Method for detecting two target nucleic acids in sample

A two-temperature method using a single label in a single reaction container effectively detects two target nucleic acids by leveraging signal strength ratios at different temperatures, addressing limitations of conventional methods and enhancing accuracy.

WO2025143881A1PCT designated stage expired Publication Date: 2025-07-03SEEGENE INC
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2024/021293
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-28
Filing Date
2024-12-27
Publication Date
2025-07-03

AI Technical Summary

Technical Problem

Conventional real-time nucleic acid detection methods can only detect a limited number of target nucleic acids simultaneously, and existing methods for detecting two target nucleic acids using a single label suffer from high variability and accuracy issues.

Method used

A method involving two detection temperatures is used to detect two target nucleic acids in a single reaction container, utilizing a single type of label, where the signal strength ratio at different temperatures allows for precise differentiation and detection of both nucleic acids.

Benefits of technology

The method achieves high accuracy and reliability in detecting two target nucleic acids by minimizing signal interference and variability, enabling precise determination of both nucleic acids through signal strength analysis at distinct temperatures.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2024021293_03072025_PF_FP_ABST
    Figure KR2024021293_03072025_PF_FP_ABST
Patent Text Reader

Abstract

The present disclosure relates to a method for detecting two target nucleic acids in a sample using two detection temperatures. The method according to the present disclosure can reduce the variability of a result value (e.g., a Ct value) for determining the presence or absence of a target nucleic acid, thereby enabling the detection of target nucleic acids with high accuracy and high reliability.
Need to check novelty before this filing date? Find Prior Art

Description

Method for detecting two target nucleic acids in a sample

[0001] Cross-reference to related applications

[0002] This application claims the benefit of Republic of Korea Patent Application No. 10-2023-0194962, filed December 28, 2023, with the Korean Intellectual Property Office, the disclosure of which is incorporated herein by reference in its entirety.

[0003] Technology field

[0004] The present disclosure relates to a method for detecting two target nucleic acids in a sample using two detection temperatures.

[0005]

[0006] For the detection of target nucleic acids, real-time detection methods that can detect target nucleic acids while monitoring target amplification in real time are widely used. Real-time detection methods generally utilize labeled probes or primers that specifically hybridize with the target nucleic acid. Examples of methods utilizing hybridization between labeled probes and target nucleic acids include the molecular beacon method (Tyagi et al., Nature Biotechnology v. 14 MARCH 1996) using dual-labeled probes with hairpin structures, the HyBeacon method (French DJ et al., Mol. Cell Probes, 15(6):363-374 (2001)), the hybridization probe method using two probes each labeled with a donor and an acceptor (Bernad et al., 147-148 Clin Chem 2000; 46), and the Lux method (U.S. Patent No. 7,537,886) using single-labeled oligonucleotides. The TaqMan method (U.S. Patent Nos. 5,210,015 and 5,538,848) utilizing a double-labeled probe and cleavage of the probe by the 5'-nuclease activity of DNA polymerase is widely used in the art.

[0007] Examples of methods utilizing labeled primers include the Sunrise primer method (Nazarenko et al., 2516-2521 Nucleic Acids Research, 1997, v.25 no.12, and U.S. Pat. No. 6,117,635), the Scorpion primer method (Whitcombe et al., 804-807, Nature Biotechnology v.17 AUGUST 1999, and U.S. Pat. No. 6,326,145), and the TSG primer method (WO 2011-078441).

[0008] As an alternative approach, real-time detection methods that utilize dimer formation dependent on the presence of target nucleic acids have been proposed: the Invader assay (U.S. Pat. No. 5,691,142, U.S. Pat. No. 6,358,691 and U.S. Pat. No. 6,194,149), the PTO cleavage and extension (PTOCE) method (WO 2012 / 096523), the PTO Cleavage and Extension-Dependent Signaling Oligonucleotide Hybridization (PCE-SH) method (WO 2013 / 115442) and the PTO Cleavage and Extension-Dependent Non-Hybridization (PCE-NH) method (WO 2014 / 104818).

[0009] Since the conventional real-time detection technologies described above can detect only one target nucleic acid using one label, the number of target nucleic acids that can be detected simultaneously in one reaction is limited by the number of available labels (e.g., 5 or less).

[0010] Although melting analysis can be used to detect multiple target nucleic acids using a single marker, melting analysis has serious drawbacks in that it takes longer to perform than real-time techniques and the design of probes with different Tm becomes increasingly difficult as the number of target nucleic acids increases.

[0011] To address this, US Patent Application Publication No. 2017-0247750 or 2019-0024155 disclose a method for determining the presence of two target nucleic acids using a single label in real time without using melting analysis. Specifically, the references disclose a method for determining the presence of two target nucleic acids by reacting a sample with two signal generating means in a single reaction vessel, which are indistinguishable from each other, i.e., containing the same type of label, and then measuring the signals at two detection temperatures, and then analyzing the signals. According to the method, a single signal for one target nucleic acid is measured at one of the two detection temperatures, and a combined signal for the two target nucleic acids is measured at the other detection temperature, and the presence of one target nucleic acid is determined by the single signal, and the presence of the other target nucleic acid is determined by the difference between the signals measured at the two detection temperatures.

[0012] However, the method disclosed in the above prior art may cause high inter-reaction or inter-instrument variability in the values ​​(e.g., Ct values) for determining the presence or absence of two target nucleic acids, and this high variability may affect the accuracy and reliability of the final target nucleic acid detection results.

[0013] Therefore, development of a new method to improve the above-described method is required.

[0014] Numerous references and patents are cited and cited throughout this specification. The disclosures of these references and patents are incorporated herein by reference in their entirety to further clarify the state of the art and the scope of the present invention.

[0015]

[0016] The present inventors sought to develop a novel method for detecting two target nucleic acids using a single type of label in a single reaction vessel. As a result, the inventors confirmed that by controlling the ratio of signal intensities provided by identical target nucleic acids at two detection temperatures, two target nucleic acids can be detected using a single type of label in a single reaction vessel with significantly improved precision and accuracy.

[0017]

[0018] Accordingly, an object of the present disclosure is to provide a method for detecting two target nucleic acids in a sample using two detection temperatures.

[0019]

[0020] Other objects and advantages of the present disclosure will become more apparent from the detailed description below taken together with the appended claims.

[0021]

[0022] According to one aspect of the present disclosure, a method for detecting two target nucleic acids in a sample using two detection temperatures is provided, comprising the following steps:

[0023] (a) a step of incubating a sample suspected of containing at least one of a first target nucleic acid and a second target nucleic acid in one reaction vessel with (i) a composition for detecting a first target nucleic acid and (ii) a composition for detecting a second target nucleic acid, and measuring a signal at a first detection temperature and a second detection temperature;

[0024] The above incubation and signal measurement are performed by real-time nucleic acid amplification reaction,

[0025] The first target nucleic acid is amplified and detected by the first target nucleic acid detection composition, and the second target nucleic acid is amplified and detected by the second target nucleic acid detection composition.

[0026] The composition for detecting the first target nucleic acid reacts with the first target nucleic acid to provide a signal for the first target nucleic acid at a first detection temperature, and the composition for detecting the second target nucleic acid reacts with the second target nucleic acid to provide a signal for the second target nucleic acid at both the first detection temperature and the second detection temperature.

[0027] The first detection temperature is a temperature at which both a signal for the first target nucleic acid and a signal for the second target nucleic acid are detectable, and the second detection temperature is a temperature at which a signal for the second target nucleic acid is detectable, provided that the intensity of the signal for the second target nucleic acid at the first detection temperature is 0.5 times or less the intensity of the signal for the second target nucleic acid at the second detection temperature,

[0028] At the first detection temperature, the signal for the first target nucleic acid and the signal for the second target nucleic acid are not distinguished from each other by a single type detector,

[0029] (b) a step of determining the presence of the two target nucleic acids by the signals measured in the step (a),

[0030] (i) the presence of the second target nucleic acid is determined by a signal measured at the second detection temperature, and (ii) the presence of the first target nucleic acid is determined by a difference between a signal measured at the first detection temperature and a signal measured at the second detection temperature.

[0031] According to one embodiment of the present disclosure, in step (b), the presence of the first target nucleic acid is determined by the difference between a signal measured at the first detection temperature and a signal measured at the second detection temperature using a reference value, wherein the reference value is obtained by the following steps:

[0032] (i) a step of incubating the second target nucleic acid together with the composition for detecting the second target nucleic acid in a reaction vessel different from the single reaction vessel used in step (a);

[0033] (ii) a step of measuring a signal at both the first detection temperature and the second detection temperature; and

[0034] (iii) A step of calculating the difference between the signal measured at the first detection temperature and the signal measured at the second detection temperature.

[0035] According to one embodiment of the present disclosure, the reference value is obtained using the following mathematical formula I:

[0036] [Formula I]

[0037] Reference value = [Signal measured at the first detection temperature for a sample containing only the second target nucleic acid] ÷ [Signal measured at the second detection temperature for a sample containing only the second target nucleic acid]

[0038] According to one embodiment of the present disclosure, in step (b), the presence of the first target nucleic acid is determined by an analysis signal, and the analysis signal is obtained by the following steps:

[0039] (i-1) A step of extracting a signal for a first target nucleic acid from a signal measured at the first detection temperature using a signal measured at the second detection temperature modified by a reference value;

[0040] (i-2) a step of selecting a cycle having a maximum signal value or a minimum signal value from the extracted signal for the first target nucleic acid; and

[0041] (i-3) A step of obtaining signal values ​​from the selected cycle to the last cycle as analysis signals for the first target nucleic acid;

[0042] The above reference value is obtained by the following steps:

[0043] (ii-1) a step of incubating the second target nucleic acid together with the composition for detecting the second target nucleic acid in a reaction vessel different from the single reaction vessel used in the step (a);

[0044] (ii-2) a step of measuring a signal at both the first detection temperature and the second detection temperature; and

[0045] (ii-3) A step of calculating the difference between the signal measured at the first detection temperature and the signal measured at the second detection temperature.

[0046] According to one embodiment of the present disclosure, the extraction of a signal for the first target nucleic acid is performed by the following mathematical formula II:

[0047] [Formula II]

[0048] Extracted signal for the first target nucleic acid = [signal measured at the first detection temperature in step (a)] - [(signal measured at the second detection temperature in step (a)) x (reference value)]

[0049] According to one embodiment of the present disclosure, the second detection temperature is higher than the first detection temperature, the second target nucleic acid detection composition has a signal-changing temperature range (SChTR) in which a signal changes as the second target nucleic acid reacts with the second target nucleic acid to amplify the second target nucleic acid, and the signal-changing temperature range includes a temperature subrange that exhibits a pattern in which the signal change increases as the temperature increases.

[0050] According to one embodiment of the present disclosure, the second detection temperature is lower than the first detection temperature, the second target nucleic acid detection composition has a signal-change temperature range in which a signal changes as the second target nucleic acid reacts with the second target nucleic acid to amplify the second target nucleic acid, and the signal-change temperature range includes a temperature sub-region that exhibits a pattern in which the signal change decreases as the temperature increases.

[0051] According to one embodiment of the present disclosure, the first target nucleic acid detection composition and the second target nucleic acid detection composition each provide a dimer formed by a cleavage reaction dependent on the presence of the corresponding target nucleic acid.

[0052] According to one embodiment of the present disclosure, the composition for detecting the first target nucleic acid comprises:

[0053] (i) primer,

[0054] The primer comprises a nucleotide sequence that hybridizes to a first region of a first target nucleic acid;

[0055] (ii) Probing and Tagging Oligonucleotide (PTO),

[0056] The PTO comprises, in 5' to 3' order, (i) a 5'-tagging portion comprising a nucleotide sequence that non-hybridizes to a first target nucleic acid, and (ii) a 3'-targeting portion comprising a nucleotide sequence that hybridizes to a second region of the first target nucleic acid; and

[0057] (iii) Capturing and Templating Oligonucleotide (CTO),

[0058] The CTO comprises, in 3' to 5' order, (i) a capturing portion comprising a nucleotide sequence that hybridizes to the 5'-tagging portion or a portion of the 5'-tagging portion of the PTO, and (ii) a templating portion comprising a nucleotide sequence that non-hybridizes to the 5'-tagging portion and the 3'-targeting portion of the PTO,

[0059] The above CTO comprises a reporter molecule and a quencher molecule linked thereto.

[0060] According to one embodiment of the present disclosure, the first target nucleic acid detection composition provides a signal by a method comprising the following steps:

[0061] (a') A step of hybridizing the first target nucleic acid with the primer and the PTO,

[0062] The 5'-tagging portion of the PTO does not hybridize to the first target nucleic acid, the 3'-targeting portion of the PTO hybridizes to the first target nucleic acid, and the primer is located upstream of the PTO;

[0063] (b') a step of contacting the resultant of step (a') with a DNA polymerase having 5' nuclease activity under conditions for cleavage of the PTO,

[0064] The primer is extended by a DNA polymerase having the 5' nuclease activity to induce cleavage of the PTO, which cleavage releases a fragment comprising the 5'-tagging portion or a part of the 5'-tagging portion of the PTO;

[0065] (c') A step of hybridizing the fragment released from the PTO and the CTO,

[0066] The above fragment hybridizes to the capturing portion of the CTO;

[0067] (d') A step of performing an extension reaction using the result of the above step (c') and the DNA polymerase having the 5' nuclease activity,

[0068] The fragment hybridized to the capturing portion of the CTO is extended to generate an extended strand complementary to the templating portion of the CTO, thereby generating an extended duplex between the extended strand and the CTO.

