Method for delivering nucleic acid to immune cells, agent for delivering nucleic acid to immune cells, and use thereof

WO2025143231A1PCT designated stage expired Publication Date: 2025-07-03FUJIFILM CORP

Patent Information

Application Number
PCT/JP2024/046425
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-07-10
Filing Date
2024-12-27
Publication Date
2025-07-03

AI Technical Summary

Technical Problem

The prior art has safety concerns, high cost, special equipment and complex steps when delivering nucleic acids to immune cells, and it is difficult to activate and inactivate immune cells simultaneously, resulting in reduced cell efficacy and DNA damage.

Method used

Nucleic acid-free lipid particles are prepared using ionizable lipids, nonionized lipids and lipid particles with nonionic polymers, and nucleic acids are delivered to immune cells, including activated and inactivated cells, by mixing and adjusting pH.

Benefits of technology

It enables efficient delivery of nucleic acid to immune cells without using special equipment, improving delivery flexibility and reducing production costs while maintaining cell activity and reducing DNA damage.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure JPOXMLDOC01-APPB-C000001
    Figure JPOXMLDOC01-APPB-C000001
  • Figure JPOXMLDOC01-APPB-C000002
    Figure JPOXMLDOC01-APPB-C000002
  • Figure JPOXMLDOC01-APPB-C000003
    Figure JPOXMLDOC01-APPB-C000003
Patent Text Reader

Abstract

The present invention addresses the problem of providing: a method for delivering a nucleic acid to immune cells and an agent for delivering a nucleic acid to immune cells, which are both capable of delivering the nucleic acid to both an immune cell that has been subjected to an activation treatment and an immune cell that has not been subjected to an activation treatment; and a method for delivering a nucleic acid to immune cells and an agent for delivering a nucleic acid to immune cells, which are both capable of encapsulating a nucleic acid in a simple manner without a dedicated device. The present invention provides a method for delivering a nucleic acid to immune cells, the method comprising: a step A for preparing lipid particles not containing any nucleic acids, by using an ionizable lipid, a non-ionized lipid, and a lipid having a nonionic polymer; a step B for preparing nucleic acid-containing lipid particles by mixing the nucleic acid with the lipid particles not containing any nucleic acids; and a step C for bringing the nucleic acid-containing lipid particles into contact with immune cells (excluding in vivo delivery methods).
Need to check novelty before this filing date? Find Prior Art

Description

Method for delivering nucleic acid to immune cells, agent for delivering nucleic acid to immune cells and use thereof

[0001] The present invention relates to a method for delivering nucleic acids to immune cells, an agent for delivering nucleic acids to immune cells, and uses thereof.

[0002] In immune cell therapies, including chimeric antigen receptor (CAR) T-cell therapy, immune cells that have been genetically modified to express a therapeutic foreign gene such as CAR or to alter endogenous gene expression are used. Genetic modification of immune cells generally involves viral vector methods, but these methods pose issues such as safety concerns due to viruses and high costs. Furthermore, electroporation has traditionally been used as a non-viral method, but electroporation can cause cytotoxicity and DNA damage, leading to problems such as growth retardation and chromosomal abnormalities.

[0003] Regarding nucleic acid delivery to immune cells using lipid particles, Patent Document 1 describes genome editing of T cells using separate LNPs containing Cas9 mRNA and gRNA to perform genome editing at multiple sites. Patent Document 2 describes the delivery of nucleic acid to T cells using LNPs containing nucleic acid (mRNA). Patent Document 3 describes the encapsulation of nucleic acid into LNPs without the use of a dedicated device by rehydrating freeze-dried LNPs, mixing the hydrated solution with nucleic acid, and subjecting them to heat treatment at 95°C. Patent Document 4 describes the mixing of purified empty LNPs (LNPs not containing nucleic acid) and nucleic acid using a pump system to obtain nucleic acid-encapsulated LNPs.

[0004] International Publication No. WO2021 / 222287 International Publication No. WO2020 / 210901 International Publication No. WO2021 / 060440 International Publication No. WO2018 / 089801

[0005] The lipid nanoparticles described in Patent Documents 1 and 2 require a process to fully activate immune cells, which limits the culturing methods that can be used. Since immune cell activation processes are known to reduce the therapeutic efficacy of immune cells, it is desirable to avoid such activation processes. Furthermore, Patent Documents 1 and 2 have the problem that encapsulating nucleic acids into lipid nanoparticles requires expensive dedicated equipment such as a high-speed microfluidic device, and additionally, cumbersome processes such as ultrafiltration are required each time encapsulation occurs. Patent Document 3 has the problem of requiring a cumbersome process of rehydrating the freeze-dried product and encapsulating nucleic acids. Furthermore, Patent Document 4 has the problem of requiring heating.

[0006] In view of the above circumstances, an object of the present invention is to provide a method for delivering nucleic acid to immune cells and an agent for delivering nucleic acid to immune cells, which are capable of delivering nucleic acid to both activated and unactivated immune cells. Another object of the present invention is to provide a method for delivering nucleic acid to immune cells and an agent for delivering nucleic acid to immune cells, which allows nucleic acid encapsulation to be performed simply and without a dedicated device.

[0007] The present invention provides the following: <1> A method for delivering nucleic acid to immune cells (excluding in vivo delivery methods), comprising: Step A: preparing nucleic acid-free lipid particles using an ionizable lipid, a nonionizable lipid, and a lipid having a nonionic polymer; Step B: mixing the nucleic acid-free lipid particles with nucleic acid to prepare nucleic acid-containing lipid particles; and Step C: contacting the nucleic acid-containing lipid particles with immune cells. <2> The method according to <1>, comprising cryopreserving the nucleic acid-free lipid particles and thawing the frozen nucleic acid-free lipid particles before mixing with the nucleic acid. <3> The method according to <1> or <2>, wherein Step B comprises incubating the nucleic acid-free lipid particles with an aqueous solution containing nucleic acid at 0°C to 30°C for 0.1 to 120 minutes, and adjusting the pH of the mixture obtained above to 6.5 to 8.5. <4> The method according to any one of <1> to <3>, wherein the mixing of the nucleic acid-free lipid particles and the nucleic acid in step B is carried out by any one of mixing by moving the liquid back and forth in a container, pipette mixing, stirrer mixing in a batch container, mixing by rotating the container to agitate the content liquid, or flask stirring. <5> The method according to any one of <1> to <4>, comprising a step of adding an apolipoprotein to a culture solution containing immune cells before contacting the nucleic acid-containing lipid particles with the immune cells in step C. <6> The method according to any one of <1> to <5>, wherein the ionizable lipid is a compound represented by formula (1) or a salt thereof. In the formula, X is —NR 1 - or -O-, R 1 is a hydrogen atom, a hydrocarbon group having 6 to 24 carbon atoms, or R 21 -L 1 -R 22 represents a group represented by -, and R 21 represents a hydrocarbon group having 1 to 24 carbon atoms, and L 1 is —O(CO)O—, —O(CO)—, —(CO)O—, —O—, or indicates R 22 represents a divalent linking group and a hydrocarbon linking group having 1 to 18 carbon atoms; R 2 and R 3are each independently a hydrogen atom, a hydrocarbon group having 3 to 24 carbon atoms, or R 31 -L 2 -R 32 represents a group represented by -, and R 31 represents a hydrocarbon group having 1 to 24 carbon atoms, and L 2 is —O(CO)O—, —O(CO)—, —(CO)O—, —O—, or indicates R 32 represents a divalent linking group and a hydrocarbon linking group having 1 to 18 carbon atoms; R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 10 , R 11 , and R 12 each independently represents a hydrogen atom or an optionally substituted alkyl group having 1 to 18 carbon atoms; R 4 and R 5 , R 10 and R 5 , R 5 and R 12 , R 4 and R 6 , R 5 and R 6 , R 6 and R 7 , R 6 and R 10 , R 12 and R 7 , and R 7 and R 8 may be bonded to each other to form a 4- to 7-membered ring which may contain an O atom, and the substituent on the alkyl group having 1 to 18 carbon atoms which may be substituted is a hydroxyl group, a carboxyl group, -NR 45 R 46 an amino group represented by the formula: 41 , —O(CO)—R 42 , -(CO)O-R 43 , or -O-R 44 and R 41 , R 42 , R 43, R 44 , R 45 and R 46 each independently represents a hydrocarbon group having 1 to 18 carbon atoms, and the substituent on the substituted or unsubstituted aryl group and the substituted or unsubstituted heteroaryl group is an alkyl group having 1 to 18 carbon atoms, a hydroxyl group, a carboxyl group, —NR 45 R 46 an amino group represented by —O(CO)O—R 41 , —O(CO)—R 42 , -(CO)O-R 43 , or -O-R 44 and R 41 , R 42 , R 43 , R 44 , R 45 and R 46 each independently represent a hydrocarbon group having 1 to 18 carbon atoms, and a, b, c, and d each independently represent an integer of 0 to 3, with the proviso that a+b is 1 or greater and c+d is 1 or greater. <7> The method according to any one of <1> to <5>, wherein the ionizable lipid is a compound represented by formula (2) or a salt thereof: In the formula, R 101 and R 102 each independently represents a hydrocarbon group having 1 to 18 carbon atoms; R 103 represents a hydrocarbon group having 2 to 8 carbon atoms, and R 101 , R 102 and R 103 The hydrocarbon group represented by is —OH, COOH, —NR 151 R 152 , -OC(O)OR 153 , -C(O)O-R 154 , —OC(O)—R 155 , and -O-R 156 and R 102 and R 103 may be linked together to form a 4- to 7-membered ring, R 104 represents a hydrocarbon group having 1 to 8 carbon atoms, and R 105 and R 106 are each independently a hydrocarbon group having 1 to 8 carbon atoms, or -R 108 -L101 -R 109 where R 105 and R 106 and R are both hydrocarbon groups having 1 to 8 carbon atoms, 107 is -R 110 -L 102 -R 111 -L 103 -R 112 indicates, R 151 and R 152 each independently represents a hydrocarbon group having 1 to 8 carbon atoms; R 153 , R 154 , R 155 , and R 156 each independently represents a hydrocarbon group having 1 to 24 carbon atoms; R 153 , R 154 , R 155 , and R 156 The hydrocarbon group represented by is an aryl group having 6 to 20 carbon atoms or -S-R 158 The aryl group having 6 to 20 carbon atoms may be substituted with —OH, —COOH, —NR 151 R 152 , -OC(O)OR 153 , -C(O)O-R 154 , —OC(O)—R 155 , -O-R 156 or -(C1-C12 hydrocarbon group)-R 157 and R 158 represents a hydrocarbon group having 1 to 12 carbon atoms, and R 157 is -OH, COOH, -NR 161 R 162 , -OC(O)OR 163 , -C(O)O-R 164 , —OC(O)—R 165 , -O-R 166 Indicates. 161 and R 162 each independently represents a hydrocarbon group having 1 to 8 carbon atoms; R 163 , R 164 , R 165 , and R 166 each independently represents a hydrocarbon group having 1 to 24 carbon atoms; R 163 , R 164 , R165 , and R 166 The hydrocarbon group represented by is an aryl group having 6 to 20 carbon atoms or -S-R 168 The aryl group having 6 to 20 carbon atoms may be substituted with —OH, —COOH, —NR 161 R 162 , -OC(O)OR 163 , -C(O)O-R 164 , —OC(O)—R 165 , -O-R 166 or - optionally substituted with a hydrocarbon group having 1 to 12 carbon atoms, R 168 represents a hydrocarbon group having 1 to 12 carbon atoms; L 101 , L 102 , and L 103 R each independently represents —OC(O)O—, —C(O)O—, —OC(O)—, or —O—. 108 represents a hydrocarbon group having 1 to 12 carbon atoms, and R 109 represents a hydrocarbon group having 1 to 24 carbon atoms, R 110 represents a hydrocarbon group having 1 to 8 carbon atoms, and R 111 represents a hydrocarbon group having 1 to 24 carbon atoms, R 112 represents a hydrocarbon group having 1 to 24 carbon atoms, R 109 , and R 112 The hydrocarbon group represented by is an aryl group, —OC(O)O—R 153 , -C(O)O-R 154 , —OC(O)—R 155 , or -S-R 158 and R 153 , R 154 , R 155 , and R 158 is defined as above, and R 111 The hydrocarbon group represented by is —OC(O)O—R 153 , -C(O)O-R 154 or —OC(O)—R 155 and R 153 , R 154 , and R 155are defined as above. <8> The method according to any one of <1> to <7>, wherein the non-ionized lipid comprises a sterol or a derivative thereof, and a phospholipid. <9> The method according to <8>, wherein the sterol is present at a molar ratio of 30 to 70 mol% relative to the total lipids in the lipid composition. <10> The method according to any one of <1> to <9>, wherein the pH of the lipid composition is 3.0 to 6.5. <11> The method according to any one of <1> to <10>, wherein in step B, the mass ratio of the lipid concentration to the nucleic acid concentration in the solution after mixing is 5:1 to 1000:1. <12> The method according to any one of <1> to <11>, wherein the immune cells are activated cells or non-activated cells. <13> The method according to any one of <1> to <12>, wherein the immune cells are derived from primary cells or stem cells. <14> The method according to any one of <1> to <13>, wherein the nucleic acid is mRNA, or a nucleic acid for gene editing comprising an mRNA encoding a Cas nuclease and a guide RNA. <15> A nucleic acid delivery agent for immune cells, comprising a lipid composition comprising an ionizable lipid that is a compound represented by formula (1) or formula (2) or a salt thereof, a non-ionizable lipid, a lipid having a nonionic polymer, and a nucleic acid. In the formula, X is —NR 1 - or -O-, R 1 is a hydrogen atom, a hydrocarbon group having 6 to 24 carbon atoms, or R 21 -L 1 -R 22 represents a group represented by -, and R 21 represents a hydrocarbon group having 1 to 24 carbon atoms, and L 1 is —O(CO)O—, —O(CO)—, —(CO)O—, —O—, or indicates R 22 represents a divalent linking group and a hydrocarbon linking group having 1 to 18 carbon atoms; R 2 and R 3 are each independently a hydrogen atom, a hydrocarbon group having 3 to 24 carbon atoms, or R 31 -L 2 -R 32 represents a group represented by -, and R 31 represents a hydrocarbon group having 1 to 24 carbon atoms; L 2is —O(CO)O—, —O(CO)—, —(CO)O—, —O—, or indicates R 32 represents a divalent linking group and a hydrocarbon linking group having 1 to 18 carbon atoms; R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 10 , R 11 , and R 12 each independently represents a hydrogen atom or an optionally substituted alkyl group having 1 to 18 carbon atoms; R 4 and R 5 , R 10 and R 5 , R 5 and R 12 , R 4 and R 6 , R 5 and R 6 , R 6 and R 7 , R 6 and R 10 , R 12 and R 7 , and R 7 and R 8 may be bonded to each other to form a 4- to 7-membered ring which may contain an O atom, and the substituent on the alkyl group having 1 to 18 carbon atoms which may be substituted is a hydroxyl group, a carboxyl group, -NR 45 R 46 an amino group represented by the formula: 41 , —O(CO)—R 42 , -(CO)O-R 43 , or -O-R 44 and R 41 , R 42 , R 43 , R 44 , R 45 and R 46each independently represents a hydrocarbon group having 1 to 18 carbon atoms, and the substituent on the substituted or unsubstituted aryl group and the substituted or unsubstituted heteroaryl group is an alkyl group having 1 to 18 carbon atoms, a hydroxyl group, a carboxyl group, —NR 45 R 46 an amino group represented by —O(CO)O—R 41 , —O(CO)—R 42 , -(CO)O-R 43 , or -O-R 44 and R 41 , R 42 , R 43 , R 44 , R 45 and R 46 each independently represents a hydrocarbon group having 1 to 18 carbon atoms; a, b, c, and d each independently represent an integer of 0 to 3, with the proviso that a+b is 1 or more and c+d is 1 or more. In the formula, R 101 and R 102 each independently represents a hydrocarbon group having 1 to 18 carbon atoms; R 103 represents a hydrocarbon group having 2 to 8 carbon atoms, and R 101 , R 102 and R 103 The hydrocarbon group represented by is —OH, COOH, —NR 151 R 152 , -OC(O)OR 153 , -C(O)O-R 154 , —OC(O)—R 155 , and -O-R 156 and R 102 and R 103 may be linked together to form a 4- to 7-membered ring, R 104 represents a hydrocarbon group having 1 to 8 carbon atoms, and R 105 and R 106 are each independently a hydrocarbon group having 1 to 8 carbon atoms, or -R 108 -L 101 -R 109 where R 105 and R 106 and R are both hydrocarbon groups having 1 to 8 carbon atoms, 107 is -R110 -L 102 -R 111 -L 103 -R 112 indicates, R 151 and R 152 each independently represents a hydrocarbon group having 1 to 8 carbon atoms; R 153 , R 154 , R 155 , and R 156 each independently represents a hydrocarbon group having 1 to 24 carbon atoms; R 153 , R 154 , R 155 , and R 156 The hydrocarbon group represented by is an aryl group having 6 to 20 carbon atoms or -S-R 158 The aryl group having 6 to 20 carbon atoms may be substituted with —OH, —COOH, —NR 151 R 152 , -OC(O)OR 153 , -C(O)O-R 154 , —OC(O)—R 155 , -O-R 156 or -(C1-C12 hydrocarbon group)-R 157 and R 158 represents a hydrocarbon group having 1 to 12 carbon atoms, and R 157 is -OH, COOH, -NR 161 R 162 , -OC(O)OR 163 , -C(O)O-R 164 , —OC(O)—R 165 , -O-R 166 Indicates. 161 and R 162 each independently represents a hydrocarbon group having 1 to 8 carbon atoms; R 163 , R 164 , R 165 , and R 166 each independently represents a hydrocarbon group having 1 to 24 carbon atoms; R 163 , R 164 , R 165 , and R 166 The hydrocarbon group represented by is an aryl group having 6 to 20 carbon atoms or -S-R 168The aryl group having 6 to 20 carbon atoms may be substituted with —OH, —COOH, —NR 161 R 162 , -OC(O)OR 163 , -C(O)O-R 164 , —OC(O)—R 165 , -O-R 166 or - optionally substituted with a hydrocarbon group having 1 to 12 carbon atoms, R 168 represents a hydrocarbon group having 1 to 12 carbon atoms; L 101 , L 102 , and L 103 R each independently represents —OC(O)O—, —C(O)O—, —OC(O)—, or —O—. 108 represents a hydrocarbon group having 1 to 12 carbon atoms, and R 109 represents a hydrocarbon group having 1 to 24 carbon atoms, R 110 represents a hydrocarbon group having 1 to 8 carbon atoms, and R 111 represents a hydrocarbon group having 1 to 24 carbon atoms, R 112 represents a hydrocarbon group having 1 to 24 carbon atoms, R 109 , and R 112 The hydrocarbon group represented by is an aryl group, —OC(O)O—R 153 , -C(O)O-R 154 , —OC(O)—R 155 , or -S-R 158 and R 153 , R 154 , R 155 , and R 158 is defined as above, and R 111 The hydrocarbon group represented by is —OC(O)O—R 153 , -C(O)O-R 154 or —OC(O)—R 155 and R 153 , R 154 , and R 155is defined as above. <16> The agent for nucleic acid delivery to immune cells according to <15>, wherein the non-ionized lipid comprises a sterol or a derivative thereof, and a phospholipid. <17> The agent for nucleic acid delivery to immune cells according to <16>, wherein the sterol accounts for 30 to 70 mol % in terms of a molar ratio to the total lipids in the lipid composition. <18> The agent for nucleic acid delivery to immune cells according to any one of <15> to <17>, wherein the nucleic acid is mRNA, or a nucleic acid for gene editing comprising mRNA encoding a Cas nuclease and a guide RNA. <19> An agent for nucleic acid delivery to immune cells, comprising a lipid composition comprising an ionizable lipid which is a compound represented by formula (1) or formula (2) or a salt thereof, a non-ionized lipid, and a lipid having a non-ionic polymer. In the formula, X is —NR 1 - or -O-, R 1 is a hydrogen atom, a hydrocarbon group having 6 to 24 carbon atoms, or R 21 -L 1 -R 22 represents a group represented by -, and R 21 represents a hydrocarbon group having 1 to 24 carbon atoms, and L 1 is —O(CO)O—, —O(CO)—, —(CO)O—, —O—, or indicates R 22 represents a divalent linking group and a hydrocarbon linking group having 1 to 18 carbon atoms; R 2 and R 3 are each independently a hydrogen atom, a hydrocarbon group having 3 to 24 carbon atoms, or R 31 -L 2 -R 32 represents a group represented by -, and R 31 represents a hydrocarbon group having 1 to 24 carbon atoms; L 2 is —O(CO)O—, —O(CO)—, —(CO)O—, —O—, or indicates R 32 represents a divalent linking group and a hydrocarbon linking group having 1 to 18 carbon atoms; R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 10 , R 11, and R 12 each independently represents a hydrogen atom or an optionally substituted alkyl group having 1 to 18 carbon atoms; R 4 and R 5 , R 10 and R 5 , R 5 and R 12 , R 4 and R 6 , R 5 and R 6 , R 6 and R 7 , R 6 and R 10 , R 12 and R 7 , and R 7 and R 8 may be bonded to each other to form a 4- to 7-membered ring which may contain an O atom, and the substituent on the alkyl group having 1 to 18 carbon atoms which may be substituted is a hydroxyl group, a carboxyl group, -NR 45 R 46 an amino group represented by the formula: 41 , —O(CO)—R 42 , -(CO)O-R 43 , or -O-R 44 and R 41 , R 42 , R 43 , R 44 , R 45 and R 46 each independently represents a hydrocarbon group having 1 to 18 carbon atoms, and the substituent on the substituted or unsubstituted aryl group and the substituted or unsubstituted heteroaryl group is an alkyl group having 1 to 18 carbon atoms, a hydroxyl group, a carboxyl group, —NR 45 R 46 an amino group represented by —O(CO)O—R 41 , —O(CO)—R 42 , -(CO)O-R 43 , or -O-R 44 and R 41 , R 42 , R 43 , R 44 , R45 and R 46 each independently represents a hydrocarbon group having 1 to 18 carbon atoms; a, b, c, and d each independently represent an integer of 0 to 3, with the proviso that a+b is 1 or more and c+d is 1 or more. In the formula, R 101 and R 102 each independently represents a hydrocarbon group having 1 to 18 carbon atoms; R 103 represents a hydrocarbon group having 2 to 8 carbon atoms, and R 101 , R 102 and R 103 The hydrocarbon group represented by is —OH, COOH, —NR 151 R 152 , -OC(O)OR 153 , -C(O)O-R 154 , —OC(O)—R 155 , and -O-R 156 and R 102 and R 103 may be linked together to form a 4- to 7-membered ring, R 104 represents a hydrocarbon group having 1 to 8 carbon atoms, and R 105 and R 106 are each independently a hydrocarbon group having 1 to 8 carbon atoms, or -R 108 -L 101 -R 109 where R 105 and R 106 and R are both hydrocarbon groups having 1 to 8 carbon atoms, 107 is -R 110 -L 102 -R 111 -L 103 -R 112 indicates, R 151 and R 152 each independently represents a hydrocarbon group having 1 to 8 carbon atoms; R 153 , R 154 , R 155 , and R 156 each independently represents a hydrocarbon group having 1 to 24 carbon atoms; R 153 , R 154 , R 155 , and R 156The hydrocarbon group represented by is an aryl group having 6 to 20 carbon atoms or -S-R 158 The aryl group having 6 to 20 carbon atoms may be substituted with —OH, —COOH, —NR 151 R 152 , -OC(O)OR 153 , -C(O)O-R 154 , —OC(O)—R 155 , -O-R 156 or -(C1-C12 hydrocarbon group)-R 157 and R 158 represents a hydrocarbon group having 1 to 12 carbon atoms, and R 157 is -OH, COOH, -NR 161 R 162 , -OC(O)OR 163 , -C(O)O-R 164 , —OC(O)—R 165 , -O-R 166 Indicates. 161 and R 162 each independently represents a hydrocarbon group having 1 to 8 carbon atoms; R 163 , R 164 , R 165 , and R 166 each independently represents a hydrocarbon group having 1 to 24 carbon atoms; R 163 , R 164 , R 165 , and R 166 The hydrocarbon group represented by is an aryl group having 6 to 20 carbon atoms or -S-R 168 The aryl group having 6 to 20 carbon atoms may be substituted with —OH, —COOH, —NR 161 R 162 , -OC(O)OR 163 , -C(O)O-R 164 , —OC(O)—R 165 , -O-R 166 or - optionally substituted with a hydrocarbon group having 1 to 12 carbon atoms, R 168 represents a hydrocarbon group having 1 to 12 carbon atoms; L 101 , L 102 , and L 103 R each independently represents —OC(O)O—, —C(O)O—, —OC(O)—, or —O—. 108represents a hydrocarbon group having 1 to 12 carbon atoms, and R 109 represents a hydrocarbon group having 1 to 24 carbon atoms, R 110 represents a hydrocarbon group having 1 to 8 carbon atoms, and R 111 represents a hydrocarbon group having 1 to 24 carbon atoms, R 112 represents a hydrocarbon group having 1 to 24 carbon atoms, R 109 , and R 112 The hydrocarbon group represented by is an aryl group, —OC(O)O—R 153 , -C(O)O-R 154 , —OC(O)—R 155 , or -S-R 158 and R 153 , R 154 , R 155 , and R 158 is defined as above, and R 111 The hydrocarbon group represented by is —OC(O)O—R 153 , -C(O)O-R 154 or —OC(O)—R 155 and R 153 , R 154 , and R 155 are defined as above. <20> The agent for delivering nucleic acid to immune cells according to <19>, wherein the non-ionized lipid comprises a sterol or a derivative thereof, and a phospholipid. <21> The agent for delivering nucleic acid to immune cells according to <19>, wherein the sterol accounts for 30 to 70 mol % in terms of a molar ratio relative to the total lipids in the lipid composition. <22> A kit for delivering nucleic acid to cells, comprising the following reagents (A) to (C): (A) a lipid composition comprising an ionizable lipid which is a compound represented by formula (1) or formula (2) or a salt thereof, a non-ionized lipid, and a lipid having a non-ionic polymer; (B) a pH adjuster; and (C) an apolipoprotein: In the formula, X is —NR 1 - or -O-, R 1 is a hydrogen atom, a hydrocarbon group having 6 to 24 carbon atoms, or R 21 -L 1 -R 22 represents a group represented by -, and R 21 represents a hydrocarbon group having 1 to 24 carbon atoms, and L 1is —O(CO)O—, —O(CO)—, —(CO)O—, —O—, or indicates R 22 represents a divalent linking group and a hydrocarbon linking group having 1 to 18 carbon atoms; R 2 and R 3 are each independently a hydrogen atom, a hydrocarbon group having 3 to 24 carbon atoms, or R 31 -L 2 -R 32 represents a group represented by -, and R 31 represents a hydrocarbon group having 1 to 24 carbon atoms; L 2 is —O(CO)O—, —O(CO)—, —(CO)O—, —O—, or indicates R 32 represents a divalent linking group and a hydrocarbon linking group having 1 to 18 carbon atoms; R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 10 , R 11 , and R 12 each independently represents a hydrogen atom or an optionally substituted alkyl group having 1 to 18 carbon atoms; R 4 and R 5 , R 10 and R 5 , R 5 and R 12 , R 4 and R 6 , R 5 and R 6 , R 6 and R 7 , R 6 and R 10 , R 12 and R 7 , and R 7 and R 8 may be bonded to each other to form a 4- to 7-membered ring which may contain an O atom, and the substituent on the alkyl group having 1 to 18 carbon atoms which may be substituted is a hydroxyl group, a carboxyl group, -NR 45 R 46 an amino group represented by the formula:41 , —O(CO)—R 42 , -(CO)O-R 43 , or -O-R 44 and R 41 , R 42 , R 43 , R 44 , R 45 and R 46 each independently represents a hydrocarbon group having 1 to 18 carbon atoms, and the substituent on the substituted or unsubstituted aryl group and the substituted or unsubstituted heteroaryl group is an alkyl group having 1 to 18 carbon atoms, a hydroxyl group, a carboxyl group, —NR 45 R 46 an amino group represented by —O(CO)O—R 41 , —O(CO)—R 42 , -(CO)O-R 43 , or -O-R 44 and R 41 , R 42 , R 43 , R 44 , R 45 and R 46 each independently represents a hydrocarbon group having 1 to 18 carbon atoms; a, b, c, and d each independently represent an integer of 0 to 3, with the proviso that a+b is 1 or more and c+d is 1 or more. In the formula, R 101 and R 102 each independently represents a hydrocarbon group having 1 to 18 carbon atoms; R 103 represents a hydrocarbon group having 2 to 8 carbon atoms, and R 101 , R 102 and R 103 The hydrocarbon group represented by is —OH, COOH, —NR 151 R 152 , -OC(O)OR 153 , -C(O)O-R 154 , —OC(O)—R 155 , and -O-R 156 and R 102 and R 103 may be linked together to form a 4- to 7-membered ring, R 104 represents a hydrocarbon group having 1 to 8 carbon atoms, and R105 and R 106 are each independently a hydrocarbon group having 1 to 8 carbon atoms, or -R 108 -L 101 -R 109 where R 105 and R 106 and R are both hydrocarbon groups having 1 to 8 carbon atoms, 107 is -R 110 -L 102 -R 111 -L 103 -R 112 indicates, R 151 and R 152 each independently represents a hydrocarbon group having 1 to 8 carbon atoms; R 153 , R 154 , R 155 , and R 156 each independently represents a hydrocarbon group having 1 to 24 carbon atoms; R 153 , R 154 , R 155 , and R 156 The hydrocarbon group represented by is an aryl group having 6 to 20 carbon atoms or -S-R 158 The aryl group having 6 to 20 carbon atoms may be substituted with —OH, —COOH, —NR 151 R 152 , -OC(O)OR 153 , -C(O)O-R 154 , —OC(O)—R 155 , -O-R 156 or -(C1-C12 hydrocarbon group)-R 157 and R 158 represents a hydrocarbon group having 1 to 12 carbon atoms, and R 157 is -OH, COOH, -NR 161 R 162 , -OC(O)OR 163 , -C(O)O-R 164 , —OC(O)—R 165 , -O-R 166 Indicates. 161 and R 162 each independently represents a hydrocarbon group having 1 to 8 carbon atoms; R 163 , R 164 , R 165 , and R166 each independently represents a hydrocarbon group having 1 to 24 carbon atoms; R 163 , R 164 , R 165 , and R 166 The hydrocarbon group represented by is an aryl group having 6 to 20 carbon atoms or -S-R 168 The aryl group having 6 to 20 carbon atoms may be substituted with —OH, —COOH, —NR 161 R 162 , -OC(O)OR 163 , -C(O)O-R 164 , —OC(O)—R 165 , -O-R 166 or - optionally substituted with a hydrocarbon group having 1 to 12 carbon atoms, R 168 represents a hydrocarbon group having 1 to 12 carbon atoms; L 101 , L 102 , and L 103 R each independently represents —OC(O)O—, —C(O)O—, —OC(O)—, or —O—. 108 represents a hydrocarbon group having 1 to 12 carbon atoms, and R 109 represents a hydrocarbon group having 1 to 24 carbon atoms, R 110 represents a hydrocarbon group having 1 to 8 carbon atoms, and R 111 represents a hydrocarbon group having 1 to 24 carbon atoms, R 112 represents a hydrocarbon group having 1 to 24 carbon atoms, R 109 , and R 112 The hydrocarbon group represented by is an aryl group, —OC(O)O—R 153 , -C(O)O-R 154 , —OC(O)—R 155 , or -S-R 158 and R 153 , R 154 , R 155 , and R 158 is defined as above, and R 111 The hydrocarbon group represented by is —OC(O)O—R 153 , -C(O)O-R 154 or —OC(O)—R 155 and R 153 , R 154 , and R 155is defined as above. <23> A method for delivering nucleic acid to cells using the kit according to <22>, comprising the following steps (1) to (4): (1) mixing reagent (A) with nucleic acid; (2) adjusting the pH of the mixture obtained in step (1) with reagent (B); (3) adding reagent (C) to a culture medium containing cells; and (4) adding the mixture obtained in step (2) to the culture medium obtained in step (3). <24> The cells are immune cells. The nucleic acid delivery method according to <23>. <25> At least one compound selected from the group consisting of the following compounds, or a salt thereof: Bis(2-pentylheptyl) 11-(2-((2-(benzyloxy)ethyl)(ethyl)amino)ethyl)-5,17-dihexyl-7,15-dioxo-6,8,14,16-tetraoxa-11-azahenicosanedioic acid 2-Butyloctyl 5-ethyl-14-hexyl-1-hydroxy-8-(2-(octanoyloxy)ethyl)-12-oxo-11,13-dioxa-5,8-diazatricosane-23-oate Bis(2-butyloctyl) 16-(2-(ethyl(4-hydroxybutyl)amino)ethyl)-10,22-dihexyl-12,20-dioxo-11,13,19,21-tetraoxa-16-azahentriacontanedioate Bis(2-pentylheptyl) 11-(2-(ethyl(4-hydroxybutyl)amino)ethyl)-5,17-dihexyl-7,15-dioxo-6,8,14,16-tetraoxa-11-azahenicosanedioic acid 2-Pentylheptyl 8-(2-(decanoyloxy)ethyl)-5-ethyl-14-hexyl-1-hydroxy-12-oxo-11,13-dioxa-5,8-diazaoctadecane-18-oate Bis(2-pentylheptyl) 12-(2-(ethyl(4-hydroxybutyl)amino)ethyl)-5,19-dihexyl-7,17-dioxo-6,8,16,18-tetraoxa-12-azatricosandioate Bis(2-pentylheptyl) 11-(2-(ethyl(3-hydroxypropyl)amino)ethyl)-5,17-dihexyl-7,15-dioxo-6,8,14,16-tetraoxa-11-azahenicosanedioate Bis(2-pentylheptyl) 11-(2-(ethyl(2-hydroxyethyl)amino)ethyl)-5,17-dihexyl-7,15-dioxo-6,8,14,16-tetraoxa-11-azahenicosanedioic acid Bis(2-pentylheptyl) 13-(2-(ethyl(4-hydroxybutyl)amino)ethyl)-5,21-dihexyl-7,19-dioxo-6,8,18,20-tetraoxa-13-azapentacosane dioic acid 2-pentylheptyl 11-(2-(decanoyloxy)ethyl)-7-ethyl-17-hexyl-15-oxo-1-phenyl-2,14,16-trioxa-7,11-diazahenicosan-21-oate 2-pentylheptyl 10-(4-(decanoyloxy)butyl)-7-ethyl-18-hexyl-16-oxo-1-phenyl-2,15,17-trioxa-7,10-diazadocosane-22-oate 2-pentylheptyl 10-(3-(decanoyloxy)propyl)-7-ethyl-17-hexyl-15-oxo-1-phenyl-2,14,16-trioxa-7,10-diazahenicosan-21-oate Bis(2-pentylheptyl)5,17-dihexyl-11-(1-methylpiperidin-4-yl)-7,15-dioxo-6,8,14,16-tetraoxa-11-azahenicosanedioic acid

[0008] According to the present invention, it is possible to deliver nucleic acids to both activated and unactivated immune cells. Furthermore, according to the present invention, nucleic acids can be easily encapsulated in nucleic acid-free lipid particles without using a dedicated device.

[0009] FIG. 1 shows the frequency (percentage) of TCR-negative T cells. FIG. 2 shows cell viability. FIG. 3 shows cell proliferation rate. FIG. 4 shows the frequency (percentage) of TCR-negative T cells. FIG. 5 shows the frequency (percentage) of TCR-negative T cells. FIG. 6 shows cell viability. FIG. 7 shows the frequency (percentage) of TCR-negative T cells. FIG. 8 shows cell viability. FIG. 9 shows the ratio of GFP-positive T cells. FIG. 10 shows the ratio of GFP-positive T cells. FIG. 11 shows the frequency (percentage) of TCR-negative T cells. FIG. 12 shows the frequency (percentage) of TCR-negative T cells. FIG. 13 shows the frequency (percentage) of TCR-negative T cells. FIG. 14 shows the correlation between cholesterol ratio and TCR KO efficiency. FIG. 15 shows the ratio of GFP-positive T cells. FIG. 16 shows the frequency (percentage) of TCR-negative T cells. Figure 17 shows the frequency (percentage) of TCR-negative T cells. Figure 18 shows the frequency (percentage) of B2M-negative T cells. Figure 19 shows the frequency (percentage) of TCR and B2M co-negative T cells. Figure 20 shows the frequency (percentage) of TCR-negative T cells. Figure 21 shows the frequency (percentage) of TCR and B2M co-negative T cells. Figure 22 shows the translocation rates of B2M cleavage regions and TCR cleavage regions in T cells. Figure 23 shows the ratio of GFP-positive cells in T cells. Figure 24 shows the ratio of GFP-positive cells in NK cells. Figure 25 shows the ratio of GFP-positive cells in NKT cells. Figure 26 shows the ratio of GFP-positive cells in B cells. Figure 27 shows the ratio of GFP-positive cells in THP-1 cells. Figure 28 shows fluorescent microscope images (bright field and GFP fluorescence) of THP-1 cells. Figure 29 shows the ratio of GFP-positive cells in BM-MSCs. Figure 30 shows fluorescence microscopy images (bright field and GFP fluorescence) of BM-MSCs. Figure 31 shows the GFP-positive cell ratio of iPS cell-derived neurons. Figure 32 shows fluorescence microscopy images (bright field and GFP fluorescence) of iPS cell-derived neurons. Figure 33 shows the GFP-positive cell ratio of T cells.

