. In some cases, the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide are derived from miR33. In some cases, the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide are derived from miR451. In some cases, the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide are derived from miR144. In some cases, the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide are derived from miRlOl. In some cases, the 5’ flanking polynucleotide, the loop polynucleotide, and the 3' flanking polynucleotide are derived from miR126. Examples of 5’ flanking polynucleotides, loop polynucleotides, and 3’ flanking polynucleotides are provided in FIG. 13.

[0207] The present disclosure provides a recombinant nucleic acid (e.g., a recombinant RNA; which may be referred to as an “artificial microRNA” or a “small binding RNA” (sbRNA)) comprising: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide (also referred to herein as a “5’ leader”) and a 3’ flanking polynucleotide (also referred to herein as a “3' trailer”), wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the first strand of the double- stranded RNA; iii) the second strand of the doublestranded RNA; and iv) the 3’ trailer polynucleotide; and wherein one or both of the 5’ flanking polynucleotide and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA. The present disclosure provides a recombinant nucleic acid (e.g., a recombinant RNA) comprising: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide and a 3’ flanking polynucleotide, wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the second strand of the double-stranded RNA; iii) the first strand of the double-stranded RNA; and iv) the 3’ flanking polynucleotide; and wherein one or both of 5’ flanking polynucleotide and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA. In some cases, the 5’ flanking polynucleotide and the 3’ flanking polynucleotide are derived from miR451.Cassettes encoding a recombinant RNA molecule

[0208] The present disclosure provides a DNA molecule (e.g, a “cassette”, which can be inserted into an expression vector to generate a recombinant expression vector) comprising a nucleotidesequence encoding a recombinant RNA molecule of the present disclosure (where the recombinant RNA molecule may be referred to as an “artificial microRNA” or an “sbRNA”), where the recombinant RNA molecule comprises: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5' flanking polynucleotide (also referred to herein as a “5' leader”), a loop polynucleotide, and a 3’ flanking polynucleotide (also referred to herein as a “3’ trailer”), wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the first strand of the double-stranded RNA; iii) the loop polynucleotide; (iv) the second strand of the double-stranded RNA; and iii) the 3’ trailer polynucleotide; and wherein at least one of the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA. The present disclosure provides a DNA molecule (e.g, a “cassette”, which can be inserted into an expression vector to generate a recombinant expression vector) comprising a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure (where the recombinant RNA molecule may be referred to as an “artificial microRNA” or “sbRNA”), where the recombinant RNA molecule comprises: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide, a loop polynucleotide, and a 3’ flanking polynucleotide, wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the second strand of the double-stranded RNA; iii) the loop polynucleotide; (iv) the first strand of the double-stranded RNA; and iii) the 3’ flanking polynucleotide; and wherein at least one of the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA. In some cases, the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide are derived from miR33. In some cases, the cassette includes a Pol3 transcription sequence; for example, in some cases, the cassette includes the nucleotide sequence TTTTTG 3’ of the nucleotide sequence encoding the 3’ trailer polynucleotide. In some cases, the cassette includes the nucleotide sequence Tn, where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), 3’ of the nucleotide sequence encoding the 3’ trailer polynucleotide. In some cases, a cassette has a length of from about 110 nucleotides to about 150 nucleotides. In some cases, the cassette includes a Pol II transcription sequence; for example, in some cases, the cassette includes a polyadenylation sequence 3' of the nucleotide sequence encoding the 3’ flanking polynucleotide.

[0209] The present disclosure provides a DNA molecule (e.g, a “cassette”, which can be inserted into an expression vector to generate a recombinant expression vector) comprising a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure (where the recombinant RNA molecule may be referred to as an “artificial microRNA” or “sbRNA”), where the recombinant RNA molecule comprises: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide (also referred to herein as a “5’ leader”) and a 3’ flanking polynucleotide (also referred to herein as a “3’ trailer”), wherein the recombinant nucleic acid comprises:i) the 5’ flanking polynucleotide; ii) the first strand of the double-stranded RNA; iii) the second strand of the double-stranded RNA; and iv) the 3’ trailer polynucleotide; and wherein one or both of the 5’ flanking polynucleotide and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA. The present disclosure provides a DNA molecule (e.g, a “cassette”, which can be inserted into an expression vector to generate a recombinant expression vector) comprising a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure (where the recombinant RNA molecule may be referred to as an “artificial microRNA” or “sbRNA”), where the recombinant RNA molecule comprises: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5' flanking polynucleotide and a 3’ flanking polynucleotide, wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the second strand of the double-stranded RNA; iii) the first strand of the double-stranded RNA; and iv) the 3’ flanking polynucleotide; and wherein one or both of 5’ flanking polynucleotide and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA. In some cases, the 5’ flanking polynucleotide and the 3’ flanking polynucleotide are derived from miR451. In some cases, the cassette includes a Pol3 transcription sequence; for example, in some cases, the cassette includes the nucleotide sequence TTTTTG 3’ of the nucleotide sequence encoding the 3’ trailer polynucleotide. In some cases, the cassette includes the nucleotide sequence Tn, where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), 3’ of the nucleotide sequence encoding the 3’ trailer polynucleotide. In some cases, a cassette has a length of from about 110 nucleotides to about 650 nucleotides (e.g., from 110 nucleotides (nt) to 115 nt, from 115 nt to 120 nt, from 500 nt to 600 nt, or from 600 nt to 610 nt). In some cases, the cassette includes a Pol II transcription sequence; for example, in some cases, the cassette includes a polyadenylation sequence 3’ of the nucleotide sequence encoding the 3’ flanking polynucleotide.

[0210] In some cases, the portion of the cassette encoding the 5’ flanking polynucleotide comprises the nucleotide sequence tgcacacctcctggcgggcagctctg (SEQ ID NO:516). In some cases, the portion of the cassette encoding the loop polynucleotide comprises the nucleotide sequence tgttctggcaatacctg (SEQ ID NO:517). In some cases, the portion of the cassette encoding the 3’ flanking polynucleotide comprises the nucleotide sequence gggaggcctgccctgactgcccac (SEQ ID NO:518). In some cases, the cassette includes a Pol3 transcription sequence; for example, in some cases, the cassette includes the nucleotide sequencerpprpp’p’p y of the nucleotide sequence encoding the 3’ trailer polynucleotide. In some cases, a cassette has a length of from about 110 nucleotides to about 150 nucleotides. In some cases, the cassette includes a Pol II transcription sequence; for example, in some cases, the cassette includes a polyadenylation sequence 3' of the nucleotide sequence encoding the 3' flanking polynucleotide.

[0211] In some cases, the portion of the cassette encoding the 5’ flanking polynucleotide comprises the nucleotide sequence TCAGGTAGATATGAGACTGAACTGTCCTTTG (SEQ IDNO:519). In some cases, the portion of the cassette encoding the loop polynucleotide comprises the nucleotide sequence TGTATATCUGAAAGG (SEQ ID NO:521). In some cases, the portion of the cassette encoding the 3' flanking polynucleotide comprises the nucleotide sequence GAATGGTGGTGCCATCACATTGAGAAAGGG (SEQ ID NO:520). In some cases, the cassette includes a Pol3 transcription sequence; for example, in some cases, the cassette includes the nucleotide sequence TTTTTT 3’ of the nucleotide sequence encoding the 3’ trailer polynucleotide. In some cases, a cassette has a length of from about 110 nucleotides to about 150 nucleotides. In some cases, the cassette includes a Pol II transcription sequence; for example, in some cases, the cassette includes a poly adenylation sequence 3’ of the nucleotide sequence encoding the 3' flanking polynucleotide.

[0212] In some cases, the portion of the cassette encoding the 5’ flanking polynucleotide comprises the nucleotide sequence TCTGGAAGACGCCACGCCTCCGCTGGCGACGGGA (SEQ ID NO:522). In some cases, the portion of the cassette encoding the loop polynucleotide comprises the nucleotide sequence CTGTGACACTTCAAAC (SEQ ID NO:524). In some cases, the portion of the cassette encoding the 3' flanking polynucleotide comprises the nucleotide sequence CCGTCCACGGCACCGCATCGAAAACGCCGCTG (SEQ ID NO:523).Recombinant expression vector encoding sbRNA

[0213] The present disclosure provides a recombinant expression vector comprising a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure (where the recombinant RNA molecule may be referred to as an “artificial microRNA” or an “sbRNA”). In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to a promoter that is functional in a eukaryotic cell. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to an RNA polymerase II promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to an RNA polymerase III promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to a CMV promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to a CAG promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to a CBA promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to a U6 promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to an EFla promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ adeno- associated virus (AAV) inverted terminal repeat (ITR) sequence and a 3’ AAV ITR sequence.

[0214] The present disclosure provides a recombinant expression vector comprising a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure, where the recombinant RNA molecule comprises: a) a double-stranded RNA of the present disclosure; and b) amicroRNA scaffold comprising a 5’ flanking polynucleotide (also referred to herein as a “5’ leader”), a loop polynucleotide, and a 3’ flanking polynucleotide (also referred to herein as a “3’ trailer”), wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the first strand of the double-stranded RNA; iii) the loop polynucleotide; (iv) the second strand of the double-stranded RNA; and iii) the 3’ trailer polynucleotide; and wherein at least one of the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA. The present disclosure provides a recombinant expression vector comprising a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure, where the recombinant RNA molecule comprises: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide, a loop polynucleotide, and a 3’ flanking polynucleotide, wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the second strand of the double-stranded RNA; iii) the loop polynucleotide; (iv) the first strand of the double-stranded RNA; and iii) the 3’ flanking polynucleotide; and wherein at least one of the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA. In some cases, the 5' flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide are derived from miR33.

[0215] The present disclosure provides a recombinant expression vector comprising a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure, where the recombinant RNA molecule comprises: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5' flanking polynucleotide (also referred to herein as a “5’ leader”) and a 3' flanking polynucleotide (also referred to herein as a “3' trailer”), wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the first strand of the double-stranded RNA; iii) the second strand of the double-stranded RNA; and iv) the 3’ trailer polynucleotide; and wherein one or both of the 5’ flanking polynucleotide and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA. The present disclosure provides a recombinant expression vector comprising a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure, where the recombinant RNA molecule comprises: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide and a 3’ flanking polynucleotide, wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the second strand of the double-stranded RNA; iii) the first strand of the double-stranded RNA; and iv) the 3’ flanking polynucleotide; and wherein one or both of 5’ flanking polynucleotide and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA. In some cases, the 5’ flanking polynucleotide and the 3’ flanking polynucleotide are derived from miR451.Recombinant expression vector comprising a cassette

[0216] The present disclosure provides a recombinant expression vector comprising cassette (a “DNA molecule”) of the present disclosure, where the cassette comprises a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure (where the recombinant RNA molecule may be referred to as an “artificial microRNA” or an “sbRNA”). In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to a promoter that is functional in a eukaryotic cell. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to an RNA polymerase II promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to an RNA polymerase III promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to a CMV promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to a U6 promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to an EFla promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ adeno-associated virus (AAV) inverted terminal repeat (ITR) sequence and a 3’ AAV ITR sequence.Tandem miRNA scaffold / sbRNAs

[0217] In some cases, a nucleic acid of the present disclosure comprises two recombinant RNAs (c.g., an RNA comprising a miRNA scaffold and an sbRNA of the present disclosure, as described above). In some cases, a cassette of the present disclosure comprises a nucleotide sequence encoding two recombinant RNAs of the present disclosure. In some cases, a recombinant expression vector of the present disclosure comprises a nucleotide sequence encoding two recombinant RNAs of the present disclosure. These embodiments are depicted schematically in FIG. 7A-7C and are referred to as “tandem miRNA scaffold / sbRNAs” or “tandem recombinant nucleic acids.”

[0218] As described above, a recombinant nucleic acid comprising a miRNA scaffold and an sbRNA of the present disclosure in some cases comprises: a) a dsRNA of the present disclosure; and b) a miRNA scaffold comprising a 5’ flanking polynucleotide, a loop polynucleotide, and a 3’ flanking polynucleotide, where the recombinant nucleic acid comprises, in order from 5’ to 3’ : i) the 5’ flanking polynucleotide; ii) the first strand of the double- stranded RNA; iii) the loop polynucleotide; iv) the second stand of the double-stranded RNA; and v) the 3’ flanking polynucleotide, where at least one of the 5' flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA.

[0219] As described above, a recombinant nucleic acid comprising a miRNA scaffold and an sbRNA of the present disclosure in some cases comprises: a) a dsRNA of the present disclosure; and b) a miRNA scaffold comprising a 5’ flanking polynucleotide, a loop polynucleotide, and a 3’ flankingpolynucleotide, where the recombinant nucleic acid comprises, in order from 5’ to 3’ : i) the 5’ flanking polynucleotide; ii) the second strand of the double-stranded RNA; iii) the loop polynucleotide; iv) the first strand of the double-stranded RNA; and v) the 3' flanking polynucleotide, where at least one of the 5' flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA.

[0220] As described above, a recombinant nucleic acid comprising a miRNA scaffold and an sbRNA of the present disclosure in some cases comprises: a) a dsRNA of the present disclosure; and b) a miRNA scaffold comprising a 5’ flanking polynucleotide and a 3' flanking polynucleotide, where the recombinant nucleic acid comprises, in order from 5’ to 3’ : i) the 5' flanking polynucleotide; ii) the first strand of the dsRNA; iii) the second strand of the dsRNA; and iv) the 3’ flanking polynucleotide, where one or both of the 5’ flanking polynucleotide and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA.

[0221] As described above, a recombinant nucleic acid comprising a miRNA scaffold and an sbRNA of the present disclosure in some cases comprises: a) a dsRNA of the present disclosure; and b) a miRNA scaffold comprising a 5’ flanking polynucleotide and a 3’ flanking polynucleotide, where the recombinant nucleic acid comprises, in order from 5’ to 3’ : i) the 5’ flanking polynucleotide; ii) the second strand of the dsRNA; iii) the first strand of the dsRNA; and iv) the 3’ flanking polynucleotide, where one or both of the 5’ flanking polynucleotide and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA.

[0222] In some cases, a nucleic acid of the present disclosure comprises two recombinant nucleic acids (each comprising a miRNA scaffold and an sbRNA), i.e., a first recombinant nucleic acid and a second recombinant nucleic acid, where: a) the miRNA scaffold of the first recombinant nucleic acid has the same nucleotide sequence as the miRNA scaffold of the second recombinant nucleic acid; and b) the dsRNA of the first recombinant nucleic acid comprises a first strand that hybridizes to a target CUG repeat region of a CUG repeat-containing RNA, and the dsRNA of the second recombinant nucleic acid comprises a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA. The present disclosure provides a cassette comprising a nucleotide sequence encoding the recombinant nucleic acid. The present disclosure provides a recombinant expression vector comprising a nucleotide sequence encoding the recombinant nucleic acid.

[0223] In some cases, a nucleic acid of the present disclosure comprises two recombinant nucleic acids (each comprising a miRNA scaffold and an sbRNA), i.e., a first recombinant nucleic acid and a second recombinant nucleic acid, where: a) the miRNA scaffold of the first recombinant nucleic acid has the same nucleotide sequence as the miRNA scaffold of the second recombinant nucleic acid; and b) the double-stranded RNA of the first recombinant nucleic acid comprises a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA, and wherein the double-stranded RNA of the second recombinant nucleic acid comprises a first strand that hybridizes to a target CUG repeat region of a CUG repeat-containing RNA. The present disclosure provides a cassette comprising a nucleotide sequence encoding the recombinant nucleic acid. The present disclosure provides a recombinant expression vector comprising a nucleotide sequence encoding the recombinant nucleic acid.

[0224] Non-limiting examples of tandem (“dual”) miR33 scaffold guides targeting CAG and CTG are provided in FIG. 10A-10D. Non-limiting examples of tandem (“dual”) miR33 and miRlOl scaffolds targeting CAG and CTG are provided in FIG. 11 A-l ID. sbRNAs targeting a CAG repeat region of a CAG repeat-containing RNA

[0225] As noted above, in some cases, a nucleic acid of the present disclosure comprises two recombinant nucleic acids (each comprising a miRNA scaffold and an sbRNA), where, in some cases, one of the two recombinant nucleic acids comprises a dsRNA that comprises a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA. This dsRNA is described in more detail below.