[0069] (e') A step of detecting the presence of the above extended strand,

[0070] The presence of the above extended strand indicates the presence of the first target nucleic acid.

[0071] According to one embodiment of the present disclosure, the presence of the extended strand is detected by measuring a signal provided from the extended duplex at the first detection temperature.

[0072] According to one embodiment of the present disclosure, when the CTO is present as a single strand, the reporter molecule and the quencher molecule of the CTO are structurally close to each other, whereby the quencher molecule quenches a signal from the reporter molecule.

[0073] According to one embodiment of the present disclosure, when the CTO hybridizes with the extended strand, the reporter molecule and the quencher molecule of the CTO are structurally separated, whereby the quencher molecule unquenches a signal from the reporter molecule.

[0074] According to one embodiment of the present disclosure, the second target nucleic acid detection composition comprises:

[0075] (i) primer,

[0076] The primer comprises a nucleotide sequence that hybridizes to a first region of the second target nucleic acid;

[0077] (ii) Probing and Tagging Oligonucleotide (PTO),

[0078] The PTO comprises, from 5' to 3', (i) a 5'-tagging portion comprising a nucleotide sequence that non-hybridizes to a second target nucleic acid, and (ii) a 3'-targeting portion comprising a nucleotide sequence that hybridizes to a second region of the second target nucleic acid;

[0079] (iii) Capturing and Templating Oligonucleotide (CTO),

[0080] The CTO comprises, in 3' to 5' order, (i) a capturing portion comprising a nucleotide sequence that hybridizes to the 5'-tagging portion or a portion of the 5'-tagging portion of the PTO, and (ii) a templating portion comprising a nucleotide sequence that non-hybridizes to the 5'-tagging portion and the 3'-targeting portion of the PTO,

[0081] The CTO comprises a reporter molecule and a quencher molecule linked thereto, defining a labeled portion; and

[0082] (iv) labeled portion hybridizing oligonucleotide (LPHO),

[0083] The above LPHO comprises a nucleotide sequence that hybridizes to the labeling portion of the CTO.

[0084] According to one embodiment of the present disclosure, the second target nucleic acid detection composition provides a signal by a method comprising the following steps:

[0085] (a”) A step of hybridizing the second target nucleic acid with the primer and the PTO,

[0086] The 5'-tagging portion of the PTO does not hybridize to the second target nucleic acid, the 3'-targeting portion of the PTO hybridizes to the second target nucleic acid, and the primer is located upstream of the PTO;

[0087] (b”) A step of contacting the resultant of step (a”) with a DNA polymerase having 5' nuclease activity under conditions for cleavage of the PTO,

[0088] The primer is extended by a DNA polymerase having the 5' nuclease activity to induce cleavage of the PTO, which cleavage releases a fragment comprising the 5'-tagging portion or a part of the 5'-tagging portion of the PTO;

[0089] (c”) A step of hybridizing the fragment released from the PTO and the CTO,

[0090] The above fragment hybridizes to the capturing portion of the CTO;

[0091] (d”) A step of performing an extension reaction using the resultant of step (c”) and a DNA polymerase having the 5' nuclease activity in the presence of the LPHO,

[0092] When the second target nucleic acid is present in the sample, the fragment hybridized to the capturing portion of the CTO is extended to generate an extended strand complementary to the templating portion of the CTO, thereby generating an extended duplex between the extended strand and the CTO, and the generation of the extended duplex prevents the formation of a CTO / LPHO hybrid between the CTO and the LPHO.

[0093] If the second target nucleic acid is not present in the sample, the extended strand is not generated, but instead a CTO / LPHO hybrid is formed between the CTO and the LPHO; and

[0094] (e”) A step of detecting the presence of the above extended duplex,

[0095] The presence of the above extended duplex indicates the presence of the second target nucleic acid.

[0096] According to one embodiment of the present disclosure, the presence of the extended duplex is detected by measuring (i) a signal provided from the extended duplex, (ii) a signal provided from the CTO / LPHO hybrid, or (iii) a signal provided from the extended duplex and the CTO / LPHO hybrid at the second detection temperature.

[0097] According to one embodiment of the present disclosure, when the CTO is present as a single strand, the reporter molecule and the quencher molecule of the CTO are structurally close to each other, thereby causing the quencher molecule to quench a signal from the reporter molecule.

[0098] According to one embodiment of the present disclosure, when the CTO hybridizes with the extended strand or the LPHO, the reporter molecule and the quencher molecule of the CTO are structurally separated, thereby causing the quencher molecule to unquench a signal from the reporter molecule.

[0099] According to one embodiment of the present disclosure, the formation of the extended duplex prevents the formation of the CTO / LPHO hybrid due to cleavage of the LPHO during the extension reaction of step (d”).

[0100] According to one embodiment of the present disclosure, the melting temperature (Tm) of the extended dimer is different from the Tm of the CTO / LPHO hybrid.

[0101]

[0102] The features and advantages of the present disclosure are summarized as follows:

[0103] (a) The method according to the present disclosure detects two target nucleic acids in real time by detecting signals at two detection temperatures, despite using a single fluorescent label in one reaction vessel. In particular, the method according to the present disclosure uses a detection temperature such that among the two detection temperatures, a first detection temperature provides both a signal for a first target nucleic acid and a signal for a second target nucleic acid, and a second detection temperature provides only a signal for the second target nucleic acid, but the intensity of the signal for the second target nucleic acid at the first detection temperature is 0.5 times or less than the intensity of the signal for the second target nucleic acid at the second detection temperature.

[0104] (b) In addition, in order to satisfy the condition of the above-described detection temperature, the method according to the present disclosure uses a composition for detecting a target nucleic acid having a temperature sub-region exhibiting a specific pattern within a signal-change temperature range. Specifically, when the second detection temperature is higher than the first detection temperature, the signal-change temperature range of the second target nucleic acid detection composition has a temperature sub-region exhibiting a pattern in which the signal change increases as the temperature increases, and when the second detection temperature is lower than the first detection temperature, the signal-change temperature range of the second target nucleic acid detection composition has a temperature sub-region exhibiting a pattern in which the signal change decreases as the temperature increases.

[0105] (c) In the method according to the present disclosure, the presence of the first target nucleic acid is determined by the difference between the signal measured at the first detection temperature and the signal measured at the second detection temperature. To this end, a step of extracting a signal for the first target nucleic acid from the signal measured at the first detection temperature can be performed, and if the proportion of the signal for the second target nucleic acid among the signals measured at the first detection temperature is high, when only the signal for the first target nucleic acid is extracted, the signal for the second target nucleic acid may have a large influence. On the other hand, if the proportion of the signal for the second target nucleic acid among the signals measured at the first detection temperature is low, the influence of the signal for the second target nucleic acid on the extraction of the signal for the first target nucleic acid can be reduced, which contributes to obtaining a more accurate extraction signal. Accordingly, the method according to the present disclosure significantly reduces the proportion of the second target nucleic acid among the signals measured at the first detection temperature by making the intensity of the signal for the second target nucleic acid at the first detection temperature 0.5 times or less than the intensity of the signal for the second target nucleic acid at the second detection temperature.

[0106] (d) The method according to the present disclosure can reduce the variability of the result value (e.g., Ct value) for determining the presence or absence of a target nucleic acid, and thus can detect the target nucleic acid with high accuracy and high reliability.

[0107]

[0108] Figure 1 is a graph showing the signal change temperature range (SchTR) of two target nucleic acid detection compositions used in the method of the present disclosure and the selectable region for two detection temperatures. Figure 1A shows a case where the first detection temperature is lower than the second detection temperature, and Figure 1B shows a case where the first detection temperature is higher than the second detection temperature.

[0109] FIGS. 2 and 3 illustrate post-amplification melt curves of various target nucleic acid detection compositions having temperature subregions exhibiting a pattern of increasing signal change as temperature increases within the signal-change temperature range.

[0110] Figures 2A and 2B show the melt curves after amplification of two types of InterSC compositions, each of which has a first signal-constant temperature range (1 st ScoTR), signal-change temperature range (SChTR), second signal-constant temperature range (2 nd ScoTR), and temperature sub-regions are indicated. In each figure, the solid line with triangles is the melt curve after amplification in the presence of the corresponding target nucleic acid, and the solid line without triangles is the melt curve after amplification in the absence of the corresponding target nucleic acid. As shown in Figures 2A and 2B, the InterSC composition has temperature sub-regions that exhibit a pattern of increasing signal change as the temperature increases within its signal-change temperature range.

[0111] Figures 3A and 3B show melt curves after amplification of two types of OverSC compositions, with ScoTR, SChTR, and temperature subregions indicated within each curve. In each figure, the solid line with triangles is the melt curve after amplification in the presence of the corresponding target nucleic acid, and the solid line without triangles is the melt curve after amplification in the absence of the corresponding target nucleic acid. As shown in Figures 3A and 3B, the OverSC compositions have temperature subregions that exhibit a pattern of increasing signal change with increasing temperature within their signal change temperature range.

[0112] FIGS. 4 and 5 illustrate post-amplification melt curves of various target nucleic acid detection compositions having temperature subregions exhibiting a pattern of decreasing signal change as temperature increases within the signal-change temperature range.

[0113] Figures 4A and 4B show melt curves after amplification of two types of UnderSC compositions, with SChTR, ScoTR, and temperature subregions indicated within each curve. In each figure, the solid line with triangles is the melt curve after amplification in the presence of the corresponding target nucleic acid, and the solid line without triangles is the melt curve after amplification in the absence of the corresponding target nucleic acid. As shown in Figures 4A and 4B, the UnderSC compositions have temperature subregions that exhibit a pattern of decreasing signal change with increasing temperature within their signal change temperature range.

[0114] Figures 5A and 5B show the melt curves after amplification of two types of InterSC compositions, with 1 in each curve. st SCoTR, SChTR, 2 nd ScoTR, and temperature subregions are indicated. In each figure, the solid line with triangles represents the melt curve after amplification in the presence of the corresponding target nucleic acid, and the solid line without triangles represents the melt curve after amplification in the absence of the corresponding target nucleic acid. As shown in Figures 5A and 5B, the InterSC composition has a temperature subregion that exhibits a pattern of decreasing signal change as the temperature increases within its signal change temperature range.

[0115] Figure 6 illustrates the melt curves after combined amplification of the first target nucleic acid detection composition and the second target nucleic acid detection composition according to combination 1 of Table 1. In the figure, the signal intensity for each target nucleic acid at the selected first and second detection temperatures is indicated by the dotted arrows (first target nucleic acid) and the solid arrows (second target nucleic acid).

[0116] Figure 7 illustrates the melt curves after combined amplification of the first target nucleic acid detection composition and the second target nucleic acid detection composition according to combination 2 of Table 1. In the figure, the signal intensity for each target nucleic acid at the selected first and second detection temperatures is indicated by the dotted arrows (first target nucleic acid) and the solid arrows (second target nucleic acid).

[0117] Figure 8 illustrates the melt curves after combined amplification of the first target nucleic acid detection composition and the second target nucleic acid detection composition according to combination 3 of Table 1. In the figure, the signal intensities for each target nucleic acid at the selected first and second detection temperatures are indicated by dotted arrows (first target nucleic acid) and solid arrows (second target nucleic acid).

[0118] Figure 9 illustrates the melt curves after combined amplification of the first target nucleic acid detection composition and the second target nucleic acid detection composition according to combination 4 of Table 1. In the figure, the signal intensity for each target nucleic acid at the selected first and second detection temperatures is indicated by the dotted arrows (first target nucleic acid) and the solid arrows (second target nucleic acid).

[0119] Figure 10 illustrates the melt curves after combined amplification of the first target nucleic acid detection composition and the second target nucleic acid detection composition according to combination 5 of Table 2. In the figure, the signal intensities for each target nucleic acid at the selected first and second detection temperatures are indicated by dotted arrows (first target nucleic acid) and solid arrows (second target nucleic acid).

[0120] Figure 11 illustrates the melt curves after combined amplification of the first target nucleic acid detection composition and the second target nucleic acid detection composition according to combination 6 of Table 2. In the figure, the signal intensity for each target nucleic acid at the selected first and second detection temperatures is indicated by the dotted arrows (first target nucleic acid) and the solid arrows (second target nucleic acid).

[0121] Figure 12 illustrates the melt curves after combined amplification of the first target nucleic acid detection composition and the second target nucleic acid detection composition according to combination 7 of Table 2. In the figure, the signal intensity for each target nucleic acid at the selected first and second detection temperatures is indicated by the dotted arrows (first target nucleic acid) and the solid arrows (second target nucleic acid).

[0122] Figure 13 illustrates the melt curves after combined amplification of the first target nucleic acid detection composition and the second target nucleic acid detection composition according to combination 8 of Table 2. In the figure, the signal intensity for each target nucleic acid at the selected first and second detection temperatures is indicated by the dotted arrows (first target nucleic acid) and the solid arrows (second target nucleic acid).

[0123] FIG. 14 shows a virtual signal that can be generated by the signal fluctuation rate for a sample in which the concentration of the first target nucleic acid is lower than that of the second target nucleic acid when the first detection temperature is lower than the second detection temperature in Example <1-1>.

[0124] FIG. 15 shows a virtual signal that can be generated by the signal fluctuation rate for a sample having the same concentration of the first target nucleic acid as the second target nucleic acid when the first detection temperature is lower than the second detection temperature in Example <1-1>.