[0010] The present invention will be described in detail below. In this specification, the symbol "to" indicates a range that includes the numerical values ​​before and after it as the minimum and maximum values, respectively.

[0011] According to the present invention, there is provided a method for delivering nucleic acid to immune cells, comprising: step A of preparing nucleic acid-free lipid particles using an ionizable lipid, a non-ionizable lipid, and a lipid having a non-ionic polymer; step B of mixing the nucleic acid-free lipid particles with nucleic acid to prepare nucleic acid-containing lipid particles; and step C of contacting the nucleic acid-containing lipid particles with immune cells, although in vivo delivery methods may be excluded.

[0012] The present invention further provides a nucleic acid delivery agent for immune cells, comprising a lipid composition containing an ionizable lipid which is a compound represented by formula (1) or formula (2) or a salt thereof, a non-ionizable lipid, a lipid having a non-ionic polymer, and a nucleic acid.The present invention further provides a nucleic acid delivery agent for immune cells, comprising a lipid composition in a frozen state which contains an ionizable lipid which is a compound represented by formula (1) or formula (2) or a salt thereof, a non-ionizable lipid, and a lipid having a non-ionic polymer.

[0013] The present invention can be used to produce immune cells with modified gene expression, and provides a lipid composition that delivers nucleic acids to immune cells with high efficiency, as well as a method for easily encapsulating nucleic acids in lipid particles, which will lead to increased versatility and cost reduction in the production of immune cells with modified gene expression.

[0014] <Compound Represented by Formula (1) or Salt Thereof> The ionizable lipid is preferably a compound represented by formula (1) or a salt thereof. In the formula, X is —NR 1 - or -O-, R 1 is a hydrogen atom, a hydrocarbon group having 6 to 24 carbon atoms, or R 21 -L 1 -R 22 represents a group represented by -, and R 21 represents a hydrocarbon group having 1 to 24 carbon atoms, and L 1 is —O(CO)O—, —O(CO)—, —(CO)O—, —O—, or indicates R22 represents a divalent linking group and a hydrocarbon linking group having 1 to 18 carbon atoms; R 2 and R 3 are each independently a hydrogen atom, a hydrocarbon group having 3 to 24 carbon atoms, or R 31 -L 2 -R 32 represents a group represented by -, and R 31 represents a hydrocarbon group having 1 to 24 carbon atoms; L 2 is —O(CO)O—, —O(CO)—, —(CO)O—, —O—, or indicates R 32 represents a divalent linking group and a hydrocarbon linking group having 1 to 18 carbon atoms; R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 10 , R 11 , and R 12 each independently represents a hydrogen atom or an optionally substituted alkyl group having 1 to 18 carbon atoms; R 4 and R 5 , R 10 and R 5 , R 5 and R 12 , R 4 and R 6 , R 5 and R 6 , R 6 and R 7 , R 6 and R 10 , R 12 and R 7 , and R 7 and R 8 may be bonded to each other to form a 4- to 7-membered ring which may contain an O atom, and the substituent on the alkyl group having 1 to 18 carbon atoms which may be substituted is a hydroxyl group, a carboxyl group, -NR 45 R 46 an amino group represented by the formula: 41 , —O(CO)—R 42 , -(CO)O-R 43, or -O-R 44 and R 41 , R 42 , R 43 , R 44 , R 45 and R 46 each independently represents a hydrocarbon group having 1 to 18 carbon atoms, and the substituent on the substituted or unsubstituted aryl group and the substituted or unsubstituted heteroaryl group is an alkyl group having 1 to 18 carbon atoms, a hydroxyl group, a carboxyl group, —NR 45 R 46 an amino group represented by —O(CO)O—R 41 , —O(CO)—R 42 , -(CO)O-R 43 , or -O-R 44 and R 41 , R 42 , R 43 , R 44 , R 45 and R 46 each independently represents a hydrocarbon group having 1 to 18 carbon atoms; a, b, c, and d each independently represent an integer of 0 to 3, with the proviso that a+b is 1 or more and c+d is 1 or more.

[0015] R 1 a hydrocarbon group having 6 to 24 carbon atoms in R 2 and R 3The hydrocarbon group having 3 to 24 carbon atoms in the formula (I) is preferably an alkyl group, an alkenyl group, or an alkynyl group, and more preferably an alkyl group or an alkenyl group. The alkyl group having 6 to 24 carbon atoms and the alkyl group having 3 to 24 carbon atoms may be linear or branched, and may be chain-like or cyclic. The alkyl group having 6 to 24 carbon atoms is preferably an alkyl group having 6 to 20 carbon atoms, and more preferably the alkyl group having 3 to 24 carbon atoms is an alkyl group having 6 to 20 carbon atoms. Specific examples include hexyl, heptyl, octyl, nonyl, decyl, undecyl, dodecyl, tridecyl, trimethyldodecyl (preferably 3,7,11-trimethyldodecyl), tetradecyl, pentadecyl, hexadecyl, tetramethylhexadecyl (preferably 3,7,11,15-tetramethylhexadecyl), heptadecyl, octadecyl, nonadecyl, and icosyl. The alkenyl group having 6 to 24 carbon atoms and the alkenyl group having 3 to 24 carbon atoms may be linear or branched, and may be linear or cyclic. The alkenyl group having 6 to 24 carbon atoms is preferably an alkenyl group having 6 to 20 carbon atoms, and the alkenyl group having 3 to 24 carbon atoms is more preferably an alkenyl group having 6 to 20 carbon atoms. Specifically, hexenyl group, heptenyl group, octenyl group, nonenyl group, decenyl group, undecenyl group, dodecenyl group, dodecadienyl group, tridecenyl group, tetradecenyl group, pentadecenyl group, hexadecenyl group (preferably, (Z)-hexadec-9-enyl group), hexadecadienyl group, heptadecenyl group (preferably, (Z)-heptadeca-8-enyl group), heptadecadienyl group (preferably, (8Z, (11Z)-heptadeca-8,11-dienyl group), octadecenyl group (preferably, (Z)-octadec-9-enyl group), octadecadienyl group (preferably, (9Z,12Z)-octadeca-9,12-dienyl group), nonadecenyl group, icosenyl group (preferably, (Z)-icos-11-enyl group), icosadienyl group (preferably, (11,14)-icosa-11,14-dienyl group), and the like.The alkynyl group having 6 to 24 carbon atoms is preferably an alkynyl group having 6 to 20 carbon atoms, and the alkynyl group having 3 to 24 carbon atoms is more preferably an alkynyl group having 6 to 20 carbon atoms. Specific examples include a hexynyl group, a heptynyl group, an octynyl group, a nonynyl group, a decynyl group, an undecynyl group, a dodecynyl group, a tetradecynyl group, a pentadecynyl group, a hexadecynyl group, a heptadecynyl group, and an octadecynyl group. Each of the above alkenyl groups preferably has one or two double bonds, and each of the alkynyl groups preferably has one or two triple bonds.

[0016] R 21 and R 31The hydrocarbon group having 1 to 24 carbon atoms in the above formula (I) is preferably an alkyl group having 10 to 24 carbon atoms, an alkenyl group having 10 to 24 carbon atoms, or an alkynyl group having 10 to 24 carbon atoms. The alkyl group having 10 to 24 carbon atoms may be linear or branched, and may be linear or cyclic. The alkyl group having 10 to 24 carbon atoms is preferably an alkyl group having 12 to 24 carbon atoms. Specific examples thereof include a decyl group, an undecyl group, a dodecyl group, a tridecyl group, a trimethyldodecyl group (preferably a 3,7,11-trimethyldodecyl group), a tetradecyl group, a pentadecyl group, a hexadecyl group, a tetramethylhexadecyl group (preferably a 3,7,11,15-tetramethylhexadecyl group), a heptadecyl group, an octadecyl group, a 2-butylhexyl group, a 2-butyloctyl group, a 1-pentylhexyl group, a 2-pentylheptyl group, a 3-pentyloctyl group, a 1-hexylheptyl group, and a 1-hexylnonyl group. Examples include a 2-hexyloctyl group, a 2-hexyldecyl group, a 3-hexylnonyl group, a 1-heptyloctyl group, a 2-heptylnonyl group, a 2-heptylundecyl group, a 3-heptyldecyl group, a 1-octylnonyl group, a 2-octyldecyl group, a 2-octyldodecyl group, a 3-octylundecyl group, a 2-nonylundecyl group, a 3-nonyldodecyl group, a 2-decyldodecyl group, a 2-decyltetradecyl group, a 3-decyltridecyl group, and a 2-(4,4-dimethylpentan-2-yl)-5,7,7-trimethyloctyl group. The alkenyl group having 10 to 24 carbon atoms may be linear or branched, open-chain or cyclic.Specific examples include a decenyl group, an undecenyl group, a dodecenyl group, a dodecadienyl group, a tridecenyl group (preferably, a (Z)-tridec-8-enyl group), a tetradecenyl group (preferably, a tetradec-9-enyl group), a pentadecenyl group (preferably, a (Z)-pentadecen-8-enyl group), a hexadecenyl group (preferably, a (Z)-hexadecan-9-enyl group), a hexadecadienyl group, a heptadecenyl group (preferably, a (Z)-heptadecan-8-enyl group), a heptadecadienyl group (preferably, a (8Z,11Z)-heptadecan-8,11-dienyl group), an octadecenyl group (preferably, a (Z)-octadec-9-enyl group), and an octadecadienyl group (preferably, a (9Z,12Z)-octadecan-9,12-dienyl group). The alkynyl group having 10 to 24 carbon atoms may be linear or branched, and may be linear or cyclic. Specific examples include decynyl, undecynyl, dodecynyl, tetradecynyl, pentadecynyl, hexadecynyl, heptadecynyl, and octadecynyl. Each of the above alkenyl groups preferably has one or two double bonds, and each of the alkynyl groups preferably has one or two triple bonds.

[0017] R 22 and R 32 Regarding the above, the divalent linking group and hydrocarbon linking group having 1 to 18 carbon atoms is preferably an alkylene group having 1 to 18 carbon atoms or an alkenylene group having 2 to 18 carbon atoms. The alkylene group having 1 to 18 carbon atoms may be linear or branched, and may be chain-like or cyclic. The number of carbon atoms is preferably 1 to 12, more preferably 1 to 10, and even more preferably 2 to 10. Specific examples include a methylene group, ethylene group, trimethylene group, tetramethylene group, pentamethylene group, hexamethylene group, heptamethylene group, octamethylene group, nonamethylene group, decamethylene group, undecamethylene group, and dodecamethylene group. The alkenylene group having 2 to 18 carbon atoms may be linear or branched, and may be chain-like or cyclic. The number of carbon atoms is preferably 1 to 12, and more preferably 2 to 10.

[0018] L 1The preferred range of is —O(CO)O—, —O(CO)—, or —(CO)O—, and —O(CO)— or —(CO)O— is more preferred. 2 The preferred range is —O(CO)O—, —O(CO)—, or —(CO)O—, and —O(CO)— or —(CO)O— is more preferred.

[0019] R 4 , R 6 , R 9 , R 10 , R 11 , and R 12 The alkyl group having 1 to 18 carbon atoms in the optionally substituted alkyl group having 1 to 18 carbon atoms may be linear or branched, and may be linear or cyclic. The number of carbon atoms is preferably 1 to 12. Specific examples include a methyl group, an ethyl group, a propyl group, an isopropyl group, a cyclopropyl group, a butyl group, an isobutyl group, a tert-butyl group, a cyclobutyl group, a pentyl group, a cyclopentyl group, a hexyl group, a cyclohexyl group, a heptyl group, an octyl group, a nonyl group, a decyl group, an undecyl group, and a dodecyl group. When the alkyl group has a substituent, the substituent may be a hydroxyl group, a carboxyl group, or a -O(CO)O-R 41 , —O(CO)—R 42 , -(CO)O-R 43 , or -O-R 44 A group represented by —O(CO)—R 42 or -(CO)O-R 43 A group represented by the following formula is more preferred.

[0020] R 5 , R 7 , and R 8The alkyl group having 1 to 18 carbon atoms in the optionally substituted alkyl group having 1 to 18 carbon atoms may be linear or branched, chain-like or cyclic. The number of carbon atoms is preferably 1 to 12, and more preferably 1 to 8. Specific examples include a methyl group, an ethyl group, a propyl group, an isopropyl group, a cyclopropyl group, a butyl group, an isobutyl group, a tert-butyl group, a cyclobutyl group, a pentyl group, a cyclopentyl group, a hexyl group, a cyclohexyl group, a heptyl group, an octyl group, a nonyl group, a decyl group, an undecyl group, and a dodecyl group. When the alkyl group has a substituent, the substituent may be a hydroxyl group, a carboxyl group, or a -O(CO)O-R 41 , —O(CO)—R 42 , -(CO)O-R 43 , or -O-R 44 A group represented by the formula: —O(CO)—R 42 , -(CO)O-R 43 A group represented by the following formula is more preferred.

[0021] Examples of the 4- to 7-membered ring which may contain an O atom include an azetidine ring, a pyrrolidine ring, a piperidine ring, a morpholine ring, and an azepane ring, and a 6-membered ring is preferred, with a piperidine ring and a morpholine ring being more preferred.

[0022] R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 10 , R 11 , and R 12 In the case where the substituent on the optionally substituted alkyl group having 1 to 18 carbon atoms is a substituted or unsubstituted aryl group, the aryl group preferably has 6 to 22 carbon atoms, more preferably 6 to 18 carbon atoms, and even more preferably 6 to 10 carbon atoms. Specific examples include a phenyl group, a naphthyl group, an anthracenyl group, and a phenanthrenyl group. Examples of the substituent on the aryl group include an alkyl group having 1 to 18 carbon atoms, a hydroxyl group, a carboxyl group, and -NR 45 R 46 an amino group represented by —O(CO)O—R 41 , —O(CO)—R 42, -(CO)O-R 43 , or -O-R 44 A group represented by the formula: is preferred, and a hydroxyl group or a carboxyl group is more preferred. Specific examples of the substituted aryl group include a hydroxyphenyl group and a carboxyphenyl group.

[0023] R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 10 , R 11 , and R 12 In the case where the substituent on the optionally substituted alkyl group having 1 to 18 carbon atoms is a substituted or unsubstituted heteroaryl group, the heteroaryl group preferably has 1 to 12 carbon atoms, more preferably 1 to 6 carbon atoms. Specific examples include a pyridyl group, a pyrazolyl group, an imidazolyl group, a benzimidazolyl group, a thiazolyl group, and an oxazolyl group. Examples of the substituent on the heteroaryl group include an alkyl group having 1 to 18 carbon atoms, a hydroxyl group, a carboxyl group, and -NR 45 R 46 an amino group represented by —O(CO)O—R 41 , —O(CO)—R 42 , -(CO)O-R 43 , or -O-R 44 A group represented by the formula: is preferred, and a hydroxyl group or a carboxyl group is more preferred. Specific examples of the substituted or unsubstituted heteroaryl group include a hydroxypyridyl group, a carboxypyridyl group, and a pyridonyl group.

[0024] R 41 , R 42 , R 43 , R 44 , R 45 and R 46The hydrocarbon group having 1 to 18 carbon atoms in the above formula is preferably an alkyl group having 1 to 18 carbon atoms, an alkenyl group having 2 to 18 carbon atoms, or an alkynyl group having 2 to 18 carbon atoms, and more preferably an alkyl group having 1 to 18 carbon atoms or an alkenyl group having 2 to 18 carbon atoms. The alkyl group having 1 to 18 carbon atoms may be linear or branched, and may be linear or cyclic. The number of carbon atoms is preferably 3 to 18, and more preferably 5 to 18. Specific examples include propyl, isopropyl, cyclopropyl, butyl, isobutyl, tert-butyl, cyclobutyl, pentyl, cyclopentyl, hexyl, cyclohexyl, heptyl, octyl, nonyl, decyl, undecyl, dodecyl, tridecyl, trimethyldodecyl (preferably 3,7,11-trimethyldodecyl), tetradecyl, pentadecyl, hexadecyl, heptadecyl, octadecyl, and benzyl. The alkenyl group having 2 to 18 carbon atoms may be linear or branched, open-chain, or cyclic. The number of carbon atoms is preferably 3 to 18, and more preferably 5 to 18. Specifically, an allyl group, a prenyl group, a pentenyl group, a hexenyl group, a heptenyl group, an octenyl group, a nonenyl group (preferably, a (Z)-2-nonenyl group or an (E)-2-nonenyl group), a decenyl group, an undecenyl group, a dodecenyl group, a dodecadienyl group, a tridecenyl group (preferably, a (Z)-tridec-8-enyl group), a tetradecenyl group (preferably, a tetradec-9-enyl group), a pentadecenyl group (preferably, a (Z)-pentadecen-8-enyl group), , a hexadecenyl group (preferably a (Z)-hexadec-9-enyl group), a hexadecadienyl group, a heptadecenyl group (preferably a (Z)-heptadeca-8-enyl group), a heptadecadienyl group (preferably a (8Z,11Z)-heptadeca-8,11-dienyl group), an octadecenyl group (preferably a (Z)-octadec-9-enyl group), an octadecadienyl group (preferably a (9Z,12Z)-octadeca-9,12-dienyl group), and the like. The alkynyl group having 2 to 18 carbon atoms may be linear or branched, and may be linear or cyclic. The number of carbon atoms is preferably 3 to 18, and more preferably 5 to 18.Specific examples include a propargyl group, butynyl group, pentynyl group, hexynyl group, heptynyl group, octynyl group, nonynyl group, decynyl group, undecynyl group, dodecynyl group, tetradecynyl group, pentadecynyl group, hexadecynyl group, heptadecynyl group, and octadecynyl group.

[0025] X is -NR 1 When indicating -, R 1 is a hydrocarbon group having 6 to 24 carbon atoms, or R 21 -L 1 -R 22 In this case, R 2 and R 3 is a hydrogen atom; 2 and R 3 the other is a hydrocarbon group having 6 to 24 carbon atoms, or R 31 -L 2 -R 32 It is preferred that the group is represented by -.

[0026] When X represents —O—, R 2 and R 3 are each independently a hydrocarbon group having 6 to 24 carbon atoms, or R 31 -L 2 -R 32 It is preferred that the group is represented by -.

[0027] R 4 , R 6 , R 9 , R 10 , R 11 , and R 12 is preferably a hydrogen atom.

[0028] R 5 represents a hydrogen atom, an alkyl group having 1 to 18 carbon atoms, or —O(CO)—R 42 or -(CO)O-R 43 Preferably, R is an alkyl group having 1 to 18 carbon atoms which may be substituted with an alkyl group having 1 to 18 carbon atoms which may be substituted with an aryl group, or an alkyl group having 1 to 18 carbon atoms which may be substituted with a hydroxyl group. When R is an alkyl group, 4 , R 6 , R 10 and R 12and may be linked together to form a ring which may contain an O atom. Among these, alkyl groups having 1 to 18 carbon atoms, —O(CO)—R 42 or -(CO)O-R 43 The alkyl group may be substituted with an alkyl group having 1 to 18 carbon atoms, an alkyl group having 1 to 12 carbon atoms, or an alkyl group having 1 to 8 carbon atoms, which may be substituted with a hydroxyl group. 42 or -(CO)O-R 43 It is more preferably an alkyl group having 1 to 18 carbon atoms which may be substituted with.

[0029] R 7 and R 8 each independently represents a hydrogen atom, a hydrocarbon group having 1 to 18 carbon atoms, or —O(CO)—R 42 , -(CO)O-R 43 or -O-R 44 an alkyl group having 1 to 18 carbon atoms which may be substituted with an alkyl group having 1 to 8 carbon atoms which may be substituted with an aryl group, or an alkyl group having 1 to 8 carbon atoms which may be substituted with a hydroxyl group, or R 7 and R 8 are preferably linked to each other to form a 4- to 7-membered ring which may contain an O atom.

[0030] R 5 and R 7 or R 8 are not linked to each other and do not form a ring.

[0031] a+b is preferably 1 or 2, and more preferably 1. c+d is preferably 1 or 2, and more preferably 1.

[0032] The compound represented by formula (1) is preferably a compound represented by the following formula (1-1):

[0033] R 24 is a hydrogen atom, a hydrocarbon group having 6 to 24 carbon atoms, or R 21 -L 1 -R 22 represents a group represented by -, and R 21represents a hydrocarbon group having 1 to 24 carbon atoms, and L 1 is —O(CO)O—, —O(CO)—, —(CO)O—, —O—, or indicates R 22 represents a divalent linking group and a hydrocarbon linking group having 1 to 18 carbon atoms. 25 is a hydrogen atom, a hydrocarbon group having 3 to 24 carbon atoms, or R 31 -L 2 -R 32 represents a group represented by -, and R 31 represents a hydrocarbon group having 1 to 24 carbon atoms, and L 2 is —O(CO)O—, —O(CO)—, —(CO)O—, —O—, or indicates R 32 represents a divalent linking group and a hydrocarbon linking group having 1 to 18 carbon atoms. 4 , R 5 , R 6 , R 7 , R 8 , R 10 , and R 12 each independently represents a hydrogen atom or an optionally substituted alkyl group having 1 to 18 carbon atoms; R 4 and R 5 , R 10 and R 5 , R 5 and R 12 , R 4 and R 6 , R 5 and R 6 , R 6 and R 7 , R 6 and R 10 , R 12 and R 7 , and R 7 and R 8 Any one or more pairs of may be linked to each other to form a 4- to 7-membered ring which may contain an O atom. 5 and R 7 or R 8 and do not bond to each other and do not form a ring. The substituent on the optionally substituted alkyl group having 1 to 18 carbon atoms is a hydroxyl group, a carboxyl group, -NR 45 R46 an amino group represented by the formula: 41 , —O(CO)—R 42 , -(CO)O-R 43 , or -O-R 44 and R 41 , R 42 , R 43 , R 44 , R 45 and R 46 each independently represents a hydrocarbon group having 1 to 18 carbon atoms, and the substituent on the substituted or unsubstituted aryl group and the substituted or unsubstituted heteroaryl group is an alkyl group having 1 to 18 carbon atoms, a hydroxyl group, a carboxyl group, —NR 45 R 46 an amino group represented by —O(CO)O—R 41 , —O(CO)—R 42 , -(CO) O-R 43 , or -O-R 44 and R 41 , R 42 , R 43 , R 44 , R 45 and R 46 each independently represents a hydrocarbon group having 1 to 18 carbon atoms.

[0034] R in formula (1-1) 4 , R 5 , R 6 , R 7 , R 8 , R 10 , and R 12 The definition and preferred range of are the same as those of formula (1).

[0035] R in formula (1-1) 24is preferably an alkyl or alkenyl group having 6 to 24 carbon atoms. The alkyl group having 6 to 24 carbon atoms may be linear or branched, and may be chain-like or cyclic. The alkyl group having 6 to 24 carbon atoms is preferably an alkyl group having 8 to 20 carbon atoms. Specific examples include an octyl group, a nonyl group, a decyl group, an undecyl group, a dodecyl group, a tridecyl group, a trimethyldodecyl group (preferably, a 3,7,11-trimethyldodecyl group), a tetradecyl group, a pentadecyl group, a hexadecyl group, a tetramethylhexadecyl group (preferably, a 3,7,11,15-tetramethylhexadecyl group), a heptadecyl group, an octadecyl group, a nonadecyl group, and an icosyl group. The alkenyl group having 6 to 24 carbon atoms may be linear or branched, and may be chain-like or cyclic. The alkenyl group having 6 to 24 carbon atoms is preferably an alkenyl group having 8 to 20 carbon atoms. Specifically, octenyl group, nonenyl group, decenyl group, undecenyl group, dodecenyl group, dodecadienyl group, tridecenyl group, tetradecenyl group, pentadecenyl group, hexadecenyl group (preferably, (Z)-hexadec-9-enyl group), hexadecadienyl group, heptadecenyl group (preferably, (Z)-heptadeca-8-enyl group), heptadecadienyl group (preferably, (8Z,11Z)-heptadeca-8-enyl group), Examples of alkenyl groups include an octadecenyl group (preferably, (Z)-octadec-8,11-dienyl group), an octadecenyl group (preferably, (9Z,12Z)-octadeca-9,12-dienyl group), a nonadecenyl group, an icosenyl group (preferably, (Z)-icosa-11-enyl group), and an icosadienyl group (preferably, (11,14)-icosa-11,14-dienyl group). Each of the above alkenyl groups preferably has one or two double bonds.

[0036] R in formula (1-1) 25is preferably an alkyl or alkenyl group having 6 to 24 carbon atoms. The alkyl group having 6 to 24 carbon atoms may be linear or branched, and may be chain-like or cyclic. The alkyl group having 6 to 24 carbon atoms is preferably an alkyl group having 7 to 20 carbon atoms. Specific examples include hexyl, heptyl, octyl, nonyl, decyl, undecyl, dodecyl, tridecyl, trimethyldodecyl (preferably 3,7,11-trimethyldodecyl), tetradecyl, pentadecyl, hexadecyl, tetramethylhexadecyl (preferably 3,7,11,15-tetramethylhexadecyl), heptadecyl, and octadecyl. The alkenyl group having 6 to 24 carbon atoms may be linear or branched, and may be chain-like or cyclic. The alkenyl group having 6 to 24 carbon atoms is preferably an alkenyl group having 8 to 20 carbon atoms. Specifically, octenyl group, nonenyl group, decenyl group, undecenyl group, dodecenyl group, dodecadienyl group, tridecenyl group, tetradecenyl group, pentadecenyl group, hexadecenyl group (preferably, (Z)-hexadec-9-enyl group), hexadecadienyl group, heptadecenyl group (preferably, (Z)-heptadeca-8-enyl group), heptadecadienyl group (preferably, (8Z,11Z)-heptadeca-8-enyl group), Examples of alkenyl groups include an octadecenyl group (preferably, (Z)-octadec-8,11-dienyl group), an octadecenyl group (preferably, (9Z,12Z)-octadeca-9,12-dienyl group), a nonadecenyl group, an icosenyl group (preferably, (Z)-icosa-11-enyl group), and an icosadienyl group (preferably, (11,14)-icosa-11,14-dienyl group). Each of the above alkenyl groups preferably has one or two double bonds.

[0037] In a preferred embodiment, X represents —O—; 2 , R 3 , R 31 , L 2 , and R 32 is the same as that in formula (1), 4 , R 5 , R 6 , R 7 , R8 , R 9 , R 10 , R 11 , and R 12 each independently represents a hydrogen atom or an optionally substituted alkyl group having 1 to 18 carbon atoms, the substituents on the optionally substituted alkyl group having 1 to 18 carbon atoms, the substituents on the substituted or unsubstituted aryl group, and the substituents on the substituted or unsubstituted heteroaryl group are defined as in formula (1), a+b is 1, and c+d is 1 or 2.

[0038] In a more preferred embodiment, the compound represented by formula (1) is a compound represented by the following formula (1-2):

[0039] In the formula, R 2 and R 3 are each independently a hydrogen atom, a hydrocarbon group having 3 to 24 carbon atoms, or R 31 -L 2 -R 32 represents a group represented by -, R 31 represents a hydrocarbon group having 1 to 24 carbon atoms; L 2 is —O(CO)O—, —O(CO)—, —(CO)O—, —O—, or indicates, R 32 represents a divalent linking group, a hydrocarbon linking group having 1 to 18 carbon atoms; R 5 represents a hydrogen atom or an optionally substituted alkyl group having 1 to 18 carbon atoms; R 7 and R 8 each independently represents a hydrogen atom or an optionally substituted alkyl group having 1 to 18 carbon atoms, and the substituent on the optionally substituted alkyl group having 1 to 18 carbon atoms is a hydroxyl group, a carboxyl group, -NR 45 R 46 an amino group represented by the formula: 41 , —O(CO)—R 42 , -(CO)O-R 43 , or -O-R 44 and R 41 , R 42 , R43 , R 44 , R 45 and R 46 each independently represents a hydrocarbon group having 1 to 18 carbon atoms, and the substituent on the substituted or unsubstituted aryl group and the substituted or unsubstituted heteroaryl group is an alkyl group having 1 to 18 carbon atoms, a hydroxyl group, a carboxyl group, —NR 45 R 46 an amino group represented by —O(CO)O—R 41 , —O(CO)—R 42 , -(CO)O-R 43 , or -O-R 44 and R 41 , R 42 , R 43 , R 44 , R 45 and R 46 each independently represents a hydrocarbon group having 1 to 18 carbon atoms, and e represents 2 or 3. 2 , R 3 , R 5 , R 7 and R 8 The definition of is the same as that of equation (1).

[0040] In formula (1-2), preferably, R 7 and R 8 each independently represents a hydrogen atom or an optionally substituted alkyl group having 1 to 18 carbon atoms; R 5 The substituent on the alkyl group having 1 to 18 carbon atoms which may be substituted is a hydroxyl group, a substituted or unsubstituted aryl group, —O(CO)O—R 41 , —O(CO)—R 42 , -(CO)O-R 43 , or -O-R 44 and R 41 , R 42 , R 43 , R 44 , R 45 and R 46 each independently represents a hydrocarbon group having 1 to 18 carbon atoms, and the substituent on the substituted or unsubstituted aryl group is an alkyl group having 1 to 18 carbon atoms, a hydroxyl group, a carboxyl group, -NR 45 R46 an amino group represented by —O(CO)O—R 41 , —O(CO)—R 42 , -(CO)O-R 43 , or -O-R 44 and R 41 , R 42 , R 43 , R 44 , R 45 and R 46 each independently represents a hydrocarbon group having 1 to 18 carbon atoms.

[0041] In formula (1-2), more preferably, R 2 and R 3 are each independently a hydrocarbon group having 3 to 24 carbon atoms, or R 31 -L 2 -R 32 represents a group represented by -, and L 2 represents —O(CO)— or —(CO)O—, and R 7 and R 8 each independently represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms; R 5 The substituent on the alkyl group having 1 to 18 carbon atoms which may be substituted with respect to the above group is an unsubstituted aryl group, —O(CO)—R 42 or -(CO)O-R 43 and R 42 and R 43 each independently represents a hydrocarbon group having 1 to 18 carbon atoms.

[0042] In formula (1-2), more preferably, R 2 and R 3 each independently represents a hydrogen atom or a hydrocarbon group having 3 to 24 carbon atoms; R 7 and R 8 each independently represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms; R 5 The substituent on the alkyl group having 1 to 18 carbon atoms which may be substituted with respect to the above group is an unsubstituted aryl group, —O(CO)—R 42 or -(CO)O-R 43 and R 42 , and R 43each independently represents a hydrocarbon group having 1 to 18 carbon atoms.

[0043] In formula (1-2), preferably, R 2 and R 3 At least one of 31 -L 2 -R 32 represents a group represented by -, and L 2 represents —O(CO)— or —(CO)O—, and R 7 and R 8 each independently represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms; R 5 The substituent on the alkyl group having 1 to 18 carbon atoms which may be substituted with respect to the above group is an unsubstituted aryl group, —O(CO)—R 42 or -(CO)O-R 43 and R 42 , and R 43 each independently represents a hydrocarbon group having 1 to 18 carbon atoms.

[0044] In formula (1-2), more preferably, R 2 and R 3 are each independently R 31 -L 2 -R 32 represents a group represented by -, and L 2 represents —O(CO)— or —(CO)O—, and R 7 and R 8 each independently represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms; R 5 The substituent on the alkyl group having 1 to 18 carbon atoms which may be substituted with respect to the above group is an unsubstituted aryl group, —O(CO)—R 42 or -(CO)O-R 43 and R 42 , and R 43 each independently represents a hydrocarbon group having 1 to 18 carbon atoms.

[0045] In formula (1-2), preferably, R 2 and R 3 One of them is R 31 -L 2 -R 32 represents a group represented by -, and R2 and R 3 the other represents a hydrocarbon group having 3 to 24 carbon atoms, and L 2 represents —O(CO)— or —(CO)O—, and R 7 and R 8 each independently represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms; R 5 The substituent on the alkyl group having 1 to 18 carbon atoms which may be substituted with respect to the above group is an unsubstituted aryl group, —O(CO)—R 42 or -(CO)O-R 43 and R 42 , and R 43 each independently represents a hydrocarbon group having 1 to 18 carbon atoms. In formula (1-2), R 2 and R 3 One of them is R 31 -L 2 -R 32 represents a group represented by -, and R 2 and R 3 the other represents a hydrocarbon group having 6 carbon atoms, and L 2 represents —O(CO)— or —(CO)O—, and R 7 and R 8 each independently represents a hydrogen atom or an optionally substituted alkyl group having 1 to 18 carbon atoms; R 5 The substituent on the alkyl group having 1 to 18 carbon atoms that may be substituted is —O(CO)—R 42 or -(CO)O-R 43 and R 42 , and R 43 each independently represents a hydrocarbon group having 1 to 18 carbon atoms.

[0046] In formula (1-2), more preferably, R 2 and R 3 One of them is R 31 -L 2 -R 32 represents a group represented by -, and R 2 and R 3 the other represents a hydrocarbon group having 6 carbon atoms, and L 2 represents —O(CO)— or —(CO)O—, and R5 represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms, and R 7 and R 8 each independently represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms.

[0047] In formula (1-2), more preferably, R 2 and R 3 One of them is R 31 -L 2 -R 32 represents a group represented by -, and R 2 and R 3 the other represents a hydrocarbon group having 6 carbon atoms, and L 2 represents —O(CO)— or —(CO)O—, and R 5 represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms, and R 7 and R 8 each independently represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms, and e represents 2. In formula (1-2), R 2 and R 3 One of them is R 31 -L 2 -R 32 represents a group represented by -, and R 2 and R 3 the other represents a hydrocarbon group having 3 to 5 carbon atoms, and L 2 represents —O(CO)— or —(CO)O—, and R 5 represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms, and R 7 and R 8 each independently represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms.

[0048] In formula (1-2), more preferably, R 2 and R 3 One of them is R 31 -L 2 -R 32 represents a group represented by -, and R 2 and R 3 the other represents a hydrocarbon group having 3 to 5 carbon atoms, and L 2 represents —O(CO)— or —(CO)O—, and R 5represents a hydrogen atom or an optionally substituted alkyl group having 1 to 18 carbon atoms, and R 7 and R 8 each independently represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms, and e represents 2. In formula (1-2), R 2 and R 3 One of them is R 31 -L 2 -R 32 represents a group represented by -, and R 2 and R 3 the other represents a hydrocarbon group having 6 carbon atoms, and L 2 represents —O(CO)— or —(CO)O—, and R 5 represents a hydrogen atom or a substituted alkyl group having 1 to 18 carbon atoms, and R 7 and R 8 each independently represents a hydrogen atom or an optionally substituted alkyl group having 1 to 18 carbon atoms, and the substituent on the substituted alkyl group having 1 to 18 carbon atoms is a hydroxy group, —O(CO)—R 42 , -(CO)O-R 43 or -O-R 44 and R 42 , and R 43 each independently represents a hydrocarbon group having 1 to 18 carbon atoms.

[0049] In formula (1-2), more preferably, R 2 and R 3 One of them is R 31 -L 2 -R 32 represents a group represented by -, and R 2 and R 3 the other represents a hydrocarbon group having 6 carbon atoms, and L 2 represents —O(CO)— or —(CO)O—, and R 5 represents a hydrogen atom or a substituted alkyl group having 1 to 18 carbon atoms, and R 7 and R 8 each independently represents a hydrogen atom or an alkyl group having 1 to 18 carbon atoms, and the substituent on the substituted alkyl group having 1 to 18 carbon atoms is —O(CO)—R 42 or -(CO)O-R 43and R 42 , and R 43 each independently represents a hydrocarbon group having 1 to 18 carbon atoms, and e represents 2.

[0050] The compound may form a salt. Examples of salts of basic groups include salts with mineral acids such as hydrochloric acid, hydrobromic acid, nitric acid, and sulfuric acid; salts with organic carboxylic acids such as formic acid, acetic acid, citric acid, oxalic acid, fumaric acid, maleic acid, succinic acid, malic acid, tartaric acid, aspartic acid, trichloroacetic acid, and trifluoroacetic acid; and salts with sulfonic acids such as methanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, mesitylenesulfonic acid, and naphthalenesulfonic acid. Salts of acidic groups include, for example, salts with alkali metals such as sodium and potassium, salts with alkaline earth metals such as calcium and magnesium, ammonium salts, and salts with nitrogen-containing organic bases such as trimethylamine, triethylamine, tributylamine, pyridine, N,N-dimethylaniline, N-methylpiperidine, N-methylmorpholine, diethylamine, dicyclohexylamine, procaine, dibenzylamine, N-benzyl-β-phenethylamine, 1-ephenamine, and N,N'-dibenzylethylenediamine. Of the above-mentioned salts, preferred salts include pharmacologically acceptable salts.