[0226] In some cases, a double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target CAG repeat region; and ii) at least a second mismatch to the target CAG repeat region. In some cases, the first mismatch is at position 8 based on the numbering of SEQ ID NO:4, 5, or 6; when the first mismatch is a position 8 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:4), UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:5), or GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:6), the second mismatch is from 1 to 13 bases 3’ of the first mismatch. In some cases, the first mismatch is at position 9 based on the numbering of SEQ ID NO:1, 2, or 3; when the first mismatch is at position 9 based on the numbering of SEQ ID NO:4, 5, or 6, the second mismatch is from 1 to 12 bases 3' of the first mismatch. In some cases, the first mismatch is at position 10 based on the numbering of SEQ ID NO:4, 5, or 6; when the first mismatch is at position 10 based on the numbering of SEQ ID NO:4, 5, or 6, the second mismatch is from 1 to 11 bases 3’ of the first mismatch. In some cases, the first mismatch is at position 11 based on the numbering of SEQ ID NO:4, 5, or 6; when the first mismatch is at position 11 based on the numbering of SEQ ID NO:4, 5, or 6, the second mismatch is from 1 to 10 bases 3’ of the first mismatch. In some cases, the ds RNA contains only 2 mismatches to the target repeat region. In some cases, the ds RNA contains only 3 mismatches to the target repeat region. In some cases, the ds RNA contains only 4 mismatches to the target repeat region. In some cases, the ds RNA contains only 5 mismatches to the target repeat region. In some cases, the ds RNA contains only 6 mismatches to the target repeat region. In some cases, the ds RNA contains only 7 mismatches to the target repeat region. In some cases, each mismatch is generated by a substitution independently selected from: a) asubstitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G.

[0227] In some cases, the first strand of an sbRNA that targets a CAG repeat-containing RNA- comprises two mismatches to the target repeat region, and the second mismatch is within nucleotides 8- 11, based on the numbering of any one of SEQ ID NOs:4-6.

[0228] In some cases, the first strand of an sbRNA that targets a CAG repeat-containing RNA- comprises two mismatches to the target repeat region, and the second mismatch is not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:4-6.

[0229] In some cases, the first strand of an sbRNA that targets a CAG repeat-containing RNA- comprises three mismatches to the target repeat region, and the second and the third mismatches are within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:4-6.

[0230] In some cases, the first strand of an sbRNA that targets a CAG repeat-containing RNA- comprises three mismatches to the target repeat region, where the second mismatch is within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:4-6, and where the third mismatch is not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:4-6.

[0231] In some cases, the first strand of an sbRNA that targets a CAG repeat-containing RNA- compriscs three mismatches to the target repeat region, where the second and the third mismatches arc not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:4-6.

[0232] In some cases, the first strand of an sbRNA that targets a CAG repeat-containing RNA- comprises four mismatches to the target repeat region, where the second, third, and fourth mismatches are within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:4-6.

[0233] In some cases, the first strand of an sbRNA that targets a CAG repeat-containing RNA- comprises four mismatches to the target repeat region, where the second mismatch is within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:4-6, and where the third and fourth mismatches are not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:4-6.

[0234] In some cases, the first strand of an sbRNA that targets a CAG repeat-containing RNA- compriscs four mismatches to the target repeat region, where the second and third mismatches arc within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:4-6, and where the fourth mismatch is not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:4-6.

[0235] In some cases, the first strand of an sbRNA that targets a CAG repeat-containing RNA- comprises four mismatches to the target repeat region, where the second, third, and fourth mismatches are not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:4-6.

[0236] In some cases, the at least a second mismatch in the first strand of an sbRNA that targets a CAG repeat-containing RNA is within nucleotides 12-21, based on the numbering of any one of SEQ ID NOs:4-6.

[0237] In some cases, the first strand or the second strand of an sbRNA that targets a CAG repeat-containing RNA comprises any one of the guide strand sequences depicted in FIG. 9A and FIG. 9B. As explained herein, the first strand can include a 5’U or A in addition to the sequences listed in FIGS. 9A and 9B. For example, the dsRNA can have the following sequence:5' U / A CUGCUGCUACUGAUGCUGCUG(N)m3’ 1ststrand (SEQ ID NO:711)3’ A / U GACGACGATGACUACGACGAC 5’ 2ndstrand (SEQ ID NO:712)

[0238] Where the ‘5 UA base pair- is present or absent and the overhang (N)mat the 3’end is present or absent, and where m=l or 2 and N =A, U, or G. The first mismatch “A” at position 9 and second mismatch “A” at position 13, based on numbering of SEQ ID NO:4, are shown in bold.

[0239] The sequence of a first strand or the second strand may be provided as a DNA sequence. Thus, in the corresponding RNA sequence, the T will be a U.

[0240] In some cases, the second strand of an sbRNA that targets a CAG repeat-containing RNA is 100% complementary to the first strand. In some cases, the second strand of an sbRNA that targets a CAG repeat-containing RNA comprises from 1 to 10 mismatches, from 3 to 5 mismatches, from 4 to 7 mismatches, or from 5 to 10 mismatches, to the first strand.

[0241] In some cases, the double-stranded RNA that targets a CAG repeat-containing RNA a length of from 18 bases to 25 nucleotides, from 19 to 25 nucleotides, from 19 to 23 nucleotides, or from 19 to 22 nucleotides. In some cases, the double-stranded RNA that targets a CAG repeat-containing RNA has a length of from 21 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA that targets a CAG repeat-containing RNA has a length of 21 nucleotides.

[0242] In some cases, the double-stranded RNA that targets a CAG repeat-containing RNA comprises one or more of: a) a base modification; b) a sugar modification; and c) a backbone modification. Suitable base modifications, sugar modifications, and backbone modifications are described elsewhere herein.COMPOSITIONS, DELIVERY VEHICLES, AND VIRAL PARTICLES

[0243] The present disclosure provides a delivery vehicle comprising a recombinant expression vector of the present disclosure. The present disclosure provides a viral particle comprising a recombinant expression vector of the present disclosure. The present disclosure provides a delivery vehicle comprising a conjugate of the present disclosure. The present disclosure provides a composition comprising a recombinant expression vector of the present disclosure. The present disclosure provides a composition comprising a double-stranded RNA of the present disclosure. The present disclosure provides a composition comprising a conjugate of the present disclosure.Delivery vehicles

[0244] A recombinant expression vector of the present disclosure can be present in a delivery vehicle. Thus, the present disclosure provides a delivery vehicle comprising a recombinant expression vector of the present disclosure. In some cases, the delivery vehicle is a non-viral delivery vehicle. In some cases, the delivery vehicle is a lipid nanoparticle. In some cases, the delivery vehicle is a viral delivery vehicle. In some cases, the viral delivery vehicle is a recombinant AAV virion. Suitable AAV virions include those with AAV2 capsid, an AAV9 capsid, and the like.

[0245] Suitable lipid nanoparticles can include, e.g., one or more cationic lipids, lipids modified with poly(ethylene glycol) (“PEGylated lipids”), and the like. Suitable cationic lipids include, but are not limited to, XTC (2,2-dilinoleyl-4-dimethylaminoethyl-[l,3]-dioxolane), MC3 (((6Z,9Z,28Z,31Z)- heptatriaconta-6,9,28,31 -tetraen-!9-yl 4-(dimethylamino)butanoate), ALNY-100 ((3aR,5s,6aS)-N,N- dimethyl-2,2-di((92,12Z)-octadeca-9,12-dienyl)tetrahydr- o-3aH-cyclopenta[d] [l,3]dioxol-5-amine)), NC98-5 (4,7,13-tris(3-oxo-3-(undccylamino)propyl)-Nl,N16-diundccyl-4,7,10,13-tct- raazahcxadccanc- 1,16-diamide), DODAP (l,2-dioleyl-3-dimethylammonium propane), HGT4003, ICE, HGT5000, cis or trans HGT5001, DOTAP (l,2-dioleyl-3-trimethylammonium propane), DOTMA (1,2-di-O-octadecenyl- 3 -trimethylammonium propane), DLinDMA, DLin-KC2-DMA, and C12-200. Other suitable lipids that can be included in a lipid nanoparticle include, but are not limited to, DSPC (l,2-distearoyl-sn-glycero-3- phosphocholine), DPPC (l,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleyl-sn-glycero- 3-phosphocthanolaminc), DPPE (l,2-dipalmitoyl-sn-glyccro-3-phosphocthanolaminc), DMPE (1,2- dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG (l,2-dioleoyl-sn-glycero-3-phospho-(l'-rac- glycerol)), and cholesterol. Suitable PEGylated lipids include, e.g., PEG-DSG ( 1 ,2-Distearoyl-rac- glycero-3-methoxypolyethylene glycol conjugated to, e.g., PEG-1000, PEG-2000, PEG-5000, and the like), PEG-DMG (1,2-Dimyristoyl-rac-glycerol conjugated to PEG), and PEG-ceramides.Pharmaceutical Compositions

[0246] The disclosure provides pharmaceutical compositions comprising nucleic acids (e.g., DNA; dsRNA, etc.), expression cassettes, vectors encoding double stranded RNAs, or conjugates described herein and a pharmaceutically acceptable carrier. As used herein, the term “pharmaceutically acceptable” refers to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with cells and / or tissues without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0247] As used herein, the term "pharmaceutically acceptable carrier" means a pharmaceutically acceptable material, composition or carrier, such as a liquid or solid filler, stabilizer, dispersing agent, suspending agent, diluent, excipient, thickening agent, solvent or encapsulating material, involved in carrying or transporting a compound useful within the invention within or to the patient such that it mayperform its intended function. Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the cell or tissue being contacted. Additional ingredients that may be included in the pharmaceutical compositions used in the practice of the invention are known in the art and described, for example in Remington's Pharmaceutical Sciences (Genaro, Ed., Mack Publishing Co., 1985, Easton, PA), which is incorporated herein by reference.

[0248] As is well known in the medical arts, the dosage for any one patient depends upon many factors, including the patient's size, weight, body surface area, age, the level of expression of inhibitory RNA expression required to achieve a therapeutic effect, stability of the inhibitory nucleic acid, specific disease being treated, stage of disease, sex, time and route of administration, general health, and other drugs being administered concurrently.

[0249] In some cases, rAAVs as described herein are administered to a subject in an amount of about IxlO6VG (viral genomes) to about IxlO16VGper subject, or about IxlO6, 2xl06, 3xl06, 4xl06, 5xl06, 6xl06, 7xl06, 8xl06, 9xl06, IxlO7, 2xl07, 3xl07, 4xl07, 5xl07, 6xl07, 7xl07, 8xl07, 9xl07, IxlO8, 2xl08, 3xlO8, 4xl08, 5xl08, 6xl08, 7xl08, 8xlO8, 9xl08, IxlO9, 2xl09, 3xl09, 4xl09, 5xl09, 6xl09, 7xl09, 8xlO9, 9xl09, IxlO10, 2xlO10, 3xlO10, 4xlO10, 5xlO10, 6xlO10, 7xlO10, 8xlO10, 9xlO10, IxlO11, 2x10", 2.1x10", 2.2x10", 2.3x10", 2.4x10", 2.5x10", 2.6x10", 2.7x10", 2.8x10", 2.9x10", 3x10", 4x10", 5x10", 6x10", 7x10", 7.1x10", 7.2x10", 7.3x10", 7.4x10", 7.5x10", 7.6x10", 7.7x10", 7.8x10", 7.9x10", 8x10", 9x10", IxlO12, l.lxlO12, 1.2xl012, 1.3xl012, 1.4xl012, 1.5xl012, 1.6xl012, 1.7xl012, 1.8xl012, 1.9xl012, 2xl012, 3xl012, 4xl012, 4.1xl012, 4.2xl012, 4.3xl012, 4.4xl012, 4.5xl012, 4.6xl012, 4.7xl012, 4.8xl012, 4.9xl012, 5xl012, 6xl012, 7xl012, 8xl012, 8. IxlO12, 8.2xl012, 8.3xl012, 8.4xl012, 8.5xl012, 8.6xl012, 8.7xl012, 8.8xlO12, 8.9xl012, 9xl012, IxlO11, 2xl013, 3xlO13, 4x10", 5x10", 6x10", 6.7xl013, 7x10", 8x10", 9x10", IxlO14, 2xl014, 3xl014, 4xl014, 5xl014, 6xl014, 7xl014, 8xl014, 9xl014, 1x10", 2x10", 3x10", 4x10", 5x10", 6x10", 7x10", 8x10", 9x10", or IxlO16VG / subject.

[0250] In some cases, rAAV particles as described herein are administered to a subject in an amount of about IxlO6VG / kg to about IxlO16VG / kg, or about IxlO6, 2xl06, 3xl06, 4xl06, 5xl06, 6xl06, 7xl06, 8xl06, 9xl06, IxlO7, 2xl07, 3xl07, 4xl07, 5xl07, 6xl07, 7xl07, 8xl07, 9xl07, IxlO8, 2x108, 3xl08, 4xl08, 5x108, 6xl08, 7xl08, 8x1O8, 9xl08, l x109, 2xl09, 3xlO9, 4x109, 5xl09, 6xl09, 7xl09, 8xl09, 9xl09, IxlO10, 2xlO10, 3xl010, 4xlO10, 5xl010, 6xlO10, 7xlO10, 8xl010, 9xlO10, 1x10", 2x10", 2.1x10", 2.2x10", 2.3x10", 2.4x10", 2.5x10", 2.6x10", 2.7x10", 2.8x10", 2.9x10", 3x10", 4x10", 5x10", 6x10", 7x10", 7.1x10", 7.2x10", 7.3x10", 7.4x10", 7.5x10", 7.6x10", 7.7x10", 7.8x10", 7.9x10", 8x10", 9x10", IxlO12, l.lxlO12, 1.2xl012, 1.3xl012, 1.4xl012, 1.5xl012, 1.6xl012, 1.7xl012, 1.8xl012, 1.9xl012, 2xl012, 3xl012, 4xl012, 4.1xl012, 4.2xl012, 4.3xl012, 4.4xl012, 4.5xl012, 4.6xl012, 4.7xl012, 4.8xl012, 4.9xl012, 5xl012, 6xl012, 7xl012, 8xl012, 8. IxlO12, 8.2xl012, 8.3xl012, 8.4xl012, 8.5xl012, 8.6xl012, 8.7xl012, 8.8xl012, 8.9xl012, 9xl012, IxlO13, 2xl013, 3x10", 4x10",5xlO13, 6xlO13, 6.7xl013, 7xlO13, 8xlO13, 9xlO13, IxlO14, 2xl014, 3xl014, 4xl014, 5xl014, 6xl014, 7xl014, 8xl014, 9xl014, IxlO15, 2xl015, 3xlO15, 4xl015, 5xlO15, 6xlO15, 7xl015, 8xlO15, 9xl015, or IxlO16VG / kg.

[0251] Pharmaceutical compositions may be administered in a manner appropriate to the disease or condition to be treated (or prevented) as determined by persons skilled in the medical art. An appropriate dose and a suitable duration and frequency of administration of the compositions will be determined by such factors as the health condition of the patient, size of the patient ( / '.e., weight, mass, or body area), the type and severity of the patient's disease, the particular form of the active ingredient, and the method of administration. In general, an appropriate dose and treatment regimen provide the composition(s) in an amount sufficient to provide therapeutic and / or prophylactic benefit (such as described herein, including an improved clinical outcome, such as more frequent complete or partial remissions, or longer disease-free and / or overall survival, or a lessening of symptom severity). For prophylactic use, a dose should be sufficient to prevent, delay the onset of, or diminish the severity of a disease associated with disease or disorder. Prophylactic benefit of the compositions administered according to the methods described herein can be determined by performing pre-clinical (including in vitro and in vivo animal studies) and clinical studies and analyzing data obtained therefrom by appropriate statistical, biological, and clinical methods and techniques, all of which can readily be practiced by a person skilled in the art.