[0125] FIG. 16 shows a virtual signal that can be generated by the signal fluctuation rate for a sample having a higher concentration of the first target nucleic acid than the second target nucleic acid when the first detection temperature is lower than the second detection temperature in Example <1-1>.

[0126] FIG. 17 shows the first virtual signal generated for a sample having a lower concentration of the first target nucleic acid than the second target nucleic acid when the first detection temperature is lower than the second detection temperature in Example <1-1>, i.e., the extracted signal for the first target nucleic acid extracted using mathematical formula IX from the first virtual signal of FIG. 14, and the analysis signal therefor.

[0127] FIG. 18 shows the first virtual signal generated for a sample in which the concentration of the first target nucleic acid is the same as that of the second target nucleic acid when the first detection temperature is lower than the second detection temperature in Example <1-1>, i.e., the extracted signal for the first target nucleic acid extracted using mathematical formula IX from the first virtual signal of FIG. 15, and the analysis signal therefor.

[0128] FIG. 19 shows the first virtual signal generated for a sample having a higher concentration of the first target nucleic acid than the second target nucleic acid when the first detection temperature is lower than the second detection temperature in Example <1-1>, i.e., the extracted signal for the first target nucleic acid extracted using mathematical formula IX from the first virtual signal of FIG. 16, and the analysis signal therefor.

[0129] FIG. 20 shows a virtual signal that can be generated by the signal fluctuation rate for a sample in which the concentration of the first target nucleic acid is lower than that of the second target nucleic acid when the first detection temperature is higher than the second detection temperature in Example <1-2>.

[0130] FIG. 21 shows a virtual signal that can be generated by the signal fluctuation rate for a sample having the same concentration of the first target nucleic acid as the second target nucleic acid when the first detection temperature is higher than the second detection temperature in Example <1-2>.

[0131] FIG. 22 shows a virtual signal that can be generated by the signal fluctuation rate for a sample having a higher concentration of the first target nucleic acid than the second target nucleic acid when the first detection temperature is higher than the second detection temperature in Example <1-2>.

[0132] FIG. 23 shows the first virtual signal generated for a sample having a lower concentration of the first target nucleic acid than the second target nucleic acid when the first detection temperature is higher than the second detection temperature in Example <1-2>, i.e., the extracted signal for the first target nucleic acid extracted using mathematical formula IX from the first virtual signal of FIG. 20, and the analysis signal therefor.

[0133] FIG. 24 shows the first virtual signal generated for a sample in which the concentration of the first target nucleic acid is the same as that of the second target nucleic acid when the first detection temperature is higher than the second detection temperature in Example <1-2>, i.e., the extracted signal for the first target nucleic acid extracted using mathematical formula IX from the first virtual signal of FIG. 21, and the analysis signal therefor.

[0134] FIG. 25 shows the first virtual signal generated for a sample having a higher concentration of the first target nucleic acid than the second target nucleic acid when the first detection temperature is higher than the second detection temperature in Example <1-2>, i.e., the extracted signal for the first target nucleic acid extracted using mathematical formula IX from the first virtual signal of FIG. 22, and the analysis signal therefor.

[0135] Figure 26 shows a real-time PCR graph in Example <3-1>.

[0136] Figure 27 shows the extraction signal for the first target nucleic acid extracted from the real-time PCR graph of Figure 26 and the analysis signal thereof.

[0137] Figure 28 shows a real-time PCR graph in Example <3-2>.

[0138] Figure 29 shows the extraction signal for the first target nucleic acid extracted from the real-time PCR graph of Figure 28 and the analysis signal thereof.

[0139] Figure 30 shows a real-time PCR graph in Example <3-3>.

[0140] Figure 31 shows the extraction signal for the first target nucleic acid extracted from the real-time PCR graph of Figure 30 and the analysis signal thereof.

[0141]

[0142] The present inventors sought to develop a novel method for detecting two target nucleic acids using a single type of label in a single reaction vessel. As a result, the inventors confirmed that by controlling the ratio of signal intensities provided by identical target nucleic acids at two detection temperatures, two target nucleic acids can be detected using a single type of label in a single reaction vessel with significantly improved precision and accuracy.

[0143]

[0144] In one aspect, the present disclosure provides a method for detecting two target nucleic acids in a sample using two detection temperatures, comprising the steps of:

[0145] (a) a step of incubating a sample suspected of containing at least one of a first target nucleic acid and a second target nucleic acid in one reaction vessel with (i) a composition for detecting a first target nucleic acid and (ii) a composition for detecting a second target nucleic acid, and measuring a signal at a first detection temperature and a second detection temperature;

[0146] The above incubation and signal measurement are performed by real-time nucleic acid amplification reaction,

[0147] The first target nucleic acid is amplified and detected by the first target nucleic acid detection composition, and the second target nucleic acid is amplified and detected by the second target nucleic acid detection composition.

[0148] The composition for detecting the first target nucleic acid reacts with the first target nucleic acid to provide a signal for the first target nucleic acid at a first detection temperature, and the composition for detecting the second target nucleic acid reacts with the second target nucleic acid to provide a signal for the second target nucleic acid at both the first detection temperature and the second detection temperature.

[0149] The first detection temperature is a temperature at which both a signal for the first target nucleic acid and a signal for the second target nucleic acid are detectable, and the second detection temperature is a temperature at which a signal for the second target nucleic acid is detectable, provided that the intensity of the signal for the second target nucleic acid at the first detection temperature is 0.5 times or less the intensity of the signal for the second target nucleic acid at the second detection temperature,

[0150] At the first detection temperature, the signal for the first target nucleic acid and the signal for the second target nucleic acid are not distinguished from each other by a single type detector,

[0151] (b) a step of determining the presence of the two target nucleic acids by the signals measured in the step (a),

[0152] (i) the presence of the second target nucleic acid is determined by a signal measured at the second detection temperature, and (ii) the presence of the first target nucleic acid is determined by a difference between a signal measured at the first detection temperature and a signal measured at the second detection temperature.

[0153]

[0154] In describing the components of the present disclosure, terms such as first, second, A, B, (a), (b), (i), (ii), etc. may be used. These terms are only intended to distinguish the components from other components, and the nature, order, or sequence of the components are not limited by the terms.

[0155]

[0156] Hereinafter, the present invention will be described in detail as follows:

[0157] Step (a): Incubation and signal measurement

[0158] First, in one reaction vessel, a sample suspected of containing at least one of a first target nucleic acid and a second target nucleic acid is reacted with a composition for detecting a first target nucleic acid and a composition for detecting a second target nucleic acid.

[0159] As used herein, the terms "target nucleic acid," "target nucleic acid sequence," or "target sequence" refer to a nucleic acid sequence to be detected or quantified. The target nucleic acid includes both double-stranded and single-stranded nucleic acids. The target nucleic acid includes sequences initially present in the nucleic acid sample as well as sequences newly generated during the reaction.

[0160] The target nucleic acid includes all DNA (gDNA and cDNA), RNA molecules, and hybrids thereof (chimeric nucleic acids). The target nucleic acid may be double-stranded or single-stranded.

[0161] The target nucleic acid includes any naturally occurring prokaryotic nucleic acid, eukaryotic nucleic acid (e.g., protozoa and parasites, fungi, yeast, higher plants, lower animals, and higher animals including mammals and humans), viral nucleic acid (e.g., herpes virus, HIV, influenza virus, Epstein-Barr virus, hepatitis virus, poliovirus, etc.), or viroid nucleic acid. Furthermore, the nucleic acid molecule may be any nucleic acid molecule produced or capable of being produced recombinantly, or any nucleic acid molecule synthesized or capable of being synthesized chemically. Accordingly, the nucleic acid sequence may or may not be found in nature. The target nucleic acid may be a known or unknown sequence.

[0162] In one embodiment, the two target nucleic acids may comprise nucleotide variations. For example, one of the two target nucleic acids may comprise one type of nucleotide variation, and the other may comprise a different type of nucleotide variation.

[0163] The term "nucleotide variation" as used herein may refer to a substitution, deletion, or insertion of a single or multiple nucleotides in a DNA sequence at a specific location within a contiguous DNA segment. These contiguous DNA segments may comprise a gene or some other portion of a chromosome. Such nucleotide variations may be mutations or polymorphic allelic variations. For example, nucleotide variations detected in the methods of the present disclosure include single nucleotide polymorphisms (SNPs), mutations, deletions, insertions, substitutions, and translocations. Examples of nucleotide variations include various variations within the human genome (e.g., variations in the methylenetetrahydrofolate reductase (MTHFR) gene), variations associated with drug resistance in pathogens, and tumorigenic variations. The term “nucleotide variation” as used herein includes all variations at a specific position of a nucleic acid sequence. That is, the term “nucleotide variation” includes the wild type and all mutant forms thereof at a specific position of a nucleic acid sequence.

[0164] The two target nucleic acids herein may be genes from two different organisms, two different genes from the same organism, or a combination thereof.

[0165] The term “sample” as used herein means a cell, tissue, or fluid from a biological source, or any other medium that can be beneficially evaluated according to the methods of the present disclosure, and includes viruses, bacteria, tissues, cells, blood, serum, plasma, lymph, milk, urine, feces, ocular fluid, saliva, semen, brain extracts, spinal fluid, appendix, spleen, and tonsil tissue extracts, amniotic fluid, ascites, and non-biological samples (e.g., food and water). The sample also includes natural-occurring nucleic acid molecules isolated from a biological source and synthetic nucleic acid molecules. The sample may also be a lysate, extract, or isolated target nucleic acid itself for a particular specimen.

[0166] The incubation and signal measurement of step (a) above are performed by a real-time nucleic acid amplification reaction. Specifically, the nucleic acid amplification reaction is a reaction for two target nucleic acids. More specifically, the nucleic acid amplification reaction is a reaction for simultaneous amplification of two target nucleic acids in a single reaction vessel.

[0167] In one embodiment, the real-time nucleic acid amplification reaction is real-time polymerase chain reaction (real-time PCR).

[0168] Polymerase chain reaction is widely used in the art to amplify target nucleic acids, and involves repeated cycles of denaturation of the target nucleic acid, annealing (hybridization) between the target nucleic acid and a primer, and primer extension (U.S. Patent Nos. 4,683,195, 4,683,202, and 4,800,159; Saiki et al., (1985) Science 230, 1350-1354).

[0169] If the target nucleic acid is double-stranded, it is desirable to convert the double-stranded nucleic acid into a single-stranded or partially single-stranded form. Methods for separating the double-stranded nucleic acid include, but are not limited to, heat, alkali, formamide, urea, and glycoxal treatment, enzymatic methods (e.g., helicase action), and binding proteins. For example, strand separation can be achieved by heating at a temperature ranging from 80°C to 105°C. A general method for achieving this treatment is provided by Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001).

[0170] Annealing of the primer and target nucleic acid can be performed under suitable hybridization conditions, which are generally determined by optimization procedures. Conditions such as temperature, concentration of components, number of hybridization and washing cycles, buffer components, and their pH and ionic strength can vary depending on various factors, including the length and GC content of the oligonucleotide (primer) and the target nucleic acid. Detailed hybridization conditions can be found in Joseph Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); and M. L. M. Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc., NY (1999).

[0171] The primer annealed to the target nucleic acid is extended by a template-dependent polymerase, which includes the “Klenow” fragment of E. coli DNA polymerase I, a thermostable DNA polymerase, and a bacteriophage T7 DNA polymerase. In one embodiment of the present disclosure, the template-dependent polymerase is a thermostable DNA polymerase obtained from various bacterial species.

[0172] When conducting a polymerization reaction, the components required for the reaction may be provided in excess in the reaction vessel. With respect to the components of the extension reaction, excess means an amount of each component such that the ability to achieve the desired extension is not substantially limited by the concentration of said components. In order for the desired reaction to occur, Mg 2+ It is desirable to provide sufficient amounts of necessary cofactors such as dATP, dCTP, dGTP and dTTP to the reaction mixture.

[0173] When using mRNA as a starting material, a reverse transcription step is essential prior to the annealing step, and details thereof are disclosed in the literature [Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); and Noonan, KF et al., Nucleic Acids Res. 16:10366 (1988)]. For the reverse transcription reaction, an oligonucleotide dT primer, a random primer, or a target-specific primer capable of hybridizing to the poly A tail of the mRNA can be used.

[0174] According to another embodiment, as a method for amplifying the target nucleic acid, ligase chain reaction (LCR, see Wiedmann M, et al., "Ligase chain reaction (LCR) - overview and applications." PCR Methods and Applications 1994 Feb;3(4):S51-64), gap filling LCR (GLCR, see WO 90 / 01069, European Patent No. 439182 and WO 93 / 00447), Q-beta replicase amplification (Q-beta, see Cahill P, et al., Clin Chem., 37(9):1482-5(1991), US Patent No. 5556751), strand displacement amplification (SDA, see GT Walker et al., Nucleic Acids Res. 20(7):16911696(1992), European Patent No. The amplification method may be, but is not limited to, amplification based on nucleic acid sequence (NASBA; see Compton, J. Nature 350(6313):912(1991)), transcription-mediated amplification (TMA; see Hofmann WP et al., J Clin Virol. 32(4):289-93(2005); U.S. Pat. No. 5888779), rolling circle amplification (RCA; see Hutchison CA et al., Proc. Natl Acad. Sci. USA. 102:1733217336(2005)), recombinase polymerase amplification (RPA), or loop-mediated isothermal amplification (LAMP).