[0051] Preferred specific examples of the compound represented by formula (1) include the compounds described in the Examples below, but the present invention is not to be construed as being limited thereto.

[0052] <Compound Represented by Formula (2) or Salt Thereof> The ionizable lipid is preferably a compound represented by formula (2) or a salt thereof. In the formula, R 101 and R 102 each independently represents a hydrocarbon group having 1 to 18 carbon atoms; R 103 represents a hydrocarbon group having 2 to 8 carbon atoms, and R 101 , R 102 and R 103 The hydrocarbon group represented by is —OH, COOH, —NR 151 R152 , -OC(O)OR 153 , -C(O)O-R 154 , —OC(O)—R 155 , and -O-R 156 and R 102 and R 103 may be linked together to form a 4- to 7-membered ring, R 104 represents a hydrocarbon group having 1 to 8 carbon atoms, and R 105 and R 106 are each independently a hydrocarbon group having 1 to 8 carbon atoms, or -R 108 -L 101 -R 109 where R 105 and R 106 and R are both hydrocarbon groups having 1 to 8 carbon atoms, 107 is -R 110 -L 102 -R 111 -L 103 -R 112 indicates, R 151 and R 152 each independently represents a hydrocarbon group having 1 to 8 carbon atoms; R 153 , R 154 , R 155 , and R 156 each independently represents a hydrocarbon group having 1 to 24 carbon atoms; R 153 , R 154 , R 155 , and R 156 The hydrocarbon group represented by is an aryl group having 6 to 20 carbon atoms or -S-R 158 The aryl group having 6 to 20 carbon atoms may be substituted with —OH, —COOH, —NR 151 R 152 , -OC(O)OR 153 , -C(O)O-R 154 , —OC(O)—R 155 , -O-R 156 or -(C1-C12 hydrocarbon group)-R 157 and R 158 represents a hydrocarbon group having 1 to 12 carbon atoms, and R 157 is -OH, COOH, -NR161 R 162 , -OC(O)OR 163 , -C(O)O-R 164 , —OC(O)—R 165 , -O-R 166 Indicates. 161 and R 162 each independently represents a hydrocarbon group having 1 to 8 carbon atoms; R 163 , R 164 , R 165 , and R 166 each independently represents a hydrocarbon group having 1 to 24 carbon atoms; R 163 , R 164 , R 165 , and R 166 The hydrocarbon group represented by is an aryl group having 6 to 20 carbon atoms or -S-R 168 The aryl group having 6 to 20 carbon atoms may be substituted with —OH, —COOH, —NR 161 R 162 , -OC(O)OR 163 , -C(O)O-R 164 , —OC(O)—R 165 , -O-R 166 or - optionally substituted with a hydrocarbon group having 1 to 12 carbon atoms, R 168 represents a hydrocarbon group having 1 to 12 carbon atoms; L 101 , L 102 , and L 103 R each independently represents —OC(O)O—, —C(O)O—, —OC(O)—, or —O—. 108 represents a hydrocarbon group having 1 to 12 carbon atoms, and R 109 represents a hydrocarbon group having 1 to 24 carbon atoms, R 110 represents a hydrocarbon group having 1 to 8 carbon atoms, and R 111 represents a hydrocarbon group having 1 to 24 carbon atoms, R 112 represents a hydrocarbon group having 1 to 24 carbon atoms, R 109 , and R 112 The hydrocarbon group represented by is an aryl group, —OC(O)O—R 153 , -C(O)O-R 154 , —OC(O)—R 155 , or -S-R 158 and R153 , R 154 , R 155 , and R 158 is defined as above, and R 111 The hydrocarbon group represented by is —OC(O)O—R 153 , -C(O)O-R 154 or —OC(O)—R 155 and R 153 , R 154 , and R 155 The definition of is as above.

[0053] The hydrocarbon group having 1 to 24 carbon atoms, the hydrocarbon group having 1 to 18 carbon atoms, the hydrocarbon group having 1 to 12 carbon atoms, the hydrocarbon group having 2 to 8 carbon atoms, and the hydrocarbon group having 1 to 8 carbon atoms are preferably an alkyl group, an alkenyl group, or an alkynyl group, respectively.

[0054] The alkyl group may be linear or branched, and may be linear or cyclic. Specific examples of the alkyl group include a methyl group, an ethyl group, a propyl group, an isopropyl group, a cyclopropyl group, a butyl group, an isobutyl group, a tert-butyl group, a cyclobutyl group, a pentyl group, a cyclopentyl group, a hexyl group, a cyclohexyl group, a heptyl group, an octyl group, a nonyl group, a decyl group, an undecyl group, a dodecyl group, a tridecyl group, a trimethyldodecyl group (preferably a 3,7,11-trimethyldodecyl group), a tetradecyl group, a pentadecyl group, a hexadecyl group, a tetramethylhexadecyl group (preferably a 3,7,11,15-tetramethylhexadecyl group), a heptadecyl group, an octadecyl group, a 2-butylhexyl group, a 2-butyloctyl group, a 1- Examples thereof include a pentylhexyl group, a 2-pentylheptyl group, a 3-pentyloctyl group, a 1-hexylheptyl group, a 1-hexylnonyl group, a 2-hexyloctyl group, a 2-hexyldecyl group, a 3-hexylnonyl group, a 1-heptyloctyl group, a 2-heptylnonyl group, a 2-heptylundecyl group, a 3-heptyldecyl group, a 1-octylnonyl group, a 2-octyldecyl group, a 2-octyldodecyl group, a 3-octylundecyl group, a 2-nonylundecyl group, a 3-nonyldodecyl group, a 2-decyldodecyl group, a 2-decyltetradecyl group, a 3-decyltridecyl group, a 2-(4,4-dimethylpentan-2-yl)-5,7,7-trimethyloctyl group, and a benzyl group.

[0055] The alkenyl group may be linear or branched, linear or cyclic. Specific examples include allyl, prenyl, pentenyl, hexenyl, heptenyl, octenyl, nonenyl (preferably, (Z)-2-nonenyl or (E)-2-nonenyl), decenyl, undecenyl, dodecenyl, dodecadienyl, tridecenyl (preferably, (Z)-tridec-8-enyl), tetradecenyl (preferably, tetradec-9-enyl), and pentadecenyl (preferably, (Z)-pentadecen-8-enyl). , a hexadecenyl group (preferably a (Z)-hexadec-9-enyl group), a hexadecadienyl group, a heptadecenyl group (preferably a (Z)-heptadeca-8-enyl group), a heptadecadienyl group (preferably a (8Z,11Z)-heptadeca-8,11-dienyl group), an octadecenyl group (preferably a (Z)-octadec-9-enyl group), an octadecadienyl group (preferably a (9Z,12Z)-octadeca-9,12-dienyl group), and the like.

[0056] The alkynyl group may be linear or branched, open-chain or cyclic, and specific examples thereof include a propargyl group, a butynyl group, a pentynyl group, a hexynyl group, a heptynyl group, an octynyl group, a nonynyl group, a decynyl group, an undecynyl group, a dodecynyl group, a tetradecynyl group, a pentadecynyl group, a hexadecynyl group, a heptadecynyl group, and an octadecynyl group.

[0057] Preferably, all of the above alkenyl groups have one or two double bonds, and preferably, all of the alkynyl groups have one or two triple bonds.

[0058] The hydrocarbon group having 1 to 12 carbon atoms in the hydrocarbon group having 1 to 12 carbon atoms is preferably an alkylene group having 1 to 12 carbon atoms or an alkenylene group having 2 to 12 carbon atoms. The alkylene group having 1 to 12 carbon atoms and the alkenylene group having 2 to 12 carbon atoms may be linear or branched, and may be linear or cyclic. Specific examples include a methylene group, an ethylene group, a trimethylene group, a tetramethylene group, a pentamethylene group, a hexamethylene group, a heptamethylene group, an octamethylene group, a nonamethylene group, a decamethylene group, and an undecamethylene group.

[0059] The aryl group preferably has 6 to 20 carbon atoms, more preferably 6 to 18 carbon atoms, and even more preferably 6 to 10 carbon atoms. Specific examples include a phenyl group, a naphthyl group, an anthracenyl group, and a phenanthrenyl group.

[0060] R 101 and R 102 R each independently represents a hydrocarbon group having preferably 1 to 12 carbon atoms, more preferably a hydrocarbon group having 1 to 6 carbon atoms, and even more preferably a hydrocarbon group having 1 to 3 carbon atoms. 103 R preferably represents a hydrocarbon group having 2 to 6 carbon atoms, and more preferably represents a hydrocarbon group having 2 to 4 carbon atoms. 101 , R 102 and R 103 The hydrocarbon group represented by may preferably be substituted with —OH.

[0061] L 101 , and L 103 each independently preferably represents —C(O)O— or —OC(O)—. 102 preferably represents —OC(O)O—, —C(O)O—, or —OC(O)—.

[0062] R 108 R preferably represents a hydrocarbon group having 1 to 10 carbon atoms, and more preferably represents a hydrocarbon group having 1 to 8 carbon atoms. 109 R preferably represents a hydrocarbon group having 1 to 20 carbon atoms, and more preferably represents a hydrocarbon group having 1 to 16 carbon atoms. 111R preferably represents a hydrocarbon group having 1 to 16 carbon atoms, and more preferably represents a hydrocarbon group having 1 to 9 carbon atoms. 112 R preferably represents a hydrocarbon group having 1 to 20 carbon atoms, and more preferably represents a hydrocarbon group having 1 to 16 carbon atoms. 109 , and R 112 The hydrocarbon group represented by is preferably an aryl group or —S—R 158 where R 158 R preferably represents a hydrocarbon group having 1 to 8 carbon atoms. 111 The hydrocarbon group represented by is preferably —C(O)O—R 155 , or -OC(O)-R 156 where R 155 , and R 156 R each independently represents a hydrocarbon group having 1 to 16 carbon atoms; 155 , and R 156 The hydrocarbon group represented by is preferably an aryl group having 6 to 20 carbon atoms or —S—R 158 and R 158 The definition of is as above.

[0063] The compound represented by formula (2) is preferably, as a first example, a compound represented by the following formula (2-1). In the formula, R 101 and R 102 each independently represents a hydrocarbon group having 1 to 18 carbon atoms; R 103 represents a hydrocarbon group having 2 to 8 carbon atoms, and R 101 , R 102 and R 103 The hydrocarbon group represented by is —OH, COOH, —NR 151 R 152 , -OC(O)OR 153 , -C(O)O-R 154 , —OC(O)—R 155 , or -O-R 156 and R 102 and R 103 may be linked together to form a 4- to 7-membered ring, R 104 represents a hydrocarbon group having 1 to 8 carbon atoms, and R 105 and R106 are each independently a hydrocarbon group having 1 to 8 carbon atoms, or -R 108 -L 101 -R 109 where R 105 and R 106 and L are both hydrocarbon groups having 1 to 8 carbon atoms, 101 and L 104 represents —OC(O)O—, —C(O)O—, —OC(O)—, or —O—, and R 108 represents a hydrocarbon group having 1 to 12 carbon atoms, and R 109 represents a hydrocarbon group having 1 to 24 carbon atoms, and R 109 The hydrocarbon group represented by is an aryl group, —OC(O)O—R 153 , -C(O)O-R 154 , —OC(O)—R 155 , or -S-R 158 and R 151 and R 152 each independently represents a hydrocarbon group having 1 to 8 carbon atoms; R 153 , R 154 , R 155 , and R 156 each independently represents a hydrocarbon group having 1 to 24 carbon atoms; R 153 , R 154 , R 155 , and R 156 The hydrocarbon group represented by is an aryl group having 6 to 20 carbon atoms or -S-R 158 The aryl group having 6 to 20 carbon atoms may be substituted with —OH, —COOH, —NR 151 R 152 , -OC(O)OR 153 , -C(O)O-R 154 , —OC(O)—R 155 , -O-R 156 or -(C1-C12 hydrocarbon group)-R 157 and R 158 represents a hydrocarbon group having 1 to 12 carbon atoms, and R 157 is -OH, COOH, -NR 151 R 152 , -OC(O)OR 153 , -C(O)O-R 154, —OC(O)—R 155 , -O-R 156 Indicates. 113 represents a hydrocarbon group having 1 to 8 carbon atoms, and R 114 is -R 115 -L 105 -R 116 indicates R 115 represents a hydrocarbon group having 1 to 24 carbon atoms, and L 105 represents a bond, —OC(O)O—, —C(O)O—, —OC(O)—, or —O—, and R 116 represents a hydrocarbon group having 1 to 24 carbon atoms, R 115 The hydrocarbon group having 1 to 24 carbon atoms represented by is —OC(O)O—R 153 , -C(O)O-R 154 , or —OC(O)—R 155 and R 153 , R 154 , and R 155 is defined as above, and R 116 The hydrocarbon group having 1 to 24 carbon atoms represented by is an aryl group having 6 to 20 carbon atoms, —OC(O)O—R 153 , -C(O)O-R 154 , —OC(O)—R 155 , or -S-R 158 and R 153 , R 154 , R 155 , and R 158 The definition of is as above.

[0064] In formula (2-1), R 101 and R 102 R each independently represents a hydrocarbon group having preferably 1 to 12 carbon atoms, more preferably a hydrocarbon group having 1 to 6 carbon atoms, and even more preferably a hydrocarbon group having 1 to 3 carbon atoms. 103 R preferably represents a hydrocarbon group having 2 to 6 carbon atoms, and more preferably represents a hydrocarbon group having 2 to 4 carbon atoms. 101 , R 102 and R 103 The hydrocarbon group represented by may preferably be substituted with an —OH or —O-benzyl group.

[0065] L 101and L 104 preferably represents —C(O)O— or —OC(O)—. 108 R preferably represents a hydrocarbon group having 1 to 10 carbon atoms, and more preferably represents a hydrocarbon group having 1 to 8 carbon atoms. 109 preferably represents a hydrocarbon group having 1 to 18 carbon atoms, and R 109 The hydrocarbon group represented by is an aryl group having 6 to 20 carbon atoms, or -S-R 158 may be substituted with R 114 is preferably —R 115 -L 105 -R 116 indicates R 115 represents a hydrocarbon group having 1 to 18 carbon atoms; L 105 represents -OC(O)O-, and R 116 represents a hydrocarbon group having 1 to 18 carbon atoms. 115 The hydrocarbon group having 1 to 18 carbon atoms represented by is preferably —C(O)O—R 155 , or —OC(O)—R 156 may be substituted with R 155 , and R 156 each independently represents a hydrocarbon group having 1 to 16 carbon atoms; R 155 , and R 156 The hydrocarbon group represented by is an aryl group having 6 to 20 carbon atoms or -S-R 158 and R 158 The definition of R is as above. 116 The hydrocarbon group having 1 to 18 carbon atoms represented by is preferably an aryl group or —S—R 158 and R 158 The definition of is as above.

[0066] A second example of the compound represented by formula (2) is preferably a compound represented by the following formula (2-2): In the formula, R 101 and R 102 each independently represents a hydrocarbon group having 1 to 18 carbon atoms; R 103 represents a hydrocarbon group having 2 to 8 carbon atoms, and R 101 , R 102 and R 103The hydrocarbon group represented by is —OH, COOH, —NR 151 R 152 , -OC(O)OR 153 , -C(O)O-R 154 , —OC(O)—R 155 , or -O-R 156 and R 102 and R 103 may be linked together to form a 4- to 7-membered ring, R 104 and R 108 each independently represents a hydrocarbon having 1 to 8 carbon atoms; R 121 and R 122 each independently represents a hydrocarbon group having 1 to 18 carbon atoms; R 123 and R 124 each independently represents a hydrocarbon group having 1 to 12 carbon atoms; R 125 and R 126 each independently represents a hydrocarbon group having 1 to 24 carbon atoms; L 121 and L 122 each independently represents —OC(O)O—, —C(O)O—, —OC(O)—, or —O—; R 125 and R 126 The hydrocarbon group represented by is an aryl group having 6 to 20 carbon atoms, —OC(O)O—R 153 , -C(O)O-R 154 , —OC(O)—R 155 , or -S-R 158 and R 151 and R 152 each independently represents a hydrocarbon group having 1 to 8 carbon atoms; R 153 , R 154 , R 155 and R 156 each independently represents a hydrocarbon group having 1 to 18 carbon atoms, and the aryl group having 6 to 20 carbon atoms is OH, COOH, —NR 151 R 152 , -OC(O)OR 153 , -C(O)O-R 154 , —OC(O)—R 155 , -O-R 156 or -(C1-C12 hydrocarbon group)-R 157and R 157 is -OH, COOH, -NR 151 R 152 , -OC(O)OR 153 , -C(O)O-R 154 , —OC(O)—R 155 , -O-R 156 Indicates. 158 represents a hydrocarbon group having 1 to 12 carbon atoms.

[0067] In formula (2-2), R 101 and R 102 R each independently represents a hydrocarbon group having preferably 1 to 12 carbon atoms, more preferably a hydrocarbon group having 1 to 6 carbon atoms, and even more preferably a hydrocarbon group having 1 to 3 carbon atoms. 101 and R 102 The hydrocarbon group represented by may preferably be substituted with —OH.

[0068] R 103 represents a hydrocarbon group preferably having 2 to 6 carbon atoms, and more preferably a hydrocarbon group having 2 to 4 carbon atoms.

[0069] R 121 and R 122 R each independently represents a hydrocarbon group preferably having 1 to 12 carbon atoms, more preferably a hydrocarbon group having 1 to 8 carbon atoms, and even more preferably a hydrocarbon group having 1 to 6 carbon atoms. 123 and R 124 R each independently represents a hydrocarbon group preferably having 1 to 10 carbon atoms, more preferably a hydrocarbon group having 1 to 8 carbon atoms. 125 and R 126 each independently represents a hydrocarbon group having preferably 1 to 20 carbon atoms, more preferably a hydrocarbon group having 1 to 16 carbon atoms, and even more preferably a hydrocarbon group having 1 to 12 carbon atoms. 121 and L 122 are each independently preferably —C(O)O— or —OC(O)—.

[0070] A third example of the compound represented by formula (2) is preferably a compound represented by the following formula (2-3). In the formula, R101 and R 102 each independently represents a hydrocarbon group having 1 to 18 carbon atoms; R 103 represents a hydrocarbon group having 2 to 8 carbon atoms, and R 101 , R 102 and R 103 The hydrocarbon group represented by is —OH, COOH, —NR 151 R 152 , -OC(O)OR 153 , -C(O)O-R 154 , —OC(O)—R 155 , or -O-R 156 and R 102 and R 103 may be linked together to form a 4- to 7-membered ring, R 104 and R 108 each independently represents a hydrocarbon group having 1 to 8 carbon atoms; R 131 , R 132 , R 133 , and R 134 each independently represents a hydrocarbon group having 1 to 12 carbon atoms; R 135 , R 136 , R 137 , and R 138 each independently represents a hydrocarbon group having 1 to 24 carbon atoms; L 131 , L 132 , L 133 , and L 134 each independently represents —OC(O)O—, —C(O)O—, —OC(O)—, or —O—; R 135 , R 136 , R 137 , and R 138 The hydrocarbon group represented by is an aryl group having 6 to 20 carbon atoms, —OC(O)O—R 153 , -C(O)O-R 154 , —OC(O)—R 155 , or S-R 158 and R 151 and R 152 each independently represents a hydrocarbon group having 1 to 8 carbon atoms; R 153 , R 154 , R 155 , and R 156each independently represents a hydrocarbon group having 1 to 18 carbon atoms, and the aryl group having 6 to 20 carbon atoms is OH, COOH, —NR 151 R 152 , -OC(O)OR 153 , -C(O)O-R 154 , —OC(O)—R 155 , -O-R 156 or -(C1-C12 hydrocarbon group)-R 157 and R 157 is -OH, COOH, -NR 151 R 152 , -OC(O)OR 153 , -C(O)O-R 154 , —OC(O)—R 155 , -O-R 156 Indicates. 158 represents a hydrocarbon group having 1 to 12 carbon atoms.

[0071] In formula (2-3), R 101 and R 102 R each independently represents a hydrocarbon group having preferably 1 to 12 carbon atoms, more preferably a hydrocarbon group having 1 to 6 carbon atoms, and even more preferably a hydrocarbon group having 1 to 3 carbon atoms. 101 and R 102 The hydrocarbon group represented by may preferably be substituted with —OH.

[0072] R 103 represents a hydrocarbon group preferably having 2 to 6 carbon atoms, and more preferably a hydrocarbon group having 2 to 4 carbon atoms.

[0073] R 131 , R 132 , R 133 , and R 134 are each independently preferably a hydrocarbon group having 1 to 10 carbon atoms, more preferably a hydrocarbon group having 1 to 8 carbon atoms, and even more preferably a hydrocarbon group having 1 to 3 carbon atoms.

[0074] R 135 , R 136 , R 137 , and R 138R each independently represents a hydrocarbon group having preferably 1 to 20 carbon atoms, more preferably a hydrocarbon group having 1 to 16 carbon atoms, and even more preferably a hydrocarbon group having 1 to 12 carbon atoms. 135 , R 136 , R 137 , and R 138 The hydrocarbon group represented by is preferably an aryl group having 6 to 20 carbon atoms, or S—R 158 More preferably, it is substituted with -S-R 158 R 135 , R 136 , R 137 , and R 138 are each independently particularly preferably —S—R 158 or a hydrocarbon group having 1 to 12 carbon atoms substituted with

[0075] L 131 , L 132 , L 133 , and L 134 are each independently preferably —C(O)O— or —OC(O)—.

[0076] R 158 represents a hydrocarbon group preferably having 1 to 10 carbon atoms, and more preferably a hydrocarbon group having 1 to 8 carbon atoms.

[0077] The compound may form a salt. Examples of salts of basic groups include salts with mineral acids such as hydrochloric acid, hydrobromic acid, nitric acid, and sulfuric acid; salts with organic carboxylic acids such as formic acid, acetic acid, citric acid, oxalic acid, fumaric acid, maleic acid, succinic acid, malic acid, tartaric acid, aspartic acid, trichloroacetic acid, and trifluoroacetic acid; and salts with sulfonic acids such as methanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, mesitylenesulfonic acid, and naphthalenesulfonic acid. Salts of acidic groups include, for example, salts with alkali metals such as sodium and potassium, salts with alkaline earth metals such as calcium and magnesium, ammonium salts, and salts with nitrogen-containing organic bases such as trimethylamine, triethylamine, tributylamine, pyridine, N,N-dimethylaniline, N-methylpiperidine, N-methylmorpholine, diethylamine, dicyclohexylamine, procaine, dibenzylamine, N-benzyl-β-phenethylamine, 1-ephenamine, and N,N'-dibenzylethylenediamine. Of the above-mentioned salts, preferred salts include pharmacologically acceptable salts.

[0078] Preferred specific examples of the compound represented by formula (2) include the compounds described in the Examples below, but the present invention is not intended to be limited thereto. The compounds of Synthesis Examples 33-44 and 55 in the Examples below are novel compounds. According to the present invention, the compounds of Synthesis Examples 33-44 and 55 in the Examples below are provided.

[0079] <Production Method> The compound represented by formula (1) or formula (2) is described in WO2019 / 235635 and WO2022 / 230964, and can be produced according to the production methods described in WO2019 / 235635 and WO2022 / 230964.

[0080] <Sterol> The non-ionized lipid preferably contains a sterol or a derivative thereof. By containing a sterol in the lipid composition, membrane fluidity can be reduced, and the lipid composition can be stabilized. Examples of sterols include, but are not limited to, cholesterol, phytosterols (sitosterol, stigmasterol, fucosterol, spinasterol, brassicasterol, etc.), ergosterol, cholestanone, cholestenone, coprostanol, cholesteryl-2'-hydroxyethyl ether, and cholesteryl-4'-hydroxybutyl ether. Among these, cholesterol is preferred.

[0081] In the lipid composition, the amount of sterol or its derivative is preferably 30 to 70 mol%, more preferably 30 mol% to 65 mol%, and even more preferably 30 mol% to 60 mol%, in terms of molar ratio to the total lipids in the lipid composition.

[0082] <Phospholipids> The non-ionized lipid may include phospholipids. The phospholipids are not particularly limited, but include phosphatidylcholine, phosphatidylethanolamine, sphingomyelin, ceramide, etc., and phosphatidylcholine is preferred. The phospholipids may be used alone or in combination with multiple different neutral lipids.

[0083] Examples of phosphatidylcholines include, but are not limited to, soybean lecithin (SPC), hydrogenated soybean lecithin (HSPC), egg yolk lecithin (EPC), hydrogenated egg yolk lecithin (HEPC), dimyristoylphosphatidylcholine (DMPC), dipalmitoylphosphatidylcholine (DPPC), distearoylphosphatidylcholine (DSPC), 1-palmitoyl-2-oleoylphosphatidylcholine (POPC), and dioleoylphosphatidylcholine (DOPC).

[0084] The phosphatidylethanolamine is not particularly limited, and examples thereof include dimyristoylphosphatidylethanolamine (DMPE), dipalmitoylphosphatidylethanolamine (DPPE), distearoylphosphatidylethanolamine (DSPE), dioleoylphosphatidylethanolamine (DOPE), dilinoleoylphosphatidylethanolamine (DLoPE), diphytanoylphosphatidylethanolamine (D(Phy)PE), 1-palmitoyl-2-oleoylphosphatidylethanolamine (POPE), ditetradecylphosphatidylethanolamine, dihexadecylphosphatidylethanolamine, dioctadecylphosphatidylethanolamine, and diphytanylphosphatidylethanolamine.

[0085] Examples of sphingomyelin include, but are not limited to, egg yolk-derived sphingomyelin, milk-derived sphingomyelin, etc. Examples of ceramide include, but are not limited to, egg yolk-derived ceramide, milk-derived ceramide, etc.

[0086] The phospholipid is preferably selected from the group consisting of distearoylphosphatidylcholine, dioleoylphosphatidylcholine, and dioleoylphosphatidylethanolamine.

[0087] In the lipid composition, the blending amount of the phospholipid is preferably 1 to 30 mol %, more preferably 1 to 20 mol %, in terms of molar ratio to the total lipids in the lipid composition.

[0088] <Lipids Having Nonionic Hydrophilic Polymers> The lipid composition of the present invention may contain a lipid having a nonionic hydrophilic polymer. In the present invention, the inclusion of a lipid having a nonionic hydrophilic polymer can achieve a dispersion stabilization effect of the lipid composition. Examples of nonionic hydrophilic polymers include, but are not limited to, nonionic vinyl polymers, nonionic polyamino acids, nonionic polyesters, nonionic polyethers, nonionic natural polymers, nonionic modified natural polymers, and block polymers or graft copolymers containing two or more of these polymers as building blocks. Among these nonionic hydrophilic polymers, nonionic polyethers, nonionic polyesters, nonionic polyamino acids, or nonionic synthetic polypeptides are preferred, nonionic polyethers or nonionic polyesters are more preferred, nonionic polyethers or nonionic monoalkoxy polyethers are even more preferred, and polyethylene glycol (polyethylene glycol will also be referred to as PEG hereinafter) is particularly preferred. That is, the lipid having a nonionic polymer is preferably a lipid having a polyethylene glycol chain.

[0089] The lipid having a nonionic hydrophilic polymer is not particularly limited, but examples thereof include PEG-modified phosphoethanolamine, diacylglycerol PEG derivatives, monoacylglycerol PEG derivatives, dialkylglycerol PEG derivatives, cholesterol PEG derivatives, ceramide PEG derivatives, etc. Among these, monoacylglycerol PEG or diacylglycerol PEG is preferred.

[0090] The lipid having a polyethylene glycol chain is particularly preferably selected from dimyristoyl-rac-glycerol polyethylene glycol, distearoyl-rac-glycerol polyethylene glycol, and distearoylphosphatidylethanolamine polyethylene glycol.

[0091] The weight-average molecular weight of the PEG chain of the nonionic hydrophilic polymer derivative is preferably 500 to 5000, more preferably 750 to 3000. The nonionic hydrophilic polymer chain may be branched and may have a substituent such as a hydroxymethyl group.

[0092] In the lipid composition, the amount of lipid having a nonionic hydrophilic polymer chain is preferably 0.1 to 3 mol %, more preferably 0.3 to 3 mol %, and even more preferably 0.5 to 3 mol %, in terms of molar ratio to the total lipid in the lipid composition.

[0093] In the present invention, step A is first carried out to prepare nucleic acid-free lipid particles using ionizable lipids, non-ionizable lipids, and lipids having non-ionic polymers.Nucleic acid-free lipid particles can be produced by dissolving all or some of the oil-soluble components of the nucleic acid-free lipid particles in an organic solvent or the like to form an oil phase, and then mixing this with an aqueous phase.A micromixer may be used for mixing, or emulsification may be performed using an emulsifier such as a homogenizer, an ultrasonic emulsifier, a high-pressure jet emulsifier, or the like.Alternatively, a lipid-containing solution may be dried under reduced pressure using an evaporator or the like, or spray-dried using a spray dryer or the like to prepare a dried mixture containing lipids, and this mixture is added to an aqueous solvent and further emulsified using the above-mentioned emulsifier or the like.

[0094] An example of a method for producing nucleic acid-free lipid particles includes the following steps: step (a): dissolving components of nucleic acid-free lipid particles in an organic solvent to prepare an oil phase; step (b): mixing the oil phase obtained in step (a) with an aqueous phase to obtain a lipid particle dispersion; step (c): diluting the lipid particle dispersion obtained in step (b); step (d): removing the organic solvent from the lipid particle dispersion; and step (e): adjusting the concentration of the lipid particle dispersion.

[0095] In step (a), the components of the lipid particles that do not contain nucleic acids are dissolved in an organic solvent (an alcohol such as ethanol, an ester, etc.). The total lipid concentration is not particularly limited, but is generally 1 mmol / L to 100 mmol / L, preferably 5 mmol / L to 80 mmol / L, and more preferably 10 mmol / L to 70 mmol / L.

[0096] In step (b), the oil phase and the aqueous phase may be mixed by any method, including a batch method and an in-line method using a flow channel device. For the in-line method, a micro-flow channel device is preferably used, and examples of the micro-flow channel device that can be used include a Y-mixer, a T-mixer, a herringbone mixer, a ring micromixer, and an impingement jet mixer. The mixing ratio (volume ratio) of the aqueous phase to the oil phase is preferably 5:1 to 1:1, and more preferably 4:1 to 2:1.

[0097] Components such as buffer components for pH adjustment and antioxidants can be added to the aqueous phase as needed. The pH of the aqueous phase is preferably 2.0 to 7.0, more preferably 3.0 to 6.0. To adjust the pH to the above range, buffer components such as acetic acid, citric acid, malic acid, phosphoric acid, MES, and HEPES are preferably used. If necessary, salts such as sodium chloride and potassium chloride may be added to adjust the salt strength, and sugars or sugar alcohols such as sucrose, trehalose, and mannitol may be added to adjust the osmotic pressure.

[0098] In step (c), the lipid particle dispersion is mixed with a diluent solution to reduce the organic solvent content and stabilize the lipid particles. The diluent may be water, but may also include adjusting the pH or salt strength. The components contained in the diluent may be selected arbitrarily depending on the purpose. For example, a buffer solution (e.g., citrate buffer, citrate-buffered saline, acetate buffer, acetate-buffered saline, phosphate-buffered saline, Tris buffer, MES buffer, HEPES buffer, etc.) may be used to adjust the pH. In addition, sodium chloride, potassium chloride, sucrose, trehalose, fructose, mannitol, etc. may be included to adjust the salt strength or osmotic pressure, and the above buffer solutions may also be used with the addition of these additives.

[0099] The lipid particle dispersion and the diluted solution may be mixed by any method, including a batch method or an in-line method using a flow path device. The flow path device used during mixing may be a Y-shaped mixer, a T-shaped mixer, or the like. The time from mixing the oil phase and the aqueous phase to mixing the diluted solution is not particularly limited, but the dilution is preferably carried out within 30 seconds, and more preferably within 10 seconds, of mixing the oil phase and the aqueous phase. The mixing ratio (liquid volume ratio) of the lipid particle dispersion and the diluted solution is preferably 1:0.5 to 1:10, and more preferably 1:1 to 1:5.

[0100] In some embodiments, in step (c), the lipid particle dispersion may be mixed with the dilution solution multiple times depending on the purpose.The dilution solutions used may be the same or different.In the lipid particle dispersion, the particle size of the lipid particles may change depending on the pH, so adjusting the pH of the dispersion is important.Therefore, for example, in order to adjust the pH of the lipid particle dispersion after mixing with the dilution solution, a buffer solution having an appropriate concentration and pH, or a buffer solution containing other components, may be used.

[0101] Furthermore, multiple dilution steps may be carried out consecutively, and the interval between one dilution step and the next dilution step may be set arbitrarily, for example, 10 seconds, 30 seconds, 1 minute, 5 minutes, 10 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 6 hours, 12 hours, or 24 hours.

[0102] The pH of the lipid particle dispersion after step (c) is preferably from pH 3.0 to 10.0, more preferably from pH 3.5 to pH 9.0, and particularly preferably from pH 4.0 to pH 8.5.

[0103] The lipid particles can be sized as needed. The sizing method is not particularly limited, but the particle size can be reduced using an extruder or the like. In addition, the dispersion containing the lipid composition can be frozen or freeze-dried by a general method.

[0104] In step (d), the method for removing the organic solvent from the lipid particle dispersion is not particularly limited, and a common method can be used. For example, a pH buffer solution such as phosphate buffered saline or Tris buffer can be used as the dialysis solution, and additives such as any salt or sugar can be added as needed to adjust the osmotic pressure or protect from freezing.

[0105] In step (e), the concentration of the lipid particle dispersion obtained in step (d) can be adjusted.When diluting, it can be diluted to an appropriate concentration using a solution such as phosphate buffered saline, physiological saline, Tris buffer, or sucrose-containing Tris buffer as a diluent.When concentrating, it can be concentrated by ultrafiltration using an ultrafiltration membrane, etc., with the dispersion obtained in step (d).It is preferable to use the concentrated dispersion as it is, or it is also preferable to use the above-mentioned diluent after concentrating to adjust to a desired concentration.

[0106] In some embodiments, the organic solvent removal step (step (d)) and the concentration adjustment step (step (e)) can be carried out continuously using tangential flow filtration (TFF). In this process, the organic solvent removal step and the concentration adjustment step may be carried out in any order. If necessary, the organic solvent removal step and the concentration adjustment step may each be carried out multiple times.

[0107] The solution that can be used for dialysis in step (d) or dilution in step (e) may contain an excipient, cryoprotectant, buffer, or antioxidant. Examples of excipients and cryoprotectants include, but are not limited to, sugars and sugar alcohols. Examples of sugars include sucrose, trehalose, maltose, glucose, lactose, and fructose, and examples of sugar alcohols include mannitol, sorbitol, inositol, and xylitol. Examples of buffers include, but are not limited to, ACES, BES, Bicine, CAPS, CHES, DIPSO, EPPS, HEPES, HEPPSO, MES, MOPS, MOPSO, TAPS, TAPSO, TES, Tricine, Tris, phosphoric acid, acetic acid, and citric acid. Examples of antioxidants include EDTA, ascorbic acid, and tocopherol.

[0108] The lipid particle dispersion may be subjected to sterile filtration.As a filtration method, hollow fiber membrane, reverse osmosis membrane, membrane filter, etc. can be used to remove insoluble matter from the lipid particle dispersion.In the present invention, although not particularly limited, it is preferred to use a filter with a sterilizable pore size (preferably a 0.2 μm filter sterilization filter).In addition, it is preferred to carry out sterile filtration after step (d) or step (e).

[0109] Furthermore, if necessary, the dispersion of lipid particles not containing nucleic acid can be subjected to freezing or lyophilization. The dispersion of lipid particles can be subjected to freezing or lyophilization by a general method, and the method is not particularly limited.

[0110] Preferably, in the present invention, the nucleic acid-free lipid particles are cryopreserved, and the cryopreserved nucleic acid-free lipid particles can be thawed before mixing with nucleic acid.

[0111] In the present invention, step B is carried out in which nucleic acid-containing lipid particles are prepared by mixing the nucleic acid-free lipid particles prepared as described above with nucleic acid. Examples of nucleic acids include circular double-stranded DNA (plasmid DNA, small circular double-stranded DNA without a drug resistance gene, etc.), single-stranded DNA, double-stranded DNA, siRNA (small interfering RNA), miRNA (micro RNA), mRNA, antisense oligonucleotides (also known as ASO), ribozymes, aptamers, saRNA, sgRNA, etc., and any of these may be included. Two or more types of nucleic acids may be used. Modified nucleic acids may also be included. Circular double-stranded DNA or RNA is particularly preferred as the nucleic acid, with plasmid DNA or mRNA being most preferred. The number of bases is preferably 5 to 20,000.