[0252] Compositions (e.g., pharmaceutical compositions) may be administered by any route, including enteral (e.g., oral), parenteral, intravenous, intraocular, intravitreal, intracamcral, subrctinal, intramuscular, intra-arterial, intramedullary, intrathecal, subpial, intracisternal (e.g., via intracisternal injection), intraparenchymal, intrastriatal, intrathalamic, intracerebellar, intracranial, , intra-cerebral, intracerebral ventricular, intraocular, intraventricular, intralumbar, subcutaneous, transdermal, intradermal, rectal, intravaginal, intraperitoneal, topical (as by powders, ointments, creams, and / or drops), mucosal, nasal, buccal, sublingual; by intratracheal instillation, bronchial instillation, and / or inhalation; and / or as an oral spray, nasal spray, and / or aerosol. In general, the most appropriate route of administration will depend upon a variety of factors including the nature of the agent (e.g., its stability in the environment of the gastrointestinal tract), and / or the condition of the subject. In some cases, compositions are directly injected into the CNS of the subject. In some cases, direct injection into the CNS is intracerebral injection, intracerebral ventricular injection, intracisternal injection, intraparenchymal injection, intrathecal injection, intrastriatal injection, intrathalamic injection, subpial injection, or any combination thereof. In some cases, direct injection into the CNS is direct injection into the cerebrospinal fluid (CSF) of the subject, optionally wherein the direct injection is intracisternal injection, intraventricular injection, and / or intralumbar injection. In some cases, compositions are administered by a combination of direct injection into the CNS and by a route that is not directly injected into the CNS (e.g., intravenously). In some cases, a composition is administered intraocularly (into thevitreous (intravitreal), into the anterior chamber of the eye (intracameral), or into the space between the photoreceptors and the retinal pigment epithelium (subretinal)). In some cases, a composition is administered intramuscularly (e.g., to skeletal muscle or smooth muscle). In some cases, a composition is administered via intravitreal administration. In some cases, a composition is administered via intracameral administration. In some cases, a composition is administered via intrathecal administration. In some cases, a composition is administered topically to the eye (e.g., using eye drops). In some cases, a composition is administered intravenously.

[0253] In some cases, pharmaceutical compositions comprising rAAV particles arc formulated to reduce aggregation of rAAV particles, particularly where high rAAV particle concentrations are present (e.g., ~1013VG / ml or more). Methods for reducing aggregation of rAAV particles are well known in the art and include, for example, addition of surfactants, pH adjustment, salt concentration adjustment, etc. (See, e.g., Wright F R, et al., Molecular Therapy (2005) 12:171-178, incorporated herein by reference in its entirety).Kits

[0254] In some cases, the compositions provided herein may be assembled into pharmaceutical or research kits to facilitate their use in therapeutic or research use. A kit may include one or more containers comprising: (a) expression cassette or vector encoding a double stranded RNA as described herein; (b) instructions for use; and optionally (c) reagents for transducing the kit component (a) into a host cell. In some cases, the kit component (a) may be in a pharmaceutical formulation and dosage suitable for a particular use and mode of administration. For example, the kit component (a) may be presented in unit-dose or multi-dose containers, such as sealed ampoules or vials. The components of the kit may require mixing one or more components prior to use or may be prepared in a premixed state. The components of the kit may be in liquid or solid form, and may require addition of a solvent or further dilution. The components of the kit may be sterile. The instructions may be in written or electronic form and may be associated with the kit or provided via internet or web-based communication. The kit may be shipped and stored at a refrigerated or frozen temperature.TREATMENT METHODS

[0255] The present disclosure provides nucleic acids (e.g., DNA), expression cassettes, recombinant expression vectors comprising a cassette, recombinant expression vectors encoding dsRNAs, or pharmaceutical compositions described herein for use in a method of therapy.

[0256] The present disclosure provides methods for selectively reducing translation of a disease-associated CUG repeat-containing RNA and / or accumulation of disease-associated CUG repeatcontaining RNA in an individual having a CTG repeat expansion disease or disorder. The present disclosure provides methods for selectively reducing translation of a disease-associated CAG repeatcontaining RNA and / or accumulation of disease-associated CAG repeat-containing RNA in an individualhaving a CTG repeat expansion disease or disorder. The methods comprise administering to the individual an effective amount of a recombinant expression vector of the present disclosure, a delivery vehicle of the present disclosure, a viral particle of the present disclosure, or a pharmaceutical composition of the present disclosure. Diseases associated with CTG repeat expansions include Huntington disease-like 2 (HDL2), myotonic dystrophy type 1 (DM1), Fuchs endothelial corneal dystrophy (FECD), and Spinocerebellar ataxia type 8 (SCA8).

[0257] In some cases, a composition of the present disclosure (e.g., dsRNA, isolated nucleic acid comprising an expression cassette encoding a dsRNA, recombinant expression vector, rAAV particle, pharmaceutical composition) is delivered to the eye of an individual having a CTG repeat expansion disease or disorder. In some cases, a composition of the present disclosure (e.g., dsRNA, isolated nucleic acid comprising an expression cassette encoding a dsRNA, recombinant expression vector, rAAV particle, pharmaceutical composition) is delivered to a lung of an individual having a CTG repeat expansion disease or disorder. In some cases, a composition of the present disclosure (e.g., dsRNA, isolated nucleic acid comprising an expression cassette encoding a dsRNA, recombinant expression vector, rAAV particle, pharmaceutical composition) is delivered to a muscle (e.g., a skeletal muscle) of an individual having a CTG repeat expansion disease or disorder. In some cases, a composition of the present disclosure (e.g., dsRNA, isolated nucleic acid comprising an expression cassette encoding a dsRNA, recombinant expression vector, rAAV particle, pharmaceutical composition) is delivered to the heart of an individual having a CTG repeat expansion disease or disorder.

[0258] A composition of the present disclosure (e.g., dsRNA, isolated nucleic acid comprising an expression cassette encoding a dsRNA, recombinant expression vector, rAAV particle, pharmaceutical composition) can be delivered to an individual having a CTG repeat expansion disease or disorder via any of a variety of routes of administration. Suitable routes of administration include, but are not limited to, intracameral, intravitreal, subretinal, topical, intramuscular, intravenous, intracerebral ventricular, intraparenchymal, intrathecal, intrastriatal, intrathalamic, intracisternal magna, and subpial, and combinations of two or more of such routes of administration.

[0259] In some cases, a composition of the present disclosure (e.g., dsRNA, isolated nucleic acid comprising an expression cassette encoding a dsRNA, recombinant expression vector, rAAV particle, pharmaceutical composition) is directly injected into the central nervous system (CNS) of the subject. In some cases, direct injection into the CNS is intracerebral injection, intracisternal injection, intraparenchymal injection, intrathecal injection, intrathalamic injection, subpial injection, or any combination thereof. In some cases, direct injection into the CNS is intracerebral ventricular injection. In some cases, direct injection into the CNS is direct injection into the cerebrospinal fluid (CSF) of the subject, optionally wherein the direct injection is intracisternal injection, intraventricular injection, intralumbar injection, or any combination thereof. In some cases, administration to the subject isaccomplished by a combination of direct injection to the CNS and by a route that is not directly injected into the CNS (e.g., intravenously).

[0260] A method of the present disclosure can comprise administering to an individual in need thereof an effective amount of a composition of the present disclosure (e.g., a dsRNA, an isolated nucleic acid comprising an expression cassette encoding a dsRNA, a recombinant expression vector encoding a dsRNA, a recombinant expression vector encoding a dsRNA within a miR scaffold, an rAAV particle, a conjugate, or a pharmaceutical composition of the present disclosure). In some cases, an effective amount of a composition of the present disclosure is an amount that, when administered to an individual in need thereof, reduces translation of a disease-associated CUG repeat-containing RNA and / or a disease-associated CAG repeat-containing RNA produced by transcription of a CTG repeat expansion more than it reduces translation of a non-disease-associated CUG repeat-containing RNA and / or a nondisease-associated CAG repeat-containing RNA. In some cases, an effective amount of a composition of the present disclosure is an amount that, when administered to an individual in need thereof, reduces translation of a disease-associated CUG repeat-containing RNA and / or a disease-associated CAG repeatcontaining RNA produced by transcription of a CTG repeat expansion to an extent that is at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 2- fold, at least 2.5-fold, at least 5-fold, or at least 10-fold, greater than the extent to which it reduces translation of a non-disease-associated CUG repeat-containing RNA and / or a non-disease-associated CAG repeat-containing RNA.

[0261] In some cases, an effective amount of a composition of the present disclosure (e.g., a dsRNA, an isolated nucleic acid comprising an expression cassette encoding a dsRNA, a recombinant expression vector encoding a dsRNA, a recombinant expression vector encoding a dsRNA within a miR scaffold, an rAAV particle, a conjugate, or a pharmaceutical composition of the present disclosure) is an amount that, when administered to an individual in need thereof, reduces the amount or level of one or more of a poly(Gln), a poly(Ala), and a poly(Ser) polypeptide by at least 10%, compared to the level of the poly(Gln), a poly(Ala), or poly(Ser) polypeptide in the individual, or in a cell or tissue in the individual, before said administering.

[0262] In some cases, a method of the present disclosure (e.g., where the method results in the presence of an sbRNA of the present disclosure in a target cell) reduces the level of one or more of a poly(Gln), a poly(Ala), and a poly(Scr) polypeptide in a cell by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or more, in a cell compared to the level of the poly(Gln), a poly(Ala), or poly(Ser) polypeptide in a cell that does not comprise the double stranded RNA. In some cases, the methods of the present disclosure reduces the level of one or more of a poly (Gin), a poly (Ala), and a poly(Ser) polypeptide in a cell by 10-20%, 10-30%, 10-40%, 10-50%, 10-60%, 10-70%, 10-80%,10-90%, 10-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30- 40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40-50%, 40-60%, 40-70%, 40- 80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 60-70%, 60- 80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90- 95%, or 90-100% compared to the level of the poly(Gln), a poly(Ala), or poly(Ser) polypeptide in a cell that does not comprise the double stranded RNA.

[0263] In some cases, the methods of the present disclosure reduce the number of nuclear toxic sense RNA foci in a cell (e.g., a neuron, a muscle cell, a lung cell, a red blood cell, an ocular cell (e.g., a retinal cell)) in an individual, compared to the number of nuclear toxic sense RNA foci in the cell before treatment with the method. For example, in some cases, the methods of the present disclosure reduce the number of nuclear toxic sense RNA foci in a cell (e.g., a neuron, a muscle cell, a lung cell, a red blood cell, an ocular cell (e.g., a retinal cell)) in an individual by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or more, compared to the number of nuclear toxic sense RNA foci in the cell before treatment with the method. In some cases, a method of the present disclosure stabilizes the number of nuclear toxic sense RNA foci in a cell in an individual.

[0264] In some cases, the methods of the present disclosure reduce the number of nuclear toxic antisense RNA foci in a cell (e.g., a neuron, a muscle cell, a lung cell, a red blood cell, an ocular cell (e.g., a retinal cell)) in an individual, compared to the number of nuclear toxic antisense RNA foci in the cell before treatment with the method. For example, in some cases, the methods of the present disclosure reduce the number of nuclear toxic antisense RNA foci in a cell (e.g., a neuron, a muscle cell, a lung cell, a red blood cell, an ocular cell (e.g., a retinal cell)) in an individual by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or more, compared to the number of nuclear toxic antisense RNA foci in the cell before treatment with the method. In some cases, a method of the present disclosure stabilizes the number of nuclear toxic antisense RNA foci in a cell in an individual.

[0265] In some cases, the methods of the present disclosure reduce the number of cells in an individual that contain toxic RNA foci, compared to the number cells containing toxic RNA foci in the individual before treatment with the method. For example, in some cases, the methods of the present disclosure reduce the number of cells containing toxic RNA foci in an individual by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or more, compared to the number of cells containing toxic RNA foci before treatment with the method.

[0266] In some cases, a method of the present disclosure reduces the level of misprocessed RNA transcribed from a disease-associated allele. For example, in some cases, a method of the presentdisclosure reduces the level of misprocessed RNA transcribed from a disease-associated allele by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or more, compared to the level of misprocessed RNA transcribed from a disease-associated allele in a cell in the individual before treatment with the method.FECD

[0267] Fuchs endothelial corneal dystrophy (FECD) can be caused by an CTG trinucleotide repeat (CTG18.1) expansion in intron 3 within the transcription factor 4 (TCF4) gene. Most individuals without FECD have between 12 and 40 repeats of a CTG sequence in the third intron of TCF4. Wieben et al. (2021) PLoSOne 16:e0260837. The following non-mutually exclusive mechanisms can drive and / or exacerbate the onset of disease: i) dysregulated expression of TCF4 transcripts; ii) accumulation of toxic (CUG)n and (CAG)n repetitive RNA transcripts; iii) repeat-associated non- AUG dependent (RAN) translation of repetitive RNA transcripts; and (iv) age- and tissue-related somatic instability of the CTG repeat expansion. Fautsch et al. (2021) Prog. Retin. Eye Res. 81:100883.

[0268] Whether a composition of the present disclosure is effective to treat FECD can be determined using any of a variety of assays. In some cases, in an individual having FECD, a method of the present disclosure stabilizes or improves a clinical domain as assessed by change from baseline in findings from slit lamp examinations (SLE). In some cases, in an individual having FECD, a method of the present disclosure stabilizes or improves a clinical domain as assessed by change from baseline in intraocular pressure. In some cases, in an individual having FECD, a method of the present disclosure stabilizes or improves a clinical domain as assessed by change from baseline in central comeal thickness. In some cases, in an individual having FECD, a method of the present disclosure stabilizes or improves a clinical domain as assessed by endothelial cell hexagonality. In some cases, in an individual having FECD, a method of the present disclosure stabilizes or improves a clinical domain as assessed by change from baseline in Best Corrected Visual Acuity (BCVA). In some cases, in an individual having FECD, a method of the present disclosure stabilizes or improves a clinical domain as assessed by change from baseline in Best Corrected Visual Acuity (BCVA) using the Early Treatment Diabetic Retinopathy Study (ETDRS). In some cases, in an individual having FECD, a method of the present disclosure stabilizes or improves a clinical domain as assessed by change from baseline in endothelial cell density. In some cases, in an individual having FECD, a method of the present disclosure stabilizes or improves a clinical domain as assessed by change from baseline in endothelial cell coefficient of variation. In some cases, in an individual having FECD, amethod of the present disclosure stabilizes or improves a clinical domain as assessed by change from baseline in corneal area affected by microcysts. In some cases, in an individual having FECD, a method of the present disclosure stabilizes or improves a clinical domain as assessed by change from baseline in comeal bullae. In some cases, in an individual having FECD, a method of the present disclosure stabilizes or improves a clinical domain as assessed by change from baseline in severity of comeal stromal folds. In some cases, in an individual having FECD, a method of the present disclosure stabilizes or improves a clinical domain as assessed by change from baseline in contrast sensitivity. In some cases, in an individual having FECD, a method of the present disclosure stabilizes or improves a clinical domain as assessed by change from baseline in corneal endothelial cell count. In some cases, in an individual having FECD, a method of the present disclosure stabilizes or improves a clinical domain as assessed by change in patient-reported visual disability. One way to measure patient-reported visual disability is the V-FUCHS instrument. In some cases, in an individual having FECD, a method of the present disclosure stabilizes or improves a clinical domain as assessed by change from baseline in comeal tomography. In some cases, in an individual having FECD, a method of the present disclosure stabilizes or improves a clinical domain as assessed by reduced need for corneal transplantation (either increased duration of time before a comeal transplant is required - or eliminating the need for a comeal transplantation entirely).DM1

[0269] Myotonic dystrophy 1 (DM1; also known as Steinert’s disease)) is caused by a CTG expansion in the 3’ untranslated region (UTR) of the dystrophia myotonica protein kinase (DMPK) gene on chromosome 19ql3. A healthy individual with normal DMPK alleles has5 to 37 CTG repeats. Yum et al. (2017) Curr. Opin. Genet. Dev. 44:30. DMPK transcripts having pathological CTG repeat expansions aggregate into nuclear foci and alter the function of RNA-binding proteins, leading to defects in the alternative splicing of numerous pre-mRNAs. Lo Scrudato et al. (2019) Mol. Ther. 27:1372.