[0175] The amplification method described above can amplify target nucleic acids through repetition of a series of reactions with or without temperature changes. The unit of amplification, which includes repetition of the series of reactions, is expressed as a "cycle." Depending on the amplification method, the unit of the cycle can be expressed as the number of repetitions or time.

[0176] In one embodiment, the signal measurement can be performed at each cycle of amplification, at a selected portion of the cycle, or at the end-point of the reaction. In one embodiment, when the signal is measured at at least two cycles, the signal measurement at each cycle can be performed at all detection temperatures or at a selected portion of the detection temperatures.

[0177] In one embodiment, the number of cycles is 2 to 100 cycles, 2 to 90 cycles, 2 to 80 cycles, 2 to 70 cycles, 2 to 60 cycles, 2 to 50 cycles, 2 to 40 cycles, 2 to 30 cycles, 2 to 20 cycles, 2 to 10 cycles, 5 to 100 cycles, 5 to 90 cycles, 5 to 80 cycles, 5 to 70 cycles, 5 to 60 cycles, 5 to 50 cycles, 5 to 40 cycles, 5 to 30 cycles, 5 to 20 cycles, 5 to 10 cycles, 10 to 100 cycles, 10 to 90 cycles, 10 to 80 cycles, 10 to 70 cycles, 10 to 60 cycles, 10 to 50 cycles, 10 to 40 cycles, 10 to 30 The cycles may be 10 to 20 cycles, 20 to 100 cycles, 20 to 90 cycles, 20 to 80 cycles, 20 to 70 cycles, 20 to 60 cycles, 20 to 50 cycles, 20 to 40 cycles or 20 to 30 cycles, and specifically, may be 10 cycles, 15 cycles, 20 cycles, 25 cycles, 30 cycles, 35 cycles, 40 cycles, 45 cycles or 50 cycles.

[0178] The term “composition for detecting a target nucleic acid” as used herein means a composition containing components used to amplify and / or detect a target nucleic acid, and is used interchangeably with “composition for a target nucleic acid” or simply “composition”.

[0179] In the present invention, a composition for detecting a target nucleic acid is specific for a corresponding target nucleic acid. The phrase "a composition for detecting a target nucleic acid is specific for a corresponding target nucleic acid" means that the composition for detecting a target nucleic acid is involved in the detection of the corresponding target nucleic acid but is not involved in the detection of other target nucleic acids. In other words, the phrase means that the composition for detecting a target nucleic acid interacts with the corresponding target nucleic acid but does not interact with other target nucleic acids.

[0180] In the present invention, the first target nucleic acid detection composition is specific for the first target nucleic acid, and the second target nucleic acid detection composition is specific for the second target nucleic acid.

[0181] The first and second target nucleic acid detection compositions used herein are used together in one reaction, i.e., the first and second target nucleic acid detection compositions exist together in one reaction solution or reaction vessel.

[0182] According to the method of the present disclosure, the first and second target nucleic acid detection compositions each include a label that provides a signal dependent on the presence of the first target nucleic acid and the second target nucleic acid, and the signals provided from each of the first and second target nucleic acid detection compositions are not distinguished from each other by a single detection channel.

[0183] In one embodiment, the first and second target nucleic acid detection compositions may include various oligonucleotides involved in the amplification and detection of the corresponding target nucleic acid. For example, each of the target nucleic acid detection compositions may include a primer that serves to amplify the target nucleic acid and a probe that serves to provide a signal dependent on the presence of the target nucleic acid.

[0184] The term "primer" as used herein refers to an oligonucleotide that can act as an initiator of synthesis under conditions that induce the synthesis of a primer extension product complementary to a target nucleic acid sequence (template), i.e., the presence of nucleotides and a polymerization agent such as DNA polymerase, and at suitable temperature and pH. The primer must be sufficiently long to prime the synthesis of the extension product in the presence of the polymerization agent. The appropriate length of the primer depends on several factors, such as temperature, application, and the source of the primer.

[0185] As used herein, the term “probe” refers to a single-stranded nucleic acid molecule comprising a portion or portions substantially complementary to a target nucleic acid sequence or a nucleic acid sequence derived therefrom. In one embodiment, the 3'-end of the probe is “blocked” to prevent its extension. Blocking can be accomplished using conventional methods. For example, blocking can be accomplished by adding a chemical moiety, such as biotin, a label, a phosphate group, an alkyl group, a non-nucleotide linker, a phosphorothioate, or an alkane-diol moiety, to the 3'-hydroxyl group of the last nucleotide. Alternatively, blocking can be accomplished by removing the 3'-hydroxyl group of the last nucleotide or by using a nucleotide lacking a 3'-hydroxyl group, such as a dideoxynucleotide.

[0186] “Complementary” means sufficiently complementary to allow a primer or probe to selectively hybridize to a target nucleic acid under given annealing or hybridization conditions, and includes both “substantially complementary” and “perfectly complementary,” preferably perfectly complementary.

[0187] The term "substantially complementary" means that the oligonucleotide is sufficiently complementary that it can selectively hybridize to a template nucleic acid under designated annealing or hybridization conditions, such that the annealed oligonucleotide can be extended by a polymerase to form a complementary copy of the template. Therefore, this term has a different meaning from "fully complementary" or related terms.

[0188] The term “non-complementary” as used herein means sufficiently non-complementary that the primer or probe does not selectively hybridize to the target nucleic acid under specified annealing or hybridization conditions, and is intended to encompass both “substantially non-complementary” and “perfectly noncomplementary,” preferably perfectly non-complementary.

[0189] The primer or probe may be single-stranded. The primer or probe comprises deoxyribonucleotides, ribonucleotides, or a combination thereof. The primer or probe used in the present disclosure may comprise naturally occurring dNMPs (i.e., dAMP, dGMP, dCMP, and dTMP), modified nucleotides, or non-natural nucleotides.

[0190] The term “annealing” or “priming” refers to the apposition of an oligonucleotide or nucleic acid to a template nucleic acid, which causes a polymerase to polymerize the nucleotides to form a nucleic acid molecule complementary to the template nucleic acid or a portion thereof.

[0191] The term "hybridization" as used herein refers to the formation of a double-stranded polynucleotide by non-covalent bonding between complementary nucleotide sequences of two single-stranded polynucleotides under certain hybridization conditions.

[0192] The terms “annealing” and “hybridization” are not different and will be used interchangeably throughout this specification.

[0193] In one embodiment, when an oligonucleotide (e.g., a probe or primer) hybridized to the target nucleic acid is cleaved to release a fragment, the composition for detecting the target nucleic acid may additionally include a capture oligonucleotide that specifically hybridizes to the fragment; or when the fragment hybridized to the capture oligonucleotide is extended to generate an extended strand, the composition for detecting the target nucleic acid may additionally include an oligonucleotide that specifically hybridizes to the extended strand; or the composition for detecting the target nucleic acid may additionally include an oligonucleotide that specifically hybridizes to the capture oligonucleotide; or the composition for detecting the target nucleic acid may include a combination thereof.

[0194] As mentioned above, when cleavage of oligonucleotides is required, enzymes including 5' nucleases and 3' nucleases, particularly nucleic acid polymerases having 5' nuclease activity, nucleic acid polymerases having 3' nuclease activity or FEN nucleases can be used.

[0195] In the present disclosure, a suitable DNA polymerase having 5' nuclease activity is a thermostable DNA polymerase obtained from various bacterial species, which are Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, Thermus antranikianii, Thermus caldophilus, Thermus chliarophilus, Thermus flavus, Thermus igniterrae, Thermus lacteus, Thermus oshimai, Thermus ruber, Thermus rubens, Thermus scotoductus, Thermus silvanus, Thermus species Z05, Thermus species sps 17, Thermus thermophilus, Thermotoga maritima, Thermotoga neapolitana, Thermosipho africanus, Thermococcus litoralis, Thermococcus barossi, Thermococcus gorgonarius, Thermotoga maritima, Thermotoga neapolitana, Thermosiphoafricanus, Pyrococcus woesei, Pyrococcus horikoshii, Pyrococcus abyssi, Pyrodictium occultum, Aquifex pyrophilus, and Aquifex aeolieus. Specifically, the thermostable DNA polymerase is Taq polymerase.

[0196] Alternatively, the present disclosure may utilize a DNA polymerase having 5' nuclease activity that is modified to have less polymerase activity.

[0197] The FEN (flap endonuclease) nuclease used is a 5'flap-specific nuclease.

[0198] FEN nucleases suitable for the present disclosure include FEN nucleases obtained from various bacterial species, including Sulfolobus solfataricus, Pyrobaculum aerophilum, Thermococcus litoralis, Archaeaglobus veneficus, Archaeaglobus profundus, Acidianus brierlyi, Acidianus ambivalens, Desulfurococcus amylolyticus, Desulfurococcus mobilis, Pyrodictium brockii, Thermococcus gorgonarius, Thermococcus zilligii, Methanopyrus kandleri, Methanococcus igneus, Pyrococcus horikoshii, Aeropyrum pernix, and Archaeaglobus veneficus.

[0199] The label herein may be linked to the oligonucleotide or may be present in a free form, or may be incorporated into the oligonucleotide during the incubation.

[0200] Useful labels in the present disclosure may include various labels known in the art, including, but not limited to, single labels, interactive dual labels, and incorporating labels.

[0201] The single label includes, for example, a fluorescent label, a luminescent label, a chemiluminescent label, an electrochemical label, and a metal label. In one embodiment, the single label provides different signals (e.g., different signal intensities) depending on whether it is present in the double-strand or single-strand. In one embodiment, the single label is a fluorescent label. Preferred types and binding sites of the single fluorescent labels used in the present disclosure are disclosed in U.S. Patent Nos. 7,537,886 and 7,348,141, the teachings of which are incorporated herein by reference in their entirety. For example, the single fluorescent labels include JOE, FAM, TAMRA, ROX, and fluorescein-based labels. The single label can be linked to the oligonucleotide by various methods. For example, the label is linked to the probe via a spacer comprising a carbon atom (e.g., a 3-carbon spacer, a 6-carbon spacer, or a 12-carbon spacer).

[0202] As a representative example of the above interactive labeling system, the FRET (fluorescence resonance energy transfer) labeling system includes a fluorescent reporter molecule (donor molecule) and a quencher molecule (acceptor molecule). In FRET, the energy donor is fluorescent, but the energy acceptor can be fluorescent or non-fluorescent. In another type of interactive labeling system, the energy donor is non-fluorescent, such as a chromophore, and the energy acceptor is fluorescent. In yet another type of interactive labeling system, the energy donor is luminescent, such as bioluminescent, chemiluminescent, or electrochemiluminescent, and the acceptor is fluorescent. The interactive labeling system may include a dual label based on “contact-mediated quenching” (Salvatore et al., Nucleic Acids Research, 2002 (30) no. 21 e122 and Johansson et al., J. AM. CHEM. SOC 2002 (124) pp 6950-6956). The interactive labeling system may include any labeling system that induces a signal change by interaction between at least two molecules (e.g., dyes).

[0203] Reporter molecules and quencher molecules useful in the present disclosure may include any molecules known in the art. Examples include: Cy2™ (506), YO-PRO™-1 (509), YOYO™-1 (509), Calcein (517), FITC (518), FluorX™ (519), Alexa™ (520), Rhodamine 110 (520), Oregon Green™ 500 (522), Oregon Green™ 488 (524), RiboGreen™ (525), Rhodamine Green™ (527), Rhodamine 123 (529), Magnesium Green™ (531), Calcium Green™ (533), TO-PRO™-1 (533), TOTO1 (533), JOE (548), BODIPY530 / 550 (550), Dil (565), BODIPY TMR (568), BODIPY558 / 568 (568), BODIPY564 / 570 (570), Cy3™ (570), Alexa™ 546 (570), TRITC (572), Magnesium Orange™ (575), Phycoerythrin R&B (575), Rhodamine Phalloidin (575), Calcium Orange™ (576), Pyronin Y (580), Rhodamine B (580), TAMRA (582), Rhodamine Red™ (590), Cy3.5™ (596), ROX (608), Calcium Crimson™ (615), Alexa™ 594 (615), Texas Red (615), Nile Red (628), YO-PRO™-3 (631), YOYO™-3 (631), Rphycocyanin (642), C-Phycocyanin (648), TO-PRO™-3 (660), TOTO3 (660), DiD DilC(5) (665), Cy5™ (670), Thiadicarbocyanine (671), Cy5.5 (694), HEX (556), TET (536), Biosearch Blue (447), CAL Fluor Gold 540 (544), CAL Fluor Orange 560 (559), CAL Fluor Red 590 (591), CAL Fluor Red 610 (610), CAL Fluor Red 635 (637), FAM (520), Fluorescein (520), Fluorescein-C3 (520), Pulsar 650 (566), Quasar 570 (667), Quasar 670 (705), and Quasar 705 (610). The numbers in parentheses are the maximum emission wavelengths in nanometers. Preferably, the reporter molecule and quencher molecule may include JOE, FAM, TAMRA, ROX, and fluorescein-based labels.

[0204] Suitable fluorescent molecules and suitable reporter-quencher pairs are described in various references, including: Pesce et al., editors, Fluorescence Spectroscopy (Marcel Dekker, New York, 1971); White et al., Fluorescence Analysis: A Practical Approach (Marcel Dekker, New York, 1970); Berlman, Handbook of Fluorescence Spectra of Aromatic Molecules, 2nd Edition (Academic Press, New York, 1971); Griffiths, Color AND Constitution of Organic Molecules (Academic Press, New York, 1976); Bishop, editor, Indicators (Pergamon Press, Oxford, 1972); Haugland, Handbook of Fluorescent Probes and Research Chemicals (Molecular Probes, Eugene, 1992); Pringsheim, Fluorescence and Phosphorescence (Interscience Publishers, New York, 1949); Haugland, RP, Handbook of Fluorescent Probes and Research Chemicals, 6th Edition (Molecular Probes, Eugene, Oreg., 1996); U.S. Patent Nos. 3,996,345 and 4,351,760.