[0112] The nucleic acid may be a sequence for gene editing, such as mRNA encoding a DNA nuclease. The nucleic acid may be a sequence for gene editing, such as guide RNA. The nucleic acid may be a sequence for gene editing, such as a nucleic acid mixture containing mRNA encoding a Cas nuclease and guide RNA. That is, the nucleic acid may be a nucleic acid for gene editing that contains mRNA encoding a Cas nuclease and guide RNA. The mixture may further contain any donor DNA. The nucleic acid may be a sequence for single base editing, such as a nucleic acid mixture containing mRNA encoding a deaminase and a mutant Cas nuclease and guide RNA. The nucleic acid may be a sequence for replacing a target DNA nucleotide, such as a nucleic acid mixture containing mRNA encoding a fusion protein of an artificial reverse transcriptase and a Cas9 endonuclease and a prime editing guide RNA.

[0113] The nucleic acid may be a nucleic acid mixture containing a guide RNA-dependent gene transcription activation sequence (such as a CRISPR activator system), an mRNA encoding a fusion protein of an activator protein (VP64, p65, Rta) and a mutant Cas nuclease, and a guide RNA. Alternatively, the nucleic acid may be a nucleic acid mixture containing an mRNA encoding an activator protein (MS2, p65, HSF1), an mRNA encoding a fusion protein of VP64 and a mutant Cas nuclease, and a guide RNA.

[0114] The nucleic acid may be a nucleic acid mixture containing a guide RNA and an mRNA encoding a fusion protein of a transcriptional repressor (e.g., KRAB) and a mutant Cas nuclease, as well as a sequence for guide RNA-dependent gene transcription suppression (e.g., CRISPR interference system). The nucleic acid may be an mRNA or DNA encoding a DNA recombinase, and optionally a nucleic acid mixture containing donor DNA. Examples of DNA recombinase include, but are not limited to, transposases (e.g., Sleeping Beauty transposase, piggyBac transposase, Tol2, etc.), Cre recombinase, and serine integrase. The nucleic acid may be a nucleic acid mixture containing a sequence for inserting a foreign gene into the host cell genome, such as an mRNA encoding a reverse transcriptase, and optionally a donor RNA. The nucleic acid may be an mRNA encoding a sequence for expressing a foreign gene, or a DNA comprising the foreign gene, a promoter sequence, and a terminal sequence.

[0115] The nucleic acid may be a sequence for gene editing or gene transcription suppression of a gene (target gene) present in immune cells. Target genes include, but are not limited to, T cell receptor genes (TRAC, TRBC), MHC-I (or HLA-I), MHC-II, B2M, genes related to autoantigens, genes related to inhibitory receptors or their ligands (PDCD1, CD274 (or PD-L1), PDCD1LG2, LAG3, CTLA4), genes related to cytotoxicity (TGFBR2, PGE2, EP2, EP4, FAS, FASLG), genes related to cell exhaustion or differentiation (SOCS1, ZC3H12A, NR4A1, NR4A2, NR4A3, PRDM1, BLIMP1, TIM3), cell death-related genes (CASP3, CASP6, CASP7), genes related to inflammatory responses (CGAS, STING, TBK1), and the like. etc.), methylation genes (TET1, TET2, DNMT3A), genes involved in immune evasion (CD47, NKG2A), others (DGK, EZH2, CSF2, PAX5, LDLR, MAP4K1, CISH, CD5, CD52, ADORA2A, CD39, CD73, CD5, MCM3AP, EIF3D, CAD, HGS, RPL19, MAK16, PDG FRA, NRF1, EP400, CBLB, RPS7, CPSF4, IL2RG, RPL38, IL2RB, JAK3, MCM2, SNRPC, PSMD4, MAP4K1, BRD9, RNF20, RNF40, NFKB2, NMT1, MYB, TSC1, EIF3K, RPL19, TBX21, PRDM1, SUV39H1, ARID1A), and the like.

[0116] The nucleic acid may be a sequence for expressing a foreign gene that enhances the function of immune cells, or a sequence for activating the transcription of a gene (target gene) present in immune cells. The foreign gene or the target gene for transcription activation is not particularly limited, but may be any of cytokines (IFNG, IL2, IL7, IL12, IL15, IL18, IL19, IL21), cytokine receptors (IL2RA, IL2RB, IL2RG, IL12B1, IL12B2), costimulatory factors (CD28, TNFRSF9), genes involved in immune evasion (CD47, HLA-E), metabolism-related genes (GLUT1, PPARGC1A), genes involved in exhaustion suppression (FOXO1, TCF7, LEF1), genes involved in cell survival (BCL2), and others (dominant negative forms of TGFBR2, AKT1, LTBR, ​​AHCY, DUPD1). , AKR1C4, ATF6B, ITM2A, AHNAK, BATF, GPD1, CDK2, CDK1, GPN3, MRPL51, DBI, CALML2, IL1 2B, IFNL2, CLIC1, HOMER1, ADA, CYP27A1, MRPL18, RAN, SLC10A7, CRLF2, VAV1, TRIM21, L HX6, FOXO4, IRX4, FOXQ1, OTUD7B, LCP2, FOSB, RAC2, FOSL1, APOBEC3D, RIPK3, EMP1, ANXA2R, CDKN2C, OTUD7A, CD2, LAT, LCP2, TBX21, EOMES), and sequences encoding secretory proteins that induce inflammation.

[0117] The nucleic acid may be a sequence for expressing a chimeric antigen receptor gene, a T cell receptor gene, an antibody, a bispecific antibody, a multispecific antibody, a single chain Fv (scFv), a nanobody, or a bispecific T cell-inducing antibody (BiTE).

[0118] The nucleic acid may be a sequence for expressing a foreign gene involved in cell reprogramming, including, but not limited to, Oct3 / 4, Sox2, Klf4, c-Myc, Nanog, and Lin28.

[0119] In step B, the mass ratio of lipid concentration to nucleic acid concentration in the solution after mixing is preferably 5:1 to 1000:1, more preferably 5:1 to 500:1, even more preferably 7:1 to 200:1, and particularly preferably 7:1 to 100:1.

[0120] Preferably, step B may include the steps of incubating nucleic acid-free lipid particles and an aqueous solution containing nucleic acid at 0°C to 30°C for 0.1 to 120 minutes and adjusting the pH of the mixture obtained above to 6.5 to 8.5. In step B, the nucleic acid-free lipid particles and nucleic acid can be mixed by any of the following methods: mixing the liquid using a flow channel, mixing by moving the liquid back and forth in a container, pipette mixing, stirring in a batch container, mixing by rotating the container to agitate the contents, or flask stirring. The aqueous solution containing nucleic acid can be obtained by dissolving nucleic acid in water or a buffer solution. The concentration of the nucleic acid is not particularly limited, but is preferably 1 to 2000 μg / mL, and more preferably 10 to 1000 μg / mL. Components such as buffer components for pH adjustment and antioxidants can be added as needed. The nucleic acid-containing lipid particles obtained as a result of step B can be used immediately for contact with immune cells, or, if necessary, can be stored refrigerated or frozen before use for contact with immune cells.

[0121] <Lipid Particles / Lipid Compositions> The lipid composition may be lipid particles. Lipid particles refer to particles composed of lipids, and include compositions having any structure selected from lipid aggregates in which lipids are aggregated, micelles, liposomes, lipid nanoparticles (LNPs), and lipoplexes. Liposomes have a lipid bilayer structure, an internal aqueous phase, and include liposomes with a single bilayer membrane and multilayer liposomes with multiple layers stacked on top of each other. Either type of liposome may be included in the present invention. Lipid particles are preferably lipid nanoparticles (LNPs).

[0122] The morphology of lipid particles can be confirmed by electron microscope observation or X-ray structural analysis.For example, by using a cryo-transmission electron microscope (cryo-TEM) method, it can be confirmed whether the lipid particles have a lipid bilayer structure (lamellar structure) and an inner water layer, like liposomes, or whether the particles have a core with high electron density inside and a structure packed with lipids and other components.Small-angle X-ray scattering (SAXS) measurement can also be used to confirm whether the lipid particles have a lipid bilayer structure (lamellar structure).

[0123] The particle size of the lipid particles is not particularly limited, but is preferably 10 to 1000 nm, more preferably 30 to 500 nm, and even more preferably 50 to 250 nm. The particle size of the lipid particles can be measured by a general method (e.g., dynamic light scattering method, laser diffraction method, etc.).

[0124] The pH of the lipid composition is preferably 3.0 to 6.5, more preferably 4.0 to 6.5.

[0125] In the present invention, step B is followed by step C, in which immune cells are contacted with the nucleic acid-containing lipid particles obtained in step B. Preferably, a step of adding an apolipoprotein to a culture medium containing immune cells may be carried out before contacting the nucleic acid-containing lipid particles with immune cells in step C.

[0126] Apolipoproteins are a group of proteins that bind to lipoproteins and activate enzymes involved in lipoprotein recognition and lipid metabolism, or act as coenzymes. Apolipoproteins are broadly classified into five types, apolipoproteins A to E, based on their structure and function, and some of these are divided into subclasses, such as apolipoproteins A-I and C-II. In the present invention, for example, apolipoprotein E, particularly apolipoprotein E3, may be used. The origin of the apolipoprotein is not particularly limited, and apolipoproteins from mammals such as humans can be used.

[0127] Step C of contacting the nucleic acid-containing lipid particles with immune cells can be carried out by transfecting the nucleic acid-containing lipid particles into immune cells ex vivo, in vitro, or in vivo.

[0128] Immune cells may be either activated or non-activated cells, and can be selected as appropriate depending on the cell production method. For example, in the case of T cells, activation treatment refers to stimulation via the TCR / CD3 complex using anti-CD3 antibodies and anti-CD28 antibodies, or via the lectin pathway. This activation treatment is usually performed in the presence of cytokine signals such as IL-2, IL-7, and IL-15, which induce the expression of cytokine receptors such as IL-2R and active cell proliferation. For example, activated T cells refer to T cells that have been subjected to such an activation treatment. Furthermore, non-activated cells refer to T cells that have been cultured in the presence of cytokine signals such as IL-2, IL-7, and IL-15 without undergoing the above-mentioned activation treatment. However, the activation method is not limited to these methods.

[0129] Examples of steps for transfecting immune cells using nucleic acid-containing particles include the following: (i) seeding immune cells, (ii) contacting immune cells with nucleic acid-containing particles (step C), and (iii) culturing immune cells.

[0130] When activated cells are used as immune cells, activation treatment may be carried out in step (i). The activation treatment can be carried out by the above-mentioned method.

[0131] In step (i), the medium used for seeding immune cells includes serum-free medium (RPMI1640 medium, PRIME-XV T Cell Expansion XSFM (FUJIFILM Irvine Scientific), PRIME-XV T Cell CDM (FUJIFILM Irvine Scientific), TexMACS TMMedium (Miltenyi Biotec), CTS OpTmizer Pro Serum Free Medium (Gibco), CTS TM OpTmizer TM Examples of suitable medium include T Cell Expansion SFM (Gibco), KBM501 / KBM502 / KBM550 / KBM551 (Kohjin Bio), and ALyS505 / 705 (Cell Science Institute). Additives can be added to the medium. Examples of suitable additives include serum (fetal bovine serum, human serum, etc.) and serum substitutes (StemSure serum substitute (Fujifilm Wako Pure Chemical Industries, Ltd.), OpTmizer). TM Examples of such additives include T-Cell Expansion Supplement (Gibco), growth factors, etc. The medium can also be replaced with another medium the day before or the day of step (ii). When the medium contains the above-mentioned additives, it is preferable to replace the medium with a serum-free medium containing no serum or serum substitute the day before or the day of step (ii).

[0132] The medium used in step (ii) is the same as the medium described above, and may further contain additives such as the apolipoproteins described above.

[0133] Step (ii) is the same as step C, as described above. On the day of step (ii), the culture medium may be replaced with a freshly prepared medium using methods such as centrifugation or perfusion culture. Step (ii) can be performed at any time from the day of step (i) to the end of step (iii). When activated cells are used as immune cells, step (ii) is preferably performed 1 to 7 days after the activation treatment, more preferably 2 or 3 days after the activation treatment. In addition, the activation treatment can be performed multiple times, and step (ii) may be performed each time.

[0134] In step (iii), the medium and additives described in step (i) can be used as the medium for culturing immune cells. In step (iii), serum or serum substitutes may be added, or not. In step (iii), it is preferable to add 0.5 or more volumes of medium to the culture solution the day after step (ii). Alternatively, it is preferable to partially remove the culture supernatant (not containing cells), or to completely or partially remove the culture supernatant using techniques such as centrifugation or perfusion culture, and then add freshly prepared medium to completely or partially replace the medium in the culture solution. Examples of culture vessels used in steps (i) to (iii) include culture plates (e.g., untreated, low-adhesion, and adherent culture plates), culture flasks, culture vessels with a gas-permeable membrane on the bottom (e.g., G-Rex (Wilson Wolf)), culture bags, culture tubes, and culture reactors.

[0135] The immune cells are preferably mammalian-derived cells, more preferably human-derived cells. Examples of immune cells include, but are not limited to, lymphocytes (e.g., T cells, B cells, natural killer cells (NK cells), NKT cells, and iNKT cells), monocytes, macrophages, mast cells, dendritic cells, granulocytes (e.g., neutrophils, eosinophils, and basophils), hematopoietic stem / progenitor cells, primary immune cells, and CD3 + cells, CD4 + cells, CD8 + The immune cells can be selected from T cells, regulatory T cells (Treg), B cells, NK cells, innate lymphocytes, or dendritic cells (DC). The immune cells are preferably peripheral blood mononuclear cells (PBMC), lymphocytes, tumor infiltrating lymphocytes (TIL), T cells, CD4 + cells, CD8 + The immune cells may be selected from primary T cells, memory T cells, naive T cells, or stem cell memory T cells. The immune cells may be primary cells or cells derived from stem cells (preferably pluripotent stem cells).

[0136] <Nucleic acid delivery agent for cells other than immune cells> The present invention is capable of delivering nucleic acid to cells other than immune cells. Examples of cells other than immune cells include mammalian-derived cells, preferably human-derived cells. Cells other than immune cells are not particularly limited, but are preferably selected from mesenchymal stem cells, nerve cells, iPS cell-derived nerve cells, HEK293 cells, and CHO cells. In particular, the following nucleic acid delivery agents can be used.

[0137] The agent for delivering nucleic acid to mesenchymal stem cells is preferably an agent for delivering nucleic acid to mesenchymal cells, which comprises a lipid composition containing an ionizable lipid that is a compound represented by formula (1) or formula (2) or a salt thereof, a nonionizable lipid, a lipid having a nonionic polymer, and a nucleic acid. Formulas (1) and (2) are defined as above.

[0138] The nucleic acid contained in the agent for nucleic acid delivery to mesenchymal stem cells may be a sequence for gene editing or gene transcription suppression of a gene (target gene) present in mesenchymal stem cells. Target genes include, but are not limited to, MHC-I (or HLA-I), MHC-II, B2M, genes associated with autoantigens, and cell death-related genes (CASP3, CASP6, CASP7, UCHL1).

[0139] The nucleic acid contained in the agent for delivering nucleic acid to mesenchymal stem cells may be a sequence for expressing a foreign gene that enhances the function of mesenchymal stem cells, a sequence for activating the transcription of a gene (target gene) present in mesenchymal stem cells, or a sequence for regulating the function and proliferation of cells surrounding mesenchymal stem cells. The foreign gene or the target gene for transcription activation is not particularly limited, but includes growth factors (bFGF, EGF, NGF, BDNF, sonic hedgehog (SHH), neurotrophin 3 (NT-3)), transcription factors (STAT3, SOX9, nuclear receptor-related factor 1 (Nurr1), neurotrophic tyrosine receptor kinase 1 (NTRK1), achaete-scute family bHLH transcription factor 1 (ASCL1), conserved dopamine neurotrophic factor 1 (ASCL2)), and the like. These include genes related to CDNF (CDNF), neurogenin 1, Txnip, Vcam1, AABR07054614.1, Aldh1a3, and Cox4i2), trophic factors (BDNF, GDNF, NGF, NT-3, HGF, and VEGF), genes related to cell proliferation and survival factors (genes related to Notch signaling, Wnt / β-catenin signaling, and BMP signaling, such as TCF1-4, Wnt1, Wnt2, Wnt-3a, Wnt-5a, NT-3, Ngn1, and Ngn2), factors related to immune regulation (cytokines such as IL-1Ra, IL-10, prostaglandin E2 (PGE2), TSG-6, monocyte chemotactic protein-1 (MCP-1 / CCL2), and TGF-β), and indoleamine pyrrole 2,3-dioxygenase (IDO), human leukocyte antigen (HLA)-G5, IFNγ), anti-apoptotic genes (mitochondrial rho GTPase 1, H2AX(Y142F), superoxide dismutase 2 (SOD2), Bcl-2, adrenocortical medullin (ADM), SOD-1, SOD-3, glutathione peroxidase-1 (GPx)), and others (TrkC, Snail, Shh, Nice4, as-miR-383, miR-381, BRD4, WNT5A, CNTF, miR-214, miR-21). , miR-145-5p, GIT1, KCC2, miR-146a-5p, miR-31, CXCR4, miR-138-5p, ERK1 / 2, HGF, NGR1, Zeb2, Axin 2, TSP4, ITGA4, HIF-1α, CCR2, CCL2, EGFL7, PSP, miR-145, ZFAS1, miR-455-5p, VIP, VEGF-A, Sirtuin Examples of sequences encoding miR-188-3p, as-miR-937, FOXQ-1, and Lin28B include sequences encoding miR-188-3p, as-miR-937, as-miR-188-3p, as-miR-188-3p, as-miR-188-3p, as-miR-188-3p, and as-miR-188-3p.

[0140] The agent for delivering nucleic acid to nerve cells is preferably a lipid composition containing an ionizable lipid, which is a compound represented by formula (1) or formula (2) or a salt thereof, a non-ionizable lipid, a lipid having a non-ionic polymer, and a nucleic acid. Formulas (1) and (2) are defined as above.

[0141] The nucleic acid contained in the agent for nucleic acid delivery to neurons may be a sequence for gene editing or gene expression suppression of a gene (target gene) present in neurons. Target genes are not particularly limited, but include central nervous system disease-related genes (BACE1-AS, APP, Tau, VDAC1, VDAC1, BACE1, presenilin1 (PS1), ROCK-II, mutant presenilin1 (L392V PS-1), 12 PP-2A, ACAT-1, Nogo, etc. receptor, α-synuclein (SNCA), Htt, GFAP, Vimentin, EphB3, iNOS, Nischarin, RhoA, T-bet, Notch1, LINGO-1, NR4A2, TRIF, caspase-2, CaMKII), MHC-I (or HLA-I), MHC-II, B2M, genes associated with autoantigens, and cell death-related genes (CASP3, CASP6, CASP7, UCHL1).

[0142] The nucleic acid contained in the agent for delivering nucleic acid to nerve cells may be a sequence for expressing a foreign gene that enhances the function of nerve cells, or a sequence for activating the transcription of a gene (endogenous gene) present in nerve cells. Examples of the foreign gene or the target gene for transcription activation include, but are not limited to, sequences encoding survival-promoting factors (Hiflα, Aktl, Bcl-2, Bcl-xl, etc.) and the above-mentioned central nervous system disease-related genes.

[0143] <Uses> According to the present invention, the nucleic acid delivery agent for immune cells of the present invention described above can be used for pharmaceutical purposes. When used for pharmaceutical purposes, the nucleic acid delivery agent of the present invention can be administered to a living body alone or in a mixture with a pharmaceutically acceptable carrier. Furthermore, when used for pharmaceutical purposes, the administration route of the nucleic acid delivery agent is not particularly limited, and it can be administered by any method.

[0144] The nucleic acid delivery agent of the present invention may be bound to the surface of the lipid composition with a molecule that targets immune cells (hereinafter also referred to as a target molecule) to more efficiently deliver the nucleic acid to immune cells. The target molecule is not particularly limited, but small molecules, peptides, nucleic acids, and antibodies can be used. Furthermore, when a target molecule is bound to the surface of the lipid composition, the lipid composition may contain a lipid having a modifying group for chemically or electrically bonding the lipid composition to the target molecule. Examples of lipids having such a modifying group include lipids having a maleimide group and a polyethylene glycol chain.

[0145] <Kit and Use Thereof> The present invention provides a kit for delivering nucleic acids to cells, comprising the following reagents (A) to (C): (A) a lipid composition comprising an ionizable lipid that is a compound represented by formula (1) or formula (2) or a salt thereof, a nonionizable lipid, and a lipid having a nonionic polymer; (B) a pH adjuster; and (C) an apolipoprotein:

[0146] The ionizable lipid, non-ionizable lipid, and lipid having a non-ionic polymer, which are compounds represented by formula (1) or (2) or salts thereof, and preferred embodiments thereof are as described above.

[0147] The pH adjuster may be a buffer solution (e.g., citrate buffer solution, citrate buffered saline solution, acetate buffer solution, acetate buffered saline solution, phosphate buffered saline solution, Tris buffer solution, MES buffer solution, HEPES buffer solution, etc.). Furthermore, for the purpose of adjusting salt strength or osmotic pressure, sodium chloride, potassium chloride, sucrose, trehalose, fructose, mannitol, etc. may be contained, and the above-mentioned buffer solutions may further contain these additives. The apolipoproteins are as described above.

[0148] The present invention further provides a method for delivering nucleic acid to cells using the kit of the present invention, comprising the following steps (1) to (4): (1) mixing reagent (A) with nucleic acid; (2) adjusting the pH of the mixture obtained in step (1) with reagent (B); (3) adding reagent (C) to a medium containing cells; and (4) adding the mixture obtained in step (2) to the medium obtained in step (3). The cells are preferably immune cells, and preferred immune cells are as described above.

[0149] The present invention will now be described with reference to examples, but the present invention is not limited to these examples.

[0150] Unless otherwise specified, purification by column chromatography was performed using an automatic purification system ISOLERA (Biotage), a medium-pressure fractionation and purification system Purif-espoir-2 (Shoko Science Co., Ltd.), or a medium-pressure liquid chromatograph YFLC W-prep 2XY (Yamazen Corporation).

[0151] Unless otherwise specified, the carrier used in silica gel column chromatography was Chromatorex Q-Pack SI 50 (Fuji Silysia Chemical Ltd.), Hi-Flash Column W001, W002, W003, W004, or W005 (Yamazen Corporation). The NH silica gel used was Chromatorex Q-Pack NH 60 (Fuji Silysia Chemical Ltd.).

[0152] The NMR spectrum was measured using tetramethylsilane as an internal standard with a Bruker AVNEO400 (manufactured by Bruker), and all δ values ​​are shown in ppm.

[0153] MS spectra were measured using an ACQUITY SQD LC / MS System (manufactured by Waters).

[0154] [Synthesis Example 1]

[0155] 2-((2-(dimethylamino)ethyl)(isopropyl)amino)ethyl ((6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl)carbonate (Compound 1) was synthesized according to the examples described in WO2019 / 235635.

[0156] [Synthesis Example 2]

[0157] 2-Butyloctyl 6-(2-(decanoyloxy)ethyl)-3-ethyl-12-hexyl-10-oxo-9,11-dioxa-3,6-diazahexadecane-16-oate (Compound 2) was synthesized according to the examples described in WO 2019 / 235635.

[0158] [Synthesis Example 3]

[0159] 2-Butyloctyl 3-ethyl-12-hexyl-6-(2-(oleoyloxy)ethyl)-10-oxo-9,11-dioxa-3,6-diazahexadecane-16-oate (compound 3) was synthesized according to the examples described in WO 2019 / 235635.

[0160] [Synthesis Example 4]

[0161] Bis(2-pentylheptyl) 11-(2-(diethylamino)ethyl)-5,17-dihexyl-7,15-dioxo-6,8,14,16-tetraoxa-11-azahenicosanedioate (compound 4) was synthesized according to the examples described in WO 2022 / 230964.

[0162] [Synthesis Example 5]

[0163] Bis(2-pentylheptyl) 11-(3-(diethylamino)propyl)-5,17-dihexyl-7,15-dioxo-6,8,14,16-tetraoxa-11-azahenicosanedioate (compound 5) was synthesized according to the examples described in WO 2022 / 230964.

[0164] [Synthesis Example 6]

[0165] Bis(2-pentylheptyl) 11-(4-(diethylamino)butyl)-5,17-dihexyl-7,15-dioxo-6,8,14,16-tetraoxa-11-azahenicosanedioate (compound 6) was synthesized according to the examples described in WO 2022 / 230964.

[0166] [Synthesis Example 7]

[0167] Bis(2-pentylheptyl) 11-(3-(diethylamino)propyl)-7,15-dioxo-5,17-dipropyl-6,8,14,16-tetraoxa-11-azahenicosanedioate (compound 7) was synthesized according to the examples described in WO 2022 / 230964.

[0168] [Synthesis Example 8] (1)

[0169] To a mixture of 50 mL of dimethyl sulfoxide and 30 mL of toluene, 6.6 g of powdered potassium hydroxide was added, and under ice-cooling, a solution of 10 g of di-tert-butyl malonate in 10 mL of toluene and a solution of 19.9 g of 1-bromoheptane in 10 mL of toluene were added, followed by stirring overnight at 30°C or below. The reaction mixture was stirred in an ice bath and neutralized with hydrochloric acid, after which the organic layer was separated. The resulting organic layer was washed with water and saturated brine, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure to obtain 22.9 g of di-tert-butyl 2,2-diheptylmalonate (A2) as a pale yellow oil. 1 H-NMR(CDCl3)δ:1.79-1.74 (4H, m), 1.44 (18H, s), 1.32-1.10 (20H, m), 0.87 (6H, t, J=6.8Hz).

[0170] (2)

[0171] To a mixture of 22.9 g of di-tert-butyl 2,2-diheptylmalonate (A2), 23 mL of toluene, and 2.3 mL of water, 45 mL of trifluoroacetic acid was added, followed by stirring at room temperature for 2 hours, and the solvent was distilled off under reduced pressure. 23 mL of hexane was added to the residue, and after stirring under ice cooling, the resulting solid was collected by filtration. The resulting solid was dried to obtain 11.7 g of 2,2-diheptylmalonic acid (A3) as a white solid. 1 H-NMR(CDCl3)δ:1.97-1.92 (4H, m), 1.32-1.17 (20H, m), 0.87 (6H, t, J=7.3Hz).

[0172] (3)

[0173] 11.7 g of 2,2-diheptylmalonic acid (A3) was stirred at 165° C. for 3 hours to obtain 11.7 g of pale yellow oily 2-heptylnonanoic acid (A4). 1 H-NMR(CDCl3)δ:2.39-2.32 (1H, m), 1.96-1.93 (1H, m), 1.68-1.41 (4H, m), 1.36-1.16 (20H, m), 0.89-0.85 (6H, m).

[0174] (4)

[0175] To a 40 mL toluene solution of 4.0 g of 5-oxoundecanoic acid (synthesized according to the method described in WO2019 / 235635), 2.9 mL of 1-heptanol and 170 mg of 4-toluenesulfonic acid monohydrate were added, and the mixture was stirred under reflux for 5 hours. The solvent in the reaction mixture was evaporated under reduced pressure, and the residue was purified by NH silica gel column chromatography (hexane-ethyl acetate) to obtain 5.8 g of heptyl 5-oxoundecanoate (A5) as a pale yellow oil. 1 H-NMR (CDCl3) δ: 1H-NMR(CDCl3)δ:4.05 (2H, t, J=6.7Hz), 2.46 (2H, t, J=7.2Hz), 2.38 (2H, t, J=7.5Hz), 2.32 (2H, t, J=7.2Hz), 1.93-1.83 (2H, m), 1.66-1.49 (4H, m), 1.37-1.20 (14H, m), 0.91-0.84 (6H, m).

[0176] (5)

[0177] To a mixed solution of 3.0 g of heptyl 5-oxoundecanoate (A5) in 15 mL of tetrahydrofuran and 15 mL of methanol, 0.60 g of sodium borohydride was added under ice-cooling, and the mixture was stirred for 2 hours under ice-cooling. The reaction mixture was added dropwise to ice water, and then 1N aqueous hydrochloric acid was added until the mixture became acidic. Ethyl acetate was added, and the organic layer was separated. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The resulting residue was purified by silica gel column chromatography (hexane-ethyl acetate) to yield 3.0 g of heptyl 5-hydroxyundecanoate (A6) as a colorless oil. 1 H-NMR(CDCl3)δ:4.06 (2H, t, J=6.7Hz), 3.63-3.54 (1H, m), 2.33 (2H, t, J=7.2Hz), 1.84-1.21 (24H, m), 0.93-0.84 (6H, m).

[0178] (6)

[0179] To a solution of 3.0 g of heptyl 5-hydroxyundecanoate (A6) in 30 mL of tetrahydrofuran, 2.5 g of 1,1'-carbonyldi(1,2,4-triazole) was added and stirred at room temperature overnight. Ethyl acetate and water were added to the reaction mixture, and the organic layer was separated. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The resulting residue was purified by silica gel column chromatography (hexane-ethyl acetate) to yield 4.0 g of 1-(heptyloxy)-1-oxaundecan-5-yl 1H-1,2,4-triazole-1-carboxylate (A7) as a colorless oil.1 H-NMR(CDCl3)δ:8.82 (1H, s), 8.07 (1H, s), 5.22-5.13 (1H, m), 4.05 (2H, t, J=6.7Hz), 2.35 (2H, t, J=6.9Hz), 1.87-1.67 (6H, m), 1.65-1.50 (2H, m), 1.43-1.19 (16H, m), 0.93-0.79 (6H, m).

[0180] (7)

[0181] To a solution of 3.0 g of 1-(heptyloxy)-1-oxaundecan-5-yl 1H-1,2,4-triazole-1-carboxylate (A7) in 30 mL of acetonitrile, 3.9 g of 2,2'-((2-(diethylamino)ethyl)azanediyl)bis(ethan-1-ol) and 3.4 mL of 1,8-diazabicyclo[5.4.0]-7-undecene were added, and the mixture was stirred at 50°C for 3 hours. Ethyl acetate and water were added to the reaction mixture, and the organic layer was separated. The organic layer was washed with saturated brine and then dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (methanol-ethyl acetate) and then by NH silica gel column chromatography (hexane-ethyl acetate) to obtain 2.6 g of a colorless oily substance, heptyl 3-ethyl-12-hexyl-6-(2-hydroxyethyl)-10-oxo-9,11-dioxa-3,6-diazahexadecane-16-oate (A8). 1 H-NMR(CDCl3)δ:4.74-4.65 (1H, m), 4.23-4.16 (2H, m), 4.05 (2H, t, J=6.7Hz), 3.57-3.50 (2H, m), 2.88 (2H, t, J=6.1Hz), 2.73-2.62 (4H, m), 2.59-2.50 (4H, m), 2.47 (2H, t, J=5.9Hz), 2.31 (2H, t, J=7.0Hz), 1.72-1.47 (8H, m), 1.38-1.20 (16H, m), 1.02 (6H, t, J=7.1Hz), 0.92-0.82 (6H, m). MS m / z(M+H):532.

[0182] (8)

[0183] To a solution of 200 mg of heptyl 3-ethyl-12-hexyl-6-(2-hydroxyethyl)-10-oxo-9,11-dioxa-3,6-diazahexadecan-16-oate (A8) in 2 mL of dichloromethane, 145 mg of 2-heptylnonanoic acid (A4), 147 mg of 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride, 138 mg of 4-dimethylaminopyridine, and 0.3 mL of triethylamine were added and stirred at room temperature overnight. The solvent in the reaction mixture was evaporated under reduced pressure, and then ethyl acetate and water were added, and the organic layer was separated. The organic layer was washed with saturated brine and dried over anhydrous sodium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue was purified by silica gel column chromatography (methanol-ethyl acetate) and then by NH silica gel column chromatography (hexane-ethyl acetate) to obtain 224 mg of a colorless oily substance, heptyl 3-ethyl-6-(2-((2-heptylnonanoyl)oxy)ethyl)-12-hexyl-10-oxo-9,11-dioxa-3,6-diazahexadecane-16-oate (Compound 8). 1 H-NMR(CDCl3)δ:4.72-4.64 (1H, m), 4.20-4.10 (4H, m), 4.05 (2H, t, J=6.7Hz), 2.88-2.77 (4H, m), 2.72-2.62 (2H, m), 2.58-2.46 (6H, m), 2.36-2.25 (3H, m), 1.73-1.18 (48H, m), 1.01 (6H, t, J=7.1Hz), 0.92-0.82 (12H, m). MS m / z(M+H):770.

[0184] [Synthesis Example 9] (1)

[0185] To a solution of 2.0 g of 3-(ethylamino)propan-1-ol in 40 mL of ethanol, 5.5 g of ((4-bromobutoxy)methyl)benzene and 8.0 g of potassium carbonate were added, and the mixture was stirred at room temperature for 15 minutes, followed by stirring under reflux for 6 hours. The insoluble matter in the reaction mixture was removed by filtration, and the filtrate was evaporated under reduced pressure. The resulting residue was purified by NH silica gel column chromatography (hexane-ethyl acetate) to give 3.6 g of 3-((4-(benzyloxy)butyl)(ethyl)amino)propan-1-ol (B1) as a colorless oil. MS m / z (M+H): 266.

[0186] (2)

[0187] To a solution of 1.0 g of 3-((4-(benzyloxy)butyl)(ethyl)amino)propan-1-ol (B1) in 18 mL of tetrahydrofuran was added 2.5 g of carbon tetrabromide, and then a solution of 2.0 g of triphenylphosphine in 2 mL of tetrahydrofuran was added dropwise under ice cooling, and the mixture was stirred at room temperature for 2 hours to obtain a mixture of 4-(benzyloxy)-N-(3-bromopropyl)-N-ethylbutan-1-amine (B2). To the resulting reaction mixture were added 50 mL of ethanol, 0.80 g of diethanolamine, and 1.6 g of potassium carbonate, and the mixture was stirred at room temperature for 15 minutes and then stirred under reflux with heating for 3 hours. Insoluble matter in the reaction mixture was removed by filtration, and the filtrate was evaporated under reduced pressure. The resulting residue was purified by NH silica gel column chromatography (hexane-ethyl acetate) to obtain 0.41 g of a pale yellow oily substance, 2,2'-((3-((4-(benzyloxy)butyl)(ethyl)amino)propyl)azanediyl)bis(ethan-1-ol) (B3). MS m / z (M+H): 353.

[0188] (3)

[0189] To a 30 mL solution of 3.0 g of 2-pentylheptyl 5-hydroxyundecanoate described in WO2021 / 095876 in tetrahydrofuran, 2.1 g of 1,1'-carbonyldi(1,2,4-triazole) was added and stirred at room temperature overnight. Water and ethyl acetate were added to the reaction mixture, and the organic layer was separated. After drying over anhydrous sodium sulfate, the solvent was evaporated under reduced pressure, and the residue was purified by silica gel column chromatography (hexane-ethyl acetate) to obtain 4.3 g of 1-oxo-1-((2-pentylheptyl)oxy)undecan-5-yl 1H-1,2,4-triazole-1-carboxylate as a colorless oil. 1 H-NMR(CDCl3)δ:8.82 (1H, s), 8.07 (1H, s), 5.21-5.14 (1H, m), 3.97 (2H, d, J=5.6Hz), 2.36 (2H, t, J=7.2Hz), 1.88-1.55 (7H, m), 1.40-1.22 (24H, m), 0.91-0.85 (9H, m).

[0190] (4)

[0191] To 0.55 g of 1-oxo-1-((2-pentylheptyl)oxy)undecan-5-yl 1H-1,2,4-triazole-1-carboxylate, 6 mL of acetonitrile, 0.41 g of 2,2'-((3-((4-(benzyloxy)butyl)(ethyl)amino)propyl)azanediyl)bis(ethan-1-ol) (B3), and 0.54 g of 1,8-diazabicyclo[5.4.0]-7-undecene were added, and the mixture was stirred at 55°C for 4 hours. The reaction mixture was cooled to 30°C, and ethyl acetate and water were added, and the organic layer was separated. After drying over anhydrous sodium sulfate, the solvent was evaporated under reduced pressure. The resulting residue was purified by silica gel column chromatography (ethyl acetate-methanol-triethylamine) and then by NH silica gel column chromatography (hexane-ethyl acetate) to give 0.25 g of a colorless oily substance: bis(2-pentylheptyl) 11-(3-((4-(benzyloxy)butyl)(ethyl)amino)propyl)-5,17-dihexyl-7,15-dioxo-6,8,14,16-tetraoxa-11-azahenicosanedioate. MS m / z (M+H): 1146.