[0270] Whether a composition of the present disclosure is effective to treat DM1 can be determined using any of a variety of assays. In some cases, in an individual having DM1, a method of the present disclosure stabilizes or improves a clinical domain as assessed by change and percentage change from baseline in DMPK mRNA knockdown. In some cases, in an individual having DM1, a method of the present disclosure stabilizes or improves a clinical domain as assessed by change and percentage change from baseline in spliceopathy. In some cases, in anindividual having DM1, a method of the present disclosure stabilizes or improves a clinical domain as assessed by change from baseline in ambulation as measured by the 10 meter walk. In some cases, in an individual having DM1, a method of the present disclosure stabilizes or improves a clinical domain as assessed by change from baseline in respiratory function, as measured by spirometry, specifically the supine forced vital capacity (FVC). In some cases, in an individual having DM1, a method of the present disclosure stabilizes or improves a clinical domain as assessed by change from baseline in fine motor function as measured by the nine hole peg test. In some cases, in an individual having DM1, a method of the present disclosure stabilizes or improves a clinical domain as assessed by hand strength, as measured by Myogrip / dynamometer. In some cases, in an individual having DM1, a method of the present disclosure stabilizes or improves a clinical domain as assessed by finger strength as measured by myopinch. In some cases, in an individual having DM1, a method of the present disclosure stabilizes or improves a clinical domain as assessed by manual ability as measured by the ABILHAND questionnaire. In some cases, in an individual having DM1, a method of the present disclosure stabilizes or improves a clinical domain as assessed by activity limitations, as measured by the ACTIVLIM questionnaire. In some cases, in an individual having DM1, a method of the present disclosure stabilizes or improves a clinical domain as assessed by cognitive assessment, as measured by the Montreal Cognitive Assessment (MoCA). In some cases, in an individual having DM1, a method of the present disclosure stabilizes or improves a clinical domain as assessed by change in patient-reported impact of symptoms. One way to measure patient-reported impact of symptoms is the Patient-Reported Impact of Symptoms in Myotonic Dystrophy 1 (PRISM- 1) scale. In some cases, in an individual having DM1, a method of the present disclosure stabilizes or improves a clinical domain as assessed by change from baseline in fatigue as measured by the Fatigue Severity Scale (FSS). In some cases, in an individual having DM1 , a method of the present disclosure stabilizes or improves a clinical domain as assessed by change from baseline in sleepiness, as measured by the Epworth Sleepiness Scale (ESS). In some cases, in an individual having DM1, a method of the present disclosure stabilizes or improves a clinical domain as assessed by change from baseline in maximal voluntary handgrip contractions (MVC). In some cases, in an individual having DM1, a method of the present disclosure stabilizes or improves a clinical domain as assessed by change from baseline in cognitive performance, as measured by the Trail Making Test, the stroop test, or the digit span test.HDL2

[0271] Whether a composition of the present disclosure is effective to treat HDL2 can be determined using any of a variety of assays. In some cases, in an individual having HDL2, a method of the present disclosure stabilizes or improves a clinical domain as assessed by change from baseline in the Unified Huntington’s Disease rating Scale (UHDRS). In some cases, in an individual having HDL2, a method of the present disclosure stabilizes or improves a clinical domain as assessed by change from baseline in the Quantitated Neurological Examination (QNE). In some cases, in an individual having HDL2, a method of the present disclosure stabilizes or improves a clinical domain as assessed by change from baseline in the Mini-Mental State Examination (MMSE). In some cases, in an individual having HDL2, a method of the present disclosure stabilizes or improves a clinical domain as assessed by change from baseline in the Montreal Cognitive Assessment (MoCA).SCA8

[0272] Whether a composition of the present disclosure is effective to treat SCA8 can be determined using any of a variety of assays. In some cases, in an individual having SCA8, a method of the present disclosure stabilizes or improves a clinical domain as assessed by change from baseline in the Scale for Assessment and Rating of Ataxia (SARA). In some cases, in an individual having SCA8, a method of the present disclosure stabilizes or improves a clinical domain as assessed by change from baseline in the International Cooperative Ataxia Rating Scale (ICARS). In some cases, in an individual having SCA8, a method of the present disclosure stabilizes or improves a clinical domain as assessed by change from baseline in the Behaviorally Anchored Rating Scale (BARS).Targeting repeat-containing antisense RNAs in CAG repeat expansion diseases

[0273] A double stranded RNA of the present disclosure may be targeted to a target CUG repeat region of a CUG repeat-containing RNA. As explained herein, the first strand of the dsRNA is capable of hybridizing to a target CUG repeat region of a CUG repeat-containing RNA. In some cases, the RNA comprising the targeted repeat region comprising the repeat of CUG (or UGC or GCU) is an anti-sense pre-mRNA or an anti-sense mRNA. In some cases, the anti-sense pre-mRNA comprising the targeted repeat region comprising the repeat of CUG, UGC, or GCU is present in a target cell having an expanded CAG repeat in a non-coding region of a gene. In some cases, the anti-sense mRNA comprising the targeted repeat region comprising the repeat of CUG, UGC, or GCU is present in a target cell having anexpanded CAG repeat in a coding region of a gene. In some cases, double stranded RNAs of the present disclosure target anti-sense mRNA transcribed from expanded CAG-repeat containing genes. In some cases, the expanded CAG repeat is present in one of the following genes: HIT, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, PPP2R2B, TBP, AR, ATN1, TCF4, DMPK, MLLT3, BMP2K, THAP11, ZFHX3, POU3F2, MAML2, SMARCA2, MAML3, 0RC4, RUNX2, MED12, EP400, MAGI1, UMAD1, DM1-AS, AC007161.3, IRF2BPL, and MAB21L1. In some cases, the expanded CAG repeat is present in HTT gene. In certain cases, the expanded CAG repeat is present in TCF4 gene. In some cases, the expanded CAG repeat is present in DMPK gene.

[0274] The present disclosure provides nucleic acids (e.g., dsRNA or DNA), expression cassettes, recombinant expression vectors comprising a cassette, recombinant expression vectors encoding dsRNAs, or pharmaceutical compositions described herein for use in a method of therapy of a disease associated with expression of an anti-sense pre-mRNA or RNA comprising expanded CUG repeats.

[0275] The present disclosure provides methods for treating an individual having a gene comprising expanded CAG repeats and expressing an anti-sense pre-mRNA or mRNA comprising expanded CUG repeats. In certain cases, the method includes administering to the individual an effective amount of nucleic acids (e.g., dsRNA or DNA), expression cassettes, recombinant expression vectors comprising a cassette, recombinant expression vectors encoding dsRNAs, or pharmaceutical compositions of the present disclosure. In certain cases, the individual has or is expected to develop a polyglutamine disorder caused by the gene comprising expanded CAG repeats. Expansion of the CAG- repeat is associated with a number of dominant, genetic disorders referred to as polyglutamine (polyQ) diseases. In some cases, the polyQ disease is Huntington’s disease, spinocerebellar ataxia type 1, spinocerebellar ataxia type 2, spinocerebellar ataxia type 3, spinocerebellar ataxia type 6, spinocerebellar ataxia type 7, spinocerebellar ataxia type 12, spinocerebellar ataxia type 17, spinal and bulbar muscular atrophy, dentatorubral pallidoluysian atrophy, myotonic dystrophy type 1, Fuchs’ endothelial corneal dystrophy, or cleidocranial dysplasia. In some cases, the polyQ disease is Huntington’s disease. In certain cases, the polyQ disease is Fuchs’ endothelial corneal dystrophy. In some cases, the polyQ disease is myotonic dystrophy type 1.

[0276] In certain cases, a first dsRNA and a second dsRNA of the present disclosure may be used for treating the individual having a polyQ disorder, where the first dsRNA comprises a first strand that hybridizes to a target CUG repeat region of a CUG repeat-containing RNA and the second dsRNA comprises a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA. In certain cases, the individual has been identified as expressing both sense mRNA and anti-sense mRNA transcribed from the expanded CAG repeat-containing gene. In certain cases, the first dsRNA and the second dsRNA may be present in a single nucleic acid, e.g., a cassette of the present disclosurecomprises a nucleotide sequence encoding two recombinant RNAs of the present disclosure, a recombinant expression vector of the present disclosure comprises a nucleotide sequence encoding two recombinant RNAs of the present disclosure, etc.Examples of Non-Limiting Aspects of the Disclosure

[0277] Aspects, including embodiments, of the present subject matter described above may be beneficial alone or in combination, with one or more other aspects or embodiments. Without limiting the foregoing description, certain non-limiting aspects of the disclosure are provided below. As will be apparent to those of skill in the art upon reading this disclosure, each of the individually numbered aspects may be used or combined with any of the preceding or following individually numbered aspects. This is intended to provide support for all such combinations of aspects and is not limited to combinations of aspects explicitly provided below:

[0278] Aspect 1. A double-stranded RNA comprising: a) a first strand that hybridizes to a target CUG repeat region of a CUG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target CUG repeat region; and ii) at least a second mismatch to the target CUG repeat region, wherein: i) when the first mismatch is at position 8 based on the numbering of SEQ ID NO:1 (CAGCAGCAGCAGCAGCAGCAG; SEQ ID NO:1), SEQ ID NO:2 (AGCAGCAGCAGCAGCAGCAGC; SEQ ID NO:2) or SEQ ID NOG (GCAGCAGCAGCAGCAGCAGCA; SEQ ID NO:3), the second mismatch is from 1 to 13 bases 3' of the first mismatch; ii) when the first mismatch is at position 9 based on the numbering of SEQ ID NO:1, 2, or 3, the second mismatch is from 1 to 12 bases 3’ of the fust mismatch; iii) when the first mismatch is at position 10 based on the numbering of SEQ ID NO:1, 2, or 3, the second mismatch is from 1 to 11 bases 3’ of the first mismatch; and iv) when the fust mismatch is at position 11 based on the numbering of SEQ ID NO:1, 2, or 3, the second mismatch is from 1 to 10 bases 3' of the first mismatch.

[0279] Aspect 2. The double-stranded RNA of aspect 1 , wherein each mismatch is generated by a substitution that is independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a C with an A, a U, or a G; c) a substitution of an A with a U, a C, or a G.

[0280] Aspect 3. The double-stranded RNA of aspect 1 or aspect 2, wherein the fust strand comprises no more than 2 mismatches with the target CUG repeat region of a CUG repeatcontaining RNA.

[0281] Aspect 4. The double-stranded RNA of aspect 1 or aspect 2, wherein the first strand comprises no more than 3 mismatches with the target CUG repeat region of a CUG repeatcontaining RNA.

[0282] Aspect 5. The double-stranded RNA of aspect 1 or aspect 2, wherein the first strand comprises no more than 4 mismatches with the target CUG repeat region of a CUG repeatcontaining RNA.

[0283] Aspect 6. The double-stranded RNA of aspect 1 or aspect 2, wherein the first strand comprises no more than 5 mismatches with the target CUG repeat region of a CUG repeatcontaining RNA.

[0284] Aspect 7. The double-stranded RNA of any one of aspect 1-6, wherein the fust strand comprises two mismatches to the target repeat region, and wherein the second mismatch is within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-3.

[0285] Aspect 8. The double-stranded RNA of any one of aspect 1-6, wherein the first strand comprises two mismatches to the target repeat region, and wherein the second mismatch is not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-3.

[0286] Aspect 9. The double-stranded RNA of any one of aspect 1-6, wherein the first strand comprises three mismatches to the target repeat region, and wherein the second and the third mismatches are within nucleotides 8-1 1 , based on the numbering of any one of SEQ ID NOs: 1 -3.

[0287] Aspect 10. The double-stranded RNA of any one of aspect 1-6, wherein the first strand comprises three mismatches to the target repeat region, wherein the second mismatch is within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs: 1-3, and wherein the third mismatch is not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l- 3.

[0288] Aspect 11. The double-stranded RNA of any one of aspect 1-6, wherein the first strand comprises three mismatches to the target repeat region, and wherein the second and the third mismatches are not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-3.

[0289] Aspect 12. The double-stranded RNA of any one of aspect 1 -6, wherein the first strand comprises four mismatches to the target repeat region, and wherein the second, third, and fourth mismatches arc within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-3.

[0290] Aspect 13. The double-stranded RNA of any one of aspect 1-6, wherein the first strand comprises four mismatches to the target repeat region, wherein the second mismatch is within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs: 1-3, and wherein the third and fourth mismatches are not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs: 1-3.

[0291] Aspect 14. The double-stranded RNA of any one of aspect 1-6, wherein the first strand comprises four mismatches to the target repeat region, wherein the second and third mismatchesare within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-3, and wherein the fourth mismatch is not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-3.

[0292] Aspect 15. The double-stranded RNA of any one of aspect 1-6, wherein the first strand comprises four mismatches to the target repeat region, and wherein the second, third, and fourth mismatches are not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-3.

[0293] Aspect 16. The double-stranded RNA of any one of aspect 1-6, wherein at least a second mismatch is within nucleotides 12-21, based on the numbering of any one of SEQ ID NOs:l-3.

[0294] Aspect 17. The double-stranded RNA of aspect 1, wherein the first strand or the second strand comprises any one of the guide strand sequences depicted in FIG. 2, FIG. 3, FIG. 4A, FIG. 10A, FIG. 10C, FIG. 11 A, FIG. 11C, wherein any T nucleotide in the guide strand sequences of FIG. 2, FIG. 3, FIG. 4A, FIG. 10A, FIG. 10C, FIG. 11 A, FIG. 11C is a U nucleotide in the first strand or the second strand or wherein the first strand or the second strand comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 19, 528- 534, 18, 535-539, 540-544, 695, 699, wherein any T nucleotide in the nucleotide sequence is a U nucleotide in the first strand or the second strand and optionally, wherein the first strand or the second strand further comprises a 5’ U or a 5’ A or the first strand or the second strand further comprises a 5’ U or a 5’ A and a 3’ A or a 3’ A A.

[0295] Aspect 18. The double-stranded RNA of any one of aspects 1-17, wherein the second strand is 100% complementary to the first strand.

[0296] Aspect 19. The double-stranded RNA of any one of aspects 1-17, wherein the second strand comprises from 1 to 10 mismatches, from 3 to 5 mismatches, from 4 to 7 mismatches, or from 5 to 10 mismatches, to the first strand.

[0297] Aspect 20. The double-stranded RNA of any one of aspects 1-19, wherein the doublestranded RNA has a length of from 18 bases to 25 nucleotides, from 19 to 25 nucleotides, from 19 to 23 nucleotides, or from 19 to 22 nucleotides.

[0298] Aspect 21. The double-stranded RNA of any one of aspects 1-19, wherein the doublestranded RNA has a length of from 21 nucleotides to 25 nucleotides.

[0299] Aspect 22. The double-stranded RNA of any one of aspects 1-19, wherein the doublestranded RNA has a length of 21 nucleotides.

[0300] Aspect 23. The double-stranded RNA of any one of aspects 1-22, wherein the doublestranded RNA comprises one or more of: a) a base modification; b) a sugar- modification; and c) a backbone modification.

[0301] Aspect 24. A DNA molecule comprising a nucleotide sequence encoding the first strand as set forth in any one of aspects 1-23. wherein the nucleotide sequence is operably linked to a promoter that is functional in a eukaryotic cell.