[0205] In the present disclosure, non-fluorescent quencher molecules (e.g., black quenchers or dark quenchers) capable of quenching fluorescence of a broad range of wavelengths or of a specific wavelength can be utilized.

[0206] In a labeling system comprising a reporter molecule and a quencher molecule, the reporter comprises the donor of FRET and the quencher comprises the other partner (acceptor) of FRET. For example, a fluorescein dye may be used as the reporter and a rhodamine dye may be used as the quencher.

[0207] Insertion labels can be used in processes that provide signals by inserting labels during primer extension (e.g., Plexor method, Sherrill CB, et al., Journal of the American Chemical Society, 126:4550-45569 (2004)).

[0208] The above insertion marker can generally be linked to a nucleotide. Additionally, nucleotides having non-natural bases may also be used.

[0209] As used herein, the term “non-natural base” refers to derivatives of natural bases such as adenine (A), guanine (G), thymine (T), cytosine (C), and uracil (U), which can form hydrogen-bonded base pairs. The term “non-natural base” as used herein includes bases that have base pairing patterns that are different from those of natural bases as their mother compounds, and are described, for example, in U.S. Patent Nos. 5,432,272, 5,965,364, 6,001,983, and 6,037,120. Base pairing between non-natural bases involves two or three hydrogen bonds, like natural bases. Base pairing between non-natural bases also occurs in specific ways. Specific examples of unnatural bases include the following base pairing combinations: iso-C / iso-G, iso-dC / iso-dG, K / X, H / J, and M / N (see U.S. Patent No. 7,422,850).

[0210] It should be noted that the above-mentioned labels and oligonucleotides are only mentioned as core elements in the composition for detecting the first and second target nucleic acids, and that various components may be additionally included in addition to the oligonucleotides.

[0211] Examples of components included in the composition for detecting the target nucleic acid include, but are not limited to, an oligonucleotide set used to amplify or detect the target nucleic acid, a label, a nucleic acid polymerase, a buffer, a polymerase cofactor, and deoxyribonucleotide-5-triphosphate. Optionally, the composition for detecting the target nucleic acid may include various polynucleotide molecules, a reverse transcriptase, various buffers and reagents, and an antibody that inhibits nucleic acid polymerase activity. The composition for detecting the target nucleic acid may also include an oligonucleotide set or reagent necessary for performing a positive control reaction. The optimal amount of a reagent to be used in a particular reaction can be readily determined by one of ordinary skill in the art having the benefit of the present disclosure. The components of the composition for detecting the target nucleic acid may be present or stored in one or more containers prior to the reaction.

[0212] In the present disclosure, the first target nucleic acid is amplified and detected by the first target nucleic acid detection composition, and the second target nucleic acid is amplified and detected by the second target nucleic acid detection composition. Specifically, the first target nucleic acid detection composition reacts with the first target nucleic acid to provide a signal for the first target nucleic acid at a first detection temperature, and the second target nucleic acid detection composition reacts with the second target nucleic acid to provide a signal for the second target nucleic acid at both the first detection temperature and the second detection temperature. In particular, the first detection temperature is a temperature at which both a signal for the first target nucleic acid and a signal for the second target nucleic acid are detectable, and the second detection temperature is a temperature at which only a signal for the second target nucleic acid is detectable. That is, when a first target nucleic acid and a second target nucleic acid are present, the composition for detecting the first target nucleic acid reacts with the first target nucleic acid to provide a signal for the first target nucleic acid at the first detection temperature, and the composition for detecting the second target nucleic acid reacts with the second target nucleic acid to provide a signal for the second target nucleic acid at both the first detection temperature and the second detection temperature. However, the intensity of the signal for the second target nucleic acid at the first detection temperature is 0.5 times or less than the intensity of the signal for the second target nucleic acid at the second detection temperature.

[0213] In one embodiment, the provision of the signal includes “signal generation or extinction” and “signal increase or decrease.” As used herein, the provision of the signal means provision of a significant signal, i.e., a signal indicating the presence of a target nucleic acid. For example, a significant signal, i.e., a signal indicating the presence of a target nucleic acid, means a signal having an intensity that exceeds the intensity of a background signal or a signal that can be provided in the absence of the target nucleic acid, or a significant signal, i.e., a signal indicating the presence of a target nucleic acid, means a signal having an intensity after subtracting the intensity of a background signal or a signal that can be provided in the absence of the target nucleic acid from the intensity of the provided signal.

[0214] The provision of a signal in this invention is interpreted as the provision of a change in signal, and the provision of said change in signal means providing a change in signal in the presence of a target compared to the signal in the absence of a target.

[0215]

[0216] According to the present disclosure, each of the first and second target nucleic acid detection compositions can adopt various signal generation methods known in the art.

[0217] In one embodiment, at least one of the first and second target nucleic acid detection compositions provides a signal in a manner dependent on the formation of a dimer or dissociation of the dimer.

[0218] The term "providing a signal in a manner dependent on the formation or dissociation of a dimer" as used herein means that the signal to be detected is provided in a manner dependent on the association or dissociation of two nucleic acid molecules. This expression includes the provision of a signal by a dimer formed in a manner dependent on the presence of a target nucleic acid (e.g., a dimer between a labeled detector oligonucleotide and a target nucleic acid). This expression also includes the provision of a signal by inhibition of dimer hybridization, and may include the provision of a signal by dissociation of a dimer released by cleavage in a manner dependent on the presence of a target nucleic acid.

[0219] The terms “association” or “dissociation” have the same meaning as the terms “hybridization” or “denaturation.”

[0220] In one embodiment, the duplex comprises a double-stranded target nucleic acid.

[0221] In one embodiment, the composition for detecting a target nucleic acid does not provide a signal solely through oligonucleotide cleavage in a manner independent of duplex formation or dimer dissociation. For example, if a fragment cleaved from the oligonucleotide does not participate in a duplex formation reaction or dimer dissociation reaction for signal provision, oligonucleotide cleavage alone does not provide a signal.

[0222] As used herein, the term "detection oligonucleotide" refers to an oligonucleotide that contributes to the provision of a signal to be detected. In one embodiment, the detection oligonucleotide comprises an oligonucleotide that contributes to the actual provision of a signal. For example, the hybridization or non-hybridization of the detection oligonucleotide with another oligonucleotide (e.g., an oligonucleotide comprising a nucleotide sequence complementary to a target nucleic acid or the detection oligonucleotide) determines the provision of a signal.

[0223] In one embodiment, the detection oligonucleotide comprises at least one label.

[0224] The signal resulting from the formation of a dimer between the target nucleic acid and the detection oligonucleotide can be detected by the Scorpion method (Whitcombe et al., Nature Biotechnology 17:804-807 (1999)), the Sunrise (or Amplifluor) method (Nazarenko et al., Nucleic Acids Research, 25(12):2516-2521 (1997), and U.S. Patent No. 6,117,635), the Lux method (U.S. Patent No. 7,537,886), the Plexor method (Sherrill CB, et al., Journal of the American Chemical Society, 126:4550-4556 (2004)), the molecular beacon method (Tyagi et al., Nature Biotechnology v.14 MARCH 1996), the Hybeacon method (French DJ et al., Mol. Cell Probes, 15(6):363-374 (2001)), and the adjacent hybridization probe. It can be provided by various methods including the method (Bernard PS et al., Anal. Biochem., 273:221 (1999)) and the LNA method (U.S. Patent No. 6,977,295).

[0225] In certain embodiments, at least one of the first and second target nucleic acid detection compositions provides a signal by utilizing duplex formation in a manner dependent on cleavage of a mediation oligonucleotide that specifically hybridizes to its corresponding target nucleic acid.

[0226] As used herein, the term “mediating oligonucleotide” is an oligonucleotide that mediates the formation of a duplex that does not include a target nucleic acid.

[0227] In one embodiment, cleavage of the intermediate oligonucleotide itself does not provide a signal, but rather, after hybridization and cleavage of the intermediate oligonucleotide, the fragment formed by the cleavage participates in a continuous reaction for signal provision.

[0228] In one embodiment, hybridization or cleavage of the intermediate oligonucleotide itself does not provide a signal.

[0229] In one embodiment, the mediating oligonucleotide comprises an oligonucleotide that mediates duplex formation by hybridizing to a target nucleic acid and cleaving the target nucleic acid to release a fragment. In particular, the fragment mediates duplex formation by extension of the fragment onto a capture oligonucleotide.

[0230] In one embodiment, the intermediate oligonucleotide comprises (i) a targeting moiety comprising a hybridizing nucleotide sequence complementary to the target nucleic acid and (ii) a tagging moiety comprising a nucleotide sequence non-complementary to the target nucleic acid.

[0231] In one embodiment, cleavage of the intermediate oligonucleotide releases a fragment that specifically hybridizes to and extends onto the capture oligonucleotide.

[0232] In one embodiment, a mediating oligonucleotide hybridized to a target nucleic acid is cleaved to release a fragment, which specifically hybridizes to a capture oligonucleotide, which extends to produce an extended strand, which results in the formation of an extended duplex between the extended strand and the capture oligonucleotide, thereby providing a signal indicating the presence of the target nucleic acid.

[0233] In one embodiment, when a third oligonucleotide comprising a hybridizing nucleotide sequence complementary to the extended strand is used, hybridization of the third oligonucleotide and the extended strand forms a different type of duplex, thereby providing a signal indicating the presence of the target nucleic acid.

[0234] In one embodiment, when a third oligonucleotide comprising a hybridization nucleotide sequence complementary to the capture oligonucleotide is used, duplex formation between the third oligonucleotide and the capture oligonucleotide is inhibited by duplex formation between the extended strand and the capture oligonucleotide, thereby providing a signal indicating the presence of the target nucleic acid.

[0235] In one embodiment, the fragment, the extended strand, the capture oligonucleotide, the third oligonucleotide, or a combination thereof can act as a detection oligonucleotide.

[0236] The signal by the dimer formed in a manner dependent on the cleavage of the above-mentioned intermediate oligonucleotide can be provided by various methods known in the art, including PTOCE-based methods such as the PTO cleavage and extension (PTOCE) method (WO 2012 / 096523), the PTO Cleavage and Extension-Dependent Signaling Oligonucleotide Hybridization (PCE-SH) method (WO 2013 / 115442), the PTO Cleavage and Extension-Dependent Non-Hybridization (PCE-NH) method (WO 2014 / 104818), and the PTOCE-LPHO (WO 2024 / 181774).

[0237] In connection with the terms disclosed in the above-mentioned references, corresponding examples of oligonucleotides are as follows: the intermediate oligonucleotide corresponds to a Probing and Tagging Oligonucleotide (PTO), the capture oligonucleotide corresponds to a Capturing and Templating Oligonucleotide (CTO), and the third oligonucleotide corresponds to a Signaling Oligonucleotide (SO), a Hybridization Oligonucleotide (HO), or a Labeled Portion Hybridizing Oligonucleotide (LPHO), respectively. The SO, the HO, the CTO, the extended strand, or a combination thereof can serve as the detection oligonucleotide.

[0238] PTOCE-based methods generally involve the generation of extended strands that are dependent on the presence of a target nucleic acid. The term "PTOCE-based method" is used herein to encompass a variety of methods for providing a signal, including the generation of extended strands through the cleavage and extension of PTO.

[0239] An example of signal provisioning using a PTOCE-based method includes the following steps:

[0240] (a) hybridizing a target nucleic acid with an upstream oligonucleotide and a PTO; (b) contacting the resultant of step (a) with an enzyme having 5' nuclease activity under conditions for cleavage of the PTO; wherein the upstream oligonucleotide or an extended strand thereof induces cleavage of the PTO by the enzyme having 5' nuclease activity, wherein the cleavage releases a fragment comprising a 5'-tagging portion of the PTO or a part of the 5'-tagging portion; (c) hybridizing the fragment released from the PTO with a CTO; wherein the fragment released from the PTO hybridizes to a capturing portion of the CTO; (d) performing an extension reaction using the resultant of step (c) and a template-dependent nucleic acid polymerase; The fragment hybridized to the capturing portion of the CTO is extended to generate an extended strand, and (e) a step of detecting the generation of the extended strand by detecting a signal provided dependently on the presence of the extended strand.

[0241] In step (a), a primer set for amplifying the target nucleic acid may be used instead of the upstream oligonucleotide. In such a case, the method further comprises repeating all or part of steps (a)-(e), including denaturation between repeating cycles. In the phrase “denaturation between repeating cycles,” the term “denaturation” refers to separating a double-stranded nucleic acid molecule into a single-stranded nucleic acid molecule.

[0242] In one embodiment, the signal provided by dimer formation includes a signal induced by hybridization of the dimer (e.g., hybridization of the dimer itself, or hybridization of a third oligonucleotide) or a signal induced by inhibition of hybridization of the third oligonucleotide due to dimer formation.

[0243]

[0244] It is noted that the composition for detecting a target nucleic acid according to the present disclosure does not provide a signal at all temperatures in the presence of the target nucleic acid.