[0192] (5)

[0193] To a solution of 0.25 g of bis(2-pentylheptyl)11-(3-((4-(benzyloxy)butyl)(ethyl)amino)propyl)-5,17-dihexyl-7,15-dioxo-6,8,14,16-tetraoxa-11-azahenicosanedioate in 4 mL of methanol, 57 mg of 10% palladium on carbon (55% water-wet product) and 105 mg of ammonium formate were added, and the mixture was stirred under reflux for 15 hours. Insoluble matter was removed by filtration through Celite, and the filtrate was evaporated under reduced pressure. The obtained residue was purified by NH silica gel column chromatography (hexane-ethyl acetate) to obtain 95 mg of a colorless oily substance, bis(2-pentylheptyl)11-(3-(ethyl(4-hydroxybutyl)amino)propyl)-5,17-dihexyl-7,15-dioxo-6,8,14,16-tetraoxa-11-azahenicosanedioate (Compound 9). 1H-NMR(CDCl3)δ:4.74-4.63 (2H, m), 4.22-4.08 (4H, m), 3.97 (4H, d, J=5.8Hz), 3.60-3.48 (2H, m), 2.80 (4H, t, J=6.4Hz), 2.60-2.45 (6H, MS m / z(M+H):1056.

[0194] [Synthesis Example 10]

[0195] Octyl 3-ethyl-6-(2-((3-heptyldecanoyl)oxy)ethyl)-12-hexyl-10-oxo-9,11-dioxa-3,6-diazahexadecane-16-oate (Compound 10) was synthesized in the same manner as in Synthesis Example 8(4) to (8), except that 1-octanol was used instead of 1-heptanol in Synthesis Example 8(4) and that 3-heptyldecanoic acid described in WO2019 / 235635 was used instead of 2-heptylnonanoic acid (A4) in Synthesis Example 8(8). 1 H-NMR(CDCl3)δ:4.73-4.64 (1H, m), 4.20-4.09 (4H, m), 4.05 (2H, t, J=6.7Hz), 2.89-2.77 (4H, m), 2.73-2.42 (8H, m), 2.31 (2H, t, MS m / z(M+H):798.

[0196] [Synthesis Example 11] (1)

[0197] 2-Pentylheptyl 6-hydroxydodecanoate was obtained in the same manner as in Example 84(1) described in WO2019 / 235635, except that monomethyl adipate was used instead of 10-methoxy-10-oxodecanoic acid and 2-pentylheptan-1-ol was used instead of 2-butyloctan-1-ol. 1 H-NMR(CDCl3)δ:3.97 (2H, d, J=5.8Hz), 3.59 (1H, m), 2.32 (2H, t, J=7.4Hz), 1.79-1.19 (34H, m), 0.92-0.83 (9H, m).

[0198] (2)

[0199] To a solution of 1.1 g of 2-pentylheptyl 6-hydroxydodecanoate in 11 mL of tetrahydrofuran, 0.73 g of 1,1'-carbonyldi(1,2,4-triazole) was added and stirred at 30°C for 4 hours. Ethyl acetate and water were added to the reaction mixture, and the organic layer was separated. The organic layer was washed with saturated brine, then dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The resulting residue was purified by silica gel column chromatography (hexane-ethyl acetate) to yield 1.2 g of 1-oxo-1-((2-pentylheptyl)oxy)dodecan-6-yl 1H-1,2,4-triazole-1-carboxylate as a colorless oil. 1 H-NMR(CDCl3)δ:8.81 (1H,s), 8.07 (1H, s), 5.20-5.12 (1H, m), 3.95 (2H, d, J=5.8Hz), 2.31 (2H, t, J=7.42Hz), 1.87-1.52 (7H, m), 1.48-1.19 (26H, m), 0.92-0.83 (9H, m).

[0200] (3)

[0201] To a solution of 2.5 g of diethanolamine in 25 mL of ethanol, 4.6 g of 3-chloro-N,N-diethylpropan-1-amine and 4.1 g of potassium carbonate were added, and the mixture was stirred at room temperature for 15 minutes, followed by stirring under reflux for 2 hours. 1 g of 3-chloro-N,N-diethylpropan-1-amine was added, and the mixture was again stirred under reflux for 2 hours. Insoluble matter from the reaction mixture was removed by filtration, and the filtrate was evaporated under reduced pressure. The resulting residue was purified by NH silica gel column chromatography (hexane-ethyl acetate-methanol) to yield 3.0 g of 2,2'-((3-(diethylamino)propyl)azanediyl)bis(ethan-1-ol) as a colorless oil. 1 H-NMR(CDCl3)δ:3.62 (4H, t, J=5.2Hz), 2.26 (2H, t, J=6.0Hz), 2.61-2.49 (10H, m), 1.68-1.60 (2H, m), 1.04 (6H, t, J=7.2Hz). MS m / z(M+H):219.

[0202] (4)

[0203] To 5.2 g of 2,2'-((3-(diethylamino)propyl)azanediyl)bis(ethan-1-ol), 208 mL of acetonitrile, 24.4 g of 1-oxo-1-((2-pentylheptyl)oxy)dodecan-6-yl 1H-1,2,4-triazole-1-carboxylate, and 10.9 g of 1,8-diazabicyclo[5.4.0]-7-undecene were added, and the mixture was stirred at 50°C for 2 hours. The reaction mixture was cooled to room temperature, and ethyl acetate and water were added, and the organic layer was separated. After drying over anhydrous sodium sulfate, the solvent was evaporated under reduced pressure. The obtained residue was purified by silica gel column chromatography (ethyl acetate-methanol) and then by NH silica gel column chromatography (hexane-ethyl acetate) to obtain 20.3 g of a colorless oily substance, bis(2-pentylheptyl)12-(3-(diethylamino)propyl)-8,16-dioxo-6,18-dipentyl-7,9,15,17-tetraoxa-12-azatricosandioate (Compound 11). 1H-NMR(CDCl3)δ: 4.71-4.62 (2H, m), 4.22-4.08 (4H, m), 3.96 (4H, d, J=5.8Hz), 2.80 (4H, t, J=6.4Hz), 2.60-2.45 (6H, m), 2.44-2.37 (2H, MS m / z(M+H):1040.

[0204] [Synthesis Example 12] (1)

[0205] To a suspension of 1.0 g of adipic anhydride in 50 mL of tetrahydrofuran, 7.8 mL of a 1 mol / L pentylmagnesium bromide-tetrahydrofuran solution was added dropwise under ice-cooling, and the mixture was stirred at the same temperature for 2 hours. 20 mL of a 1 mol / L aqueous hydrochloric acid solution was added to the reaction mixture under ice-cooling, followed by addition of ethyl acetate, and the organic layer was separated. The resulting organic layer was washed with water and a saturated aqueous sodium chloride solution, dried over anhydrous magnesium sulfate, and the solvent was then evaporated under reduced pressure. The resulting residue was purified by silica gel column chromatography (hexane-ethyl acetate) to yield 0.44 g of a mixture of 6-oxoundecanoic acids. 1 H-NMR(CDCl3)δ:2.49-2.32 (6H, m), 1.67-1.52 (6H, m), 1.37-1.20 (4H, m), 0.89 (3H, t, J=7.1Hz). MS m / z(M+H):201.

[0206] (2)

[0207] A pale yellow oily product, 2-pentylheptyl 6-oxoundecanoate, was obtained in the same manner as in Synthesis Example 8(4), except that 6-oxoundecanoic acid was used instead of 5-oxoundecanoic acid and 2-pentylheptan-1-ol was used instead of 1-heptanol.

[0208] (3)

[0209] A colorless oily substance, 2-pentylheptyl 6-hydroxyundecanoate, was obtained in the same manner as in Synthesis Example 8(5), except that 2-pentylheptyl 6-oxoundecanoate was used instead of heptyl 5-oxoundecanoate. 1 H-NMR(CDCl3)δ:3.97 (2H, d, J=5.8Hz), 3.59 (1H, m), 2.32 (2H, t, J=7.44Hz), 1.79-1.19 (32H, m), 0.92-0.83 (9H, m).

[0210] (4)

[0211] 1-Oxo-1-((2-pentylheptyl)oxy)undecan-6-yl 1H-1,2,4-triazole-1-carboxylate was obtained in the same manner as in Synthesis Example 11(2). 1 H-NMR(CDCl3)δ:8.81 (1H, s), 8.07 (1H, s), 5.20-5.13 (1H, m), 3.95 (2H, d, J=5.8Hz), 2.31 (2H, t, J=7.4Hz), 1.90-1.51 (7H, m), 1.50-1.19 (24H, m), 0.95-0.82 (9H, m).

[0212] (5)

[0213] Bis(2-pentylheptyl)12-(3-(diethylamino)propyl)-8,16-dioxo-6,18-dipentyl-7,9,15,17-tetraoxa-12-azatricosane dioate (compound 12) was obtained in the same manner as in Synthesis Example 11(4). 1H-NMR(CDCl3)δ: 4.72-4.61 (2H, m), 4.22-4.07 (4H, m), 3.96 (4H, d, J=5.8Hz), 2.80 (4H, t, J=6.4Hz), 2.59-2.45 (6H, m), 2.44-2.36 (2H, MS m / z(M+H):1012.

[0214]

[0215] According to the Preparation of Example 13 of WO2015 / 095340, (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate (compound 13) was obtained.

[0216] [Synthesis Example 14]

[0217] Heptyl 3-ethyl-7-(2-((3-heptyldecanoyl)oxy)ethyl)-13-hexyl-11-oxo-10,12-dioxa-3,7-diazaoctadecane-18-oate (compound 14) was synthesized according to the example described in WO 2024 / 190817.

[0218] [Synthesis Example 15]

[0219] Heptyl 3-ethyl-13-hexyl-7-(2-((2-hexyloctanoyl)oxy)ethyl)-11-oxo-10,12-dioxa-3,7-diazaoctadecane-18-oate (compound 15) was synthesized according to the example described in WO 2024 / 190817.

[0220] [Synthesis Example 16]

[0221] Heptyl 3-ethyl-7-(2-((2-heptylnonanoyl)oxy)ethyl)-13-hexyl-11-oxo-10,12-dioxa-3,7-diazaoctadecane-18-oate (compound 16) was synthesized according to the example described in WO 2024 / 190817.

[0222] [Synthesis Example 17]

[0223] Heptyl 3-ethyl-13-hexyl-7-(2-((2-octyldecanoyl)oxy)ethyl)-11-oxo-10,12-dioxa-3,7-diazaoctadecane-18-oate (compound 17) was synthesized according to the example described in WO 2024 / 190817.

[0224] [Synthesis Example 18]

[0225] (1) To a solution of 1-heptanol (5.0 g) in toluene (50 mL), 6-bromohexanoic acid (8.8 g) and 4-toluenesulfonic acid monohydrate (370 mg) were added and the mixture was stirred under reflux for 6 hours. The solvent in the reaction mixture was removed under reduced pressure, and the residue was purified by NH silica gel column chromatography (hexane-ethyl acetate) to obtain 6-bromohexanoic acid heptyl ester (C2) (12.5 g) as a pale yellow oil. 1 H-NMR(CDCl3)δ: 4.06 (2H, t, J=6.7Hz), 4.06 (2H, t, J=6.7Hz), 2.32 (2H, t, J=7.4Hz), 1.92-1.83 (2H, m), 1.72-1.56 (4H, m), 1.55-1.41 (4H, m), 1.40-1.20 (6H, m), 0.93-0.83 (3H, m).

[0226] (2) To a mixture of heptyl 6-bromohexanoate (C2) (3.0 g), n-hexylamine (4.1 mL), and acetonitrile (30 mL), potassium carbonate (4.2 g) was added and stirred at 60°C for 4 hours. After the reaction mixture was cooled to room temperature, the solvent was distilled off under reduced pressure. Ethyl acetate and water were added to the residue, and the organic layer was separated. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The resulting residue was purified by silica gel column chromatography (methanol-ethyl acetate) and then by NH silica gel column chromatography (ethyl acetate-hexane) to yield 2.5 g of heptyl 6-(hexylamino)hexanoate (C3) as a colorless oil. 1 H-NMR(CDCl3)δ: 4.05 (2H, t, J=6.7Hz), 2.63-2.54 (4H, m), 2.30 (2H, t, J=7.5Hz), 1.70-1.56 (4H, m), 1.55-1.41 (4H, m), 1.40-1.20 (17H, m), 0.93-0.84 (6H, m).

[0227] (3) A mixture of heptyl 6-(hexylamino)hexanoate (C3) (2.5 g), 2,2-diethoxyethyl 1H-1,2,4-triazole-1-carboxylate (2.2 g), acetonitrile (25 mL), and triethylamine (2.2 mL) was stirred at 50°C for 4 hours. After cooling to room temperature, the solvent was distilled off under reduced pressure. Ethyl acetate (20 mL) and water (20 mL) were added to the residue, and the organic layer was separated. The resulting organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The resulting residue was purified by silica gel column chromatography (ethyl acetate-hexane) to give heptyl 6-(((2,2-diethoxyethoxy)carbonyl)(hexyl)amino)hexanoate (C4) (3.9 g) as a colorless oil. 1H-NMR(CDCl3)δ: 4.72-4.67 (1H, m), 4.17-4.02 (4H, m), 3.77-3.51 (4H, m), 3.26-3.12 (4H, m), 2.30 (2H, t, J=7.5Hz), 1.70-1.45 (10H, m), 1.37-1.17 (20H, m), 0.93-0.84 (6H, m).

[0228] (4) A mixture of heptyl 6-(((2,2-diethoxyethoxy)carbonyl)(hexyl)amino)hexanoate (C4) (2.0 g), formic acid (8 mL), and water (2 mL) was stirred at 50°C for 2 hours, after which toluene was added and the mixture was evaporated under reduced pressure. This procedure of adding toluene again and evaporating under reduced pressure was repeated twice to obtain crude colorless oily heptyl 6-(hexyl((2-oxoethoxy)carbonyl)amino)hexanoate (C5) (1.67 g). 1 H-NMR(CDCl3)δ: 9.63 (1H, s), 4.61 (2H, s), 4.06 (2H, t, J=6.7Hz), 3.31-3.11 (4H, m), 2.31 (2H, t, J=7.3Hz), 1.72-1.42 (8H, m), 1.40-1.20 (14H, m), 0.94-0.83 (6H, m).

[0229] (5) To a solution of heptyl 6-(hexyl((2-oxoethoxy)carbonyl)amino)hexanoate (B5) (1.6 g) in ethyl acetate (16 mL), N,N-diethyl-1,3-diaminopropane (1.3 mL), acetic acid (0.1 mL), and sodium triacetoxyborohydride (2.5 g) were added at room temperature, and the mixture was stirred at room temperature for 4 hours. A saturated aqueous solution of sodium bicarbonate was added to the reaction mixture, and the organic layer was separated and washed with saturated brine. Anhydrous sodium sulfate was added for drying, and the solvent was distilled off under reduced pressure. The resulting residue was purified by NH silica gel column chromatography (ethyl acetate-hexane) to give heptyl 3-ethyl-12-hexyl-11-oxo-10-oxa-3,7,12-triazaoctadecane-18-oate (C6) (1.26 g) as a colorless oil. 1H-NMR(CDCl3)δ: 4.17 (2H, t, J=5.6Hz), 4.05 (2H, t, J=6.8Hz), 3.27-3.09 (4H, m), 2.85 (2H, t, J=5.6Hz), 2.67 (2H,t, J=7.0Hz), 2.55-2.43 MS m / z: 515 (M+H) +

[0230] (6) To a solution of heptyl 3-ethyl-12-hexyl-11-oxo-10-oxa-3,7,12-triazaoctadecane-18-oate (C6) (1.26 g) in ethyl acetate (13 mL), 2-(benzyloxy)acetaldehyde (0.58 g) and sodium triacetoxyborohydride (1.04 g) were added at room temperature, and the mixture was stirred at room temperature for 4 hours. Ethyl acetate and saturated aqueous sodium bicarbonate were added to the reaction mixture, and the organic layer was separated and washed with saturated brine. Anhydrous sodium sulfate was added to the organic layer to dry it, and the solvent was distilled off under reduced pressure. The obtained residue was purified by NH silica gel column chromatography (ethyl acetate-hexane) to obtain a colorless oily substance, heptyl 7-(2-(benzyloxy)ethyl)-3-ethyl-12-hexyl-11-oxo-10-oxa-3,7,12-triazaoctadecane-18-oate (C7) (1.44 g). 1H-NMR(CDCl3)δ: 7.36-7.22 (5H, m), 4.51 (2H, s), 4.11 (2H, t, J=6.0Hz), 4.05 (2H, t, J=6.8Hz), 3.54 (2H, t, J=6.2Hz), 3.25-3.08 (4H, m), 2.81-2.72 (4H, m), 2.59-2.45 (6H, m), 2.43-2.36 (2H, m), 2.33-2.24 (2H, m), 1.70-1.41 (10H, m), 1.39-1.18 (16H, m), 1.00 (6H, t, J=7.2Hz), 0.92-0.84 (6H, m).MS m / z: 649(M+H) +

[0231] (7) Heptyl 7-(2-(benzyloxy)ethyl)-3-ethyl-12-hexyl-11-oxo-10-oxa-3,7,12-triazaoctadecane-18-oate (C7) (1.44 g), methanol (44 mL), 10% palladium / carbon (approximately 55% wet with water) (0.43 g), and ammonium formate (1.4 g) were mixed and stirred under heating and reflux for 2 hours. 10% palladium / carbon (0.43 g) and ammonium formate (1.4 g) were added again, and the mixture was stirred under heating and reflux for 2 hours. The mixture was cooled to room temperature, and insoluble matter was removed by filtration through Celite, and the solvent was then distilled off under reduced pressure. The obtained residue was purified by NH silica gel column chromatography (methanol-ethyl acetate-hexane) to obtain a colorless oily substance, heptyl 3-ethyl-12-hexyl-7-(2-hydroxyethyl)-11-oxo-10-oxa-3,7,12-triazaoctadecane-18-oate (C8) (1.07 g). 1H-NMR(CDCl3)δ: 4.13 (2H, t, J=6.0Hz), 4.05 (2H, t, J=6.8Hz), 3.62-3.49 (2H, m), 3.27-3.08 (4H, m), 2.73 (2H, t, J=6.0Hz), 2.66-2.61 (2H, m), 2.59 (2H, t, J=6.8Hz), 2.55-2.42 (6H, m), 2.30 (2H, m), 1.72-1.41 (10H, m), 1.39-1.19 (16H, m), 1.01 (6H, t, J=7.2Hz), 0.92-0.84 (6H, m). MS m / z:559(M+H) +

[0232] (8) To a solution of heptyl 3-ethyl-12-hexyl-7-(2-hydroxyethyl)-11-oxo-10-oxa-3,7,12-triazaoctadecane-18-oate (C8) (150 mg) in dichloromethane (1.5 mL), 2-hexyloctanoic acid (AA1) (93 mg), N,N'-diisopropylcarbodiimide (84 μL), 9-azajulolidine (141 mg), and triethylamine (0.23 mL) were added and stirred at room temperature overnight. The solvent in the reaction mixture was evaporated under reduced pressure, and then ethyl acetate and water were added, and the organic layer was separated. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue was purified by silica gel column chromatography (methanol-ethyl acetate) and then by NH silica gel column chromatography (ethyl acetate-hexane) to give a colorless oily substance, heptyl 3-ethyl-12-hexyl-7-(2-((2-hexyloctanoyl)oxy)ethyl)-11-oxo-10-oxa-3,7,12-triazaoctadecane-18-oate (Compound 18) (140 mg). 1H-NMR(CDCl3)δ: 4.15-4.01 (6H, m), 3.26-3.09 (4H, m), 2.76 (4H, t, J=6.4Hz), 2.59-2.46 (6H, m), 2.45-2.37 (2H, m), 2.35-2.25 (3H, m), 1.70-1.38 (16H, m), 1.37-1.18 (30H, m), 1.01 (6H, t, J=7.1Hz), 0.92-0.82 (12H, m). MS m / z:769(M+H) +

[0233] [Synthesis Example 19]

[0234] 3-Ethyl-12-hexyl-7-(2-hydroxyethyl)-11-oxo-10-oxa-3,7,12-triazaoctadecane-18-oate Heptyl 3-ethyl-7-(2-((2-heptylnonanoyl)oxy)ethyl)-12-hexyl-11-oxo-10-oxa-3,7,12-triazaoctadecane-18-oate was synthesized in the same manner as in Synthesis Example 18(8) using heptyl and 2-heptylnonanoic acid. 1 H-NMR(CDCl3)δ:4.15-4.01 (6H, m), 3.26-3.09 (4H, m), 2.76 (4H, t, J=6.4Hz), 2.59-2.46 (6H, m), 2.45-2.37 (2H, m), 2.35-2.25 (3H, m), 1.70-1.38 (16H, m), 1.37-1.18 (34H, m), 1.00 (6H, t, J=7.1Hz), 0.92-0.83 (12H, m). MS(ESI,m / z):796.9[M+H] +

[0235] [Synthesis Example 20]

[0236] 3-Ethyl-12-hexyl-7-(2-hydroxyethyl)-11-oxo-10-oxa-3,7,12-triazaoctadecane-18-oate Heptyl 3-ethyl-12-hexyl-7-(2-((2-octyldecanoyl)oxy)ethyl)-11-oxo-10-oxa-3,7,12-triazaoctadecane-18-oate was synthesized in the same manner as in Synthesis Example 18(8) using heptyl and 2-octyldecanoic acid. 1 H-NMR(CDCl3)δ: 4.16-4.01 (6H, m), 3.26-3.09 (4H, m), 2.76 (4H, t, J=6.4Hz), 2.62-2.36 (8H, m), 2.35-2.25 (3H, m), 1.70-1.38 (16H, m), 1.37-1.18 (38H, m), 1.07-0.96 (6H, m), 0.94-0.83 (12H, m). MS(ESI,m / z):825.1[M+H] +

[0237] [Synthesis Example 21]

[0238] 3-Ethyl-12-hexyl-7-(2-hydroxyethyl)-11-oxo-10-oxa-3,7,12-triazaoctadecane-18-oate Heptyl 3-ethyl-12-hexyl-7-(2-((2-nonylundecanoyl)oxy)ethyl)-11-oxo-10-oxa-3,7,12-triazaoctadecane-18-oate was synthesized in the same manner as in Synthesis Example 18(8) using heptyl and 2-nonylundecanoic acid. 1 H-NMR(CDCl3)δ: 4.15-4.02 (6H, m), 3.27-3.09 (4H, m), 2.76 (4H, t, J=6.4Hz), 2.62-2.36 (8H, m), 2.35-2.25 (3H, m), 1.70-1.38 (16H, m), 1.37-1.18 (42H, m), 1.07-0.96 (6H, m), 0.94-0.82 (12H, m). MS(ESI,m / z):854.1[M+H] +

[0239] [Synthesis Example 22]

[0240] 3-Ethyl-12-hexyl-7-(2-hydroxyethyl)-11-oxo-10-oxa-3,7,12-triazaoctadecane-18-oate Heptyl 3-ethyl-12-hexyl-7-(2-((2-hexyldecanoyl)oxy)ethyl)-11-oxo-10-oxa-3,7,12-triazaoctadecane-18-oate was synthesized in the same manner as in Synthesis Example 18(8) using heptyl and 2-hexyldecanoic acid. 1 H-NMR(CDCl3)δ: 4.15-4.08 (4H, m), 4.05 (2H, t, J=6.8Hz), 3.25-3.10 (4H, m), 2.76 (4H, t, J=6.4Hz), 2.59-2.46 (6H, m), 2.46-2.38 (2H, MS(ESI,m / z):797[M+H] +

[0241] [Synthesis Example 23]

[0242] 3-Ethyl-12-hexyl-7-(2-hydroxyethyl)-11-oxo-10-oxa-3,7,12-triazaoctadecane-18-oate Heptyl 3-ethyl-7-(2-((3-heptyldecanoyl)oxy)ethyl)-12-hexyl-11-oxo-10-oxa-3,7,12-triazaoctadecane-18-oate was synthesized in the same manner as in Synthesis Example 18(8) using heptyl and 3-heptyldecanoic acid. 1H-NMR(CDCl3)δ: 4.15-4.02 (6H, m), 3.25-3.10 (4H, m), 2.76 (4H, t, J=6.3Hz), 2.59-2.46 (6H, m), 2.46-2.37 (2H, m), 2.30 (2H, t, J=7.5Hz), 2.22 (2H, d, J=6.9Hz), 1.87-1.79 (1H, m), 1.72-1.42 (12H, m), 1.38-1.18 (38H, m), 1.01 (6H, t, J=7.1Hz), 0.92-0.83 (12H, m). MS(ESI,m / z):811.1[M+H] +

[0243] [Synthesis Example 24]

[0244] 3-Ethyl-11-hexyl-6-(2-hydroxyethyl)-10-oxo-9-oxa-3,6,11-triazaheptadecan-17-oate Heptyl 3-ethyl-11-hexyl-6-(2-((2-hexylooctanoyl)oxy)ethyl)-10-oxo-9-oxa-3,6,11-triazaheptadecan-17-oate was synthesized in the same manner as in Synthesis Example 18(8) using heptyl and 2-hexyloctanoic acid. 1 H-NMR(CDCl3)δ: 4.14-4.02 (6H, m), 3.26-3.09 (4H, m), 2.80 (4H, t, J=6.3Hz), 2.71-2.62 (2H, m), 2.56-2.47 (6H, m), 2.35-2.25 (3H, m), 1.71-1.37 (16H, m), 1.37-1.18 (32H, m), 1.02 (6H, t, J=7.1Hz), 0.92-0.83 (12H, m). MS(ESI,m / z):755.1[M+H] +

[0245] [Synthesis Example 25]

[0246] Heptyl 3-ethyl-6-(2-((2-heptylnonanoyl)oxy)ethyl)-11-hexyl-10-oxo-9-oxa-3,6,11-triazaheptadecan-17-oate was synthesized in the same manner as in Synthesis Example 18(8) using 3-ethyl-11-hexyl-6-(2-hydroxyethyl)-10-oxo-9-oxa-3,6,11-triazaheptadecan-17-oate and 2-heptylnonanoic acid. 1H-NMR(CDCl3)δ: 4.14-4.02 (6H, m), 3.26-3.09 (4H, m), 2.80 (4H, t, J=6.3Hz), 2.71-2.62 (2H, m), 2.56-2.47 (6H, m), 2.35-2.25 (3H, MS(ESI,m / z):783.1[M+H]+

[0247] [Synthesis Example 26]

[0248] 3-Ethyl-11-hexyl-6-(2-hydroxyethyl)-10-oxo-9-oxa-3,6,11-triazaheptadecan-17-oate Heptyl 3-ethyl-11-hexyl-6-(2-((2-octyldecanoyl)oxy)ethyl)-10-oxo-9-oxa-3,6,11-triazaheptadecan-17-oate was synthesized in the same manner as in Synthesis Example 18(8) using heptyl and 2-octyldecanoic acid. 1 H-NMR(CDCl3)δ: 4.16-4.01 (6H, m), 3.26-3.08 (4H, m), 2.80 (4H, t, J=6.3Hz), 2.71-2.62 (2H, m), 2.56-2.47 (6H, m), 2.35-2.25 (3H, m), 1.71-1.37 (16H, m), 1.37-1.18 (40H, m), 1.01 (6H, t, J=7.1Hz), 0.93-0.81 (12H, m). MS(ESI,m / z):811.2[M+H] +

[0249] [Synthesis Example 27]

[0250] 3-Ethyl-11-hexyl-6-(2-hydroxyethyl)-10-oxo-9-oxa-3,6,11-triazaheptadecan-17-oate Heptyl 3-ethyl-11-hexyl-6-(2-((2-nonylundecanoyl)oxy)ethyl)-10-oxo-9-oxa-3,6,11-triazaheptadecan-17-oate was synthesized in the same manner as in Synthesis Example 18(8) using heptyl and 2-nonylundecanoic acid. 1 H-NMR(CDCl3)δ: 4.17-4.08 (4H, m), 4.05 (2H, t, J=6.8Hz), 3.27-3.08 (4H, m), 2.80 (4H, t, J=6.3Hz), 2.72-2.62 (2H, m), 2.57-2.46 (6H, MS(ESI,m / z):839.2[M+H] +

[0251] [Synthesis Example 28]

[0252] 3-Ethyl-11-hexyl-6-(2-hydroxyethyl)-10-oxo-9-oxa-3,6,11-triazaheptadecan-17-oate Heptyl 3-ethyl-11-hexyl-6-(2-((2-hexyldecanoyl)oxy)ethyl)-10-oxo-9-oxa-3,6,11-triazaheptadecan-17-oate was synthesized in the same manner as in Synthesis Example 18(8) using heptyl and 2-hexyldecanoic acid. 1H-NMR(CDCl3)δ: 4.17-4.08 (4H, m), 4.05 (2H, t, J=6.8Hz), 3.27-3.08 (4H, m), 2.80 (4H, t, J=6.3Hz), 2.70-2.63 (2H, m), 2.57-2.46 (6H, MS(ESI,m / z):783.1[M+H] +

[0253] [Synthesis Example 29]

[0254] 3-Ethyl-11-hexyl-6-(2-hydroxyethyl)-10-oxo-9-oxa-3,6,11-triazaheptadecan-17-oate Heptyl 3-ethyl-6-(2-((3-heptyldecanoyl)oxy)ethyl)-11-hexyl-10-oxo-9-oxa-3,6,11-triazaheptadecan-17-oate was synthesized in the same manner as in Synthesis Example 18(8) using heptyl and 3-heptyldecanoic acid. 1 H-NMR(CDCl3)δ: 4.16-4.01 (6H, m), 3.26-3.08 (4H, m), 2.79 (4H, t, J=6.3Hz), 2.71-2.62 (2H, m), 2.56-2.47 (6H, m), 2.30 (2H, t, J=Hz), 2.22 (2H, d, J=Hz), 1.90-1.76 (1H, m), 1.71-1.37 (10H, m), 1.37-1.18 (38H, m), 1.01 (6H, t, J=7.1Hz), 0.93-0.81 (12H, m). MS(ESI,m / z):797.2[M+H] +

[0255] [Synthesis Example 30]

[0256] Heptyl 3-ethyl-12-hexyl-6-(2-((2-nonylundecanoyl)oxy)ethyl)-10-oxo-9,11-dioxa-3,6-diazahexadecan-16-oate (compound 30) was synthesized according to the example described in WO 2024 / 190817.

[0257] [Synthesis Example 31]

[0258] Heptyl 6-(2-((2-decyldodecanoyl)oxy)ethyl)-3-ethyl-12-hexyl-10-oxo-9,11-dioxa-3,6-diazahexadecan-16-oate (compound 31) was synthesized according to the example described in WO 2024 / 190817.

[0259] [Synthesis Example 32]

[0260] Heptyl 3-ethyl-12-hexyl-6-(2-((2-hexyldecanoyl)oxy)ethyl)-10-oxo-9,11-dioxa-3,6-diazahexadecan-16-oate (compound 32) was synthesized according to the example described in WO 2024 / 190817.

[0261] [Synthesis Example 33]

[0262] Bis(2-pentylheptyl) 11-(2-((2-(benzyloxy)ethyl)(ethyl)amino)ethyl)-5,17-dihexyl-7,15-dioxo-6,8,14,16-tetraoxa-11-azahenicosanedioic acid was synthesized as a colorless oil in the same manner as in Synthesis Example 9 (4) using 2,2'-((2-((2-(benzyloxy)ethyl)(ethyl)amino)ethyl)azanediyl)bis(ethan-1-ol) and 1-oxo-1-((2-pentylheptyl)oxy)undecan-5-yl 1H-1,2,4-triazole-1-carboxylate. LC / MS rt (min): 1.57 MS (ESI, m / z): 1104.4 [M+H] +

[0263] [Synthesis Example 34]

[0264] Using 2-butyloctyl 7-ethyl-16-hexyl-10-(2-(octanoyloxy)ethyl)-14-oxo-1-phenyl-2,13,15-trioxa-7,10-diazapentacosane-25-oate, 2-butyloctyl 5-ethyl-14-hexyl-1-hydroxy-8-(2-(octanoyloxy)ethyl)-12-oxo-11,13-dioxa-5,8-diazatricosane-23-oate was synthesized as a colorless oil in the same manner as in Synthesis Example 9 (5). LC / MS rt (min): 0.83 MS (ESI, m / z): 842.1 [M+H] +

[0265] [Synthesis Example 35]

[0266] Using bis(2-butyloctyl) 16-(2-((4-(benzyloxy)butyl)(ethyl)amino)ethyl)-10,22-dihexyl-12,20-dioxo-11,13,19,21-tetraoxa-16-azahentriacontanedioate, bis(2-butyloctyl) 16-(2-(ethyl(4-hydroxybutyl)amino)ethyl)-10,22-dihexyl-12,20-dioxo-11,13,19,21-tetraoxa-16-azahentriacontanedioate was synthesized as a colorless oil in the same manner as in Synthesis Example 9 (5). LC / MS rt (min): 1.97 MS (ESI, m / z): 1182.5 [M+H] +

[0267] [Synthesis Example 36]

[0268] Using bis(2-pentylheptyl) 11-(2-((4-(benzyloxy)butyl)(ethyl)amino)ethyl)-5,17-dihexyl-7,15-dioxo-6,8,14,16-tetraoxa-11-azahenicosanedioate, bis(2-pentylheptyl) 11-(2-(ethyl(4-hydroxybutyl)amino)ethyl)-5,17-dihexyl-7,15-dioxo-6,8,14,16-tetraoxa-11-azahenicosanedioic acid was synthesized as a colorless oil in the same manner as in Synthesis Example 9 (5). LC / MS rt (min): 1.48 MS (ESI, m / z): 1042.3 [M+H] +

[0269] [Synthesis Example 37]

[0270] Using 2-pentylheptyl 10-(2-(decanoyloxy)ethyl)-7-ethyl-16-hexyl-14-oxo-1-phenyl-2,13,15-trioxa-7,10-diazaicosan-20-oate, 2-pentylheptyl 8-(2-(decanoyloxy)ethyl)-5-ethyl-14-hexyl-1-hydroxy-12-oxo-11,13-dioxa-5,8-diazaoctadecane-18-oate was synthesized as a colorless oil in the same manner as in Synthesis Example 9 (5). LC / MS rt (min): 0.62 MS (ESI, m / z): 800.0 [M+H] +

[0271] [Synthesis Example 38]

[0272] Bis(2-pentylheptyl) 12-(2-(ethyl(4-hydroxybutyl)amino)ethyl)-5,19-dihexyl-7,17-dioxo-6,8,16,18-tetraoxa-12-azatricosandioate was used in the same manner as in Synthesis Example 9 (5) to synthesize bis(2-pentylheptyl) 12-(2-(ethyl(4-hydroxybutyl)amino)ethyl)-5,19-dihexyl-7,17-dioxo-6,8,16,18-tetraoxa-12-azatricosandioate as a colorless oil. LC / MS rt (min): 1.61 MS (ESI, m / z): 1070.4 [M+H] +

[0273] [Synthesis Example 39]

[0274] Using bis(2-pentylheptyl) 11-(2-((3-(benzyloxy)propyl)(ethyl)amino)ethyl)-5,17-dihexyl-7,15-dioxo-6,8,14,16-tetraoxa-11-azahenicosanedioate, bis(2-pentylheptyl) 11-(2-(ethyl(3-hydroxypropyl)amino)ethyl)-5,17-dihexyl-7,15-dioxo-6,8,14,16-tetraoxa-11-azahenicosanedioate was synthesized as a colorless oil in the same manner as in Synthesis Example 9 (5). LC / MS rt (min): 1.40 MS (ESI, m / z): 1028.3 [M+H] +

[0275] [Synthesis Example 40]

[0276] Using bis(2-pentylheptyl)11-(2-((2-(benzyloxy)ethyl)(ethyl)amino)ethyl)-5,17-dihexyl-7,15-dioxo-6,8,14,16-tetraoxa-11-azahenicosanedioic acid, bis(2-pentylheptyl)11-(2-(ethyl(2-hydroxyethyl)amino)ethyl)-5,17-dihexyl-7,15-dioxo-6,8,14,16-tetraoxa-11-azahenicosanedioic acid was synthesized as a colorless oil in the same manner as in Synthesis Example 9 (5). LC / MS rt (min): 1.44 MS (ESI, m / z): 1014.3 [M+H] +

[0277] [Synthesis Example 41]

[0278] Bis(2-pentylheptyl)13-(2-(ethyl(4-hydroxybutyl)amino)ethyl)-5,21-dihexyl-7,19-dioxo-6,8,18,20-tetraoxa-13-azapentacosane dioic acid was synthesized as a colorless oil in the same manner as in Synthesis Example 9 (5) using bis(2-pentylheptyl)13-(2-((4-(benzyloxy)butyl)(ethyl)amino)ethyl)-5,21-dihexyl-7,19-dioxo-6,8,18,20-tetraoxa-13-azapentacosane dioic acid. LC / MS rt (min): 1.44 MS (ESI, m / z): 1098.5 [M+H] +

[0279] [Synthesis Example 42]

[0280] Using 2-pentylheptyl 7-ethyl-17-hexyl-11-(2-hydroxyethyl)-15-oxo-1-phenyl-2,14,16-trioxa-7,11-diazahenicosan-21-oate and decanoic acid, 2-pentylheptyl 11-(2-(decanoyloxy)ethyl)-7-ethyl-17-hexyl-15-oxo-1-phenyl-2,14,16-trioxa-7,11-diazahenicosan-21-oate was synthesized as a colorless oil in the same manner as in Synthesis Example 18 (8). LC / MS rt (min): 0.87 MS (ESI, m / z): 904.2 [M+H] +

[0281] [Synthesis Example 43]

[0282] Using 2-pentylheptyl 7-ethyl-18-hexyl-10-(4-hydroxybutyl)-16-oxo-1-phenyl-2,15,17-trioxa-7,10-diazadocosane-22-oate and decanoic acid, 2-pentylheptyl 10-(4-(decanoyloxy)butyl)-7-ethyl-18-hexyl-16-oxo-1-phenyl-2,15,17-trioxa-7,10-diazadocosane-22-oate was synthesized as a colorless oil in the same manner as in Synthesis Example 18 (8). LC / MS rt (min): 0.99 MS (ESI, m / z): 946.2 [M+H] +

[0283] [Synthesis Example 44]

[0284] Using 2-pentylheptyl 7-ethyl-17-hexyl-10-(3-hydroxypropyl)-15-oxo-1-phenyl-2,14,16-trioxa-7,10-diazahenicosan-21-oate and decanoic acid, 2-pentylheptyl 10-(3-(decanoyloxy)propyl)-7-ethyl-17-hexyl-15-oxo-1-phenyl-2,14,16-trioxa-7,10-diazahenicosan-21-oate was synthesized as a colorless oil in the same manner as in Synthesis Example 18 (8). LC / MS rt (min): 1.07 MS (ESI, m / z): 918.2 [M+H] +

[0285] [Synthesis Example 45]

[0286] 2-Pentylheptyl 6-(2-(decanoyloxy)ethyl)-3-ethyl-12-hexyl-10-oxo-9,11-dioxa-3,6-diazahexadecan-16-oate (compound 45) was synthesized according to the examples described in WO 2021 / 095876.