[0302] Aspect 25. A recombinant nucleic acid comprising:

[0303] al) the double-stranded RNA of any one of aspects 1-23; and

[0304] bl) a microRNA scaffold comprising a 5’ flanking polynucleotide, a loop polynucleotide, and a 3’ flanking polynucleotide,

[0305] wherein the recombinant nucleic acid comprises:

[0306] i) the 5’ flanking polynucleotide;

[0307] ii) the first strand of the double-stranded RNA;

[0308] iii) the loop polynucleotide;

[0309] iv) the second strand of the double-stranded RNA; and

[0310] v) the 3’ flanking polynucleotide;

[0311] wherein at least one of the 5’ flanking polynucleotide, the loop polynucleotide, and the 3' flanking polynucleotide is heterologous to the first and / or the second strand of the doublestranded RNA; or

[0312] a2) the double-stranded RNA of any one of aspects 1-23; and

[0313] b2) a microRNA scaffold comprising a 5’ flanking polynucleotide, a loop polynucleotide, and a 3’ flanking polynucleotide,

[0314] wherein the recombinant nucleic acid comprises:

[0315] i) the 5’ flanking polynucleotide;

[0316] ii) the second strand of the double-stranded RNA;

[0317] iii) the loop polynucleotide;

[0318] iv) the first strand of the double-stranded RNA; and

[0319] v) the 3’ flanking polynucleotide,

[0320] where at least one of the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the doublestranded RNA; or

[0321] a3) the double-stranded RNA of any one of aspects 1-23; and

[0322] b3) a microRNA scaffold comprising a 5’ flanking polynucleotide and a 3’ flanking polynucleotide,

[0323] wherein the recombinant nucleic acid comprises:

[0324] i) the 5’ flanking polynucleotide;

[0325] ii) the first strand of the double-stranded RNA;

[0326] iii) the second strand of the double-stranded RNA; and

[0327] iv) the 3’ flanking polynucleotide;

[0328] wherein one or both of the 5' flanking polynucleotide and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA; or

[0329] a4) the double-stranded RNA of any one of aspects 1 -23; and

[0330] b4) a microRNA scaffold comprising a 5’ flanking polynucleotide and a 3’ flanking polynucleotide,

[0331] wherein the recombinant nucleic acid comprises:

[0332] i) the 5’ flanking polynucleotide;

[0333] ii) the second strand of the double-stranded RNA;

[0334] iii) the first str and of the double-stranded RNA; and

[0335] iv) the 3’ flanking polynucleotide;

[0336] wherein one or both of the 5’ flanking polynucleotide and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA.

[0337] Aspect 26. The recombinant nucleic acid of aspect 25, wherein the 5' flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide are derived from miR33, miR451, miR144, miRlOl, or miR126.

[0338] Aspect 27. A DNA molecule comprising a nucleotide sequence encoding a recombinant nucleic acid according to aspect 25 or aspect 26.

[0339] Aspect 28. The DNA molecule of aspect 27, wherein the 5’ flanking polynucleotide is encoded by the nucleotide sequence: tgcacacctcctggcgggcagctctg (SEQ ID NO:516).

[0340] Aspect 29. The DNA molecule of aspect 28 or aspect 29, wherein the loop polynucleotide is encoded by the nucleotide sequence: tgttctggcaatacctg (SEQ ID NO:517).

[0341] Aspect 30. The DNA molecule of any one of aspects 28-30, wherein the 3' flanking polynucleotide is encoded by the nucleotide sequence: gggaggcctgccctgactgcccac (SEQ ID NO:518).

[0342] Aspect 31. The DNA molecule of aspect 27, wherein the DNA molecule comprises a nucleotide sequence depicted in FIG. 4A-4B or set forth in any one of SEQ ID NOs:349-515.

[0343] Aspect 32. The DNA molecule of aspect 30, wherein the DNA molecule comprises: a) a first nucleotide sequence encoding a first recombinant nucleic acid according to aspect 26 or aspect 27 ; and b) a second nucleotide sequence encoding a second recombinant nucleic acidaccording to aspect 26 or aspect 27, wherein the first recombinant nucleic acid differs in nucleotide sequence from the second recombinant nucleic acid.

[0344] Aspect 33. The DNA molecule of aspect 32, wherein the first recombinant nucleic acid comprises a first microRNA scaffold, wherein the second recombinant nucleic acid comprises a second microRNA scaffold, and wherein the first microRNA scaffold differs in nucleotide sequence from the second microRNA scaffold.

[0345] Aspect 34. The DNA molecule of aspect 33, wherein the microRNA scaffold of the first recombinant nucleic acid has the same nucleotide sequence as the microRNA scaffold of the second recombinant nucleic acid.

[0346] Aspect 35. The DNA molecule of any one of aspects 32-34, wherein the double-stranded RNA of the first recombinant nucleic acid comprises a first strand that hybridizes to a target CUG repeat region of a CUG repeat-containing RNA, and wherein the double-stranded RNA of the second recombinant nucleic acid comprises a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA.

[0347] Aspect 36. The DNA molecule of any one of aspects 32-34, wherein the double-stranded RNA of the first recombinant nucleic acid comprises a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA, and wherein the double-stranded RNA of the second recombinant nucleic acid comprises a fir st strand that hybridizes to a target CUG repeat region of a CUG repeat-containing RNA.

[0348] Aspect 37. The DNA molecule of aspect 35 or aspect 36, wherein the double-stranded RNA of the recombinant nucleic acid targeting a CAG repeat-containing RNA comprises:

[0349] a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat containing RNA; and

[0350] b) a second strand that hybridizes to the first strand,

[0351] wherein the first strand comprises:

[0352] i) a first mismatch to the target CAG repeat region; and

[0353] ii) at least a second mismatch to the target CAG repeat region,

[0354] wherein:

[0355] i) when the first mismatch is at position 8 based on the numbering of SEQ ID NO:4 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:4)), SEQ ID NO:5 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:5)), or SEQ ID NO:6 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:6)), the second mismatch is from 1 to 13 bases 3’ of the first mismatch;

[0356] ii) when the first mismatch is at position 9 based on the numbering of SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6, the second mismatch is from 1 to 12 bases 3’ of the first mismatch;

[0357] iii) when the first mismatch is at position 10 based on the numbering of SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6, the second mismatch is from 1 to 11 bases 3’ of the first mismatch; and

[0358] iv) when the first mismatch is at position 11 based on the numbering of SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6, the second mismatch is from 1 to 10 bases 3’ of the fust mismatch.

[0359] Aspect 38. The DNA molecule of aspect 37, wherein each mismatch is generated by a substitution that is independently selected from:

[0360] a) a substitution of a G with an A, a U, or a C;

[0361] b) a substitution of a U with an A, a G, or a C;

[0362] c) a substitution of C with an A, a U, or a G.

[0363] Aspect 39. The DNA molecule of aspect 37 or aspect 38, wherein the first strand of the double-stranded RNA of the recombinant nucleic acid targeting a CAG repeat-containing RNA comprises no more than 2 mismatches with the target CUG repeat region of a CUG repeatcontaining RNA.

[0364] Aspect 40. The DNA molecule of aspect 37 or aspect 38, wherein the first strand of the double-stranded RNA of the recombinant nucleic acid targeting a CAG repeat-containing RNA comprises no more than 3 mismatches with the target CUG repeat region of a CUG repeatcontaining RNA.

[0365] Aspect 41. The DNA molecule of aspect 37 or aspect 38, wherein the first strand of the double-stranded RNA of the recombinant nucleic acid targeting a CAG repeat-containing RNA comprises no more than 4 mismatches with the target CUG repeat region of a CUG repeatcontaining RNA.

[0366] Aspect 42. The DNA molecule of aspect 37 or aspect 38, wherein the first strand of the double-stranded RNA of the recombinant nucleic acid targeting a CAG repeat-containing RNA comprises no more than 5 mismatches with the target CUG repeat region of a CUG repeatcontaining RNA.

[0367] Aspect 43. The DNA molecule of any one of aspects 37-42, wherein the first strand of the double-stranded RNA of the recombinant nucleic acid targeting a CAG repeat-containing RNA comprises two mismatches to the target repeat region, and wherein the second mismatch is within nucleotides 8-1 1 , based on the numbering of any one of SEQ ID NOs:4-6.

[0368] Aspect 44. The DNA molecule of any one of aspects 37-42, wherein the first strand of the double-stranded RNA of the recombinant nucleic acid targeting a CAG repeat-containing RNA comprises two mismatches to the target repeat region, and wherein the second mismatch is not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:4-6.

[0369] Aspect 45. The DNA molecule of any one of aspects 37-42, wherein the first strand of the double-stranded RNA of the recombinant nucleic acid targeting a CAG repeat-containing RNA comprises three mismatches to the target repeat region, and wherein the second and the third mismatches are within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:4-6.

[0370] Aspect 46. The DNA molecule of any one of aspects 37-42, wherein the first strand of the double-stranded RNA of the recombinant nucleic acid targeting a CAG repeat-containing RNA comprises three mismatches to the target repeat region, wherein the second mismatch is within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:4-6, and wherein the third mismatch is not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:4-6.

[0371] Aspect 47. The DNA molecule of any one of aspects 37-42, wherein the first strand of the double-stranded RNA of the recombinant nucleic acid targeting a CAG repeat-containing RNA comprises three mismatches to the target repeat region, and wherein the second and the third mismatches are not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:4-6.

[0372] Aspect 48. The DNA molecule of any one of aspects 37-42, wherein the first strand of the double-stranded RNA of the recombinant nucleic acid targeting a CAG repeat-containing RNA comprises four mismatches to the target repeat region, and wherein the second, third, and fourth mismatches are within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:4-6.

[0373] Aspect 49. The DNA molecule of any one of aspects 37-42, wherein the first strand of the double-stranded RNA of the recombinant nucleic acid targeting a CAG repeat-containing RNA comprises four mismatches to the target repeat region, wherein the second mismatch is within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:4-6, and wherein the third and fourth mismatches are not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:4-6.

[0374] Aspect 50. The DNA molecule of any one of aspects 37-42, wherein the first strand of the double-stranded RNA of the recombinant nucleic acid targeting a CAG repeat-containing RNA comprises four mismatches to the target repeat region, wherein the second and thirdmismatches are within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:4-6, and wherein the fourth mismatch is not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:4-6.

[0375] Aspect 51. The DNA molecule of any one of aspects 37-42, wherein the first strand of the double-stranded RNA of the recombinant nucleic acid targeting a CAG repeat-containing RNA comprises four mismatches to the target repeat region, and wherein the second, third, and fourth mismatches are not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:4-6.

[0376] Aspect 52. The DNA molecule of any one of aspects 37-42, wherein the at least a second mismatch is within nucleotides 12-21, based on the numbering of any one of SEQ ID NOs:4-6.

[0377] Aspect 53. The DNA molecule of any one of aspects 37-52, wherein the second strand is 100% complementary to the first strand.

[0378] Aspect 54. The DNA molecule of any one of aspects 37-52, wherein the second strand comprises from 1 to 10 mismatches, from 3 to 5 mismatches, from 4 to 7 mismatches, or from 5 to 10 mismatches, to the first strand.

[0379] Aspect 55. The DNA molecule of any one of aspects 37-54, wherein the double-stranded RNA has a length of from 18 bases to 25 nucleotides, from 19 to 25 nucleotides, from 19 to 23 nucleotides, or from 19 to 22 nucleotides.

[0380] Aspect 56. The DNA molecule of any one of aspects 37-54, wherein the double-stranded RNA has a length of from 21 nucleotides to 25 nucleotides.

[0381] Aspect 57. The DNA molecule of any one of aspects 37-54, wherein the double-stranded RNA has a length of 21 nucleotides.

[0382] Aspect 58. The DNA molecule of any one of aspects 37-57, wherein the double-stranded RNA comprises one or more of: a) a base modification; b) a sugar modification; and c) a backbone modification.

[0383] Aspect 59. A recombinant expression vector comprising the DNA molecule of any one of aspects 27-58.

[0384] Aspect 60. The recombinant expression vector of aspect 59, wherein the nucleotide sequence is operably linked to a promoter that is functional in a eukaryotic cell.

[0385] Aspect 61. The recombinant expression vector of aspect 60, wherein the promoter is an RNA polymerase II promoter or an RNA polymerase III promoter.

[0386] Aspect 62. The recombinant expression vector of aspect 60 or aspect 61, wherein the promoter is a CAG promoter, a CBA promoter, a CMV promoter, a U6 promoter, an EFla promoter, or an H1 promoter.

[0387] Aspect 63. The recombinant expression vector of any one of aspects 59-62, wherein the recombinant expression vector comprises a 5' adeno- associated virus (AAV) inverted terminal repeat (ITR) sequence and a 3’ AAV ITR sequence.

[0388] Aspect 64. A recombinant expression vector comprising a nucleotide sequence encoding the recombinant nucleic acid of aspect 26. aspect 27, or any one of aspects 28-58.

[0389] Aspect 65. The recombinant expression vector of aspect 64, wherein the nucleotide sequence is operably linked to a promoter that is functional in a eukaryotic cell.

[0390] Aspect 66. The recombinant expression vector of aspect 65, wherein the promoter is an RNA polymerase II promoter or an RNA polymerase III promoter.

[0391] Aspect 67. The recombinant expression vector of aspect 64 or aspect 65, wherein the promoter is a CAG promoter, a CBA promoter a CMV promoter, a U6 promoter, an EFla promoter, or an Hl promoter.

[0392] Aspect 68. The recombinant expression vector of any one of aspects 63-67, wherein the recombinant expression vector comprises a 5’ adeno- associated virus (AAV) inverted terminal repeat (ITR) sequence and a 3’ AAV ITR sequence.

[0393] Aspect 69. A conjugate comprising:

[0394] a) a double-stranded RNA of any one of aspects 1-23; and

[0395] b) one or more non-nucleic acid moieties conjugated, directly or via a linker, to one or both strands of the double-stranded RNA, at one or both terminal positions or at one or more internal positions.

[0396] Aspect 70. The conjugate of aspect 69, wherein the one or more non-nucleic acid moieties is or comprises a lipophilic moiety.

[0397] Aspect 71 . The conjugate of aspect 70, wherein the lipophilic moiety is a lipid, cholesterol, retinoic acid, cholic acid, adamantane acetic acid, hexadecyl, 1 -pyrene butyric acid, dihydrotestosterone, l,3-bis-O(hexadecyl)glycerol, geranyloxyhexanol, hexadecylglycerol, borneol, menthol, 1,3-propandediol, a heptadecyl group, palmitic acid, myristic acid, 03- (oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, docosanoic acid (DCA), eicosapentaenoic acid (EPA), a dendrimer, dimethoxy trityl, or phenoxazine.

[0398] Aspect 72. The conjugate of aspect 70, wherein the lipophilic moiety comprises a saturated or unsaturated C4-C30 hydrocarbon chain or saturated or unsaturated hydrocarbon chain longer than 30, and an optional functional group selected from the group consisting of a hydroxyl, an amine, a carboxylic acid, a sulfonate, a phosphate, a thiol, an azide, and an alkyne.

[0399] Aspect 73. The conjugate of aspect 72, wherein the lipophilic moiety contains a saturated or unsaturated G.-Cix hydrocarbon chain, C6-C22 hydrocarbon chain, a C22 hydrocarbon chain, or hydrocarbon chain longer than C 2.

[0400] Aspect 74. The conjugate of aspect 73, wherein the lipophilic moiety contains a saturated or unsaturated Ci6 hydrocarbon chain.

[0401] Aspect 75. The conjugate of any one of aspects 69-74, wherein the lipophilic moiety is conjugated, directly or via a linker, to a nucleobase, a sugar moiety, or an internucleoside linkage in the double-stranded RNA, optionally wherein the lipophilic moiety is linked to the first or the second strand, further optionally wherein the lipophilic moiety is linked to a 2'-O of a sugar moiety at a terminal position and / or internal position in the first strand, the second strand or both strands.

[0402] Aspect 76. A delivery vehicle comprising the recombinant expression vector of any one of aspects 59-68.

[0403] Aspect 77. The delivery vehicle of aspect 76, wherein the delivery vehicle is a non-viral delivery vehicle.

[0404] Aspect 78. The delivery vehicle of aspect 77, wherein the delivery vehicle is a lipid nanoparticle.

[0405] Aspect 79. The delivery vehicle of aspect 77, wherein the delivery vehicle is a viral particle.

[0406] Aspect 80. A delivery vehicle comprising the double-stranded RNA of any one of aspects 1-23.