[0245] Each of the first and second target nucleic acid detection compositions used herein has a temperature range in which a signal changes depending on the presence of the target nucleic acid in a reaction with the target nucleic acid (e.g., an amplification reaction), i.e., a signal-changing temperature range (SChTR), and a temperature range in which a signal does not change even when the target nucleic acid is present, i.e., a signal-constant temperature range (SCoTR).

[0246] The signal-change temperature range and signal-constant temperature range exhibited by each of the above target nucleic acid compositions can be confirmed by melting analysis, i.e., post-amplification melt curve analysis, after amplifying each target nucleic acid detection composition with the corresponding target nucleic acid. Specifically, the signal-change temperature range and the signal-constant temperature range can be confirmed by comparing the post-amplification melt curve using the target nucleic acid detection composition in the presence of the target nucleic acid with the post-amplification melt curve using the target nucleic acid detection composition in the absence of the target nucleic acid.

[0247] Referring to Figure 2A, the first signal-constant temperature range (1 stSCoTR) and second signal-constant temperature range (2 nd In the ScoTR, the intensity of the signal in the melt curve after amplification in the presence of the target nucleic acid is substantially the same as the intensity of the signal in the melt curve after amplification in the absence of the target nucleic acid, but in the signal-change temperature range (SChTR), the intensity of the signal in the melt curve after amplification in the presence of the target nucleic acid (solid line with triangles) is substantially greater than the intensity of the signal in the melt curve after amplification in the absence of the target nucleic acid (solid line without triangles).

[0248] International Patent Application Publication No. WO2022-265463 discloses that various signal generation methods for detecting a target nucleic acid have a temperature range in which the signal changes depending on the presence of the target nucleic acid (i.e., a signal-change temperature range) and a temperature range in which the signal does not change even when the target nucleic acid is present (i.e., a signal-constant temperature range). The document discloses that various signal methods can be classified, depending on the number and order of the signal-change temperature ranges and signal-constant temperature ranges, into (i) an UnderSC (Signal Change) signal generation method having a characteristic that the signal-change temperature range is lower than the signal-constant temperature range, (ii) an OverSC signal generation method having a characteristic that the signal-change temperature range is higher than the signal-constant temperature range, and (iii) an InterSC signal generation method having a characteristic that the signal-change temperature range is higher than one of two signal-constant temperature ranges and lower than the other signal-constant temperature range. Based on this, the above literature proposed a novel method for detecting multiple target nucleic acids using a single type of label and a single type of detector in a single reaction vessel by various combinations of the three types of signal generation methods.

[0249] The target nucleic acid detection method proposed in the above international application publication WO2022-265463 uses n different compositions corresponding to each target nucleic acid to detect n different target nucleic acids using one label in one reaction vessel, and each of the n different compositions provides a signal by one of the signal generation methods among the above-described UnderSC, OverSC, and InterSC signal generation methods, and by controlling the signal-change temperature ranges thereof (e.g., controlling them so as not to overlap each other), the n target nucleic acids are detected by measuring the change in the signal at n temperatures (i.e., detection temperatures). Among the n compositions, the i-th composition for detecting the i-th target nucleic acid provides a change in the signal at the i-th detection temperature among the n detection temperatures in the presence of the i-th target nucleic acid, and provides a constant signal at other detection temperatures. The i represents an integer from 1 to n, and the i-th detection temperature is lower than the i+1-th detection temperature. The presence of the i-th target nucleic acid can be determined by a change in the signal detected at the i-th detection temperature (i.e., the i-th signal). In one embodiment, when i is n, the i+1 detection temperature (i.e., the n+1 detection temperature) does not exist.

[0250] The composition according to the present disclosure can be applied as any one of the three compositions described in WO2022-265463. That is, each of the first and second target nucleic acid detection compositions herein is any one of (i) an Under-Signal-Change (UnderSC) composition having a characteristic that the signal-change temperature range is lower than the signal-constant temperature range, (ii) an Inter-Signal Change (InterSC) composition having a characteristic that the signal-change temperature range is higher than one of the two signal-constant temperature ranges and lower than the other signal-constant temperature range, and (iii) an Over-Signal Change (OverSC) composition having a characteristic that the signal-change temperature range is higher than the signal-constant temperature range. For a specific description of the UnderSC composition, the InterSC composition, and the OverSC composition, please refer to the International Application Publication No. WO2022-265463, which is incorporated herein by reference in its entirety.

[0251] As used herein, the term “signal-constant temperature range” refers to a temperature range over which a composition for detecting a target nucleic acid provides a constant signal despite the presence of the target nucleic acid. The signal-constant temperature range is a temperature range over which the composition provides a constant signal over the course of a reaction time, which may also be referred to herein as a temperature range over which the composition does not provide a significant signal, or a temperature range over which the composition does not provide a signal indicating the presence of the target nucleic acid.

[0252] As used herein, the term “constant signal” means that the signal does not substantially change during a reaction between a target nucleic acid and a composition (e.g., a target nucleic acid amplification reaction). That is, the term means all or any signal pattern other than a significant signal change resulting from amplification of the target nucleic acid present. In particular, the constant signal means no signal change. For example, a “signal is constant” may be expressed when the signal during the amplification reaction does not exceed the intensity of the background signal or the intensity of the signal that would be provided in the absence of the target nucleic acid. The constant signal may be used interchangeably herein with an unchanging signal or a signal that does not exhibit change.

[0253] As used herein, the term "signal-change temperature range" refers to a temperature range over which a composition provides a signal that changes dependently on the presence of a target nucleic acid. The signal-change temperature range is a temperature range over which a composition provides a signal that changes over time, and may also be referred to herein as a temperature range over which a composition provides a significant signal, or a temperature range over which a signal indicating the presence of a target nucleic acid is provided.

[0254] As used herein, “signal change” means a significant signal change, i.e., a change in the signal that is a significant change indicating the presence of a target nucleic acid. For example, a significant signal change, i.e., a signal change indicating the presence of a target nucleic acid, means the appearance or disappearance of a signal having a distinct intensity compared to the intensity of a background signal or the intensity of a signal in the absence of the target nucleic acid, or means a substantial increase or substantial decrease in the intensity of a signal indicating the presence of a target nucleic acid as the target nucleic acid and / or the signal is amplified during the incubation reaction of step (a).

[0255] In the present invention, “change in signal” and / or “constant signal” are based on signals detected at the same temperature while performing a nucleic acid amplification reaction using the same composition. For example, “change in signal” and / or “constant signal” are referred to based on the difference between signal values ​​detected at the same temperature using n compositions, and specifically, “change in signal” and / or “constant signal” are referred to as “change in signal” and / or “constant signal” based on (i) the difference between signal values ​​in multiple cycles detected at the same temperature or (ii) the difference between a “reference value” described below and a signal value detected at the same temperature as the temperature at which the reference value is set. In other words, “change in signal” and / or “constant signal” are not referred to based on the difference between signal values ​​detected at different temperatures.

[0256] Therefore, each of the first and second target nucleic acid detection compositions in the present invention provides a signal in a predetermined temperature range, but does not provide a signal in other temperature ranges.

[0257] In one embodiment, the expression “one temperature range is lower than the other temperature range” used in relation to the signal-change temperature range and the signal-constant temperature range of the composition means that the highest temperature within one temperature range is lower than the lowest temperature within the other temperature range. Conversely, the expression “one temperature range is higher than the other temperature range” means that the lowest temperature within one temperature range is higher than the highest temperature within the other temperature range. For example, the expression that the signal-constant temperature range is higher than the signal-change temperature range means that the lowest temperature within the signal-constant temperature range is higher than the highest temperature within the signal-change temperature range.

[0258] In one embodiment, the composition provides a dimer that provides one or more signal changes. In one embodiment, the dimer that provides the signal change provided by the composition is a single-type dimer or a multi-type dimer.

[0259] In one embodiment, the signal-change temperature range of the composition can be determined dependently on the length and / or sequence of the dimer providing the signal change.

[0260] In one embodiment, when the composition provides a single-type duplex during a nucleic acid amplification reaction, the composition may have one signal-changing temperature range and one signal-constant temperature range. The signal-changing range and the signal-constant temperature range may be determined depending on the length and / or sequence of the single-type duplex.

[0261] In one embodiment, when the composition provides multiple types of duplexers during a nucleic acid amplification reaction, specifically, when providing two types of duplexers, the composition may have one signal-change temperature range and two signal-constant temperature ranges. The signal-change range and the signal-constant temperature range may be determined depending on the length and / or sequence of the two types of duplexers.

[0262]

[0263] According to the method of the present disclosure, signals are measured at first and second detection temperatures to detect the first and second target nucleic acids. The first and second detection temperatures are in an ascending order from a low temperature to a high temperature or in a descending order from a high temperature to a low temperature. For example, the first detection temperature is lower than the second detection temperature, or the first detection temperature is higher than the second detection temperature.

[0264] According to the present disclosure, the second detection temperature is a single-signal detection temperature selected so that a single signal from the second target nucleic acid is provided, and the first detection temperature is a combined-signal detection temperature selected so that a combined signal from the first and second target nucleic acids is provided.

[0265] As used herein, the term "single signal" refers to a signal provided by a reaction between one target nucleic acid and a composition specific therefor, whereas the term "combined signal" refers to a signal provided by a reaction between two target nucleic acids and two compositions specific therefor. The term "combined signal" may be used interchangeably herein with the terms "mixed signal" or "composite signal."

[0266] According to the method of the present disclosure, the first target nucleic acid detection composition is configured to provide only a signal (signal change) indicating the presence of the first target nucleic acid at a first detection temperature in the presence of the first target nucleic acid, whereas the second target nucleic acid detection composition is configured to provide a signal (signal change) indicating the presence of the second target nucleic acid at first and second detection temperatures in the presence of the second target nucleic acid. In particular, the second target nucleic acid detection composition is configured such that the intensity of the signal for the second target nucleic acid provided at the first detection temperature is no more than 0.5 times the intensity of the signal for the second target nucleic acid provided at the second detection temperature. Therefore, the signal detectable at the first detection temperature is a combined signal provided due to the reaction of the first and second target nucleic acid detection compositions with the first and second target nucleic acids, and the signal detectable at the second detection temperature is a single signal provided due to the reaction of the second target nucleic acid detection composition with the second target nucleic acid.

[0267] As used herein, the term "single signal" refers to a signal provided by a reaction between one target nucleic acid and a composition specific therefor, whereas the term "combined signal" refers to a signal provided by a reaction between two target nucleic acids and two compositions specific therefor. The term "combined signal" may be used interchangeably herein with the terms "mixed signal" or "composite signal."

[0268] A detection temperature selected or intended to provide a single signal from one target nucleic acid herein is termed a “single-signal detection temperature,” while a detection temperature selected or intended to provide a combined signal from two target nucleic acids is termed a “combined-signal detection temperature.” Accordingly, the second detection temperature is a single-signal detection temperature selected to provide a single signal from the second target nucleic acid, and the first detection temperature is a combined-signal detection temperature selected to provide a combined signal from the first and second target nucleic acids.

[0269]

[0270] In the present invention, the first and second detection temperatures may be selected based on the fact that there is a temperature range in which a signal is provided by each target nucleic acid detection composition (referred to herein as a “signal-change temperature range”) and a temperature range in which no signal is provided (referred to herein as a “signal-constant temperature range”). For example, as shown in FIG. 1A, it is assumed that the first target nucleic acid detection composition is configured to provide a signal change at a temperature of 60° C. or lower, and the second target nucleic acid detection composition is configured to provide a signal change at a temperature of 50° C. to 85° C. In this case, the first detection temperature is lower than the second detection temperature, and the first detection temperature may be selected from a temperature range in which a signal change can be provided from both the first and second target nucleic acid detection compositions, i.e., a temperature range of 50° C. to 60° C. The second detection temperature may be selected from a temperature range in which a signal change can be provided only from the second target nucleic acid detection composition, i.e., a temperature range of 60°C to 85°C. As another example, as shown in FIG. 1B, assume that the first target nucleic acid detection composition is configured to provide a signal change at a temperature of 50°C to 85°C, and the second target nucleic acid detection composition is configured to provide a signal change at a temperature of 30°C to 60°C. In this case, the first detection temperature is higher than the second detection temperature, and the first detection temperature may be selected from a temperature range in which a signal change can be provided from both the first and second target nucleic acid detection compositions, i.e., a temperature range of 50°C to 60°C. The second detection temperature may be selected from a temperature range in which a signal change can be provided only from the second target nucleic acid detection composition, i.e., a temperature range of 30°C to 50°C.

[0271] In addition, the first and second detection temperatures in the present invention may be selected within a temperature range in which the intensity of the signal for the second target nucleic acid at the first detection temperature is 0.5 times or less than the intensity of the signal for the second target nucleic acid at the second detection temperature. To satisfy the above-described requirement, the composition for detecting the second target nucleic acid has a temperature subrange that exhibits a specific pattern within the signal-changing temperature range.