[0287] [Synthesis Example 46]

[0288] 2-Butyloctyl 3-ethyl-12-hexyl-6-(2-(octanoyloxy)ethyl)-10-oxo-9,11-dioxa-3,6-diazahenicosan-21-oate (compound 46) was synthesized according to the example described in WO 2019 / 235635.

[0289] [Synthesis Example 47]

[0290] Bis(2-pentylheptyl)11-(2-(dimethylamino)ethyl)-5,17-dihexyl-7,15-dioxo-6,8,14,16-tetraoxa-11-azahenicosanedioate (compound 47) was synthesized according to the examples described in WO2022 / 230964.

[0291] [Synthesis Example 48]

[0292] Bis(2-pentylheptyl) 11-(2-(dipropylamino)ethyl)-5,17-dihexyl-7,15-dioxo-6,8,14,16-tetraoxa-11-azahenicosanedioate (compound 48) was synthesized according to the example described in WO 2022 / 230964.

[0293] [Synthesis Example 49]

[0294] Bis(2-pentylheptyl) 10-(2-(diethylamino)ethyl)-4,16-dihexyl-6,14-dioxo-5,7,13,15-tetraoxa-10-azanonadecandioate (compound 49) was synthesized according to the example described in WO 2022 / 230964.

[0295] [Synthesis Example 50]

[0296] Bis(2-hexyloctyl) 5,17-dibutyl-11-(2-(diethylamino)ethyl)-7,15-dioxo-6,8,14,16-tetraoxa-11-azahenicosanedioate (compound 50) was synthesized according to the example described in WO 2022 / 230964.

[0297] [Synthesis Example 51]

[0298] Bis(2-pentylheptyl) 12-(2-(diethylamino)ethyl)-6,18-dihexyl-8,16-dioxo-7,9,15,17-tetraoxa-12-azatricosane dioate (compound 51) was synthesized according to the example described in WO 2022 / 230964.

[0299] [Synthesis Example 52]

[0300] Bis(2-pentylheptyl) 11-(2-(diethylamino)ethyl)-7,15-dioxo-5,17-dipentyl-6,8,14,16-tetraoxa-11-azahenicosanedioate (compound 52) was synthesized according to the example described in WO 2022 / 230964.

[0301] [Synthesis Example 53]

[0302] Bis(2-pentylheptyl) 11-(2-(diethylamino)ethyl)-5,17-dioctyl-7,15-dioxo-6,8,14,16-tetraoxa-11-azahenicosanedioate (compound 53) was synthesized according to the example described in WO 2022 / 230964.

[0303] [Synthesis Example 54]

[0304] Bis(2-pentylheptyl)5,17-dibutyl-11-(2-(diethylamino)ethyl)-7,15-dioxo-6,8,14,16-tetraoxa-11-azahenicosanedioate (compound 54) was synthesized according to the example described in WO 2022 / 230964.

[0305] [Synthesis Example 55]

[0306] (1) To a solution of 1-oxo-1-((2-pentylheptyl)oxy)undecan-5-yl 1H-1,2,4-triazole-1-carboxylate (D1) (5 g), synthesized according to the example described in WO2024 / 014430, and 2,2-diethoxyethan-1-ol (1.9 g) in acetonitrile (10 mL), diazabicycloundecene (2.4 mL) was added and stirred at 50° C. for 20 minutes. The reaction mixture was partitioned between ethyl acetate and water, and the resulting organic phase was dried over anhydrous sodium sulfate. The solvent was then evaporated to give 2-pentylheptyl 5-(((2,2-diethoxyethoxy)carbonyl)oxy)undecanoate (D2) (5.77 g). 1 H-NMR(CDCl3)δ: 4.71 (2H, t, J=5.4Hz), 4.13 (2H, t, J=5.3Hz), 3.97 (2H, d, J=5.8Hz), 3.76-3.54 (4H, m), 2.32 (2H, t, J=7.0Hz), 1.78-1.58 (7H, m), 1.33-1.20 (30H, m), 0.90-0.86 (9H, m).

[0307] (2) To a solution of 5-(((2,2-diethoxyethoxy)carbonyl)oxy)undecanoic acid (D2) (1.00 g), acetic acid (4 mL), and water (1 mL), p-toluenesulfonic acid (0.32 g) was added and stirred at 60°C for 1 hour. The reaction mixture was separated into layers using ethyl acetate and saturated brine, and the resulting organic phase was washed with 10% aqueous potassium carbonate and saturated brine. After drying over anhydrous sodium sulfate, the solvent was distilled off to give 2-pentylheptyl 5-(((2-oxoethoxy)carbonyl)oxy)undecanoic acid (D3) (0.86 g). MS m / z: 458 (M+H) +

[0308] (3) A solution of 2-pentylheptyl 5-(((2-oxoethoxy)carbonyl)oxy)undecanoate (D3) (0.86 g) and ethyl acetate (8.6 mL) was cooled to 0°C, and 1-methylpiperidin-4-amine (99 mg) and then sodium triacetoxyborohydride (0.60 g) were added and stirred. The cooling bath was then removed and the mixture was stirred at room temperature for 2 hours. The resulting reaction solution was diluted with ethyl acetate and then quenched by carefully adding 10% aqueous sodium bicarbonate solution. The organic phase of the resulting mixture was washed with 10% aqueous sodium bicarbonate solution and then with saturated brine. After drying over anhydrous sodium sulfate, the solvent was evaporated, and the resulting residue was purified by silica gel column chromatography (hexane / ethyl acetate, then methanol / ethyl acetate) and then further purified by NH silica gel column chromatography (hexane / ethyl acetate) to give bis(2-pentylheptyl)5,17-dihexyl-11-(1-methylpiperidin-4-yl)-7,15-dioxo-6,8,14,16-tetraoxa-11-azahenicosanedioic acid (compound 55) (0.49 g) as a colorless oil. 11H-NMR (CDCl3) δ: 4.71 - 4.65 (2H, m), 4.15 - 4.03 (4H, m), 3.96 (4H, d, J = 5.8 Hz), 2.88 (2H, d, J = 11.3 Hz), 2.80 (4H, t, J = 6.7 Hz), 2.50 - 2.42 (1H, m), 2.32 (4H, t, J = 7.0 Hz), 2.24 (3H, s), 1.91 (2H, t, J = 10.9 Hz), 1.73 - 1.49 (18H, m), 1.34 - 1.21 (48H, m), 0.90 - 0.86 (18H, m). MS m / z: 997(M + H) +

[0309] Compound 56 (product name: DLin-MC3-DMG; manufactured by Fujifilm Wako Pure Chemical Corporation), and compound 57 (product name: COSMETOC(R) SS-OP; manufactured by NOF corporation) were purchased as commercial products.

[0310] [Production of lipid particles] <Preparation of nucleic acid-free lipid particles (empty LNPs)> The ionizable lipids listed in Table 1, DOPE (L-α-dioleoyl phosphatidylethanolamine, product name: COATSOME® ME-8181; manufactured by NOF Corporation), DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine, product name: COATSOME® MC-8080; manufactured by NOF Corporation), DOPC (1,2-dioleoyl-sn-glycero-3-phosphocholine, product name: COATSOME® MC-8181; manufactured by NOF Corporation), and DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine, product name: COATSOME® MC-6060; manufactured by NOF Corporation) were used. One phospholipid (helper lipid) selected from the group consisting of DMPC (1,2-dimyristoyl-sn-glycero-3-phosphocholine, product name: COATSOME® MC-4040; manufactured by NOF Corporation), cholesterol, and DMG-PEG2000 (1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000, product name: SUNBRIGHT® GM-020; manufactured by NOF Corporation) were dissolved in ethanol at the molar ratios shown in Table 1 so that the total lipid concentration was 12.5 mmol / L or 62.5 mmol / L, to obtain an oil phase.

[0311] A 50 mmol / L citrate buffer solution at pH 4 was mixed with the oil phase at a volume ratio of 3:1 citrate buffer to oil phase using a NanoAssemblr (Precision NanoSystems). The mixture was then diluted 2-fold with water to obtain a lipid particle dispersion. This dispersion was dialyzed against 20 mmol / L MES buffer solution at pH 6.0 containing 8% sucrose using a dialysis cassette (Slide-A-Lyzer G2, MWCO: 10 kD, Thermo Fisher Scientific) to remove ethanol. Nucleic acid-free lipid particles (empty LNP) were obtained by a concentration step using an ultrafiltration filter (Amicon ultra 100 kDa, Merck) as needed. The empty LNP was stored frozen at -70°C until use.

[0312] <Encapsulation of GFP mRNA into Empty LNP (Post-Addition Method)> An RNA solution was prepared by diluting CleanCap® EGFP mRNA (5 moU) (TriLink, L-7201) with water for injection. Empty LNP stored at -70°C was thawed at 4°C. An equal volume of the RNA solution was added to the LNP solution and mixed by pipetting (LNP-RNA mixture). After standing at room temperature for 5 minutes, an equal volume of 20 mmol / L Tris buffer (pH 8.4) containing 8% sucrose was added to the LNP-RNA mixture and mixed by pipetting to prepare GFP mRNA-encapsulated LNP using the post-addition method.

[0313] <Inclusion of gRNA and Cas9 mRNA into empty LNP (post-addition method)> CleanCap (registered trademark) Cas9 mRNA (5 moU) (TriLink, L-7206) and sgRNA targeting the human T cell receptor alpha constant (TRAC) gene (sequence; A * G * A * GUCUCUCAGCUGGUACA + modified Scaffold, Thermo Fisher A35514, custom synthesis) were mixed at the weight ratio shown in Table 1 and diluted with water for injection to prepare an RNA solution. Empty LNP stored at -70 ° C was thawed at 4 ° C. An equal volume of RNA solution was added to this LNP solution and mixed by pipetting (LNP-RNA mixture). After allowing to stand at room temperature for 5 minutes, an equal volume of 20 mmol / L Tris buffer containing 8% sucrose was added to the LNP-RNA mixture and mixed by pipetting to prepare Cas9 mRNA / gRNA-encapsulated LNPs using the post-addition method.

[0314]

[0315] <Encapsulation of GFP pDNA into empty LNP (post-addition method)> A DNA solution was prepared by diluting GFP pDNA (GenScript, custom-synthesized plasmid DNA) with water for injection. Empty LNP stored at -70°C was thawed at 4°C. An equal volume of the DNA solution was added to the LNP solution and mixed by pipetting (LNP-DNA mixture). After standing at room temperature for 5 minutes, an equal volume of 20 mmol / L Tris buffer (pH 8.4) containing 8% sucrose was added to the LNP-DNA mixture and mixed by pipetting to prepare GFP pDNA-encapsulated LNP using the post-addition method.

[0316]

[0317] <Preparation of lipid particles encapsulating Cas9 mRNA or GFP mRNA (conventional method)> Ionizable lipids listed in Tables 3 and 4, DOPE (L-α-dioleoyl phosphatidylethanolamine, product name: COATSOME® ME-8181; manufactured by NOF Corporation) or DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine, product name: COATSOME® MC-8080; manufactured by NOF Corporation), cholesterol, DMG-PEG2000 (1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000, product name: SUNBRIGHT® GM-020; manufactured by NOF Corporation), and GFP mRNA were used. Corporation) was dissolved in ethanol at the molar ratios shown in Tables 2 and 3 so that the total lipid concentration was 12.5 mmol / L to obtain an oil phase.

[0318] CleanCap (registered trademark) Cas9 mRNA (5 moU) (TriLink, L-7206) and sgRNA targeting the human T cell receptor alpha constant (TRAC) gene (sequence; A * G * A * GUCUCUCAGCUGGUACA + modified Scaffold, Thermo Fisher A35514, custom synthesis), Tables 3 and 4. Nucleic acid mixture (Cas9 / sgRNA) or GFP mRNA (product name: CleanCap GFP mRNA; manufactured by TriLink) was diluted with 50 mmol / L citrate buffer at pH 4 so that the weight ratio of the total lipid concentration to the mRNA concentration after mixing of the oil and aqueous phases was as shown in Tables 2 and 3 to obtain an aqueous phase. The aqueous and oil phases were then mixed using a NanoAssemblr (Precision NanoSystems) at a volume ratio of 3:1, and the mixture was diluted 2-fold with water to obtain a dispersion of mRNA lipid particles. This dispersion was dialyzed against 20 mmol / L Tris buffer (pH 7.4) containing 8% sucrose using a dialysis cassette (Slide-A-Lyzer G2, MWCO: 10 kD, Thermo Fisher Scientific) to remove ethanol, yielding nucleic acid-encapsulating lipid particles according to the conventional method.

[0319]

[0320]

[0321] <Preparation of GFP pDNA-Encapsulating Lipid Particles (Conventional Method)> The ionizable lipids listed in Table 5, DOPE (L-α-dioleoyl phosphatidylethanolamine, product name: COATSOME® ME-8181; manufactured by NOF Corporation) or DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine, product name: COATSOME® MC-8080; manufactured by NOF Corporation), cholesterol, and DMG-PEG2000 (1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000, product name: SUNBRIGHT® GM-020; manufactured by NOF Corporation) were dissolved in ethanol at the molar ratios shown in Table 5 to a total lipid concentration of 12.5 mmol / L to obtain an oil phase.

[0322] GFP pDNA (GenScript, custom-synthesized plasmid DNA) was diluted with 50 mmol / L citrate buffer at pH 4 so that the weight ratio of total lipid concentration to DNA concentration after mixing of the oil and aqueous phases was as shown in Table 5 to obtain an aqueous phase. The aqueous and oil phases were then mixed using a NanoAssemblr (Precision NanoSystems) so that the volume ratio of aqueous phase to oil phase was 3:1, and the mixture was diluted 2-fold with water to obtain a dispersion of mRNA lipid particles. This dispersion was dialyzed against 20 mmol / L Tris buffer pH 7.4 containing 8% sucrose using a dialysis cassette (Slide-A-Lyzer G2, MWCO: 10 kD, Thermo Fisher Scientific) to remove ethanol, and nucleic acid-encapsulating lipid particles were obtained using conventional methods.

[0323]

[0324] <Preparation of GenVoy T cell kit> As a comparative example, a GenVoy T cell kit (Precision nanosystems) was prepared according to the recommended protocol. Specifically, after all of the kit contents were returned to room temperature, the lipid mix was heated in a 52°C water bath for 10 minutes to fully melt it. CleanCap® Cas9 mRNA (5 moU) (TriLink, L-7206) and sgRNA (sequence: A*G*A*GUCUCUCAGCUGGUACA+modified Scaffold, Thermo Fisher A35514, custom synthesized) targeting the human T cell receptor alpha constant (TRAC) gene were mixed at a weight ratio of 1:1 to prepare a nucleic acid mixture (Cas9 / sgRNA). This mixture was then mixed with water and 10x formulation buffer to prepare a final total RNA concentration of 312 μg / mL, which served as the aqueous phase.

[0325] A 50 mmol / L citrate buffer solution at pH 4 was mixed using a NanoAssembler Ignite (Precision NanoSystems) so that the volume ratio of the aqueous phase to the oil phase was 2:1. The mixture was diluted 30-fold with 1x dilution buffer to obtain a lipid particle dispersion. This dispersion was concentrated using an ultrafiltration filter (Amicon Ultra 100 kDa, Merck), and an equal volume of cryoprotect buffer was added to obtain GenVoy (Comparative Example 1). The prepared GenVoy was stored frozen at -70°C until use.

[0326] <Measurement of particle size> The particle size of the nucleic acid-encapsulated lipid particles was measured using a particle size measurement system NanoSAQLA (Otsuka Electronics) after arbitrarily diluting the lipid particles with phosphate-buffered saline (PBS). The measurement results of particle size and polydispersity index (PDI) are shown in Table 4.

[0327] <Evaluation of Nucleic Acid Encapsulation Rate> (Quantification of Total Nucleic Acid Concentration) Nucleic acid was diluted with MilliQ water to prepare diluted samples in a 2-fold dilution series from 100 μg / mL to 3.1 μg / mL, and a calibration curve solution was prepared. 50 μL of the calibration curve solution or lipid particles was mixed with 450 μL of methanol to prepare a measurement solution. The absorbance of each measurement solution at 260 nm and 330 nm was measured using a UV plate reader (Multiskan Go, Thermo Fisher Scientific), and the absorbance at 330 nm was subtracted from the absorbance at 260 nm to obtain the absorbance of each measurement solution. The total RNA concentration was calculated from the calibration curve using the absorbance of each sample measurement solution.

[0328] (Quantification of nucleic acid concentration in the external aqueous phase) Using the Quant-iT RiboGreen RNA Assay Kit (Thermo Fisher Scientific), the nucleic acid concentration in the external aqueous phase was quantified by the standard addition method. First, the 20x TE buffer included in the kit was diluted with water to prepare 1x TE buffer. TE stands for Tris / EDTA (ethylenediaminetetraacetic acid). A nucleic acid dilution series was prepared by diluting the nucleic acid with TE buffer to a final concentration of 0 to 400 ng / mL. 10 μL of lipid particles diluted with TE buffer and 90 μL of the nucleic acid dilution series were mixed in a 96-well plate, and then 100 μL of RiboGreen reagent diluted 200-fold with TE buffer was added to each well. Fluorescence (excitation wavelength: 485 nm, fluorescence wavelength: 535 nm) was measured using a fluorescent plate reader (Infitite 200 Pro M nano+, TECAN). The external aqueous phase RNA concentration of each measurement solution was calculated from the obtained results according to the standard addition method.

[0329] (Calculation of Encapsulation Rate) Using the quantitative results of the total nucleic acid concentration and the nucleic acid concentration in the external aqueous phase obtained in the above steps, the RNA encapsulation rate of the nucleic acid-lipid nanoparticles was calculated according to the following formula: Nucleic acid encapsulation rate (%) = (total nucleic acid concentration - nucleic acid concentration in the external aqueous phase) / total nucleic acid concentration × 100 The results are shown in Table 6.

[0330]

[0331] [T Cell Culture and Evaluation Methods] [Materials and Methods] <Preparation of Activation Medium> The medium used for culturing T cells under activation culture conditions consists of TexMACS™ Medium (Miltenyi biotech, 130-097-196) and 5 ng / ml human interleukin-2 (IL-2, Roche, 11147528001) (hereinafter referred to as the activation medium), or consists of PRIME-XV T Cell CDM (FUJIFILM Irvine Scientific, 91154) and 5 ng / ml human interleukin-2 (IL-2, Roche, 11147528001) (hereinafter referred to as the activation CDM medium).

[0332] <Preparation of T cells and activation culture> Frozen T cells derived from peripheral blood of a healthy human donor (Human PB Pan-T, Cryo, STEMCELL Technologies, ST-70024) were thawed by placing in a water bath at 37°C for several minutes. The thawed T cells were resuspended in TexMACS Medium containing 1% BSA (SIGMA, A9576) and 20 U / ml DNase I (Worthington Biochemical, LS002139), washed by centrifugation, and resuspended in activation medium. T cells were cultured at a concentration of 1.0 x 10 6 The cell concentration was adjusted to 1.0 × 10 cells / ml, and Dynabeads Human T-Activator CD3 / CD28 (Thermo Fisher DB11131) was added at 1.0 × 10 6 Add to a concentration of 1000 beads / ml, or use ImmunoCult TM Human CD3 / CD28 T Cell Activator (STEMCELL Technologies, 10971) was added to a concentration of 25 μL / mL. The cells were seeded in a 24-well cell culture plate and incubated at 37°C with 5% CO.2 The cells were cultured in an incubator for 3 days for activation. On day 3 of activation, the Dynabeads were removed from the T cell culture medium. The T cells thus pretreated were used as activated T cells.

[0333] <Preparation of Non-activation Medium> The medium used when culturing T cells under non-activation culture conditions consists of TexMACStm Medium (Miltenyi biotech, 130-097-196), 5 ng / ml human interleukin-2 (IL-2, Roche, 11147528001), 5 ng / ml human IL-7 (Miltenyi biotech 130-095-367), and 5 ng / ml human IL-15 (Miltenyi biotech, 130-095-760) (hereinafter referred to as non-activation medium).

[0334] <Preparation of T cells and non-activation culture> Frozen T cells (Human PB Pan-T, Cryo, STEMCELL Technologies, ST-70024) derived from peripheral blood of a healthy human donor were thawed by placing in a water bath at 37°C for several minutes. The thawed T cells were resuspended in TexMACS Medium containing 1% BSA and 20 U / ml DNase I, washed by centrifugation, and resuspended in non-activation medium. T cells were cultured at a concentration of 1.0 x 10 6 The cell concentration was adjusted to 1000 cells / ml, and the cells were seeded in a 24-well cell culture plate. The cells were incubated at 37°C in 5% CO 2 The cells were cultured in an incubator for 3 days, and the pretreated T cells were used as non-activated T cells.

[0335] <Evaluation of cell viability and cell proliferation rate> T cells were stained for live and dead cells using an Acridine Orange / Propidium Iodide (AO / PI) Cell Viability Kit (Logos Biosystems, F23001). Immediately after staining, the live cell concentration, dead cell concentration, and viability were measured using an automated cell counter Luna-FL (Logos Biosystems). Cell viability was calculated using the following formula 1, where the viability measurement value under the medium treatment conditions was set to 100%. The cell proliferation rate on day 7 after the start of culture was calculated according to the following formula 2.

[0336] (Equation 1) Cell viability (%) = (measured viability by each method) / (measured viability under medium treatment conditions) × 100

[0337] (Equation 2) Cell proliferation rate (fold) = (viable cell concentration) x (dilution factor at time of subculture) / (seeded cell concentration at time of treatment with each method)

[0338] <Flow cytometry> On days 4, 7, or 14 after the start of culture, the T cells edited by each method were evaluated by flow cytometry for endogenous TCR knockout (KO) efficiency or GFP positivity rate. TCRKO efficiency was evaluated by flow cytometry using BD Horizon T cells. TM Dead cells were stained with Fixable Viability Stain (FVS) Reagents (BD, 565388) and then incubated with an antibody targeting the TCR. To assess the GFP positivity rate, T cells were stained for dead cells with FVS Reagents. After each staining procedure, cells were fixed and washed, and the cell status was analyzed using an Attune instrument (Thermo Fisher). Data were analyzed using Flowjo software. T cells were gated by size, single cells, and live cells, and the percentage of TCR-negative cells or the percentage of GFP-positive cells and median fluorescence intensity (MFI) were analyzed.

[0339] <Test Example 1> Nucleic acid delivery to activated T cells using post-added LNPs <1-1> LNP treatment of activated T cells The required number of activated T cells were collected on day 3 of culture, centrifuged, and the supernatant was removed. The activated T cells were cultured in an activation medium containing recombinant human apolipoprotein E3 (ApoE3) (Fujifilm Wako, 010-20261) at a final concentration of 1 μg / ml, at a concentration of 1.0 × 10 6 The RNA-encapsulated LNPs prepared by the post-addition method of Examples 1, 2, 36, and 37, or the RNA-encapsulated LNPs prepared by the conventional method of Comparative Example 3, were used to adjust the concentration to 1.0 × 10 cells / ml and seeded in a 96-well plate. 6 The cells were added at 1.8 to 6.0 μg (total RNA amount) per cell, and cultured in a 37° C., 5% CO 2 incubator.

[0340] 24 hours after the addition of LNP, activation medium was added to the T cell suspension at a volume ratio of 1:3 for expansion, and the cells were further cultured for 3 days.

[0341] <1-2> TCR KO Efficiency in Activated T Cells On day 7 of culture, the proportion of TCR-negative cells in T cells treated with each method was measured by flow cytometry to evaluate TCR KO efficiency. Figure 1 shows the frequency (percentage) of TCR-negative cells in T cells treated with Examples 1, 2, 36, and 37, Comparative Example 1, or medium (control condition). The results in Figure 1 demonstrate that Examples 1, 2, 36, and 37 all enabled mRNA introduction and TCR KO into T cells, with Examples 1 and 2 in particular demonstrating high TCR KO efficiency. Furthermore, Examples 1 and 2 demonstrated higher TCR KO efficiency than Comparative Example 1 treatment.

[0342] <1-3> Cell viability and proliferation rate after treatment of activated T cells On day 4 of culture (one day after treatment by each method), the cell viability of T cells treated with each LNP was evaluated. Figure 2 shows the cell viability when the medium (control condition) was set at 100%. This result demonstrated that a high survival rate of 80% or more was maintained under all added concentration conditions. Furthermore, on day 7 from the start of culture, the proliferation rate of T cells treated with each LNP was evaluated. Figure 3 shows the cell proliferation rate on day 7. The results of Figure 3 demonstrate that a proliferation rate equivalent to that under the control condition was maintained under all added concentration conditions in Examples 1, 2, 36, and 37, and further demonstrates higher proliferation compared to Comparative Example 1.

[0343] <2-1> Lipofectamine treatment of activated T cells The required number of activated T cells were collected on day 3 of culture, centrifuged, and the supernatant was removed. 6 The cells were adjusted to a concentration of 1000 cells / ml and seeded onto a 96-well plate. A Lipofectamine and RNA mixture was prepared according to the manufacturer's protocol for Lipofectamine MessengerMAX (hereafter referred to as Lipofectamine (M), Thermo Fisher, LMRNA001). Briefly, Opti-MEM I Medium (hereafter referred to as Opti-MEM, Thermo Fisher, 31985-062) and Lipofectamine (M) were mixed in the volumes shown in Table 7, vortexed for 2-3 seconds, and then incubated at room temperature for 10 minutes (Liquid 1). In parallel, an RNA solution (1 μg / ml) containing Cas9 mRNA and TRAC sgRNA mixed at a weight ratio of 4:1 was mixed with Opti-MEM in the amounts shown in Table 7 (liquid 2). Ten minutes after mixing with liquid 1, equal volumes of liquids 1 and 2 were mixed and incubated at room temperature for 5 minutes (Lipofectamine-RNA mixture). 1.0 × 10 activated T cells seeded in a 96-well plate were incubated for 1 hour. 5 10 μl of the Lipofectamine-RNA mixture was added per cell.

[0344]

[0345] A mixture of Lipofectamine (CR) and Cas9 Protein / sgRNA complex was prepared according to the manufacturer's protocol for Lipofectamine CRISPRMAX (hereafter referred to as Lipofectamine (CR) Thermo Fisher Scientific, CMAX00001). Lipofectamine (CR) is composed of Cas9 Plus Reagent and CRISPRMAX Reagent. Briefly, 10 μl Opti-MEM, 0.5 μl TrueCut TM Cas9 Protein v2 (Thermo Fisher, A36498, 1 μg / μl), 0.1 μl TRAC sgRNA (1 μg / μl), and 1 μl Cas9 Plus Reagent were mixed and vortexed for 2-3 seconds (Solution 3). Next, 10 μl Opti-MEM and 0.6 μl CRISPRMAX Reagent were added and mixed by pipetting (Solution 4). The entire volume of Solution 3 was immediately added to Solution 4, mixed by pipetting, and incubated at room temperature for 10 minutes (Lipofectamine (CR) mixture). 1.0 × 10 activated T cells were seeded in a 96-well plate. 5 10 μl of Lipofectamine (CR) mixture was added per cell.

[0346] <2-2> TCR KO Efficiency in Activated T Cells On day 7 of culture, the proportion of TCR-negative cells in T cells treated with each method was measured by flow cytometry to evaluate TCR KO efficiency. Figure 4 shows the frequency (percentage) of TCR-negative cells in T cells treated with Examples 1, 2, 36, and 37, Lipofectamine (M), Lipofectamine (CR), or medium (control condition). These results demonstrate that treatment with Lipofectamine (M) and Lipofectamine (CR) did not result in TCR KO, whereas treatment with Examples 1, 2, 36, and 37 significantly improved TCR KO efficiency.

[0347] <3-1> TCR KO in activated T cells using conventional LNP and supplemented LNP The required number of activated T cells were collected on day 3 of culture, centrifuged, and the supernatant was removed. 1.0 x 10 activated T cells were cultured in an activation medium containing ApoE3 at a final concentration of 1 μg / ml, which had been prepared just before use. 6 The RNA-encapsulated LNPs were adjusted to a concentration of 1.0 × 10 cells / ml and seeded onto a 96-well plate. The RNA-encapsulated LNPs prepared by the conventional method of Examples 9, 10, or 11, the post-addition method of Examples 3 to 5 (LNP to RNA ratio: 20), and the post-addition method of Examples 6 to 8 (LNP to RNA ratio: 6.7) were used. 6 The cells were cultured in a 37°C, 5% CO2 incubator. 24 hours after LNP addition, activation medium was added to the T cell suspension at a volume ratio of 1:3, followed by expansion and further culture for 3 days.

[0348] <3-2> TCR KO Efficiency by Conventional and Post-Addition LNP Treatments On day 7 of culture, the TCR KO efficiency was evaluated by measuring the proportion of TCR-negative cells in T cells treated with each method using flow cytometry. Figure 5 shows the frequency (percentage) of TCR-negative cells in T cells treated with each method. These results demonstrate that the post-addition methods of Examples 3 and 4 (LNP to RNA ratio of 20) had equivalent TCR KO efficiency compared to Examples 9 and 10. Furthermore, the post-addition method (LNP to RNA ratio of 6.7) demonstrated equivalent KO efficiency under the RNA 5.4 μg / ml addition condition compared to the conventional method. On the other hand, under the RNA 1.0 or 1.8 μg / ml addition condition, the post-addition method (LNP to RNA ratio of 6.7) demonstrated lower KO efficiency compared to the post-addition method (LNP to RNA ratio of 20) and the conventional method. The above results showed that the post-addition method (LNP to RNA ratio of 20) had the same mRNA delivery efficiency as the conventional method, and that the delivery efficiency was higher when the LNP to RNA ratio in the post-addition method was 20 than when it was 6.7.

[0349] <3-3> Cell viability after treatment of activated T cells On day 4 of culture (one day after treatment with each method), the cell viability of T cells treated with each LNP under conditions with 1.0 μg / ml of RNA added was evaluated. Figure 6 shows the cell viability when the medium (control condition) was set at 100%. These results demonstrate that comparable cell viability was obtained when treating with LNP prepared by the conventional method and the post-addition method.

[0350] <Test Example 2> Nucleic acid delivery to non-activated T cells using post-added LNPs <1> LNP treatment of non-activated T cells The required number of non-activated T cells on day 3 of culture were collected, centrifuged, and the supernatant was removed. 1.0 x 10 non-activated T cells were cultured in a non-activation medium containing recombinant human apolipoprotein E3 (ApoE3) (Fujifilm Wako, 010-20261) at a final concentration of 1 μg / ml. 6 The cells were adjusted to a concentration of 1000 cells / ml and seeded onto a 96-well plate.

[0351] Using the RNA-encapsulated LNPs prepared by the post-addition method in Examples 3 to 5, 1.0 × 10 6 The total amount of RNA was added to each cell at 1.0 to 1.8 μg (total RNA amount). The mixture was incubated at 37°C in 5% CO 2 The cells were cultured in an incubator. 24 hours after the addition of LNP, non-activation medium was added to the T cell suspension at a volume ratio of 1:3, and the cells were expanded and cultured for a further 11 days. During this period, the cell concentration was maintained at 0.1 to 6.0 × 10 6 The medium was exchanged or the cells were subcultured every 2 to 4 days so that the cell density was maintained at 100 cells / ml.

[0352] <2> TCR KO efficiency in resting T cells On day 14 of culture, the proportion of TCR-negative cells in T cells treated by each method was measured by flow cytometry to evaluate TCR KO efficiency. Figure 7 shows the frequency (percentage) of TCR-negative cells in T cells treated with RNA-encapsulated LNPs prepared by the post-addition method of Examples 3 to 5. These results demonstrate that the treatments in Examples 3 and 4 had high mRNA transfer efficiency and TCR KO efficiency in resting T cells.

[0353] <3> Cell viability after treatment of non-activated T cells The cell viability of T cells treated with each LNP was evaluated on day 4 of culture (one day after treatment with each method). Figure 8 shows the cell viability when the medium (control condition) was set at 100%. The results showed that the viability was maintained at a high level of 95% or higher under all added concentration conditions.

[0354] <Test Example 3> Nucleic acid delivery to activated T cells using conventional LNPs <1> Lipid selection in mRNA delivery to activated T cells The required number of activated T cells were collected on day 3 of culture, centrifuged, and the supernatant was removed. 1.0 x 10 activated T cells were cultured in an activation medium containing ApoE3 at a final concentration of 1 μg / ml, which had been prepared just before use. 6 The GFP mRNA-encapsulated LNPs prepared by the conventional methods of Examples 20 to 32 were used to prepare 1.0 × 10 cells / ml of LNPs and seeded in a 96-well plate. 6 The total RNA was added to each cell at 1.0 μg per cell, and incubated at 37°C in 5% CO 2 The cells were cultured in an incubator. 24 hours after addition of LNP, the cells were collected, and the GFP-positive cell ratio of T cells treated with each LNP was measured by flow cytometry to evaluate the efficiency of GFP mRNA transfer. The results are shown in Figure 9. All of the lipids in Examples 20 to 32 were capable of highly efficient mRNA delivery to activated T cells, with Examples 24 to 28, 30, and 32 demonstrating particularly high efficiency.

[0355] <2> Comparison of helper lipids in GFP mRNA delivery to activated T cells. The required number of activated T cells on day 3 of culture were collected, centrifuged, and the supernatant was removed. 1.0 x 10 activated T cells were cultured in an activation medium containing ApoE3 at a final concentration of 1 μg / ml, which had been prepared just before use. 6 The RNA-encapsulated LNPs prepared by the conventional methods of Examples 24 and 32 were used to prepare 1.0 × 10 6The cells were cultured at 37°C in a 5% CO2 incubator. 24 hours after LNP addition, the cells were harvested, and the GFP-positive cell ratio and GFP MFI of T cells treated with each LNP were measured by flow cytometry to evaluate the GFP mRNA transduction efficiency. The results are shown in Figure 10.

[0356] <3> Comparison of helper lipids in mRNA delivery to activated T cells The required number of activated T cells on day 3 of culture were collected, centrifuged, and the supernatant was removed. 1.0 × 10 activated T cells were cultured in an activation medium containing ApoE3 at a final concentration of 1 μg / ml, which had been prepared just before use. 6 The RNA-encapsulated LNPs prepared by the conventional methods of Examples 12 and 13 and Comparative Example 2 were used to prepare 1.0 × 10 6 The total amount of RNA was added to each cell at 1.0 to 3.6 μg (total RNA amount). The mixture was incubated at 37°C in 5% CO 2 The cells were cultured in an incubator. 24 hours after the addition of LNP, activation medium was added to the T cell suspension at a volume ratio of 1:3, and the cells were expanded and cultured for an additional 3 days. On day 7 of culture, the TCR-negative cell ratio of T cells treated with each method was measured by flow cytometry to evaluate the TCR KO efficiency. Figure 11 shows the frequency (percentage) of TCR-negative T cells. These results indicate that the treatment in Example 13 had a higher TCR KO efficiency in activated T cells than that in Example 12. These results indicate that when this lipid and T cells are combined, the use of DOPE as a helper lipid results in higher mRNA delivery efficiency than DSPC.