[0407] Aspect 81. The delivery vehicle of aspect 80, wherein the double-stranded RNA comprises a covalently linked lipid moiety, wherein the lipid moiety is linked to the first or the second strand, further optionally wherein the lipid moiety is linked to a 2'-0 of a sugar moiety at a terminal position and / or internal position in the first strand and / or the second strand or a phosphate group at a terminal nucleotide in the first strand and / or the second strand.

[0408] Aspect 82. The delivery vehicle of aspect 81 , wherein the covalently linked lipid moiety comprises a palmityl moiety, palmitoyl moiety, docosanoic acid (DCA), docosanyl moiety, eicosapentaenoic acid (EP A), eicosepentaenyl moiety, or a dendrimer, optionally wherein the dendrimer comprises the dendrimer of Fig. 12, further optionally, wherein the lipid moiety is linked directly or via a linker to (i) 2'-0 of a sugar moiety at a terminal position and / or internal position in the first strand and / or the second strand or (ii) a phosphate group at a terminal position in the first strand and / or the second strand.

[0409] Aspect 83. The delivery vehicle of any one of aspects 80-82, wherein the delivery vehicle is a lipid nanoparticlc.

[0410] Aspect 84. A delivery vehicle comprising the conjugate of any one of aspects 69-75.

[0411] Aspect 85. A viral particle comprising the recombinant expression vector of any one of aspects 59-68.

[0412] Aspect 86. The viral particle of aspect 85, wherein the viral particle is an adeno- associated virus (AAV) particle.

[0413] Aspect 87. The viral particle of aspect 86, wherein the AAV particle comprises an AAV9 capsid.

[0414] Aspect 88. The viral particle of aspect 86, wherein the AAV particle comprises an AAV2 capsid.

[0415] Aspect 89. A composition comprising: a) the double- stranded RNA of any one of claims 1-22 or the recombinant expression vector of any one of aspects 59-68; and b) a pharmaceutically acceptable excipient.

[0416] Aspect 90. A composition comprising: a) the delivery vehicle of any one of aspects 76- 84; and b) a pharmaceutically acceptable excipient.

[0417] Aspect 91. A composition comprising: a) a viral particle of any one of aspects 85-88; and b) a pharmaceutically acceptable excipient.

[0418] Aspect 92. A composition comprising: a) a conjugate of any one of aspects 69-75; and b) a pharmaceutically acceptable excipient.

[0419] Aspect 93. A method for selectively reducing the translation and / or accumulation of a disease-associated CUG repeat-containing RNA and / or a disease-associated CAG repeatcontaining RNA produced by transcription of a CTG repeat expansion gene in an individual having a CTG repeat expansion disorder, the method comprising administering to the individual an effective amount of the double-stranded RNA of any one of claims 1-22, the expression vector of any one of aspects 59-68, delivery vehicle of any one of aspects 76-84, the viral particle of any one of aspects 85-88, or the composition of any one of aspects 89-71.

[0420] Aspect 94. The method of aspect 93, wherein the CTG repeat expansion disorder is Huntington disease-like 2, myotonic dystrophy type 1 , Fuchs endothelial corneal dystrophy, or Spinocerebellar ataxia type 8.

[0421] Aspect 95. The method of aspect 92 or aspect 93, wherein said administering comprises delivery to the eye, muscle, heart, lungs, red blood cells, and / or central nervous system of the individual.

[0422] Aspect 96. The method of any one of aspects 93-95, wherein the injection is intracamcral, intravitrcal, subrctinal, topical, intramuscular, intravenous, intracerebral ventricular injection, intraparenchymal injection, intrathecal injection, intrastriatal injection, intrathalamic injection, intracisternal magna injection, subpial injection, or any combination thereof.

[0423] Aspect 97. The method of any one of aspects 93-96, wherein said administering reduces the number of cells containing toxic foci by at least 10%, compared to the number of cells containing toxic foci in the individual before said administering.

[0424] Aspect 98. A method of heating a CTG repeat expansion disorder in an individual, the method comprising administering to the individual an effective amount of the double-stranded RNA of any one of claims 1-22, the expression vector of any one of aspects 59-68, delivery vehicle of any one of aspects 76-84, the viral particle of any one of aspects 85-88, or the composition of any one of aspects 89-92.

[0425] Aspect 99. A method for selectively reducing the hanslation and / or accumulation of a disease-associated CUG repeat-containing RNA and / or a disease-associated CAG repeatcontaining RNA produced by transcription of a CAG repeat expansion gene in an individual having a CAG repeat expansion disorder, the method comprising administering to the individual an effective amount of the double-stranded RNA of any one of claims 1-22, the expression vector of any one of aspects 59-68, delivery vehicle of any one of aspects 76-84, the viral particle of any one of aspects 85-88, or the composition of any one of aspects 89-92.

[0426] Aspect 100. The method of aspect 99, wherein the CAG repeat expansion disorder is Huntington’s disease, spinocerebellar ataxia type 1, spinocerebellar ataxia type 2, spinocerebellar ataxia type 3, spinocerebellar ataxia type 6, spinocerebellar ataxia type 7, spinocerebellar ataxia type 12, spinocerebellar ataxia type 17, spinal and bulbar muscular atrophy, dentatorubral pallidoluysian atrophy, amyotrophic lateral sclerosis, myotonic dystrophy type 1, Fuchs’ endothelial corneal dystrophy, branchi ootorenal syndrome 2, or cleidocranial dysplasia.

[0427] Aspect 101. The method of aspect 98 or aspect 99, wherein said administering comprises delivery to central nervous system of the individual.

[0428] Aspect 102. The method of aspect 101, wherein the administering comprises intraventricular injection, intrathecal injection, intrastriatal injection, intrathalamic injection, intracisternal magna injection, subpial injection, or any combination thereof.

[0429] Aspect 103. A method of treating a CAG repeat expansion disorder in an individual, the method comprising administering to the individual an effective amount of the double-stranded RNA of any one of claims 1-22, the expression vector of any one of aspects 59-68, deliveryvehicle of any one of aspects 76-84, the viral particle of any one of aspects 85-88, or the composition of any one of aspects 89-92.EXAMPLES

[0430] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention nor are they intended to represent that the experiments below are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g. amounts, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Celsius, and pressure is at or near atmospheric. Standard abbreviations may be used, e.g., bp, base pair(s); kb, kilobase(s); pl, picoliter(s); s or sec, second(s); min, minute(s); h or hr, hour(s); aa, amino acid(s); kb, kilobase(s); bp, base pair(s); nt, nucleotide(s); i.m., intramuscular(ly); i.p., intraperitoneal(ly); s.c., subcutaneous(ly); and the like.Example 1: Reduction of CTG repeat-associated translation with repeat-targeting small binding RNAs (sbRNAs) in a fluorescence-based model system

[0431] Guide sequence candidates were generated to systematically evaluate the effect of the sequence, number, and position of mismatches, as well as the starting position of the guide within the repeat (i.e. CAG, AGC, or GCA). Guide sequences containing double mismatches, where at least one mismatch is located in position 8, 9, 10 or 11, and the second mismatch is located between the first mismatch and position 21, were generated. Triple and quadruple mismatches, where the second mismatch is within nucleotides 9-21, the third mismatch is within nucleotides 10-21, the fourth mismatch is within nucleotides 11-21 were also generated.

[0432] In silica analyses were conducted to remove guide sequences that have the potential for deleterious off-target effects. Guide sequences were selected if the following criteria for off-target genes are met: (1) 0 off-target genes containing fully complementary sequence to guide sequence within positions 1-21; (2) < 3 off-target genes containing fully complementary 17mer within guide sequence positions 1-21; (3) If off-target gcnc(s) contain fully complementary 17mcr: i) Off-target gcnc(s) cannot be tumor suppressor gene(s), essential genes (708 genes identified from three independent studies (Wang et al. (2015) Science 350:6264; Hart et al. (2015) Cell 163:1515; Blomen et al. (2015) Science 350:6264]), or housekeeping genes (Hounkpe et al. (2021) Nucl. Acids. Res. 49:D947; Eisenberg and Levanon (2013) Trends Genet. 29:569), ii) Off-target gene(s) cannot have high expression in the eye, smooth muscle, or skeletal muscle relative to all other genes; specifically, if sbRNA guide sequence hasa perfect seed match, and TPM (transcript per million) of off-target gene >1, expression values should not be > Q3 (corresponding to the upper quartile, highest cut off (25%) of data) relative to all expressed genes in the eye, smooth muscle, or skeletal muscle. If expression values are > Q3, but TPM < 10, an off-target analysis by Western-blot is required. If sequence does not have a perfect seed match but has TPM >_1 and expression values > Q3 relative to all expressed genes in the eye, smooth muscle, or skeletal muscle, Western-blot analysis is required for TPM < 10. If the sbRNA guide sequence does not have a perfect seed match, and expression values of off-target genes are not > Q3 relative to all expressed genes in the tissues listed above, the sbRNA is selected for follow up cloning.

[0433] 171 CTG-targeting guide sequence candidates that passed the in silica analysis were embedded within the miR-33 scaffold, synthesized, and cloned into a custom mammalian expression plasmid that contains a U6 promoter driving the sbRNA and a human CMV promoter driving DsRed2. Of the guide sequences synthesized, there were 14 CTG-targeting guide sequences with 2 mismatches, 50 CTG-targeting guide sequences with 3 mismatches, and 107 CTG-targeting guide sequences with 4 mismatches.

[0434] To evaluate the ability of CTG repeat-targeting sbRNAs to block translation, cells were transfected with 12.5 ng of a plasmid containing 100 CTG repeats in the 3’ UTR of a fluorescent reporter (green fluorescent protein; GFP) and 50 ng plasmid containing a fluorescent reporter (dsRed2) and the CTG-targeting guide sequence.

[0435] Fluorescence assays were established and performed by transfecting the HEK293T cells on 96- well plates (20,000 cells / well) with 50 ng indicated sbRNA-expressing plasmid and 12.5 ng of the fluorescent GFP reporter containing 100 CTG repeats using Lipofectamine 3000. Seventy-two hours after transfection, fluorescence was measured via flow cytometry to determine the knockdown efficiency of the designed sbRNAs.

[0436] Cells were first gated for forward scatter area (FSC-A) and side-scatter area (SSC-A) to isolate the cell population. That population was further gated on SSC-A and side-scatter height (SSC-H) to isolate single cells. Using an untransfected control cell population, populations for DsRed2 and GFP positive cells were established. Cells that were positive for DsRed2 were measured for the mean fluorescence of GFP containing cells. The mean fluorescence was normalized to a scramble control (CGAGGGCGACUUAACCUUAGG; SEQ ID NO:527). Flow cytometry experiments were performed a minimum of three times and statistical analysis was performed using multiple t-tests comparing the average GFP fluorescence intensity for each sbRNA compared to the negative (scramble) control. The positive control miRNA targeting the GFP sequence was expected to result in -85% decrease in GFP fluorescence (corresponding to the effect of the 3’ untranslated region (UTR) on translation).

[0437] A significant (p < 0.05) reduction in GFP fluorescence intensity was observed for 108 of the 171 CTG-targcting guide sequences evaluated (FIG. 5). Overall, guide sequences containing three or four mismatches showed the most potent knock-down of GFP fluorescence. 15 CTG-targeting guide sequences (Table 1) were identified as the top candidates, based on the following criteria: 1) mean GFP fluorescence activity < 61% of scramble control, 2) biological coefficient of variance (CV) <50%, 3) significant decreases (p < 0.05) in GFP fluorescence activity relative to negative (scramble) control. A significant reduction in GFP fluorescence intensity compared to the negative control was observed for guides which started with any of the possible registers: CAG, AGC, or GCA. A significant reduction due to starting site of the guide was found for guides which started with CAG and AGC relative to guides that started with GCA. Table 1: mm = mismatches.Table 1 (SEQ ID NOs:19, 528-534, 18, and 535-539, respectively)

[0438] The GFP fluorescence knockdown normalized to scramble following transfection with the guide sequences set out in Table 1 are shown in FIG. 6.Example 2: Reduction of CTG and CAG repeat-associated translation with repeat-targeting small binding RNAs (sbRNAs) in a fluorescence-based model system

[0439] Therapeutic candidates were generated to deliver two sbRNA sequences from miRNA scaffolds (Table 3). The scaffolds were designed in different orientations such that the “tandem” orientation results in two sbRNA sequences transcribed from a single promoter, and the “dual” orientation results in two sbRNA sequences transcribed from two separate promoters. The guidesequences in Table 1 were combined with the guide sequences in Table 2 to generate 225 possible candidates.Table 2 (SEQ ID NOs:540-544)

[0440] Fluorescence-based assays are established and performed as described in Example1. Cells are first gated to determine the Dsred2 positive population. Average GFP fluorescence intensity values are then normalized to scramble control (CGAGGGCGACUUAACCUUAGG; SEQ ID NO:527). Flow cytometry experiments are performed a minimum of three times and statistical analysis is performed using multiple t-tests comparing the average GFP fluorescence intensity for each sbRNA compared to the negative (scramble) control for both 100 CTG and 100 CAG repeats. The positive control miRNA targeting the GFP sequence is expected to result in -85% decrease in average GFP fluorescence intensity.

[0441] The top combinations will be identified based on the following criteria: 1) mean GFP fluorescence intensity < 61% of scramble control for 100 CTG repeats, 2) mean GFP fluorescence intensity < 61% of scramble control for 100 CAG repeats, 3) biological coefficient of variance (CV) <50%, 4) significant decreases (p < 0.05) in GFP fluorescence intensity relative to scramble control.Table 3Example 3: Reducing TCF4 foci detection - while preserving TCF4 mRNA levels - in FECD patient corneal endothelial cells in vitro

[0442] AAV vectors containing nucleotide sequences encoding an sbRNA arc produced using standard methods. FECD patient corneal endothelial cells and immortalized corneal endothelial cell lines are infected with the AAV particles, and the sbRNAs are produced in the transduced cells. Ten days afterinfection, foci levels are measured by RNA in situ hybridization (RNA-ISH) using probes complementary to the CAG and CTG trinucleotide repeats. TCF4 mRNA levels are measured by RNA- Seq.Example 4: Reducing DMPK foci detection in DM1 patient-derived fibroblasts in vitro

[0443] AAV vectors containing nucleotide sequences encoding an sbRNA are produced using standard methods. DM1 patient fibroblasts are infected with the AAV particles, and the sbRNAs are produced in the fibroblasts. Ten days after infection, foci levels are measured by RNA-ISH using probes complementary to the CAG and CTG trinucleotide repeats, and DMPK mRNA levels are measured by RNA-Seq.Example 5: Reduction of TCF4 associated RNA foci and splicing changes in vivo in a Repeat Expansion mouse model of FECD

[0444] DNA expression cassettes comprising nucleotide sequences encoding sbRNAs targeting the CTG and / or CAG repeats, where the nucleotide sequences are operably linked to a U6 promoter, are packaged into an AAV9 capsid to produce recombinant AAV9. Recombinant virus comprising the recombinant AAV9 capsid is produced using dual transfection into mammalian cells and purified by column purification. Recombinant virus is formulated in an isotonic, physiological pH buffer consisting of histidine, sodium chloride, trehalose, and poloxamcr 188. Recombinant AAV vectors arc titered using digital droplet PCR (ddPCR). As a negative control, formulation vehicle is delivered to one group of transgenic mice and one group of wild-type littermates.

[0445] The vector preparation is administered via intracameral (into the anterior chamber of the eye) injection into anesthetized male and female TCF4 expansion containing mice and wild-type littermates at or about 3 months of age. Approximately 2.0 pL volume of test ar ticle is delivered to either one or both eyes.

[0446] Body weights of animals are taken at baseline to ensure even distribution between treatment groups. Weights are then assessed once per week until the time of tissue collection when animals ar e weighed before being collected. Measures of corneal thickness and corneal endothelial cell density are among the measurements collected to assess corneal health and function.

[0447] Four or eight weeks after injections, animals are euthanized, and tissues are harvested. Eyes, brains, optic nerves, and optic tracts are harvested for analysis. Brains, optic nerves, optic tracts, and some eyes are analyzed for vector biodistribution, sbRNA expression and splicing analyses. These tissues are collected as flash frozen or immersed in an RNA preservative such as RNALater.