[0272] In one embodiment, when the second detection temperature is higher than the first detection temperature, the signal-change temperature range of the second target nucleic acid detection composition has a temperature sub-region showing a pattern in which the signal change increases as the temperature increases. As an example, an InterSC composition or an OverSC composition can be adopted as the second target nucleic acid detection composition of the present disclosure. Figures 2A and 2B show melt curves after amplification of two types of InterSC compositions, and within each curve, a first signal-constant temperature range (1) st ScoTR), signal-change temperature range (SChTR), second signal-constant temperature range (2 ndScoTR), and temperature sub-regions are indicated. Figures 3A and 3B show the melt curves after amplification of two types of OverSC compositions, with ScoTR, SChTR, and temperature sub-regions indicated within each curve. As shown in Figures 2 and 3, the InterSC composition and the OverSC composition have temperature sub-regions that exhibit a pattern in which the amount of signal change increases as the temperature increases within their signal-change temperature range. When a first detection temperature is selected within the temperature sub-region, the intensity of the signal for the second target nucleic acid at the first detection temperature is always lower than the intensity of the signal for the second target nucleic acid at the second detection temperature. One skilled in the art can appropriately select the first detection temperature and the second detection temperature such that the intensity of the signal for the second target nucleic acid at the first detection temperature is 0.5 times or less than the intensity of the signal for the second target nucleic acid at the second detection temperature.

[0273] In one embodiment, when the second detection temperature is higher than the first detection temperature, the UnderSC or InterSC composition may be adopted as the first target nucleic acid detection composition. Specifically, the signal generation method of the first target nucleic acid detection composition may be adopted as a molecular beacon method (Tyagi et al., Nature Biotechnology v. 14 MARCH 1996), the scorpion method (Whitcombe et al., Nature Biotechnology 17:804-807 (1999)), the sunrise (or Amplifluor) method (Nazarenko et al., Nucleic Acids Research, 25(12):2516-2521 (1997), and U.S. Patent No. 6,117,635), the adjacent hybridization probe method (Bernard PS et al., Anal. Biochem., 273:221 (1999)), or the Yin-Yang probe method (U.S. Patent No. 7,799,522), but is not limited thereto.

[0274] In certain embodiments, when the second detection temperature is higher than the first detection temperature, a signal generation method that provides a duplex formed by a cleavage reaction dependent on the presence of the corresponding target nucleic acid may be adopted for signal generation of the first and second target nucleic acid detection compositions.

[0275] A specific implementation example of a signal generation method that provides a dimer formed by a cleavage reaction dependent on the presence of the target nucleic acid is described below:

[0276] First, the PTOCE method can be adopted as a signal generation method of the composition for detecting the first target nucleic acid.

[0277] Specifically, the composition for detecting the first target nucleic acid comprises:

[0278] (i) primer,

[0279] The primer comprises a nucleotide sequence that hybridizes to a first region of a first target nucleic acid;

[0280] (ii) Probing and Tagging Oligonucleotide (PTO),

[0281] The PTO comprises, in 5' to 3' order, (i) a 5'-tagging portion comprising a nucleotide sequence that non-hybridizes to a first target nucleic acid, and (ii) a 3'-targeting portion comprising a nucleotide sequence that hybridizes to a second region of the first target nucleic acid; and

[0282] (iii) Capturing and Templating Oligonucleotide (CTO),

[0283] The CTO comprises, in 3' to 5' order, (i) a capturing portion comprising a nucleotide sequence that hybridizes to a 5'-tagging portion or a portion of a 5'-tagging portion of the PTO, and (ii) a templating portion comprising a nucleotide sequence that non-hybridizes to the 5'-tagging portion and the 3'-targeting portion of the PTO, and the CTO comprises a reporter molecule and a quencher molecule linked thereto.

[0284] In one embodiment, the composition for detecting the first target nucleic acid provides a signal by a method comprising the following steps:

[0285] (a') A step of hybridizing the first target nucleic acid with the primer and the PTO,

[0286] The 5'-tagging portion of the PTO does not hybridize to the first target nucleic acid, the 3'-targeting portion of the PTO hybridizes to the first target nucleic acid, and the primer is located upstream of the PTO;

[0287] (b') a step of contacting the resultant of step (a') with a DNA polymerase having 5' nuclease activity under conditions for cleavage of the PTO,

[0288] The primer is extended by a DNA polymerase having the 5' nuclease activity to induce cleavage of the PTO, which cleavage releases a fragment comprising the 5'-tagging portion or a part of the 5'-tagging portion of the PTO;

[0289] (c') A step of hybridizing the fragment released from the PTO and the CTO,

[0290] The above fragment hybridizes to the capturing portion of the CTO;

[0291] (d') A step of performing an extension reaction using the result of the above step (c') and the DNA polymerase having the 5' nuclease activity,

[0292] The fragment hybridized to the capturing portion of the CTO is extended to generate an extended strand complementary to the templating portion of the CTO, thereby generating an extended duplex between the extended strand and the CTO.

[0293] (e') A step of detecting the presence of the above extended strand,

[0294] The presence of the above extended strand indicates the presence of the first target nucleic acid.

[0295] The above step (a') first hybridizes the target nucleic acid in the sample with a primer and a PTO (Probing and Tagging Oligonucleotide).

[0296] Primers and PTOs contain nucleotide sequences that hybridize to a target nucleic acid. The expression herein that an oligonucleotide (e.g., a primer or PTO) "comprises a nucleotide sequence that hybridizes" to another oligonucleotide (e.g., a target nucleic acid) means that all or part of the sequence of said oligonucleotide contains a complementary nucleotide sequence necessary for hybridization with all or part of the sequence of the other oligonucleotide.

[0297] The 5'-tagging portion of the PTO comprises a nucleotide sequence that non-hybridizes to a target nucleic acid. The expression herein that an oligonucleotide (e.g., the 5'-tagging portion of the PTO) "comprises a nucleotide sequence that non-hybridizes" to another oligonucleotide (e.g., the target nucleic acid) means that the one oligonucleotide and the other oligonucleotide comprise a non-complementary nucleotide sequence necessary for non-hybridization with each other.

[0298] As used herein, the term “Probing and Tagging Oligonucleotide (PTO)” means an oligonucleotide comprising (i) a 5'-tagging portion comprising a nucleotide sequence that is released from the PTO by cleavage of the 3'-targeting portion of the PTO after hybridization with the target nucleic acid and that does not hybridize to the target nucleic acid, and (ii) a 3'-targeting portion comprising a nucleotide sequence that hybridizes to the target nucleic acid (specifically, a second region of the target nucleic acid) that serves as a probe. The 5'-tagging portion and the 3'-targeting portion of the PTO must be positioned in a 5' to 3' order.

[0299] PTO does not require any specific length.

[0300] For example, the length of the PTO can be 15-150 nucleotides, 15-100 nucleotides, 15-80 nucleotides, 15-60 nucleotides, 15-40 nucleotides, 20-150 nucleotides, 20-100 nucleotides, 20-80 nucleotides, 20-60 nucleotides, 20-50 nucleotides, 30-150 nucleotides, 30-100 nucleotides, 30-80 nucleotides, 30-60 nucleotides, 30-50 nucleotides, 35-150 nucleotides, 35-100 nucleotides, 35-80 nucleotides, 35-60 nucleotides or 35-50 nucleotides. The 3'-targeting portion of the PTO can have any length as long as it specifically hybridizes to the target nucleic acid. For example, the 3'-targeting portion of the PTO can have a length of 10-100 nucleotides, 10-80 nucleotides, 10-50 nucleotides, 10-40 nucleotides, 10-30 nucleotides, 15-100 nucleotides, 15-80 nucleotides, 15-50 nucleotides, 15-40 nucleotides, 15-30 nucleotides, 20-100 nucleotides, 20-80 nucleotides, 20-50 nucleotides, 20-40 nucleotides, or 20-30 nucleotides. The 5'-tagging portion of the PTO can have any length as long as it is extended after specifically hybridizing to the capturing portion of the CTO. For example, the 5'-tagging portion of the PTO can have a length of 5-50 nucleotides, 5-40 nucleotides, 5-30 nucleotides, 5-20 nucleotides, 10-50 nucleotides, 10-40 nucleotides, 10-30 nucleotides, 10-20 nucleotides, 15-50 nucleotides, 15-40 nucleotides, 15-30 nucleotides, or 15-20 nucleotides.

[0301] In one embodiment, the 3'-terminus of the PTO may have a 3'-OH terminal.

[0302] In one embodiment, the 3'-end of the PTO may be blocked to prevent its extension. Blocking may be achieved by conventional methods.

[0303] Non-hybridization between the 5'-tagging portion of the PTO and the target nucleic acid means that a stable double-stranded molecule is not formed between them under specific hybridization conditions. In one embodiment, the 5'-tagging portion of the PTO that is not involved in hybridization with the target nucleic acid forms a single-stranded molecule.

[0304] The primer used in the present disclosure refers to an upstream primer located upstream of a PTO. When the target nucleic acid is double-stranded, the primer and PTO hybridize to one strand of the double-stranded target nucleic acid, and the PTO is located downstream of the primer. The primer hybridizes to a specific region (i.e., a first region of the target nucleic acid) located in the 3' direction compared to the region of the target nucleic acid strand to which the PTO hybridizes (i.e., a second region of the target nucleic acid).

[0305] In one embodiment, when the target nucleic acid is double-stranded, one strand of the double-stranded target nucleic acid comprises a first region of the target nucleic acid and a second region of the target nucleic acid. Specifically, the target nucleic acid comprises, in 3' to 5' order, (i) a first region to which the primer can hybridize and (ii) a second region to which the PTO can hybridize.

[0306] In one embodiment, the method is performed in the presence of an additional primer. The additional primer generates additional target nucleic acids that hybridize to the PTO, thereby improving the sensitivity of target detection. The additional primer may be referred to as a downstream primer.

[0307] In one embodiment, when using a primer and an additional primer, an additional template-dependent nucleic acid polymerase may be used to extend both primers. The primer and the additional primer may be referred to as a forward primer and a reverse primer, respectively.

[0308] Next, step (b') contacts the product of step (a') with a DNA polymerase having 5' nuclease activity under conditions for cleavage of the PTO. Extension of the primer induces cleavage of the PTO by the DNA polymerase having 5' nuclease activity, thereby releasing a PTO fragment comprising or including a 5'-tagging portion of the PTO.

[0309] In another embodiment, the primer hybridizes proximately to the PTO to induce cleavage of the PTO by a DNA polymerase having 5' nuclease activity, and the enzyme bound to the primer cleaves the PTO without an extension reaction.

[0310] In one embodiment, prior art techniques for primer-mediated cleavage reactions may be applied to the present disclosure, as long as a primer hybridizing to a first region of a target nucleic acid induces cleavage of a PTO hybridized to a second region of the target nucleic acid to release a fragment comprising the 5'-tagging portion of the PTO or a portion of the 5'-tagging portion of the PTO. For example, U.S. Patent Nos. 5,210,015, 5,487,972, 5,691,142, 5,994,069, 7,381,532, and U.S. Application Publication No. 2008-0241838 may be applied to the present disclosure.

[0311] In step (c'), the fragment released from the PTO is hybridized with the capturing and templating oligonucleotide (CTO). Then, in step (d'), an extension reaction is performed using the product of step (c') and the DNA polymerase having the 5' nuclease activity.

[0312] CTO serves as a template for the extension of fragments released from PTO. These fragments, which serve as primers, hybridize with CTO and are extended to form extended duplexes.

[0313] The templating portion of the CTO may comprise any sequence, as long as it has a non-complementary sequence to the 5'-tagging portion and 3'-targeting portion of the PTO. Furthermore, the templating portion of the CTO may comprise any sequence that can serve as a template for the extension of a fragment released from the PTO.

[0314] The length of a CTO can vary. For example, CTO can be 5-1000 nucleotides, 5-500 nucleotides, 5-300 nucleotides, 5-100 nucleotides, 5-80 nucleotides, 5-60 nucleotides, 5-40 nucleotides, 7-1000 nucleotides, 7-500 nucleotides, 7-300 nucleotides, 7-100 nucleotides, 7-80 nucleotides, 7-60 nucleotides, 7-40 nucleotides, 15-1000 nucleotides, 15-500 nucleotides, 15-300 nucleotides, 15-100 nucleotides, 15-80 nucleotides, 15-60 nucleotides, 15-40 nucleotides, The length is 20-1000 nucleotides, 20-500 nucleotides, 20-300 nucleotides, 20-100 nucleotides, 20-80 nucleotides, 20-60 nucleotides, 20-40 nucleotides, 30-1000 nucleotides, 30-500 nucleotides, 30-300 nucleotides, 30-100 nucleotides, 30-80 nucleotides, 30-60 nucleotides or 30-40 nucleotides.

[0315] The capturing portion of the CTO can be of any length as long as it specifically hybridizes to the PTO fragment. For example, the capturing portion of the CTO can be 5-100 nucleotides, 5-60 nucleotides, 5-40 nucleotides, 5-30 nucleotides, 5-20 nucleotides, 10-100 nucleotides, 10-60 nucleotides, 10-40 nucleotides, 10-30 nucleotides, 10-20 nucleotides, 15-100 nucleotides, 15-60 nucleotides, 15-40 nucleotides, 15-30 nucleotides, or 15-20 nucleotides in length.

[0316] The templating portion of the CTO can have any length as long as it can act as a template in the extension of the PTO fragment. For example, the templating region of CTO is 1-900 nucleotides, 1-400 nucleotides, 1-300 nucleotides, 1-100 nucleotides, 1-80 nucleotides, 1-60 nucleotides, 1-40 nucleotides, 1-20 nucleotides, 2-900 nucleotides, 2-400 nucleotides, 2-300 nucleotides, 2-100 nucleotides, 2-80 nucleotides, 2-60 nucleotides, 2-40 nucleotides, 2-20 nucleotides, 5-900 nucleotides, 5-400 nucleotides, 5-300 nucleotides, 5-100 nucleotides, 5-80 nucleotides, 5-60 nucleotides, 5-40 nucleotides, 5-30 nucleotides, 10-900 nucleotides, 10-400 nucleotides, 10-300 nucleotides, 10-100 nucleotides, 10-80 nucleotides, 10-60 nucleotides, 10-40 nucleotides, 10-20 nucleotides, 15-900 nucleotides, 15-300 nucleotides, 15-100 nucleotides, 15-80 nucleotides, 15-60 nucleotides, 15-40 nucleotides, 15-30 nucleotides, or 15-20 nucleotides in length.