[0357] <4> Ratio of each composition in mRNA delivery to activated T cells The required number of activated T cells on day 3 of culture were collected, centrifuged, and the supernatant was removed. 1.0 x 10 activated T cells were cultured in an activation medium containing ApoE3 at a final concentration of 1 μg / ml, which had been prepared just before use. 6The RNA-encapsulated LNPs prepared by the conventional methods of Examples 13 and 9, Examples 9, 10, 11, 14 to 19, and Comparative Examples 2 and 3 were used to adjust the concentration to 1.0 × 10 cells / ml and seeded on a 96-well plate. 6 The total amount of RNA was added to each cell at 1.0 to 5.45 μg (total RNA amount). The mixture was incubated at 37°C in 5% CO 2 The cells were cultured in an incubator. 24 hours after the addition of LNP, activation medium was added to the T cell suspension at a volume ratio of 1:3, and the cells were expanded and cultured for an additional 3 days. On day 7 of culture, the proportion of TCR-negative T cells in the T cells treated with each method was measured by flow cytometry to evaluate the TCR KO efficiency.

[0358] Figures 12 and 13 show the frequency (percentage) of TCR-negative T cells treated with each LNP. Figure 14 shows the relationship between cholesterol ratio and TCR KO efficiency. The results in Figures 12 and 13 show that Examples 9-11 and 13-19 significantly improved TCR KO efficiency in activated T cells compared to Comparative Examples 2 and 3. The results in Figure 14 also show that cholesterol ratios of 48.5% or higher resulted in higher mRNA delivery efficiency.

[0359] <Test Example 4> Nucleic acid delivery to non-activated T cells using conventional LNPs <1> Lipid selection in mRNA delivery to non-activated T cells The required number of non-activated T cells on day 3 of culture were collected, centrifuged, and the supernatant was removed. 1.0 x 10 non-activated T cells were cultured in an activation medium containing ApoE3 at a final concentration of 1 μg / ml, which had been prepared just before use. 6 The cells were adjusted to a concentration of 1000 cells / ml and seeded onto a 96-well plate.

[0360] For Examples 23 to 35, 1.0 × 10 GFP mRNA-encapsulated LNPs prepared by conventional methods were used. 6 The total RNA was added to each cell at 1.0 μg per cell, and incubated at 37°C in 5% CO 2The cells were cultured in an incubator. 24 hours after addition of LNP, the cells were collected, and the GFP-positive cell ratio of T cells treated with each LNP was measured by flow cytometry to evaluate the efficiency of GFP mRNA transfer. The results are shown in Figure 15. All of the LNPs of Examples 23 to 35 were capable of highly efficient mRNA delivery to activated T cells, with Example 24 being particularly efficient.

[0361] <2> TCR KO efficiency in non-activated T cells On day 3 of culture, the required number of non-activated T cells were collected, centrifuged, and the supernatant was removed. The non-activated T cells were cultured at a concentration of 1.0 × 10 in a non-activation medium containing recombinant human apolipoprotein E3 (ApoE3) (Fujifilm Wako, 010-20261) at a final concentration of 1 μg / ml. 6 The cells were adjusted to a concentration of 1000 cells / ml and seeded onto a 96-well plate.

[0362] For Examples 13 and 9, 1.0 × 10 RNA-encapsulated LNPs prepared by conventional methods were used. 6 The total amount of RNA was added to each cell at 1.0 to 5.5 μg (total RNA amount). The mixture was incubated at 37°C in 5% CO 2 The cells were cultured in an incubator. 24 hours after the addition of LNP, non-activation medium was added to the T cell suspension at a volume ratio of 1:3, and the cells were expanded and cultured for a further 11 days. During this period, the cell concentration was maintained at 0.1 to 6.0 × 10 6 The medium was changed or the cells were subcultured every 2-4 days to maintain a density of 1000 cells / ml. On day 14 of culture, the proportion of TCR-negative T cells in the T cells treated with each method was measured by flow cytometry to evaluate the TCR KO efficiency.

[0363] 16 shows the frequency (percentage) of TCR-negative T cells. These results demonstrate that treatments using Examples 13 and 9 enable highly efficient mRNA transfection in non-activated T cells. Furthermore, since the treatment using Example 9 had a higher TCR KO efficiency in activated T cells than the treatment using Example 13, a cholesterol ratio of 48.5% or higher indicates higher mRNA delivery efficiency.

[0364] As methods for increasing the concentration of empty LNP by 10 times, we compared a method in which empty LNP prepared with a total lipid concentration of 12.5 mM as described in Example 2 was concentrated 10 times by ultrafiltration (empty LNP concentration method 1), with a method in which empty LNP prepared with a total lipid concentration of 62.5 mM was concentrated 2 times by ultrafiltration (empty LNP concentration method 2). Empty LNP was prepared according to the above examples, and CleanCap (registered trademark) Cas9 mRNA (5 moU) (TriLink, L-7206) and sgRNA targeting the human T cell receptor alpha constant (TRAC) gene (sequence; A * G * A * GUCUCUCAGCUGGUACA + modified Scaffold, Thermo Fisher A35514, custom synthesis) were mixed at a weight ratio of 4: 1 to form a nucleic acid mixture (Cas9 / sgRNA), which was then encapsulated by the post-addition method. Table 8 shows the results of the TCR KO efficiency test in T cells according to the above test example. From the results of Table 8, it was shown that empty LNP enrichment methods 1 and 2 have equivalent viability, TCR KO efficiency, and proliferation rate, and both are very efficient.

[0365]

[0366] <Encapsulation of various RNAs into empty LNP (post-addition method)> gp46 siRNA (Gene design), CleanCap (registered trademark) EPO mRNA (5 moU) (TriLink, L-7209), CleanCap FLuc mRNA (TriLink, L-7602), CleanCap Cas9 mRNA (5 moU) (TriLink, L-7206), and GFP pDNA (GenScript, custom-synthesized plasmid DNA) were diluted with water for injection to prepare RNA solutions of different concentrations. The empty LNP of Example 2 stored at -70°C was thawed at 4°C. An equal volume of RNA solution was added to this LNP solution and mixed by pipetting (LNP-RNA mixture). After standing at room temperature for 5 minutes, an equal volume of 20 mmol / L Tris buffer containing 8% sucrose was added to the LNP-RNA mixture and mixed by pipetting to prepare RNA-encapsulated LNPs by the post-addition method.

[0367] <Measurement of Encapsulation Rate> The encapsulation rate was measured using Quant-iT RiboGreen RNA Assay Kit (Thermo Fisher Scientific). First, the above RNA-encapsulated LNP was diluted with TE buffer or TE buffer containing 0.1% Triton X-100. Then, an equal volume of Ribogreen diluted 200-fold with TE buffer was added, and fluorescence (excitation wavelength: 485 nm, fluorescence wavelength: 535 nm) was measured using a fluorescence plate reader (Infitite 200 Pro M nano+, TECAN). The encapsulation rate was calculated according to the following formula from the value obtained by multiplying the obtained fluorescence intensity by the dilution factor: (Encapsulation rate) = (Fluorescence intensity when diluted with TE buffer) / (Fluorescence intensity when diluted with TE buffer containing 0.1% Triton X-100) × 100

[0368] The results are shown in Table 9 below.

[0369]

[0370] <Test Example 4> Nucleic acid delivery to activated T cells using post-addition LNP <4-1> Encapsulation of gRNA and Cas9 mRNA in empty LNP (post-addition method) CleanCap (registered trademark) Cas9 mRNA (5 moU) (TriLink, L-7206) and sgRNA targeting the human T cell receptor alpha constant (TRAC) gene (sequence; A*G*A*GUCUCUCAGCUGGUACA+modified Scaffold, Thermo Fisher A35514, custom synthesis) were mixed at a weight ratio of 8:4, 8:2, or 8:1, and diluted with water for injection to prepare an RNA solution (total nucleic acid concentration of 480, 400, or 360 μg / mL). The empty LNP of Example 2 stored at -70 ° C was thawed at 4 ° C. An equal volume of RNA solution was added to this LNP solution and mixed by pipetting (LNP-RNA mixture). After standing at room temperature for 5 minutes, an equal volume of 20 mmol / L Tris buffer containing 8% sucrose was added to this LNP-RNA mixture and mixed by pipetting to prepare Cas9 mRNA / gRNA-encapsulated LNPs by the post-addition method.

[0371] <4-2> LNP treatment of activated T cells The required number of activated T cells on days 1 to 4 of activation were collected, centrifuged, and the supernatant was removed. The activated T cells were cultured at a concentration of 1.0 × 10 in an activation medium containing recombinant human apolipoprotein E3 (ApoE3) (Fujifilm Wako, 010-20261) at a final concentration of 1 μg / ml. 6 The RNA-encapsulated LNPs prepared by the post-addition method in Example 2 were used to prepare 1.0 × 10 6 The cells were cultured in a 37°C, 5% CO incubator at 37°C for 24 hours after LNP addition, and the T cell suspension was added with activation medium at a volume ratio of 1:3 for expansion, followed by further culture for 7 days from the start of culture.

[0372] <4-3> TCR KO Efficiency in Activated T Cells On day 7 of culture, the TCR KO efficiency was evaluated by measuring the TCR-negative cell ratio of T cells treated with each method using flow cytometry. Figure 17 shows the frequency (percentage) of TCR-negative cells in T cells treated with LNPs containing empty LNPs (Example 2) containing various ratios of Cas9 and sgRNA at each LNP treatment timing. The results of Figure 17 demonstrate that high TCR KO efficiency is achieved at Cas9 mRNA to sgRNA ratios ranging from 8:4 to 8:1. Furthermore, LNP treatment can be performed on any of days 1 to 4 of activation, with particularly high TCR KO efficiency observed on days 2 and 3 of activation.

[0373] <Test Example 5> Nucleic acid delivery to activated T cells using post-addition LNP <5-1> Encapsulation of gRNA and Cas9 mRNA in empty LNP (post-addition method) CleanCap® Cas9 mRNA (5 moU) (TriLink, L-7206) and sgRNA targeting the human β2-microglobulin (B2M) gene (sequence: GAGTAGCGCGAGCACAGCTA, Thermo Fisher A35514, Assay ID CRISPR983706_SGM) were mixed at a weight ratio of 8:4, 8:2, or 8:1 and diluted with water for injection to prepare RNA solutions (total nucleic acid concentrations of 480, 400, and 360 μg / mL). The empty LNP of Example 2 stored at -70°C was thawed at 4°C. An equal volume of RNA solution was added to this LNP solution and mixed by pipetting (LNP-RNA mixture). After standing at room temperature for 5 minutes, an equal volume of 20 mmol / L Tris buffer containing 8% sucrose was added to this LNP-RNA mixture and mixed by pipetting to prepare Cas9 mRNA / gRNA-encapsulated LNPs by the post-addition method.

[0374] <5-2> LNP treatment of activated T cells The required number of activated T cells on days 1 to 4 of activation were collected, centrifuged, and the supernatant was removed. The activated T cells were cultured at a concentration of 1.0 × 10 in an activation medium containing recombinant human apolipoprotein E3 (ApoE3) (Fujifilm Wako, 010-20261) at a final concentration of 1 μg / ml. 6 The RNA-encapsulated LNPs prepared by the post-addition method in Example 2 were used to prepare 1.0 × 10 6 The cells were cultured in a 37°C, 5% CO incubator at 37°C for 24 hours after LNP addition, and the T cell suspension was added with activation medium at a volume ratio of 1:3 for expansion, followed by further culture for 7 days from the start of culture.

[0375] <5-3> B2M KO Efficiency in Activated T Cells On day 7 of culture, the B2M KO efficiency was evaluated by measuring the proportion of B2M-negative cells in T cells treated with each method using flow cytometry. Figure 18 shows the frequency (percentage) of B2M-negative cells in T cells treated with LNPs containing empty LNPs (Example 2) containing various ratios of Cas9 and sgRNA at each LNP treatment timing. The results in Figure 18 demonstrate that high B2M KO efficiency was achieved at Cas9 mRNA to sgRNA ratios ranging from 8:4 to 8:1. Furthermore, LNP treatment can be performed on days 1 to 4 of activation, with particularly high KO efficiency observed on days 2 and 3 of activation.

[0376] <Test Example 6> Nucleic acid delivery to activated T cells using post-addition LNPs <6-1> Encapsulation of gRNA and Cas9 mRNA into empty LNPs (post-addition method, co-encapsulation) CleanCap (registered trademark) Cas9 mRNA (5 moU) (TriLink, L-7206), sgRNA targeting the human TRAC gene (sequence: A*G*A*GUCUCUCAGCUGGUACA+modified Scaffold, Thermo Fisher A35514, custom synthesis), and sgRNA targeting the human B2M gene (sequence: GAGTAGCGCGAGCACAGCTA, Thermo Fisher A35514, Assay ID CRISPR983706_SGM) were mixed at a weight ratio of 8:4:4, 8:2:2, or 8:1:1, and diluted with water for injection to prepare RNA solutions (total nucleic acid concentrations of 640, 480, and 400 μg / mL). The empty LNP of Example 2, stored at -70 ° C, was thawed at 4 ° C. An equal volume of RNA solution was added to this LNP solution and mixed by pipetting (LNP-RNA mixture). After standing at room temperature for 5 minutes, an equal volume of 20 mmol / L Tris buffer containing 8% sucrose was added to this LNP-RNA mixture and mixed by pipetting. Cas9 mRNA / gRNA-encapsulated LNP was prepared by the post-addition method.

[0377] <6-2> Encapsulation of gRNA and Cas9 mRNA into empty LNP (post-addition method, separate encapsulation) CleanCap (registered trademark) Cas9 mRNA (5 moU) (TriLink, L-7206) and sgRNA targeting the human TRAC gene (sequence; A * G * A * GUCUCUCAGCUGGUACA + modified Scaffold, Thermo Fisher A35514, custom synthesis), or Cas9 mRNA (5 moU) and sgRNA targeting the human B2M gene (sequence; GAGTAGCGCGAGCACAGCTA, Thermo Fisher A35514, Assay ID CRISPR983706_SGM) were mixed at a weight ratio of 8: 2, and diluted with water for injection to prepare an RNA solution (total nucleic acid concentration of 400 μg / mL). The empty LNP of Example 2 stored at -70°C was thawed at 4°C. An equal volume of one of the RNA solutions was added to this LNP solution and mixed by pipetting (LNP-RNA mixture). After standing at room temperature for 5 minutes, an equal volume of 20 mmol / L Tris buffer containing 8% sucrose was added to this LNP-RNA mixture and mixed by pipetting. Cas9 mRNA / gRNA (TRAC)-encapsulated LNP and Cas9 mRNA / gRNA (B2M)-encapsulated LNP were separately prepared by the post-addition method.

[0378] <6-3> LNP treatment of activated T cells The required number of activated T cells on days 1 to 4 of activation were collected, centrifuged, and the supernatant was removed. The activated T cells were cultured at a concentration of 1.0 × 10 in an activation medium containing recombinant human apolipoprotein E3 (ApoE3) (Fujifilm Wako, 010-20261) at a final concentration of 1 μg / ml. 6 The RNA-encapsulated LNPs prepared by the post-addition method in Example 2 were used to prepare 1.0 × 10 6 The cells were cultured in a 37°C, 5% CO2 incubator. 24 hours after LNP addition, activation medium was added to the T cell suspension at a volume ratio of 1:3, and the cells were expanded and cultured for 7 days.

[0379] <6-4> TCR and B2M double knockout efficiency in activated T cells. On day 7 of culture, the ratio of TCR-negative and B2M-negative cells in T cells treated with each method was measured by flow cytometry to evaluate double knockout efficiency. Figure 19 shows the frequency (percentage) of TCR- and B2M-co-negative cells in T cells treated with LNPs containing a mixture of Cas9 and two sgRNAs at various ratios encapsulated in empty LNPs (Example 2) at each LNP treatment timing. The results in Figure 19 demonstrate that high double knockout efficiency can be achieved whether Cas9 mRNA and two sgRNAs are encapsulated in a single LNP or in separate LNPs. Furthermore, it was shown that a higher double knockout efficiency was achieved, particularly when Cas9 mRNA and two sgRNAs were encapsulated in a single LNP.

[0380] <Test Example 7> Nucleic acid delivery to activated T cells using post-addition LNP (cryopreserved) <7-1> Encapsulation of gRNA and Cas9 mRNA in empty LNP (post-addition method) CleanCap (registered trademark) Cas9 mRNA (5 moU) (TriLink, L-7206) and sgRNA targeting the human T cell receptor alpha constant (TRAC) gene (sequence; A*G*A*GUCUCUCAGCUGGUACA+modified Scaffold, Thermo Fisher A35514, custom synthesis) were mixed at a weight ratio of 4:1 and diluted with water for injection to prepare an RNA solution (total nucleic acid concentration 400 μg / mL). The empty LNP of Example 2 stored at -70 ° C was thawed at 4 ° C. An equal volume of RNA solution was added to this LNP solution and mixed by pipetting (LNP-RNA mixture). After leaving it at room temperature for 5 minutes, an equal volume of 20 mmol / L Tris buffer containing 8% sucrose was added to this LNP-RNA mixture and mixed by pipetting to prepare Cas9 mRNA / gRNA-encapsulated LNPs using the post-addition method. (Post-added LNP before freezing) This post-added LNP was refrozen and stored at -70°C, and then thawed again at 4°C. (Post-added LNP after freezing and thawing)

[0381] <7-2> LNP treatment of activated T cells On day 3 of activation, the required number of activated T cells were collected, centrifuged, and the supernatant was removed. The activated T cells were cultured at a concentration of 1.0 × 10 in an activation medium containing recombinant human apolipoprotein E3 (ApoE3) (Fujifilm Wako, 010-20261) at a final concentration of 1 μg / ml. 6 The RNA-encapsulated LNPs prepared by the post-addition method in Example 2 were used to prepare 1.0 × 10 6 The cells were cultured in a 37°C, 5% CO incubator at 37°C for 24 hours after LNP addition, and the T cell suspension was added with activation medium at a volume ratio of 1:3 for expansion, followed by further culture for 7 days from the start of culture.

[0382] <7-3> TCR KO Efficiency in Activated T Cells On day 7 of culture, the proportion of TCR-negative cells in T cells treated with each method was measured by flow cytometry to evaluate TCR KO efficiency. Figure 20 shows the frequency (percentage) of TCR-negative cells in T cells treated with post-added LNP (before freezing) or post-added LNP (after freeze-thawing). The results in Figure 20 demonstrate that post-added LNP maintained a high KO efficiency equivalent to that before freezing, even after refrozen, storage, and thawing at -70°C.

[0383] <Test Example 8> Nucleic acid delivery to activated T cells using post-added LNPs (sequential processing) <1> Encapsulation of gRNA and Cas9 mRNA into empty LNPs (post-addition method, co-encapsulation) CleanCap (registered trademark) Cas9 mRNA (5 moU) (TriLink, L-7206), sgRNA targeting the human TRAC gene (sequence: A*G*A*GUCUCUCAGCUGGUACA+modified Scaffold, Thermo Fisher A35514, custom synthesis), and sgRNA targeting the human B2M gene (sequence: GAGTAGCGCGAGCACAGCTA, Thermo Fisher A35514, Assay ID CRISPR983706_SGM) were mixed in an 8:4:4 weight ratio and diluted with water for injection to prepare an RNA solution (total nucleic acid concentration 640 μg / mL). The empty LNP of Example 2 stored at -70 ° C was thawed at 4 ° C. An equal volume of RNA solution was added to this LNP solution and mixed by pipetting (LNP-RNA mixture). After standing at room temperature for 5 minutes, an equal volume of 20 mmol / L Tris buffer containing 8% sucrose was added to this LNP-RNA mixture and mixed by pipetting to prepare Cas9 mRNA / gRNA-encapsulated LNP by the post-addition method (hereinafter referred to as TRAC-B2M target LNP).

[0384] <2> Encapsulation of gRNA and Cas9 mRNA into empty LNP (post-addition method, separate encapsulation) CleanCap (registered trademark) Cas9 mRNA (5 moU) (TriLink, L-7206) and sgRNA targeting the human TRAC gene (sequence; A * G * A * GUCUCUCAGCUGGUACA + modified Scaffold, Thermo Fisher A35514, custom synthesis), or Cas9 mRNA (5 moU) and sgRNA targeting the human B2M gene (sequence; GAGTAGCGCGAGCACAGCTA, Thermo Fisher A35514, Assay ID CRISPR983706_SGM) were mixed at a weight ratio of 8: 4, and diluted with water for injection to prepare an RNA solution (total nucleic acid concentration 400 μg / mL). The empty LNP of Example 2 stored at -70 ° C was thawed at 4 ° C. An equal volume of one of the RNA solutions was added to this LNP solution and mixed by pipetting (LNP-RNA mixture). After standing at room temperature for 5 minutes, an equal volume of 20 mmol / L Tris buffer containing 8% sucrose was added to this LNP-RNA mixture and mixed by pipetting. Cas9 mRNA / gRNA (TRAC)-encapsulated LNP and Cas9 mRNA / gRNA (B2M)-encapsulated LNP were separately prepared by the post-addition method (hereinafter referred to as TRAC-targeted LNP and B2M-targeted LNP, respectively).

[0385] <3> LNP treatment of activated T cells On the second day of activation, the required number of activated T cells were collected, centrifuged, and the supernatant was removed. The activated T cells were cultured at a concentration of 1.0 × 10 in an activation medium containing recombinant human apolipoprotein E3 (ApoE3) (Fujifilm Wako, 010-20261) at a final concentration of 1 μg / ml. 6 The cells were adjusted to a concentration of 1.0 × 10 cells / ml and seeded onto a 96-well plate. 6TRAC-B2M-targeted LNP or B2M-targeted LNP prepared by the post-addition method of Example 2 was added to cells at 6.4 or 4.8 μg (total RNA amount) per cell, and the cells were cultured in a 37°C, 5% CO2 incubator. 24 hours after LNP addition, half of the culture supernatant was replaced with freshly prepared activation medium for all culture conditions. Next, B2M-targeted LNP was added to the TCR-targeted LNP-treated T cell suspension at 4.8 μg (total RNA amount) and ApoE3 (final concentration 1 μg / ml), and the cells were cultured in a 37°C, 5% CO2 incubator. After another 24 hours, activation medium was added to the T cell suspension at a volume ratio of 1:3, and the cells were expanded and further cultured until day 7 from the start of culture.

[0386] <4> TCR and B2M double knockout efficiency in activated T cells On day 7 of culture, the ratio of TCR-negative and B2M-negative cells in T cells treated with each method was measured by flow cytometry to evaluate double knockout efficiency. Figure 21 shows the frequency (percentage) of TCR- and B2M-co-negative cells in T cells treated with LNPs containing Cas9 and two types of sgRNA encapsulated in empty LNPs (Example 2) under each condition at each LNP treatment timing. The results of Figure 21 demonstrate that high double knockout efficiency can be achieved whether Cas9 mRNA and two types of sgRNA are encapsulated in a single LNP or encapsulated in separate LNPs and treated sequentially.

[0387] <5> Evaluation of translocation rates at TRAC and B2M cleavage sites Genomic DNA was collected from T cells treated with each method on day 7 of culture. Genomic DNA was collected using a QIAamp DNA mini kit (QIAGEN, 51306) according to the manufacturer's protocol. ddPCR Supermix for probes (no dUTP) (BioRad, 1863024) was used according to the protocol. dUTP), recovered genomic DNA, BamH1-HF (NEB, R3136S), HindIII-HF (NEB, R3104S), primers targeting the RPP30 locus, and a HEX-labeled probe (Fw primer: TCAGCATGGCGGTGTTT, Rv primer: GCTGTCTCCACAAGTC, probe: TTCTGACCTGAAGGCTCTGCGC). The mixture was mixed, and further, primers and a FAM-labeled probe for detecting the normal B2M gene (FW primer: tgggcacgcgttaataataag, RV primer: cttggagaagggaagtcacg, probe: cagagcgggagggtagga), primers and a FAM-labeled probe for detecting the normal TRAC gene (FW primer: gtcccacagata tccagaaccc, Rv primer: tcagaatccttactttgtgacacat, probe: aatcggtgaataggcagacagact), primers and FAM-labeled probe for detecting B2M-TRAC gene translocation (Fw primer: tgggcacgcgtttaataataag, Rv primer: tcagaatccttactttgtgacaca The cells were mixed with either a primer and a FAM-labeled probe (Fw primer: gtcccacagatatccagaaccc, Rv primer: cttggagaagggaagtcacg, probe: cagagcgggaggggtagga) to detect TRAC-B2M gene translocation. These mixtures were used to analyze the B2M-TRAC gene translocation rate and the TRAC-B2M gene translocation rate per cell by ddPCR.The results of the analysis of the translocation rate in each treatment are shown in FIG.

[0388] <Test Example 9> Nucleic acid delivery to activated T cells using post-added LNPs (TCR KO) <1> LNP treatment of activated T cells The required number of activated T cells on day 3 of culture were collected, centrifuged, and the supernatant was removed. The activated T cells were cultured at a concentration of 1.0 × 10 in an activation medium containing recombinant human apolipoprotein E3 (ApoE3) (Fujifilm Wako, 010-20261) at a final concentration of 1 μg / ml. 6 The RNA-encapsulated LNPs prepared by the post-addition method of Examples 38 to 158 were used to prepare 1.0 × 10 6 The total RNA was added to the cells at 1.8 to 4.0 μg per cell, and the cells were cultured in a 37° C., 5% CO 2 incubator.

[0389] 24 hours after the addition of LNP, the T cell suspension was expanded by adding activation medium at a volume ratio of 1:3, and the cells were further cultured for 3 days.

[0390] <2> TCR KO efficiency in activated T cells On day 7 of culture, the ratio of TCR-negative cells in T cells treated by each method was measured by flow cytometry to evaluate the TCR KO efficiency. The results are shown in Table 10.

[0391]

[0392] <Test Example 10> Plasmid DNA Delivery to Activated T Cells Using Conventional LNPs <1> LNP Treatment of Activated T Cells The required number of activated T cells were collected on day 3 of culture, centrifuged, and the supernatant was removed. The activated T cells were cultured in an activation medium or activation CDM medium containing recombinant human apolipoprotein E3 (ApoE3) (Fujifilm Wako, 010-20261) at a final concentration of 1 μg / ml, at a concentration of 1.0 × 10 6 The GFP pDNA-encapsulated LNPs of Examples 159 to 202 were used to prepare 1.0 × 10 6The cells were cultured in a 37°C, 5% CO 2 incubator, with the total amount of DNA added being 0.4 to 10.0 μg per cell (total DNA amount).

[0393] <2> TCR KO efficiency in activated T cells On day 4 of culture, the ratio of GFP-positive T cells in the T cells treated by each method was measured by flow cytometry to evaluate the efficiency of plasmid DNA introduction. The results are shown in Table 11.

[0394]

[0395] Test Example 11: Delivery of plasmid DNA to activated T cells using post-added LNPs <1> LNP treatment of activated T cells The required number of activated T cells were collected on day 3 of culture, centrifuged, and the supernatant was removed. The activated T cells were cultured in an activation medium or activation CDM medium containing recombinant human apolipoprotein E3 (ApoE3) (Fujifilm Wako, 010-20261) at a final concentration of 1 μg / ml, which had been prepared just before use. 6 The GFP pDNA-encapsulated LNPs of Examples 203 to 391 were used to prepare 1.0 × 10 6 The total DNA was added at 0.4 to 10.0 μg per cell, and the cells were cultured in a 37°C, 5% CO2 incubator. <2> TCR KO efficiency in activated T cells On day 4 of culture, the GFP-positive cell ratio of T cells treated with each method was measured by flow cytometry to evaluate the efficiency of plasmid DNA introduction. The results are shown in Table 12.

[0396]

[0397] Test Example 12: Nucleic acid delivery to human peripheral blood mononuclear cells (hPBMCs) using conventional LNPs or post-added LNPs <1> Preparation of culture medium The culture medium used for culturing hPBMCs consisted of TexMACStm Medium (Miltenyi biotech, 130-097-196) and 5 ng / ml human interleukin-2 (IL-2, Roche, 11147528001) (hereinafter referred to as the activation medium).

[0398] <2> Preparation and Culture of PBMCs hPBMCs (Human Peripheral Blood Mononuclear Cells, Frozen, STEMCELL Technologies, 70025) derived from peripheral blood of healthy human donors were thawed by placing in a water bath at 37°C for several minutes. The thawed hPBMCs were resuspended in TexMACS Medium containing 1% BSA (SIGMA, A9576) and 20 U / ml DNase I (Worthington Biochemical, LS002139), washed by centrifugation, and resuspended in the medium. hPBMCs were cultured at a concentration of 1.0 x 10 6 The cell concentration was adjusted to 1.0 × 10 cells / ml, and Dynabeads Human T-Activator CD3 / CD28 (Thermo Fisher DB11131) was added at 1.0 × 10 6 The cells were seeded in a 24-well cell culture plate and incubated at 37°C and 5% CO 2 The cells were cultured in an incubator for 3 days. On the third day of culture, the Dynabeads were removed from the cell culture medium.

[0399] <3> Encapsulation of GFP mRNA into empty LNP (post-addition method) CleanCap (registered trademark) EGFP mRNA (5 moU) (TriLink, L-7201) was diluted with water for injection to prepare an RNA solution (total nucleic acid concentration 400 μg / mL). The empty LNP of Example 2 stored at -70 ° C was thawed at 4 ° C. An equal volume of the RNA solution was added to this LNP solution and mixed by pipetting (LNP-RNA mixture). After standing at room temperature for 5 minutes, an equal volume of 20 mmol / L Tris buffer containing 8% sucrose was added to this LNP-RNA mixture and mixed by pipetting to prepare GFP mRNA-encapsulated LNP by the post-addition method (post-addition method GFP mRNA-encapsulated LNP).

[0400] <4> LNP treatment of PBMCs The required number of cells were collected on day 3 of culture, centrifuged, and the supernatant was removed. The cells were cultured at a concentration of 1.0 × 10 in a medium containing recombinant human apolipoprotein E3 (ApoE3) (Fujifilm Wako, 010-20261) at a final concentration of 1 μg / ml. 6 The GFP mRNA-encapsulated LNP prepared by the conventional method of Example 32 and the GFP mRNA-encapsulated LNP prepared by the post-addition method in <3> above were used to prepare 1.0 × 10 6 The total amount of RNA was added to each cell at 4.0 μg (total RNA amount), and the cells were cultured in a 37° C., 5% CO 2 incubator.

[0401] <5> mRNA expression efficiency in hPBMCs On the fourth day after the start of culture, the GFP-positive rate of hPBMCs edited by each method was evaluated by flow cytometry. The GFP efficiency of hPBMCs was evaluated using BD Horizon TMDead cells were stained with Fixable Viability Stain (FVS) Reagents (BD, 565388) and then incubated with an antibody cocktail containing anti-CD45 antibody (BD, 564105), anti-CD3 antibody (BD, 563423), anti-CD14 antibody (BD, 555399), anti-CD19 antibody (R&D Systems, FAB4867V-100UG), anti-CD16 antibody (BD, 562878), and anti-CD56 antibody (BD, 740076). After each staining procedure, cells were fixed, washed, and analyzed using an Attune instrument (Thermo Fisher). Data were analyzed using Flowjo software. The cell measurement data was gated on single cells, CD45-positive cells, and live cells, and then CD3-positive CD16 / 56-negative cells were gated as T cells, CD3-negative CD16 / 56-positive cells as NK cells, CD3-positive CD16 / 56-positive cells as NKT cells, and CD3-negative CD19-positive cells as B cells, and the ratio of GFP-positive cells was analyzed. The results shown in Figures 23 to 26 demonstrate that both the conventional method and the post-addition method enable highly efficient mRNA delivery to T cells, NK cells, NKT cells, and B cells in PBMCs.

[0402] <Test Example 13> Nucleic acid delivery to human acute monocytic leukemia-derived cells (THP-1) using post-addition LNP <1> Encapsulation of GFP mRNA into empty LNP (post-addition method) CleanCap (registered trademark) EGFP mRNA (5 moU) (TriLink, L-7201) was diluted with water for injection to prepare an RNA solution (total nucleic acid concentration 400 μg / mL). The empty LNP of Example 2 stored at -70 ° C was thawed at 4 ° C. An equal volume of the RNA solution was added to this LNP solution and mixed by pipetting (LNP-RNA mixture). After standing at room temperature for 5 minutes, an equal volume of 20 mmol / L Tris buffer containing 8% sucrose was added to this LNP-RNA mixture and mixed by pipetting to prepare GFP mRNA-encapsulated LNP by the post-addition method (post-addition method GFP mRNA-encapsulated LNP).

[0403] <2> Culture of THP-1 and LNP treatment Human acute monocytic leukemia-derived cells (THP-1, JCRB Cell Bank, JCRB0112.1) were cultured at 1.1 × 10 in TexMACS Medium containing ApoE3 at a final concentration of 1 μg / ml, or in RPMI 1640 Medium (ATCC modification) (Thermo Fisher, A1049101) containing ApoE3 at a final concentration of 1 μg / ml and 10% fetal bovine serum. 6 The cells were adjusted to a cell concentration of 100 μg / mL and seeded at 0.1 mL / well in a 96-well cell culture plate. Subsequently, 4 μL (final concentration: 4 μg / mL) or 8 μL (final concentration: 8 μg / mL) of the GFP mRNA-encapsulated LNPs (total RNA concentration: 100 μg / mL) prepared by the post-addition method described in <1> above was added to each well, and the cells were cultured in a 37°C, 5% CO2 incubator.

[0404] <3> mRNA expression efficiency in THP-1 The day after LNP treatment, THP-1 treated under each condition was observed under a fluorescent microscope to evaluate the GFP positive rate. Furthermore, THP-1 treated under each condition was collected from the 96-well plate, and the GFP positive rate was evaluated by flow cytometry. The GFP efficiency of THP-1 was evaluated using BD Horizon TM Dead cells were stained with Fixable Viability Stain (FVS) Reagents (BD, 565388), then fixed and washed, and the cell status was analyzed using an Attune instrument (Thermo Fisher). Analysis data was analyzed using Flowjo software. Cell measurement data was gated for size, single cells, and live cells, and the proportion of GFP-positive cells was analyzed. The results shown in Figures 27 and 28 demonstrate that mRNA can be introduced into THP-1 cells with high efficiency.

[0405] <Test Example 14> Nucleic acid delivery to human bone marrow-derived mesenchymal stem cells (BM-MSCs) using post-added LNPs <1> Preparation and culture of BM-MSCs Mesenchymal stem cells derived from the bone marrow of a healthy human donor (Xeno-Free RoosterVial™-hBM, Roosterbio, MSC-031) were suspended in PRIME-XV Expansion XSFM (FUJIFILM Irvine Scientific, 91149) (hereinafter referred to as MSC medium) at a concentration of 0.015 × 10 6 The cells were then seeded at 0.5 ml / well in a 24-well cell culture plate and incubated at 37°C with 5% CO 2 The cells were cultured in an incubator for 4 days.

[0406] <2> Encapsulation of GFP mRNA into empty LNP (post-addition method) CleanCap (registered trademark) EGFP mRNA (5 moU) (TriLink, L-7201) was diluted with water for injection to prepare an RNA solution (total nucleic acid concentration 400 μg / mL). The empty LNP of Example 2 stored at -70 ° C was thawed at 4 ° C. An equal volume of the RNA solution was added to this LNP solution and mixed by pipetting (LNP-RNA mixture). After standing at room temperature for 5 minutes, an equal volume of 20 mmol / L Tris buffer containing 8% sucrose was added to this LNP-RNA mixture and mixed by pipetting to prepare GFP mRNA-encapsulated LNP by the post-addition method (post-addition method GFP mRNA-encapsulated LNP).

[0407] <3> LNP treatment of BM-MSCs On day 4 of culture, the medium was aspirated from the wells containing the seeded cells, and 500 μL / well of MSC medium containing ApoE3 at a final concentration of 1 μg / ml, which had been prepared in advance and was added. 20 μL (final concentration: 4 μg / ml) or 50 μL (final concentration: 10 μg / ml) of GFP mRNA-encapsulated LNP (total RNA concentration: 100 μg / mL) prepared by the post-addition method described in <3> above was added to each well, and the cells were cultured in a 37°C, 5% CO2 incubator.

[0408] <4> mRNA expression efficiency in BM-MSCs The day after LNP treatment, BM-MSCs treated under each condition were observed under a fluorescent microscope to evaluate the GFP-positive rate. BM-MSCs treated under each condition were also detached and collected from the 24-well plate, and the GFP-positive rate was evaluated by flow cytometry. GFP efficiency of BM-MSCs was evaluated using BD Horizon TM After staining dead cells with Fixable Viability Stain (FVS) Reagents (BD, 565388), the cells were fixed and washed, and the cell status was analyzed using an Attune instrument (Thermo Fisher). The analysis data was analyzed using Flowjo software. After gating the cell measurement data by size, single cells, and live cells, the proportion of GFP-positive cells was analyzed. The results shown in Figures 29 and 30 demonstrate that mRNA can be introduced into BM-MSCs with high efficiency.

[0409] Test Example 15 Nucleic Acid Delivery to iPS Cell-Derived Neurons (iNeurons) Using Post-Added LNPs <1> Preparation of Culture Medium The culture medium used for culturing iNeurons consisted of Neurobasal Medium (Thermo Fisher Scientific, 21103-049), GlutaMAX Supplement (Thermo Fisher Scientific, 35050061) (final concentration 1%), and B27 supplement (Thermo Fisher Scientific, 17504) (final concentration 2%) (hereinafter referred to as iNeuron medium).