[0448] Remaining eyes will be immersed in fixative for histological analysis via cross section and flat mount. Histological analyses include corneal cell density, presence of RNA foci and endothelial morphology.Example 6: Safety and tolerability in a wild type mouse of an sbRNA directed against repeat expansions in the TCF4 gene

[0449] DNA expression cassettes comprising nucleotide sequences encoding sbRNAs targeting the CTG and / or CAG repeats, where the nucleotide sequences are operably linked to a U6 promoter, are packaged into an AAV9 capsid to produce recombinant AAV9. Recombinant virus comprising the recombinant AAV9 capsid is produced using dual transfection into mammalian cells and purified by column purification. Recombinant virus is formulated in an isotonic, physiological pH buffer consisting of histidine, sodium chloride, trehalose, and poloxamer 188. Recombinant AAV vectors are titered using digital droplet PCR (ddPCR). As a negative control, formulation vehicle is delivered to one group of wild- type littermates.

[0450] The vector preparation is administered via intracameral (into the anterior chamber of the eye) injection into anesthetized male and female wild type mice at or about 3 months of age at various concentrations. Approximately 2.0 pL volume of test article is delivered to either one or both eyes.

[0451] Body weights of animals are taken at baseline to ensure even distribution between treatment groups. Weights are then assessed once per week until the time of tissue collection when animals are weighed before being collected. Measures of corneal thickness and corneal endothelial cell density are among the measurements collected to assess corneal health and function. Periodic ophthalmic exams will be conducted which may include indirect ophthalmoscopy, slit-lamp biomicroscopy, ocular scoring, intraocular pressure, optical coherence tomography and electroretinography .

[0452] Four or eight weeks after injections, animals are euthanized, and tissues are harvested. Eyes, brains, optic nerves, and optic tracts are harvested for analysis. Brains, optic nerves, optic tracts, and some eyes are analyzed for vector biodistribution, sbRNA expression and splicing analyses. These tissues are collected as flash frozen or immersed in an RNA preservative such as RNALater.

[0453] Remaining eyes will be immersed in fixative for histological analysis via cross section and flat mount. Histological analyses include corneal cell density, endothelial morphology and hematoxylin and eosin staining.Example 7: Reduction of CTG repeat associated RNA foci and splicing changes in vivo in the HSA(LR) mouse model of Myotonic Dystrophy Type 1 (DM1)

[0454] DNA expression cassettes comprising nucleotide sequences encoding sbRNAs targeting the CUG and / or CAG repeats, where the nucleotide sequences are operably linked to a U6 promoter, are packaged into an AAV9 capsid to produce recombinant AAV9. Recombinant virus comprising the recombinant AAV9 capsid is produced using dual transfection into mammalian cells and purified by column purification. Recombinant virus is formulated in an isotonic, physiological pH buffer consisting of histidine, sodium chloride, trehalose, and poloxamer 188. Recombinant AAV vectors are titered using digital droplet PCR (ddPCR). As a negative control, formulation vehicle is delivered to one group of transgenic mice and one group of wild-type littermates.

[0455] The vector preparation is administered via intravenous or intramuscular injection into anesthetized or immobilized male and female HSA(LR) expansion containing mice and wild-type littermates at or about 1 month of age. Up to 200 LIL volume of test article is delivered intravenously or up to 25 pL is delivered intramuscularly into the gastrocnemius or similar skeletal muscle.

[0456] Body weights of animals are taken at baseline to ensure even distribution between treatment groups. Weights are then assessed once per week until the time of tissue collection when animals ar e weighed before being collected. Electromyography (EMG) is used to assess myotonia due to the presence of expanded repeat containing RNA. Behavioral assessments, such as open field, may be collected to determine therapeutic efficacy.

[0457] Four or eight weeks after injections, animals are euthanized, and tissues are harvested. Skeletal muscles, heart and liver are analyzed for vector biodistribution, sbRNA expression, and splicing analyses. These tissues are collected as flash frozen or immersed in an RNA preservative such as RNALater.

[0458] Additional skeletal muscles will be collected for histological analysis. In some cases, muscles will be collected as formalin fixed and paraffin embedded samples. In other cases, skeletal muscle is collected as flash frozen in liquid nitrogen cooled isopentane, then analyzed as frozen sections. Histological analyses may include hematoxylin and eosin and labeling for muscle blind (Mbnll ).Example 8: Safety and tolerability in a wild-type mouse of an sbRNA directed against repeat expansions in the DMPK gene

[0459] DNA expression cassettes comprising nucleotide sequences encoding sbRNAs targeting the CUG and / or CAG repeats, where the nucleotide sequences are operably linked to a U6 promoter, are packaged into an AAV9 capsid to produce recombinant AAV9. Recombinant virus comprising the recombinant AAV9 capsid is produced using dual transfection into mammalian cells and purified bycolumn purification. Recombinant virus is formulated in an isotonic, physiological pH buffer consisting of histidine, sodium chloride, trehalose, and poloxamer 188. Recombinant AAV vectors are titered using digital droplet PCR (ddPCR). As a negative control, formulation vehicle is delivered to one group of wild- type littermates.

[0460] The vector preparation is administered via intravenous or intramuscular injection into anesthetized or immobilized male and female wild-type mice at or about 1 month of age. Up to 200 pL volume of test article is delivered intravenously or up to 25 pL is delivered intramuscularly into the gastrocnemius or similar skeletal muscle.

[0461] Body weights of animals are taken at baseline to ensure even distribution between treatment groups. Weights are then assessed once per week until the time of tissue collection when animals are weighed before being collected. Electromyography (EMG) is used to assess muscle health and test for signs of treatment induced toxicity.

[0462] 1 to 6 months after injections, animals are euthanized, and tissues are harvested. Skeletal muscles, heart and liver are analyzed for vector biodistribution, and sbRNA expression. These tissues are collected as flash frozen or immersed in an RNA preservative such as RNALater.

[0463] Additional skeletal muscles will be collected for histological analysis. In some cases, muscles will be collected as formalin fixed and paraffin embedded samples. In other cases, skeletal muscle is collected as flash frozen in liquid nitrogen cooled isopentane, then analyzed as frozen sections. Histological analyses may include hematoxylin and eosin and labeling for muscle blind (Mbnll).

[0464] While the present invention has been described with reference to the specific embodiments thereof, it should be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the true spirit and scope of the invention. In addition, many modifications may be made to adapt a particular situation, material, composition of matter, process, process step or steps, to the objective, spirit and scope of the present invention. All such modifications are intended to be within the scope of the claims appended hereto.

Claims

CLAIMSWhat is claimed is:

1. A double-stranded RNA comprising: a) a first strand that hybridizes to a target CUG repeat region of a CUG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target CUG repeat region; and ii) at least a second mismatch to the target CUG repeat region, wherein: i) when the first mismatch is at position 8 based on the numbering of SEQ ID NO:1(CAGCAGCAGCAGCAGCAGC G; SEQ ID NO:1), SEQ ID NO:2(AGCAGCAGCAGCAGCAGCAGC; SEQ ID NO:2) or SEQ ID NOG(GCAGCAGCAGCAGCAGCAGCA; SEQ ID NOG), the second mismatch is from 1 to 13 bases 3' of the first mismatch, ii) when the first mismatch is at position 9 based on the numbering of SEQ ID NO:1, 2, or 3, the second mismatch is from 1 to 12 bases 3’ of the first mismatch; iii) when the first mismatch is at position 10 based on the numbering of SEQ ID NO:1, 2, or3, the second mismatch is from 1 to 11 bases 3’ of the first mismatch; and iv) when the first mismatch is at position 11 based on the numbering of SEQ ID NO:1, 2, or3, the second mismatch is from 1 to 10 bases 3' of the first mismatch.

2. The double-stranded RNA of claim 1 , wherein each mismatch is generated by a substitution that is independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a C with an A, a U, or a G; c) a substitution of an A with a U, a C, or a G.

3. The double-stranded RNA of claim 1 or claim 2, wherein the first strand comprises no more than 2 mismatches with the target CUG repeat region of a CUG repeat-containing RNA.

4. The double-stranded RNA of claim 1 or claim 2, wherein the first strand comprises no more than 3 mismatches with the target CUG repeat region of a CUG repeat-containing RNA.

5. The double-stranded RNA of claim 1 or claim 2, wherein the first strand comprises no more than 4 mismatches with the target CUG repeat region of a CUG repeat-containing RNA.

6. The double-stranded RNA of claim 1 or claim 2, wherein the first strand comprises no more than 5 mismatches with the target CUG repeat region of a CUG repeat-containing RNA.

7. The double-stranded RNA of any one of claim 1-6, wherein the first strand comprises two mismatches to the target repeat region, and wherein the second mismatch is within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-3.

8. The double-stranded RNA of any one of claim 1-6, wherein the first strand comprises two mismatches to the target repeat region, and wherein the second mismatch is not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-3.

9. The double-stranded RNA of any one of claim 1-6, wherein the first strand comprises three mismatches to the target repeat region, and wherein the second and the third mismatches are within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-3.

10. The double-stranded RNA of any one of claim 1-6, wherein the first strand comprises three mismatches to the target repeat region, wherein the second mismatch is within nucleotides 8- 11 , based on the numbering of any one of SEQ ID NOs:l -3, and wherein the third mismatch is not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-3.

11. The double-stranded RNA of any one of claim 1-6, wherein the first strand comprises three mismatches to the target repeat region, and wherein the second and the third mismatches are not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-3.

12. The double-stranded RNA of any one of claim 1-6, wherein the first strand comprises four mismatches to the target repeat region, and wherein the second, third, and fourth mismatches are within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-3.

13. The double-stranded RNA of any one of claim 1-6, wherein the first strand comprises four mismatches to the target repeat region, wherein the second mismatch is within nucleotides 8- 11, based on the numbering of any one of SEQ ID NOs:l-3, and wherein the third and fourthmismatches are not within nucleotides 8-11, based on the numbering of any one of SEQ IDNOs:l-3.

14. The double-stranded RNA of any one of claim 1-6, wherein the first strand comprises four mismatches to the target repeat region, wherein the second and third mismatches are within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-3, and wherein the fourth mismatch is not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-3.

15. The double-stranded RNA of any one of claim 1-6, wherein the first strand comprises four mismatches to the target repeat region, and wherein the second, third, and fourth mismatches are not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:l-3.

16. The double-stranded RNA of any one of claim 1-6, wherein at least a second mismatch is within nucleotides 12-21, based on the numbering of any one of SEQ ID NOs:l-3.

17. The double-stranded RNA of claim 1, wherein the first strand or the second strand comprises any one of the guide strand sequences depicted in FIG. 2, FIG. 3, FIG. 4A, FIG. 10A, FIG. 10C, FIG. 11A, FIG. 11C, wherein any T nucleotide in the guide strand sequences of FIG.2, FIG. 3, FIG. 4A, FIG. 10A, FIG. 10C, FIG. 11 A, FIG. 11C is a U nucleotide in the first strand or the second strand or wherein the first strand or the second strand comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 19, 528-534, 18, 535-539, 540- 544, 695, 699, wherein any T nucleotide in the nucleotide sequence is a U nucleotide in the first strand or the second strand, optionally, wherein the first strand or the second strand further comprises a 5’ U or a 5’ A or the first strand or the second strand further comprises a 5’ U or a 5’ A and a 3’ A or a 3’ AA.

18. The double-stranded RNA of any one of claims 1-17, wherein the second strand is 100% complementary to the first strand.

19. The double-stranded RNA of any one of claims 1-17, wherein the second strand comprises from 1 to 10 mismatches, from 3 to 5 mismatches, from 4 to 7 mismatches, or from 5 to 10 mismatches, to the first strand.

20. The double-str anded RNA of any one of claims 1-19, wherein the double-stranded RNA has a length of from 18 bases to 25 nucleotides, from 19 to 25 nucleotides, from 19 to 23 nucleotides, or from 19 to 22 nucleotides.

21. The double-stranded RNA of any one of claims 1-19, wherein the double-stranded RNA has a length of from 21 nucleotides to 25 nucleotides.

22. The double-stranded RNA of any one of claims 1-19, wherein the double-stranded RNA has a length of 21 nucleotides.

23. The double-stranded RNA of any one of claims 1-22, wherein the double-stranded RNA comprises one or more of: a) a base modification; b) a sugar modification; and c) a backbone modification.

24. A DNA molecule comprising a nucleotide sequence encoding the first strand as set forth in any one of claims 1-23, wherein the nucleotide sequence is operably linked to a promoter that is functional in a eukaryotic cell.

25. A recombinant nucleic acid comprising: al) the double-stranded RNA of any one of claims 1-23; and bl) a microRNA scaffold comprising a 5' flanking polynucleotide, a loop polynucleotide, and a 3’ flanking polynucleotide, wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the first strand of the double-stranded RNA; iii) the loop polynucleotide; iv) the second strand of the double-stranded RNA; and v) the 3’ flanking polynucleotide; wherein at least one of the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA; or a2) the double-stranded RNA of any one of claims 1-23; and b2) a microRNA scaffold comprising a 5’ flanking polynucleotide, a loop polynucleotide, and a 3’ flanking polynucleotide, wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the second strand of the double-stranded RNA; iii) the loop polynucleotide;iv) the first strand of the double-stranded RNA; and v) the 3’ flanking polynucleotide, where at least one of the 5’ flanking polynucleotide, the loop polynucleotide, and the 3' flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA; or a3) the double-stranded RNA of any one of claims 1-23; and b3) a microRNA scaffold comprising a 5’ flanking polynucleotide and a 3’ flanking polynucleotide, wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the first strand of the double-stranded RNA; iii) the second strand of the double-stranded RNA; and iv) the 3’ flanking polynucleotide; wherein one or both of the 5’ flanking polynucleotide and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA; or a4) the double-stranded RNA of any one of claims 1-23; and b4) a microRNA scaffold comprising a 5’ flanking polynucleotide and a 3’ flanking polynucleotide, wherein the recombinant nucleic acid comprises: i) the 5' flanking polynucleotide; ii) the second strand of the double-stranded RNA; iii) the first strand of the double-stranded RNA; and iv) the 3’ flanking polynucleotide; wherein one or both of the 5’ flanking polynucleotide and the 3’ flanking polynucleotide is heterologous to the first and / or the second strand of the double-stranded RNA.

26. The recombinant nucleic acid of claim 25, wherein the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide are derived from miR33, miR451, miR144, miRlOl, or miR126.

27. A DNA molecule comprising a nucleotide sequence encoding a recombinant nucleic acid according to claim 25 or claim 26.

28. The DNA molecule of claim 27, wherein the 5’ flanking polynucleotide is encoded by the nucleotide sequence: tgcacacctcctggcgggcagctctg (SEQ ID NO:516).

29. The DNA molecule of claim 28 or claim 29, wherein the loop polynucleotide is encoded by the nucleotide sequence: tgttctggcaatacctg (SEQ ID NO:517).

30. The DNA molecule of any one of claims 28-30, wherein the 3’ flanking polynucleotide is encoded by the nucleotide sequence: gggaggcctgccctgactgcccac (SEQ ID NO:518).

31. The DNA molecule of claim 27, wherein the DNA molecule comprises a nucleotide sequence depicted in FIG. 4A-4B or set forth in any one of SEQ ID NOs:349-515.

32. The DNA molecule of claim 30, wherein the DNA molecule comprises: a) a first nucleotide sequence encoding a fust recombinant nucleic acid according to claim 26 or claim 27 ; and b) a second nucleotide sequence encoding a second recombinant nucleic acid according to claim 26 or claim 27, wherein the first recombinant nucleic acid differs in nucleotide sequence from the second recombinant nucleic acid.

33. The DNA molecule of claim 32, wherein the first recombinant nucleic acid comprises a first microRNA scaffold, wherein the second recombinant nucleic acid comprises a second microRNA scaffold, and wherein the first microRNA scaffold differs in nucleotide sequence from the second microRNA scaffold.