[0410] <2> iNeuron Culture Neurons were generated by forcibly expressing the Ngn2 gene from iPS cells and cryopreserved. The cryopreserved cells were thawed in a 37°C warm bath. After thawing, the cells were added to iNeuron medium and centrifuged at 600 × g for 5 minutes at room temperature. After centrifugation, the supernatant was removed, and the cells were suspended in 1 mL of iNeuron medium and counted. 2.5 to 10.0 × 10 cells were placed in an iMatrix (Matrixome, 892021)-coated 96-well plate. 4 Neurons were seeded in 1000 cells / well and incubated at 37°C with 5% CO2 The cells were cultured in an incubator for 1 day.

[0411] <3> Encapsulation of GFP mRNA into empty LNP (post-addition method) CleanCap (registered trademark) EGFP mRNA (5 moU) (TriLink, L-7201) was diluted with water for injection to prepare an RNA solution (total nucleic acid concentration 400 μg / mL). The empty LNP of Example 2 stored at -70 ° C was thawed at 4 ° C. An equal volume of the RNA solution was added to this LNP solution and mixed by pipetting (LNP-RNA mixture). After standing at room temperature for 5 minutes, an equal volume of 20 mmol / L Tris buffer containing 8% sucrose was added to this LNP-RNA mixture and mixed by pipetting to prepare GFP mRNA-encapsulated LNP by the post-addition method (post-addition method GFP mRNA-encapsulated LNP).

[0412] <4> LNP Treatment of iNeuron On day 1 of culture, the medium was aspirated from the wells containing the seeded cells, and 100 μL / well of iNeuron medium containing ApoE3 at a final concentration of 1 μg / mL, which had been prepared in advance and was added. 4 μL (final concentration: 4 μg / mL) or 8 μL (final concentration: 10 μg / mL) of GFP mRNA-encapsulated LNP (total RNA concentration: 100 μg / mL) prepared by the post-addition method described in <3> above was added to each well, and the cells were cultured in a 37°C, 5% CO2 incubator.

[0413] <5> mRNA expression efficiency in iNeurons The day after LNP treatment, the iNeurons treated under each condition were observed under a fluorescent microscope to evaluate the GFP-positive rate. The iNeurons treated under each condition were also detached and collected from the 96-well plate, and the GFP-positive rate was evaluated by flow cytometry. The GFP efficiency of iNeurons was evaluated using BD Horizon TMAfter staining dead cells with Fixable Viability Stain (FVS) Reagents (BD, 565388), the cells were fixed and washed, and the cell status was analyzed using an Attune instrument (Thermo Fisher). Analysis data was analyzed using Flowjo software. Cell measurement data was gated for size, single cells, and live cells, and the proportion of GFP-positive cells was analyzed. The results shown in Figures 31 and 32 demonstrate that iNeuron enables highly efficient mRNA delivery.

[0414] Test Example 16: Nucleic acid delivery to T cells after long-term culture. <1> Preparation of T cells after long-term culture. On day 10 of culture (day 7 after activation), the required number of T cells was collected, centrifuged, and the supernatant was removed. The activated T cells were adjusted to a concentration of 1.0 x 10 cells / ml in activation medium containing recombinant human apolipoprotein E3 (ApoE3) (Fujifilm Wako, 010-20261) at a final concentration of 1 μg / ml, and seeded into a 96-well plate.

[0415] <2> Preparation of T cells after long-term culture with medium change the day before LNP treatment. T cells were harvested on day 9 of culture in activation medium (day 6 after activation) and resuspended in freshly prepared activation medium or Opti-MEM™ I Reduced Serum Medium (Thermo Fisher, 31985062) containing 5 ng / ml IL-2 and cultured for 1 day. The required number of T cells on day 10 of culture was collected, centrifuged, and the supernatant removed. Activated T cells were adjusted to a concentration of 1.0 x 10 cells / ml in activation medium containing recombinant human apolipoprotein E3 (ApoE3) (Fujifilm Wako, 010-20261) at a final concentration of 1 μg / ml and seeded onto a 96-well plate.

[0416] <3> Encapsulation of GFP mRNA into empty LNP (post-addition method) CleanCap (registered trademark) EGFP mRNA (5 moU) (TriLink, L-7201) was diluted with water for injection to prepare an RNA solution (total nucleic acid concentration 400 μg / mL). The empty LNP of Example 2 stored at -70 ° C was thawed at 4 ° C. An equal volume of the RNA solution was added to this LNP solution and mixed by pipetting (LNP-RNA mixture). After standing at room temperature for 5 minutes, an equal volume of 20 mmol / L Tris buffer containing 8% sucrose was added to this LNP-RNA mixture and mixed by pipetting to prepare GFP mRNA-encapsulated LNP by the post-addition method (post-addition method GFP mRNA-encapsulated LNP).

[0417] The GFP mRNA-encapsulated LNP prepared by the post-addition method in <3> above was added at 4.0 μg (total RNA amount) per 1.0 x 10 cells and cultured in a 37°C, 5% CO2 incubator. 24 hours after LNP addition, cells were harvested, and the GFP-positive cell ratio of T cells treated with each LNP was measured by flow cytometry to evaluate the GFP mRNA transduction efficiency. The results are shown in Figure 33 (Day 9 MC_Day 10 TF condition, Day 9 OptiMEM_Day 10 TF condition).

Claims

1. A method for delivering nucleic acid to immune cells (excluding in vivo delivery methods), comprising: step A of preparing lipid particles that do not contain nucleic acid using an ionizable lipid, a nonionizable lipid, and a lipid having a nonionic polymer; step B of mixing the lipid particles that do not contain nucleic acid with nucleic acid to prepare nucleic acid-containing lipid particles; and step C of contacting the nucleic acid-containing lipid particles with immune cells.

2. The method of claim 1, comprising freezing and storing the nucleic acid-free lipid particles, and thawing the frozen, nucleic acid-free lipid particles prior to mixing with the nucleic acid.

3. The method according to claim 1, wherein step B comprises the steps of incubating the lipid particles not containing nucleic acid and an aqueous solution containing nucleic acid at 0°C to 30°C for 0.1 to 120 minutes, and adjusting the pH of the mixture obtained above to 6.5 to 8.

5.

4. The method according to claim 1, wherein in step B, the nucleic acid-free lipid particles and the nucleic acid are mixed by any one of mixing by moving the liquid back and forth in a container, pipette mixing, stirrer mixing in a batch container, mixing by rotating a container to stir the contents, or flask stirring.

5. The method according to claim 1, further comprising the step of adding an apolipoprotein to a culture medium containing immune cells before contacting the nucleic acid-containing lipid particles with the immune cells in step C.

6. The method according to any one of claims 1 to 5, wherein the ionizable lipid is a compound represented by the formula (1) or a salt thereof. In the formula, X represents -NR 1 - or -O-, and R 1 represents a hydrogen atom, a hydrocarbon group having 6 to 24 carbon atoms, or a group represented by R 21 -L 1 -R 22 -, R 21 represents a hydrocarbon group having 1 to 24 carbon atoms, L 1 represents -O(CO)O-, -O(CO)-, -(CO)O-, -O-, or represents, R 22 is a divalent linking group and represents a hydrocarbon linking group having 1 to 18 carbon atoms, R 2 and R 3 each independently represents a hydrogen atom, a hydrocarbon group having 3 to 24 carbon atoms, or a group represented by R 31 -L 2 -R 32 -, R 31 represents a hydrocarbon group having 1 to 24 carbon atoms, L 2 represents -O(CO)O-, -O(CO)-, -(CO)O-, -O-, or represents, R 32 is a divalent linking group and represents a hydrocarbon linking group having 1 to 18 carbon atoms, R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 10 , R 11 , and R 12 each independently represents a hydrogen atom or an optionally substituted alkyl group having 1 to 18 carbon atoms, R 4 and R 5 , R 10 and R 5 , R 5 and R 12 , R 4 and R 6 , R 5 and R 6 , R 6 and R 7 , R 6 and R 10 and R 12 and R 7 and R 7 and R 8 Any one or more of them may be linked to each other to form a 4- to 7-membered ring which may contain an O atom, and the substituent on the optionally substituted alkyl group having 1 to 18 carbon atoms is a hydroxyl group, a carboxyl group, -NR 45 R 46 amino group represented by, a substituted or unsubstituted aryl group, a substituted or unsubstituted heteroaryl group, -O(CO)O-R 41 -O(CO)-R 42 -(CO)O-R 43 or -O-R 44 group represented by, and R 41 R 42 R 43 R 44 R 45 and R 46 each independently represents a hydrocarbon group having 1 to 18 carbon atoms, and the substituents on the substituted or unsubstituted aryl group and the substituted or unsubstituted heteroaryl group are an alkyl group having 1 to 18 carbon atoms, a hydroxyl group, a carboxyl group, -NR 45 R 46 amino group represented by, -O(CO)O-R 41 -O(CO)-R 42 -(CO)O-R 43 or -O-R 44 group represented by, and R 41 R 42 R 43 R 44 R 45 and R 46 each independently represents a hydrocarbon group having 1 to 18 carbon atoms, and a, b, c, and d each independently represent an integer of 0 to 3, provided that a + b is 1 or more and c + d is 1 or more.

7. The method according to any one of claims 1 to 5, wherein the ionizable lipid is a compound represented by the formula (2) or a salt thereof. In the formula, R 101 and R 102 each independently represent a hydrocarbon group having 1 to 18 carbon atoms, and R 103 represents a hydrocarbon group having 2 to 8 carbon atoms, and R 101 , R 102 and R 103 The hydrocarbon group represented by may be substituted with one or more substituents selected from -OH, COOH, -NR 151 R 152 , -OC(O)O-R 153 , -C(O)O-R 154 , -OC(O)-R 155 , and -O-R 156 and may be substituted, and R 102 and R 103 may be linked to each other to form a 4- to 7-membered ring, and R 104 represents a hydrocarbon group having 1 to 8 carbon atoms, and R 105 and R 106 each independently represent a hydrocarbon group having 1 to 8 carbon atoms, or -R 108 -L 101 -R 109 provided that R 105 and R 106 are excluded when both are hydrocarbon groups having 1 to 8 carbon atoms, and R 107 is -R 110 -L 102 -R 111 -L 103 -R 112 and R 151 and R 152 each independently represent a hydrocarbon group having 1 to 8 carbon atoms, and R 153 , R 154 , R 155 , and R 156 each independently represent a hydrocarbon group having 1 to 24 carbon atoms, and R 153 , R 154 , R 155 , and R 156 The hydrocarbon group represented by is an aryl group having 6 to 20 carbon atoms or -S-R 158 may be replaced, and the aryl group having 6 to 20 carbon atoms may be -OH, COOH, -NR 151 R 152 , -OC(O)O-R 153 , -C(O)O-R 154 , -OC(O)-R 155 , -O-R 156 , or -(hydrocarbon group having 1 to 12 carbon atoms)-R 157 may be replaced, and R 158 represents a hydrocarbon group having 1 to 12 carbon atoms, and R 157 is -OH, COOH, -NR 161 R 162 , -OC(O)O-R 163 , -C(O)O-R 164 , -OC(O)-R 165 , -O-R 166 . R 161 and R 162 each independently represent a hydrocarbon group having 1 to 8 carbon atoms, and R 163 , R 164 , R 165 , and R 166 each independently represent a hydrocarbon group having 1 to 24 carbon atoms, and the hydrocarbon group represented by R 163 , R 164 , R 165 , and R 166 may be replaced by an aryl group having 6 to 20 carbon atoms or -S-R 168 , and the aryl group having 6 to 20 carbon atoms may be -OH, COOH, -NR 161 R 162 , -OC(O)O-R 163 , -C(O)O-R 164 , -OC(O)-R 165 , -O-R 166 , or may be replaced by a hydrocarbon group having 1 to 12 carbon atoms, and R 168 represents a hydrocarbon group having 1 to 12 carbon atoms, and L 101 , L 102 , and L 103 each independently represent -OC(O)O-, -C(O)O-, -OC(O)-, or -O-. R 108 represents a hydrocarbon group having 1 to 12 carbon atoms, and R 109 represents a hydrocarbon group having 1 to 24 carbon atoms, and R 110 represents a hydrocarbon group having 1 to 8 carbon atoms, and R 111 represents a hydrocarbon group having 1 to 24 carbon atoms, and R 112 represents a hydrocarbon group having 1 to 24 carbon atoms, and R 109 , and the hydrocarbon group represented by R 112 may be substituted with an aryl group, -OC(O)O-R 153 , -C(O)O-R 154 , -OC(O)-R 155 , or -S-R 158 , and the definitions of R 153 , R 154 , R 155 , and R 158 are as defined above, and the hydrocarbon group represented by R 111 may be substituted with -OC(O)O-R 153 , -C(O)O-R 154 , or -OC(O)-R 155 , and the definitions of R 153 , R 154 , and R 155 are as defined above.

8. The method of any one of claims 1 to 5, wherein the non-ionizable lipid comprises a sterol or a derivative thereof, and a phospholipid.

9. The method according to claim 8, wherein the sterol is present in an amount of 30 to 70 mol % based on the molar ratio of the total lipids in the lipid composition.

10. The method according to any one of claims 1 to 5, wherein the lipid composition has a pH of 3.0 to 6.

5.

11. A method according to any one of claims 1 to 5, wherein in step B, the mass ratio of lipid concentration to nucleic acid concentration in the solution after mixing is 5:1 to 1000:

1.

12. The method of any one of claims 1 to 5, wherein the immune cells are activated or non-activated cells.

13. The method of any one of claims 1 to 5, wherein the immune cells are derived from primary cells or stem cells.

14. The method according to any one of claims 1 to 5, wherein the nucleic acid is an mRNA or a nucleic acid for gene editing comprising an mRNA encoding a Cas nuclease and a guide RNA. A nucleic acid delivery agent to immune cells, comprising a lipid composition containing an ionizable lipid which is a compound represented by formula (1) or formula (2) or a salt thereof, a non-ionizable lipid, a lipid having a nonionic polymer, and a nucleic acid. In the formula, X represents -NR 1 - or -O-, and R 1 represents a hydrogen atom, a hydrocarbon group having 6 to 24 carbon atoms, or a group represented by R 21 -L 1 -R 22 -, R 21 represents a hydrocarbon group having 1 to 24 carbon atoms, L 1 represents -O(CO)O-, -O(CO)-, -(CO)O-, -O-, or , R 22 is a divalent linking group and represents a hydrocarbon linking group having 1 to 18 carbon atoms, R 2 and R 3 each independently represents a hydrogen atom, a hydrocarbon group having 3 to 24 carbon atoms, or a group represented by R 31 -L 2 -R 32 -, R 31 represents a hydrocarbon group having 1 to 24 carbon atoms, L 2 represents -O(CO)O-, -O(CO)-, -(CO)O-, -O-, or , R 32 is a divalent linking group and represents a hydrocarbon linking group having 1 to 18 carbon atoms, R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 10 , R 11 , and R 12 each independently represents a hydrogen atom or an optionally substituted alkyl group having 1 to 18 carbon atoms, R 4 and R 5 , R 10 and R 5 , R 5 and R 12 , R 4 and R 6 , R 5 and R 6 , R 6 and R 7 , R 6 and R 10 , R 12 and R 7 , and R 7 and R 8 Any one or more of and may be connected to each other to form a 4- to 7-membered ring that may contain an O atom, and the substituent on the optionally substituted alkyl group having 1 to 18 carbon atoms is a hydroxyl group, a carboxyl group, -NR 45 R 46 amino group represented by, substituted or unsubstituted aryl group, substituted or unsubstituted heteroaryl group, -O(CO)O-R 41 , -O(CO)-R 42 , -(CO)O-R 43 , or -O-R 44 group represented by, R 41 , R 42 , R 43 , R 44 , R 45 and R 46 each independently represents a hydrocarbon group having 1 to 18 carbon atoms, and the substituents on the substituted or unsubstituted aryl group and the substituted or unsubstituted heteroaryl group are an alkyl group having 1 to 18 carbon atoms, a hydroxyl group, a carboxyl group, -NR 45 R 46 amino group represented by, -O(CO)O-R 41 , -O(CO)-R 42 , -(CO)O-R 43 , or -O-R 44 group represented by, R 41 , R 42 , R 43 , R 44 , R 45 and R 46 each independently represents a hydrocarbon group having 1 to 18 carbon atoms, and a, b, c, and d each independently represent an integer of 0 to 3, provided that a + b is 1 or more and c + d is 1 or more. In the formula, R 101 and R 102 each independently represents a hydrocarbon group having 1 to 18 carbon atoms, R 103 represents a hydrocarbon group having 2 to 8 carbon atoms, R 101 , R 102 and R 103 The hydrocarbon group represented by is substituted with one or more substituents selected from -OH, COOH, -NR 151 R 152 , -OC(O)O-R 153 , -C(O)O-R 154 , -OC(O)-R 155 , and -O-R 156 and may be substituted with one or more substituents selected from, and R 102 and R 103 may be linked to each other to form a 4- to 7-membered ring, R 104 represents a hydrocarbon group having 1 to 8 carbon atoms, and R 105 and R 106 each independently represent a hydrocarbon group having 1 to 8 carbon atoms, or -R 108 -L 101 -R 109 provided that the case where both R 105 and R 106 are hydrocarbon groups having 1 to 8 carbon atoms is excluded, and R 107 represents -R 110 -L 102 -R 111 -L 103 -R 112 and R 151 and R 152 each independently represent a hydrocarbon group having 1 to 8 carbon atoms, and R 153 , R 154 , R 155 , and R 156 each independently represent a hydrocarbon group having 1 to 24 carbon atoms, and R 153 , R 154 , R 155 , and R 156 The hydrocarbon group represented by may be substituted with an aryl group having 6 to 20 carbon atoms or -S-R 158 , and the aryl group having 6 to 20 carbon atoms may be substituted with -OH, COOH, -NR 151 R 152 , -OC(O)O-R 153 , -C(O)O-R 154 , -OC(O)-R 155 , -O-R 156 , or -(hydrocarbon group having 1 to 12 carbon atoms)-R 157 and may be substituted, and R 158 represents a hydrocarbon group having 1 to 12 carbon atoms, and R 157 is -OH, COOH, -NR 161 R 162 , -OC(O)O-R 163 , -C(O)O-R 164 , -OC(O)-R 165 , -O-R 166 . R 161 and R 162 each independently represent a hydrocarbon group having 1 to 8 carbon atoms, and R 163 , R 164 , R 165 , and R 166 each independently represent a hydrocarbon group having 1 to 24 carbon atoms, and R 163 , R 164 , R 165 , and R 166 represents a hydrocarbon group which may be substituted with an aryl group having 6 to 20 carbon atoms or -S-R 168 , and the aryl group having 6 to 20 carbon atoms may be substituted with -OH, COOH, -NR 161 R 162 , -OC(O)O-R 163 , -C(O)O-R 164 , -OC(O)-R 165 , -O-R 166 , or may be substituted with a hydrocarbon having 1 to 12 carbon atoms, and R 168 represents a hydrocarbon group having 1 to 12 carbon atoms, and L 101 , L 102 , and L 103 each independently represent -OC(O)O-, -C(O)O-, -OC(O)-, or -O-. R 108 represents a hydrocarbon group having 1 to 12 carbon atoms, and R 109 represents a hydrocarbon group having 1 to 24 carbon atoms, and R 110 represents a hydrocarbon group having 1 to 8 carbon atoms, and R 111 represents a hydrocarbon group having 1 to 24 carbon atoms, and R 112 represents a hydrocarbon group having 1 to 24 carbon atoms, and R 109 , and R 112 represents an aryl group, -OC(O)O-R 153 , -C(O)O-R 154 , -OC(O)-R 155 , or -S-R 158 may be substituted, and R 153 , R 154 , R 155 , and R 158 are as defined above, and the hydrocarbon group represented by R 111 may be substituted with -OC(O)O-R 153 , -C(O)O-R 154 , or -OC(O)-R 155 may be substituted, and R 153 , R 154 , and R 155 are as defined above.

16. The nucleic acid delivery agent to immune cells according to claim 15, wherein the non-ionized lipid contains a sterol or its derivative and a phospholipid.

17. The nucleic acid delivery agent to immune cells according to claim 16, wherein the sterol is 30 to 70 mol% in terms of the molar ratio to the total lipids in the lipid composition.

18. The nucleic acid delivery agent to immune cells according to any one of claims 15 to 17, wherein the nucleic acid is mRNA or a nucleic acid for gene editing containing mRNA encoding Cas nuclease and guide RNA. A nucleic acid delivery agent to immune cells, comprising a lipid composition containing an ionizable lipid which is a compound represented by formula (1) or formula (2) or a salt thereof, a non-ionizable lipid, and a lipid having a non-ionic polymer. In the formula, X represents -NR 1 - or -O-, and R 1 represents a hydrogen atom, a hydrocarbon group having 6 to 24 carbon atoms, or a group represented by R 21 -L 1 -R 22 -, R 21 represents a hydrocarbon group having 1 to 24 carbon atoms, L 1 represents -O(CO)O-, -O(CO)-, -(CO)O-, -O-, or and R 22 is a divalent linking group and represents a hydrocarbon linking group having 1 to 18 carbon atoms, R 2 and R 3 each independently represent a hydrogen atom, a hydrocarbon group having 3 to 24 carbon atoms, or a group represented by R 31 -L 2 -R 32 -, R 31 represents a hydrocarbon group having 1 to 24 carbon atoms, L 2 represents -O(CO)O-, -O(CO)-, -(CO)O-, -O-, or and R 32 is a divalent linking group and represents a hydrocarbon linking group having 1 to 18 carbon atoms, R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 10 , R 11 , and R 12 each independently represent a hydrogen atom or an optionally substituted alkyl group having 1 to 18 carbon atoms, R 4 and R 5 , R 10 and R 5 , R 5 and R 12 , R 4 and R 6 , R 5 and R 6 , R 6 and R 7 and R 6 and R 10 and R 12 and R 7 and R, and R 7 and R 8 Any one or more of may be linked to each other to form a 4- to 7-membered ring which may contain an O atom, and the substituent on the optionally substituted alkyl group having 1 to 18 carbon atoms is a hydroxyl group, a carboxyl group, -NR 45 R 46 amino group represented by, a substituted or unsubstituted aryl group, a substituted or unsubstituted heteroaryl group, -O(CO)O-R 41 -O(CO)-R 42 -(CO)O-R 43 or -O-R 44 represented by a group, R 41 R 42 R 43 R 44 R 45 and R 46 each independently represents a hydrocarbon group having 1 to 18 carbon atoms, and the substituents on the substituted or unsubstituted aryl group and the substituted or unsubstituted heteroaryl group are an alkyl group having 1 to 18 carbon atoms, a hydroxyl group, a carboxyl group, -NR 45 R 46 amino group represented by, -O(CO)O-R 41 -O(CO)-R 42 -(CO)O-R 43 or -O-R 44 represented by a group, R 41 R 42 R 43 R 44 R 45 and R 46 each independently represents a hydrocarbon group having 1 to 18 carbon atoms, and a, b, c, and d each independently represent an integer of 0 to 3, provided that a + b is 1 or more and c + d is 1 or more. In the formula, R 101 and R 102 each independently represents a hydrocarbon group having 1 to 18 carbon atoms, R 103 represents a hydrocarbon group having 2 to 8 carbon atoms, R 101 R, 102 and R 103 The hydrocarbon group represented by is optionally substituted with one or more substituents selected from -OH, COOH, -NR 151 R 152 , -OC(O)O-R 153 , -C(O)O-R 154 , -OC(O)-R 155 , and -O-R 156 and may be optionally substituted with one or more substituents selected from, and R 102 and R 103 may be linked to each other to form a 4- to 7-membered ring, R 104 represents a hydrocarbon group having 1 to 8 carbon atoms, R 105 and R 106 each independently represents a hydrocarbon group having 1 to 8 carbon atoms, or -R 108 -L 101 -R 109 provided that R 105 and R 106 are excluded when both are hydrocarbon groups having 1 to 8 carbon atoms, R 107 is -R 110 -L 102 -R 111 -L 103 -R 112 represents, R 151 and R 152 each independently represents a hydrocarbon group having 1 to 8 carbon atoms, R 153 , R 154 , R 155 , and R 156 each independently represents a hydrocarbon group having 1 to 24 carbon atoms, R 153 , R 154 , R 155 , and R 156 The hydrocarbon group represented by may be substituted with an aryl group having 6 to 20 carbon atoms or -S-R 158 , and the aryl group having 6 to 20 carbon atoms may be substituted with -OH, COOH, -NR 151 R 152 , -OC(O)O-R 153 , -C(O)O-R 154 , -OC(O)-R 155 , -O-R 156 , or -(hydrocarbon group having 1 to 12 carbon atoms)-R 157 and may be optionally substituted, R 158 represents a hydrocarbon group having 1 to 12 carbon atoms, and R 157 is -OH, COOH, -NR 161 R 162 , -OC(O)O-R 163 , -C(O)O-R 164 , -OC(O)-R 165 , -O-R 166 represents. R 161 and R 162 each independently represent a hydrocarbon group having 1 to 8 carbon atoms, and R 163 , R 164 , R 165 , and R 166 each independently represent a hydrocarbon group having 1 to 24 carbon atoms, and R 163 , R 164 , R 165 , and R 166 The hydrocarbon group represented by may be substituted with an aryl group having 6 to 20 carbon atoms or -S-R 168 , and the aryl group having 6 to 20 carbon atoms may be substituted with -OH, COOH, -NR 161 R 162 , -OC(O)O-R 163 , -C(O)O-R 164 , -OC(O)-R 165 , -O-R 166 , or may be substituted with a hydrocarbon group having 1 to 12 carbon atoms, and R 168 represents a hydrocarbon group having 1 to 12 carbon atoms, and L 101 , L 102 , and L 103 each independently represent -OC(O)O-, -C(O)O-, -OC(O)-, or -O-. R 108 represents a hydrocarbon group having 1 to 12 carbon atoms, and R 109 represents a hydrocarbon group having 1 to 24 carbon atoms, and R 110 represents a hydrocarbon group having 1 to 8 carbon atoms, and R 111 represents a hydrocarbon group having 1 to 24 carbon atoms, and R 112 represents a hydrocarbon group having 1 to 24 carbon atoms, and R 109 , and R 112 The hydrocarbon group represented by is an aryl group, -OC(O)O-R 153 , -C(O)O-R 154 , -OC(O)-R 155 , or -S-R 158 may be substituted, and R 153 , R 154 , R 155 , and R 158 are as defined above, and the hydrocarbon group represented by R 111 may be substituted with -OC(O)O-R 153 , -C(O)O-R 154 , or -OC(O)-R 155 may be substituted, and R 153 , R 154 , and R 155 are as defined above.

20. The nucleic acid delivery agent to immune cells according to claim 19, wherein the non-ionized lipid contains a sterol or its derivative and a phospholipid.

21. The nucleic acid delivery agent to immune cells according to claim 19, wherein the sterol is 30 to 70 mol% in terms of the molar ratio to the total lipids in the lipid composition.

22. A kit for delivering nucleic acids to cells, comprising the following reagents (A) to (C). (A) A lipid composition comprising an ionizable lipid which is a compound represented by formula (1) or formula (2) or a salt thereof, a non-ionizable lipid, and a lipid having a non-ionic polymer; (B) a pH adjuster; and (C) apolipoprotein: In the formula, X represents -NR 1 - or -O-, and R 1 represents a hydrogen atom, a hydrocarbon group having 6 to 24 carbon atoms, or a group represented by R 21 -L 1 -R 22 -, R 21 represents a hydrocarbon group having 1 to 24 carbon atoms, L 1 represents -O(CO)O-, -O(CO)-, -(CO)O-, -O-, or , R 22 is a divalent linking group and represents a hydrocarbon linking group having 1 to 18 carbon atoms, R 2 and R 3 each independently represent a hydrogen atom, a hydrocarbon group having 3 to 24 carbon atoms, or a group represented by R 31 -L 2 -R 32 -, R 31 represents a hydrocarbon group having 1 to 24 carbon atoms, L 2 represents -O(CO)O-, -O(CO)-, -(CO)O-, -O-, or , R 32 is a divalent linking group and represents a hydrocarbon linking group having 1 to 18 carbon atoms, R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 10 , R 11 , and R 12 each independently represent a hydrogen atom or an optionally substituted alkyl group having 1 to 18 carbon atoms, R 4 and R 5 , R 10 and R 5 , R 5 and R 12 , R 4 and R 6 , R 5 and R 6 , R 6 and R 7 , R 6 and R 10 , R 12 and R 7 , and R 7 and R 8 Any one or more of them may be linked to each other to form a 4- to 7-membered ring which may contain an O atom, and the substituent on the optionally substituted alkyl group having 1 to 18 carbon atoms is a hydroxyl group, a carboxyl group, -NR 45 R 46 amino group represented by, a substituted or unsubstituted aryl group, a substituted or unsubstituted heteroaryl group, -O(CO)O-R 41 , -O(CO)-R 42 , -(CO)O-R 43 , or -O-R 44 group represented by, R 41 , R 42 , R 43 , R 44 , R 45 and R 46 each independently represents a hydrocarbon group having 1 to 18 carbon atoms, and the substituents on the substituted or unsubstituted aryl group and the substituted or unsubstituted heteroaryl group are an alkyl group having 1 to 18 carbon atoms, a hydroxyl group, a carboxyl group, -NR 45 R 46 amino group represented by, -O(CO)O-R 41 , -O(CO)-R 42 , -(CO)O-R 43 , or -O-R 44 group represented by, R 41 , R 42 , R 43 , R 44 , R 45 and R 46 each independently represents a hydrocarbon group having 1 to 18 carbon atoms, and a, b, c, and d each independently represent an integer of 0 to 3, provided that a + b is 1 or more and c + d is 1 or more. In the formula, R 101 and R 102 each independently represents a hydrocarbon group having 1 to 18 carbon atoms, R 103 represents a hydrocarbon group having 2 to 8 carbon atoms, and R 101 , R 102 and R 103 may be substituted with one or more substituents selected from -OH, COOH, -NR 151 R 152 , -OC(O)O-R 153 , -C(O)O-R 154 , -OC(O)-R 155 , and -O-R 156 ; also, R 102 and R 103 may be linked to each other to form a 4- to 7-membered ring; R 104 represents a hydrocarbon group having 1 to 8 carbon atoms; R 105 and R 106 each independently represent a hydrocarbon group having 1 to 8 carbon atoms, or -R 108 -L 101 -R 109 , provided that the case where both R 105 and R 106 are hydrocarbon groups having 1 to 8 carbon atoms is excluded; R 107 represents -R 110 -L 102 -R 111 -L 103 -R 112 ; R 151 and R 152 each independently represent a hydrocarbon group having 1 to 8 carbon atoms; R 153 , R 154 , R 155 , and R 156 each independently represent a hydrocarbon group having 1 to 24 carbon atoms; R 153 , R 154 , R 155 , and R 156 may be substituted with an aryl group having 6 to 20 carbon atoms or -S-R 158 ; the aryl group having 6 to 20 carbon atoms may be substituted with -OH, COOH, -NR 151 R 152 , -OC(O)O-R 153 , -C(O)O-R 154 , -OC(O)-R 155 , -O-R 156 or -(hydrocarbon group having 1 to 12 carbon atoms)-R 157 may be substituted, and R 158 represents a hydrocarbon group having 1 to 12 carbon atoms, and R 157 is -OH, COOH, -NR 161 R 162 , -OC(O)O-R 163 , -C(O)O-R 164 , -OC(O)-R 165 , -O-R 166 . R 161 and R 162 each independently represent a hydrocarbon group having 1 to 8 carbon atoms, and R 163 , R 164 , R 165 , and R 166 each independently represent a hydrocarbon group having 1 to 24 carbon atoms, and R 163 , R 164 , R 165 , and R 166 The hydrocarbon group represented by may be substituted with an aryl group having 6 to 20 carbon atoms or -S-R 168 , and the aryl group having 6 to 20 carbon atoms may be substituted with -OH, COOH, -NR 161 R 162 , -OC(O)O-R 163 , -C(O)O-R 164 , -OC(O)-R 165 , -O-R 166 , or may be substituted with a hydrocarbon having 1 to 12 carbon atoms, and R 168 represents a hydrocarbon group having 1 to 12 carbon atoms, and L 101 , L 102 , and L 103 each independently represent -OC(O)O-, -C(O)O-, -OC(O)-, or -O-. R 108 represents a hydrocarbon group having 1 to 12 carbon atoms, and R 109 represents a hydrocarbon group having 1 to 24 carbon atoms, and R 110 represents a hydrocarbon group having 1 to 8 carbon atoms, and R 111 represents a hydrocarbon group having 1 to 24 carbon atoms, and R 112 represents a hydrocarbon group having 1 to 24 carbon atoms, and R 109 , and R 112 The hydrocarbon group represented by is an aryl group, -OC(O)O-R 153 , -C(O)O-R 154 , -OC(O)-R 155 , or -S-R 158 may be substituted, and the definitions of R 153 , R 154 , R 155 , and R 158 are as described above. The hydrocarbon group represented by R 111 is -OC(O)O-R 153 , -C(O)O-R 154 , or -OC(O)-R 155 may be substituted, and the definitions of R 153 , R 154 , and R 155 are as described above.

23. A method for nucleic acid delivery to cells using the kit according to claim 22, comprising the following steps (1) to (4): (1) a step of mixing reagent (A) and nucleic acid; (2) a step of adjusting the pH of the mixture obtained in step (1) with reagent (B); (3) a step of adding reagent (C) to a medium containing cells; and (4) a step of adding the mixture obtained in step (2) to the medium obtained in step (3).

24. The nucleic acid delivery method according to claim 23, wherein the cells are immune cells. At least one compound selected from the group consisting of the following compounds, or a salt thereof. Bis(2-pentylheptyl) 11-(2-((2-(benzyloxy)ethyl)(ethyl)amino)ethyl)-5,17-dihexyl-7,15-dioxo-6,8,14,16-tetraoxa-11-azapentacosanedioic acid 2-Butyloctyl 5-ethyl-14-hexyl-1-hydroxy-8-(2-(octanoyloxy)ethyl)-12-oxo-11,13-dioxa-5,8-diazatricosane-23-oate Bis(2-butyloctyl) 16-(2-(ethyl(4-hydroxybutyl)amino)ethyl)-10,22-dihexyl-12,20-dioxo-11,13,19,21-tetraoxa-16-azapentatriacontanedioate Bis(2-pentylheptyl) 11-(2-(ethyl(4-hydroxybutyl)amino)ethyl)-5,17-dihexyl-7,15-dioxo-6,8,14,16-tetraoxa-11-azapentacosanedioic acid 2-Pentylheptyl 8-(2-(decanoyloxy)ethyl)-5-ethyl-14-hexyl-1-hydroxy-12-oxo-11,13-dioxa-5,8-diazaoctadecane-18-oate Bis(2-pentylheptyl) 12-(2-(ethyl(4-hydroxybutyl)amino)ethyl)-5,19-dihexyl-7,17-dioxo-6,8,16,18-tetraoxa-12-azatriacontanedioate Bis(2-pentylheptyl) 11-(2-(ethyl(3-hydroxypropyl)amino)ethyl)-5,17-dihexyl-7,15-dioxo-6,8,14,16-tetraoxa-11-azapentacosanedioate Bis(2-pentylheptyl) 11-(2-(ethyl(2-hydroxyethyl)amino)ethyl)-5,17-dihexyl-7,15-dioxo-6,8,14,16-tetraoxa-11-azapentacosanedioic acid Bis(2-pentylheptyl) 13-(2-(ethyl(4-hydroxybutyl)amino)ethyl)-5,21-dihexyl-7,19-dioxo-6,8,18,20-tetraoxa-13-azapentacosanedioic acid 2-Pentylheptyl 11-(2-(decanoyloxy)ethyl)-7-ethyl-17-hexyl-15-oxo-1-phenyl-2,14,16-trioxa-7,11-diazahenicosan-21-oate 2-Pentylheptyl 10-(4-(decanoyloxy)butyl)-7-ethyl-18-hexyl-16-oxo-1-phenyl-2,15,17-trioxa-7,10-diazadocosan-22-oate 2-Pentylheptyl 10-(3-(decanoyloxy)propyl)-7-ethyl-17-hexyl-15-oxo-1-phenyl-2,14,16-trioxa-7,10-diazahenicosan-21-oate Bis(2-pentylheptyl) 5,17-dihexyl-11-(1-methylpiperidin-4-yl)-7,15-dioxo-6,8,14,16-tetraoxa-11-azahenicosanedioic acid

Citation Information

Patent Citations

  • Lipids and lipid compositions for the delivery of active agents

    WO2015095340A1

  • Improved process of preparing MRNA-loaded lipid nanoparticles

    WO2018089801A1

  • Compound, salt thereof and lipid particles

    WO2019235635A1

  • Nonviral modification of t cell gene expression

    WO2020210901A1

  • Lipid composition

    WO2021095876A1

Cited By

  • Compound serving as intermediate for production of amino lipid or salt thereof, and amino lipid compound production method using same

    WO2026023622A1