34. The DNA molecule of claim 33, wherein the microRNA scaffold of the first recombinant nucleic acid has the same nucleotide sequence as the microRNA scaffold of the second recombinant nucleic acid.

35. The DNA molecule of any one of claims 32-34, wherein the double-stranded RNA of the fust recombinant nucleic acid comprises a first strand that hybridizes to a target CUG repeat region of a CUG repeat-containing RNA, and wherein the double-stranded RNA of the second recombinant nucleic acid comprises a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA.

36. The DNA molecule of any one of claims 32-34, wherein the double-stranded RNA of the first recombinant nucleic acid comprises a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA, and wherein the double-stranded RNA of the second recombinant nucleic acid comprises a first strand that hybridizes to a target CUG repeat region of a CUG repeat-containing RNA.

37. The DNA molecule of claim 35 or claim 36, wherein the double-stranded RNA of the recombinant nucleic acid targeting a CAG repeat-containing RNA comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat containing RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a fust mismatch to the target CAG repeat region; and ii) at least a second mismatch to the target CAG repeat region, wherein: i) when the first mismatch is at position 8 based on the numbering of SEQ ID NO:4 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:4)), SEQ ID NO:5 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:5)), or SEQ ID NO:6 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:6)), the second mismatch is from 1 to 13 bases 3’ of the first mismatch; ii) when the first mismatch is at position 9 based on the numbering of SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6, the second mismatch is from 1 to 12 bases 3’ of the first mismatch; iii) when the first mismatch is at position 10 based on the numbering of SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6, the second mismatch is from 1 to 11 bases 3’ of the first mismatch; and iv) when the first mismatch is at position 11 based on the numbering of SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6, the second mismatch is from 1 to 10 bases 3’ of the first mismatch.

38. The DNA molecule of claim 37, wherein each mismatch is generated by a substitution that is independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C;c) a substitution of C with an A, a U, or a G.

39. The DNA molecule of claim 37 or claim 38, wherein the first strand of the double-stranded RNA of the recombinant nucleic acid targeting a CAG repeat-containing RNA comprises no more than 2 mismatches with the target CUG repeat region of a CUG repeat-containing RNA.

40. The DNA molecule of claim 37 or claim 38, wherein the first strand of the double-stranded RNA of the recombinant nucleic acid targeting a CAG repeat-containing RNA comprises no more than 3 mismatches with the target CUG repeat region of a CUG repeat-containing RNA.

41. The DNA molecule of claim 37 or claim 38, wherein the first strand of the double-stranded RNA of the recombinant nucleic acid targeting a CAG repeat-containing RNA comprises no more than 4 mismatches with the target CUG repeat region of a CUG repeat-containing RNA.

42. The DNA molecule of claim 37 or claim 38, wherein the first strand of the double-stranded RNA of the recombinant nucleic acid targeting a CAG repeat-containing RNA comprises no more than 5 mismatches with the target CUG repeat region of a CUG repeat-containing RNA.

43. The DNA molecule of any one of claims 37-42, wherein the first strand of the doublestranded RNA of the recombinant nucleic acid targeting a CAG repeat-containing RNA comprises two mismatches to the target repeat region, and wherein the second mismatch is within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:4-6.

44. The DNA molecule of any one of claims 37-42, wherein the first strand of the doublestranded RNA of the recombinant nucleic acid targeting a CAG repeat-containing RNA comprises two mismatches to the target repeat region, and wherein the second mismatch is not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:4-6.

45. The DNA molecule of any one of claims 37-42, wherein the first strand of the doublestranded RNA of the recombinant nucleic acid targeting a CAG repeat-containing RNAcomprises three mismatches to the target repeat region, and wherein the second and the third mismatches are within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:4-6.

46. The DNA molecule of any one of claims 37-42, wherein the first strand of the doublestranded RNA of the recombinant nucleic acid targeting a CAG repeat-containing RNA comprises three mismatches to the target repeat region, wherein the second mismatch is within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:4-6, and wherein the third mismatch is not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:4-6.

47. The DNA molecule of any one of claims 37-42, wherein the first strand of the doublestranded RNA of the recombinant nucleic acid targeting a CAG repeat-containing RNA comprises three mismatches to the target repeat region, and wherein the second and the third mismatches are not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:4-6.

48. The DNA molecule of any one of claims 37-42, wherein the first strand of the doublestranded RNA of the recombinant nucleic acid targeting a CAG repeat-containing RNA comprises four- mismatches to the target repeat region, and wherein the second, third, and fourth mismatches are within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:4-6.

49. The DNA molecule of any one of claims 37-42, wherein the first strand of the doublestranded RNA of the recombinant nucleic acid targeting a CAG repeat-containing RNA comprises four mismatches to the target repeat region, wherein the second mismatch is within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:4-6, and wherein the third and fourth mismatches are not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:4-6.

50. The DNA molecule of any one of claims 37-42, wherein the first strand of the doublestranded RNA of the recombinant nucleic acid targeting a CAG repeat-containing RNA comprises four mismatches to the target repeat region, wherein the second and third mismatches are within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:4-6, and wherein the fourth mismatch is not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:4-6.

51. The DNA molecule of any one of claims 37-42, wherein the first strand of the doublestranded RNA of the recombinant nucleic acid targeting a CAG repeat-containing RNA comprises four mismatches to the target repeat region, and wherein the second, third, and fourth mismatches are not within nucleotides 8-11, based on the numbering of any one of SEQ ID NOs:4-6.

52. The DNA molecule of any one of claims 37-42, wherein the at least a second mismatch is within nucleotides 12-21, based on the numbering of any one of SEQ ID NOs:4-6.

53. The DNA molecule of any one of claims 37-52, wherein the second strand is 100% complementary to the first strand.

54. The DNA molecule of any one of claims 37-52, wherein the second strand comprises from 1 to 10 mismatches, from 3 to 5 mismatches, from 4 to 7 mismatches, or from 5 to 10 mismatches, to the first strand.

55. The DNA molecule of any one of claims 37-54, wherein the double-stranded RNA has a length of from 18 bases to 25 nucleotides, from 19 to 25 nucleotides, from 19 to 23 nucleotides, or from 19 to 22 nucleotides.

56. The DNA molecule of any one of claims 37-54, wherein the double-stranded RNA has a length of from 21 nucleotides to 25 nucleotides.

57. The DNA molecule of any one of claims 37-54, wherein the double-stranded RNA has a length of 21 nucleotides.

58. The DNA molecule of any one of claims 37-57, wherein the double-stranded RNA comprises one or more of: a) a base modification; b) a sugar modification; and c) a backbone modification.

59. A recombinant expression vector comprising the DNA molecule of any one of claims 27-58.

60. The recombinant expression vector of claim 59, wherein the nucleotide sequence is operably linked to a promoter that is functional in a eukaryotic cell.

61. The recombinant expression vector of claim 60, wherein the promoter is an RNA polymerase II promoter or an RNA polymerase III promoter.

62. The recombinant expression vector of claim 60 or claim 61, wherein the promoter is a CAG promoter, a CBA promoter, a CMV promoter, a U6 promoter, an EFla promoter, or an Hl promoter.

63. The recombinant expression vector of any one of claims 59-62, wherein the recombinant expression vector comprises a 5’ adeno-associated virus (AAV) inverted terminal repeat (ITR) sequence and a 3’ AAV ITR sequence.

64. A recombinant expression vector comprising a nucleotide sequence encoding the recombinant nucleic acid of claim 26, claim 27, or any one of claims 28-58.

65. The recombinant expression vector of claim 64, wherein the nucleotide sequence is operably linked to a promoter that is functional in a eukaryotic cell.

66. The recombinant expression vector of claim 65, wherein the promoter is an RNA polymerase II promoter or an RNA polymerase III promoter.

67. The recombinant expression vector of claim 64 or claim 65, wherein the promoter is a CAG promoter, a CBA promoter a CMV promoter, a U6 promoter, an EFla promoter, or an Hl promoter.

68. The recombinant expression vector of any one of claims 63-67, wherein the recombinant expression vector comprises a 5’ adeno-associated virus (AAV) inverted terminal repeat (ITR) sequence and a 3’ AAV ITR sequence.

69. A conjugate comprising: a) a double-stranded RNA of any one of claims 1-23; and b) one or more non-nucleic acid moieties conjugated, directly or via a linker, to one or both strands of the double-stranded RNA, at one or both terminal positions or at one or more internal positions.

70. The conjugate of claim 69, wherein the one or more non-nucleic acid moieties is or comprises a lipophilic moiety.

71. The conjugate of claim 70, wherein the lipophilic moiety is a lipid, cholesterol, retinoic acid, cholic acid, adamantane acetic acid, hexadecyl, 1 -pyrene butyric acid, dihydrotestosterone, l,3-bis-O(hexadecyl)glycerol, geranyloxyhexanol, hexadecylglycerol, borneol, menthol, 1,3- propandediol, a heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, 03-(oleoyl)cholenic acid, docosanoic acid (DCA), eicosapentaenoic acid (EPA), a dendrimer, dimethoxytrityl, or phenoxazine.

72. The conjugate of claim 70, wherein the lipophilic moiety comprises a saturated or unsaturated C4-C30 hydrocarbon chain or saturated or unsaturated hydrocarbon chain longer than 30, and an optional functional group selected from the group consisting of a hydroxyl, an amine, a carboxylic acid, a sulfonate, a phosphate, a thiol, an azide, and an alkyne.

73. The conjugate of claim 72, wherein the lipophilic moiety contains a saturated or unsaturated Ce-C is hydrocarbon chain, C6-C22 hydrocarbon chain, a C22 hydrocarbon chain, or hydrocarbon chain longer than Ci2-74. The conjugate of claim 73, wherein the lipophilic moiety contains a saturated or unsaturated Ci6 hydrocarbon chain.

75. The conjugate of any one of claims 69-74, wherein the lipophilic moiety is conjugated, directly or via a linker, to a nucleobase, a sugar moiety, or an internucleoside linkage in the double-stranded RNA, optionally wherein the lipophilic moiety is linked to the first or the second strand, further optionally wherein the lipophilic moiety is linked to a 2'-0 of a sugar moiety at a terminal position and / or internal position in the first strand, the second strand or both strands or a phosphate group at a terminal nucleotide in the first strand and / or the second strand.

76. A delivery vehicle comprising the recombinant expression vector of any one of claims 59- 68.

77. The delivery vehicle of claim 76, wherein the delivery vehicle is a non-viral delivery vehicle.

78. The delivery vehicle of claim 77, wherein the delivery vehicle is a lipid nanoparticle.

79. The delivery vehicle of claim 77, wherein the delivery vehicle is a viral particle.

80. A delivery vehicle comprising the double-stranded RNA of any one of claims 1-23.

81. The delivery vehicle of claim 80, wherein the double-stranded RNA comprises a covalently linked lipid moiety, wherein the lipid moiety is linked to the second or the first strand, further optionally wherein the lipid moiety is linked to a 2'-O of a sugar moiety at a terminal position and / or internal position in the first strand and / or the second strand or a phosphate group at a terminal nucleotide in the first strand and / or the second strand.

82. The delivery vehicle of claim 81 , wherein the covalently linked lipid moiety comprises a palmityl moiety; palmitoyl moiety; docosanoic acid (DCA); docosanyl moiety; eicosapentaenoic acid (EPA); eicosepentaenyl moiety; or a dendrimer, optionally wherein the dendrimer comprises the dendrimer of Fig. 12, further optionally, wherein the lipid moiety is linked directly or via a linker to (i) 2'-0 of a sugar moiety at a terminal position and / or internal position in the first strand and / or the second strand or (ii) a phosphate group at a terminal position in the first strand and / or the second strand.

83. The delivery vehicle of any one of claims 80-82, wherein the delivery vehicle is a lipid nanoparticle.

84. A delivery vehicle comprising the conjugate of any one of claims 69-75.

85. A viral particle comprising the recombinant expression vector of any one of claims 59-68.

86. The viral particle of claim 85, wherein the viral particle is an adeno-associated virus (AAV) particle.

87. The viral particle of claim 86, wherein the AAV particle comprises an AAV9 capsid.

88. The viral particle of claim 86, wherein the AAV particle comprises an AAV2 capsid.

89. A composition comprising: a) the double-stranded RNA of any one of claims 1-22 or the recombinant expression vector of any one of claims 59-68; and b) a pharmaceutically acceptable excipient.

90. A composition comprising: a) the delivery vehicle of any one of claims 76-84; and b) a pharmaceutically acceptable excipient.

91. A composition comprising: a) a viral particle of any one of claims 85-88; and b) a pharmaceutically acceptable excipient.

92. A composition comprising: a) a conjugate of any one of claims 69-75; and b) a pharmaceutically acceptable excipient.

93. A method for selectively reducing the translation and / or accumulation of a disease- associated CUG repeat-containing RNA and / or a disease-associated CAG repeatcontaining RNA produced by transcription of a CTG repeat expansion gene in an individual having a CTG repeat expansion disorder, the method comprising administering to the individual an effective amount of the double-stranded RNA of any one of claims 1-22, the expression vector of any one of claims 59-68, delivery vehicle of any one of claims 76-84, the viral particle of any one of claims 85-88, or the composition of any one of claims 89-71.

94. The method of claim 93, wherein the CTG repeat expansion disorder is Huntington disease-like 2, myotonic dystrophy type 1, Fuchs endothelial corneal dystrophy, or Spinocerebellar- ataxia type 8.

95. The method of claim 92 or claim 93, wherein said administering comprises delivery to the eye, muscle, heart, lungs, red blood cells, and / or central nervous system of the individual.

96. The method of any one of claims 93-95, wherein the injection is intracameral, intravitreal, subretinal, topical, intramuscular, intravenous, intracerebral ventricular injection, intraparenchymal injection, intrathecal injection, intrastriatal injection, intrathalamic injection, intracisternal magna injection, subpial injection, or any combination thereof.

97. The method of any one of claims 93-96, wherein said administering reduces the number of cells containing toxic foci by at least 10%, compared to the number of cells containing toxic foci in the individual before said administering.

98. A method of heating a CTG repeat expansion disorder in an individual, the method comprising administering to the individual an effective amount of the double-stranded RNA of any one of claims 1-22, the expression vector of any one of claims 59-68, delivery vehicle of any one of claims 76-84, the viral particle of any one of claims 85- 88, or the composition of any one of claims 89-92.

99. A method for selectively reducing the translation and / or accumulation of a disease- associated CUG repeat-containing RNA and / or a disease-associated CAG repeatcontaining RNA produced by transcription of a CAG repeat expansion gene in an individual having a CAG repeat expansion disorder, the method comprising administering to the individual an effective amount of the double-stranded RNA of any one of claims 1-22, the expression vector of any one of claims 59-68, delivery vehicle of any one of claims 76-84, the viral particle of any one of claims 85-88, or the composition of any one of claims 89-92.

100. The method of claim 99, wherein the CAG repeat expansion disorder is Huntington’s disease, spinocerebellar ataxia type 1, spinocerebellar ataxia type 2, spinocerebellar ataxia type 3, spinocerebellar ataxia type 6, spinocerebellar ataxia type 7, spinocerebellar ataxia type 12, spinocerebellar ataxia type 17, spinal and bulbar muscular atrophy, dentatorubral pallidoluysian atrophy, amyotrophic lateral sclerosis, myotonic dystrophy type 1, Fuchs’ endothelial corneal dystrophy, branchiootorenal syndrome 2, or cleidocranial dysplasia.

101. The method of claim 98 or claim 99, wherein said administering comprises delivery to central nervous system of the individual.

102. The method of claim 101, wherein the administering comprises intraventricular injection, intrathecal injection, intrastriatal injection, intrathalamic injection, intracistcrnal magna injection, subpial injection, or any combination thereof.

03. A method of treating a CAG repeat expansion disorder in an individual, the method comprising administering to the individual an effective amount of the doublestranded RNA of any one of claims 1-22, the expression vector of any one of claims 59- 68, delivery vehicle of any one of claims 76-84, the viral particle of any one of claims 85-88, or the composition of any one of claims 89-92.

Images