[0317] In one embodiment, the 3'-terminus of the CTO may have a 3'-OH terminal. Alternatively, the 3'-terminus of the CTO is blocked to prevent its extension. Blocking can be achieved by conventional methods.

[0318] The PTO fragment hybridizes with the CTO, providing a conformation suitable for extension of the PTO fragment. Although the uncleaved PTO hybridizes with the CTO capturing region via its 5'-tagging region, its 3'-targeting region does not hybridize with the CTO, preventing the formation of extended duplexes.

[0319] The terms “extended sequence,” “extended strand,” and “extended duplex” used in connection with the extension reaction of the PTO fragment in step (d') have the following meanings:

[0320] The term "extended sequence" refers to a sequence newly formed by extension from the PTO fragment in step (d'). In other words, the extended sequence refers to a portion of the extended strand described below, excluding the PTO fragment.

[0321] The term "extended strand" refers to a sequence encompassing the PTO fragment and the extended sequence. In other words, the extended strand refers to a portion of the extended duplex described below, excluding the CTO.

[0322] The term "extended duplex" refers to a hybrid or duplex (via complementarity) between the extended strand and the CTO. In other words, the extended duplex refers to a duplex between the extended strand composed of the PTO fragment and the extended sequence and the CTO.

[0323] In one embodiment, the extended duplex has a Tm that is controllable by (i) the sequence and / or length of the fragment, (ii) the sequence and / or length of the CTO, or (iii) the sequence and / or length of the fragment and the sequence and / or length of the CTO.

[0324] The term "Tm" as used herein refers to the melting temperature at which half of a population of double-stranded nucleic acid molecules dissociates into single-stranded molecules. Tm is determined by the length and G / C content of the hybridizing nucleotides. Tm can be calculated by conventional methods such as the Wallace rule (RB Wallace, et al., Nucleic Acids Research, 6:3543-3547 (1979)) and the nearest-neighbor method (SantaLucia J. Jr., et al., Biochemistry, 35:3555-3562 (1996)); Sugimoto N., et al., Nucleic Acids Res., 24:4501-4505 (1996)).

[0325] In specific embodiments, Tm refers to the actual Tm value under the reaction conditions actually performed.

[0326] Finally, step (e') detects the presence of the extended strand. The presence of the extended strand indicates the presence of the target nucleic acid.

[0327] In one embodiment, the presence of the extended strand is detected by measuring a signal provided from the extended duplex at a detection temperature.

[0328] In one embodiment, when the CTO exists as a single strand, the reporter molecule and the quencher molecule of the CTO are structurally close to each other, whereby the quencher molecule quenches the signal from the reporter molecule. On the other hand, when the CTO hybridizes with the extended strand, the reporter molecule and the quencher molecule of the CTO are structurally separated, whereby the quencher molecule unquenchs the signal from the reporter molecule.

[0329] Details of the “PTOCE method” are disclosed in International Application Publication No. WO2012-096523, the teachings of which are incorporated herein by reference in their entirety.

[0330]

[0331] Next, the PTOCE-LPHO method can be adopted as a signal generation method of the composition for detecting the second target nucleic acid.

[0332] Specifically, the second target nucleic acid detection composition comprises:

[0333] (i) primer,

[0334] The primer comprises a nucleotide sequence that hybridizes to a first region of the second target nucleic acid;

[0335] (ii) Probing and Tagging Oligonucleotide (PTO),

[0336] The PTO comprises, from 5' to 3', (i) a 5'-tagging portion comprising a nucleotide sequence that non-hybridizes to a second target nucleic acid, and (ii) a 3'-targeting portion comprising a nucleotide sequence that hybridizes to a second region of the second target nucleic acid;

[0337] (iii) Capturing and Templating Oligonucleotide (CTO),

[0338] The CTO comprises, in 3' to 5' order, (i) a capturing portion comprising a nucleotide sequence that hybridizes to the 5'-tagging portion or a portion of the 5'-tagging portion of the PTO, and (ii) a templating portion comprising a nucleotide sequence that non-hybridizes to the 5'-tagging portion and the 3'-targeting portion of the PTO,

[0339] The CTO comprises a reporter molecule and a quencher molecule linked thereto, defining a labeled portion; and

[0340] (iv) labeled portion hybridizing oligonucleotide (LPHO),

[0341] The above LPHO comprises a nucleotide sequence that hybridizes to the labeling portion of the CTO.

[0342] In one embodiment, the second target nucleic acid detection composition provides a signal by a method comprising the following steps:

[0343] (a”) A step of hybridizing the second target nucleic acid with the primer and the PTO,

[0344] The 5'-tagging portion of the PTO does not hybridize to the second target nucleic acid, the 3'-targeting portion of the PTO hybridizes to the second target nucleic acid, and the primer is located upstream of the PTO;

[0345] (b”) A step of contacting the resultant of step (a”) with a DNA polymerase having 5' nuclease activity under conditions for cleavage of the PTO,

[0346] The primer is extended by a DNA polymerase having the 5' nuclease activity to induce cleavage of the PTO, which cleavage releases a fragment comprising the 5'-tagging portion or a part of the 5'-tagging portion of the PTO;

[0347] (c”) A step of hybridizing the fragment released from the PTO and the CTO,

[0348] The above fragment hybridizes to the capturing portion of the CTO;

[0349] (d”) A step of performing an extension reaction using the resultant of step (c”) and a DNA polymerase having the 5' nuclease activity in the presence of the LPHO,

[0350] When the second target nucleic acid is present in the sample, the fragment hybridized to the capturing portion of the CTO is extended to generate an extended strand complementary to the templating portion of the CTO, thereby generating an extended duplex between the extended strand and the CTO, and the generation of the extended duplex prevents the formation of a CTO / LPHO hybrid between the CTO and the LPHO.

[0351] If the second target nucleic acid is not present in the sample, the extended strand is not generated, but instead a CTO / LPHO hybrid is formed between the CTO and the LPHO; and

[0352] (e) a step of detecting the presence of the extended duplex,

[0353] The presence of the above extended duplex indicates the presence of the second target nucleic acid.

[0354]

[0355] Steps (a”) to (c”) of the signal providing method of the second target nucleic acid detection composition employing the PTOCE-LPHO method can be described in detail with reference to the description of steps (a') to (c') of the signal providing method of the first target nucleic acid detection composition employing the aforementioned PTOCE method.

[0356] Step (d”) is performed in the presence of a Labeled Portion Hybridizing Oligonucleotide (LPHO).

[0357] The term “labeled portion” as used herein refers to a nucleotide sequence including a nucleotide to which a reporter molecule is linked, a nucleotide to which a quencher molecule is linked, and intervening nucleotides. For example, when a quencher molecule and a reporter molecule are linked to the 2nd nucleotide and the 12th nucleotide from the 5'-end of the templating portion of a CTO, respectively, the labeled portion refers to a total of 11 nucleotide sequences including the 2nd nucleotide to which the quencher molecule is linked, the intervening nucleotides from the 3rd nucleotide to the 11th nucleotide, and the 12th nucleotide to which the reporter molecule is linked.

[0358] In one embodiment, quenching or unquenching between the reporter molecule and the quencher molecule can be induced depending on whether the labeling portion of the CTO is single-stranded or double-stranded.

[0359] Step (d”) is performed in the same manner as step (d') of the signal providing method of the first target nucleic acid detection composition, except that it is performed in the presence of LPHO.

[0360] The term “Labeled Portion Hybridization Oligonucleotide (LPHO)” as used herein refers to an oligonucleotide comprising a nucleotide sequence that hybridizes to the label portion and which provides a signal of different intensity depending on whether the LPHO hybridizes to the label portion. For example, when the LPHO hybridizes to the label portion of a CTO, the reporter molecule and the quencher molecule of the CTO are spaced apart, thereby causing the quencher molecule to unquench a signal from the reporter molecule, whereas when the LPHO is not hybridized to the label portion of the CTO and the label portion of the CTO is not hybridized with any other oligonucleotide, the reporter molecule and the quencher molecule of the CTO are in close proximity to each other, thereby causing the quencher molecule to quench a signal from the reporter molecule.

[0361] As long as the LPHO used in the present disclosure provides signals of different intensities depending on whether it hybridizes with the labeling moiety of the CTO, the LPHO may hybridize to the entire sequence of the labeling moiety or only to a portion of the sequence. Accordingly, the LPHO comprises a nucleotide sequence that hybridizes to the entire or a portion of the sequence of the labeling moiety.

[0362] In one embodiment, the nucleotide sequence of the LPHO should be designed to include a nucleotide sequence that hybridizes to the labeling moiety. Those skilled in the art will appreciate that the LPHO may have additional nucleotide sequences in addition to the nucleotide sequence that hybridizes to the aforementioned labeling moiety.

[0363] In one embodiment, the 3'-end of the LPHO may be blocked to prevent its extension. Blocking may be achieved by conventional methods.

[0364] The length of the above LPHO can vary. For example, LPHO can be 5-100 nucleotides, 5-80 nucleotides, 5-60 nucleotides, 5-40 nucleotides, 5-20 nucleotides, 5-10 nucleotides, 7-100 nucleotides, 7-80 nucleotides, 7-60 nucleotides, 7-40 nucleotides, 7-20 nucleotides, 7-10 nucleotides, 10-100 nucleotides, 10-80 nucleotides, 10-60 nucleotides, 10-40 nucleotides, 10-30 nucleotides, 10-20 nucleotides, 10-15 nucleotides, 15-100 nucleotides, 15-80 nucleotides, 15-60 nucleotides, The length is 15-40 nucleotides, 15-30 nucleotides, 15-20 nucleotides, 20-100 nucleotides, 20-80 nucleotides, 20-60 nucleotides, 20-40 nucleotides or 20-30 nucleotides.

[0365] In one embodiment, when the target nucleic acid is present in the sample, the fragment hybridized to the capturing portion of the CTO extends to generate an extended strand complementary to the templating portion of the CTO, thereby generating an extended duplex between the extended strand and the CTO.

[0366] In one embodiment, when the target nucleic acid is present in the sample, the fragment hybridized to the capturing portion of the CTO can be (i) extended prior to hybridization between the LPHO and the CTO to form an extended duplex, (ii) extended after hybridization between the LPHO and the CTO to cleave or displace the LPHO to form an extended duplex, or the extended duplex can be formed by both (i) and (ii).

[0367] The LPHO can hybridize with the CTO before the PTO fragment is extended, and the LPHO can participate in the extension reaction. In one embodiment, when the LPHO hybridizes with the CTO before the extension of the PTO fragment, the extension of the PTO fragment cleaves or displaces the LPHO from the CTO. For example, as the PTO fragment is extended, the LPHO hybridized to the labeling portion of the CTO before the extension of the PTO fragment can be released (dissociated) from the fragment or cleaved by strand displacement.

[0368] In one embodiment, cleavage and / or strand displacement of LPHO by extension of the PTO fragment is affected by the type of enzyme (e.g., template-dependent nucleic acid polymerase) or reaction conditions.

[0369] In one embodiment, the formation of the extended duplex prevents the formation of CTO / LPHO hybrids by favoring hybridization between the CTO and the extended strand over hybridization between the CTO (specifically, the labeling moiety) and the LPHO. That is, as the CTO hybridizes with the extended strand to form the extended duplex, the CTO is consumed, and the possibility of hybridization between the CTO and the LPHO is reduced.

[0370] In one embodiment, the formation of the extended duplex prevents the formation of the CTO / LPHO hybrid due to cleavage of the LPHO during the extension of step (d”). That is, the LPHO is cleaved and removed, and the possibility of hybridization between the CTO and LPHO is reduced.

[0371] In one embodiment, the melting temperature (Tm) of the extended dimer is different from the Tm of the CTO / LPHO hybrid.

[0372] In particular, the formation of extended duplexes can be favored over the formation of CTO / LPHO hybrids by differences in the stability of the two products, e.g., in their Tm values.

[0373] In the present disclosure, the extended duplex may be a more stable duplex than the CTO / LPHO hybrid. For example, the Tm of the extended duplex is higher than the Tm of the CTO / LPHO hybrid. Specifically, the Tm of the extended duplex is higher than the Tm of the CTO / LPHO hybrid by at least 2°C, 3°C, 4°C, 5°C, 7°C, 10°C, 15°C, or 20°C.

[0374] In one embodiment, the CTO / LPHO hybrid has a Tm that is controllable by the sequence and / or length of the LPHO.

[0375] In one embodiment, the presence of the extended duplex is detected by measuring (i) a signal provided from the extended duplex, (ii) a signal provided from the CTO / LPHO hybrid, or (iii) a signal provided from the extended duplex and the CTO / LPHO hybrid at the second detection temperature.

[0376] In one embodiment, when the CTO exists as a single strand, the reporter molecule and the quencher molecule of the CTO are structurally close to each other, thereby causing the quencher molecule to quench a signal from the reporter molecule. On the other hand, when the CTO hybridizes with the extended strand or the LPHO, the reporter molecule and the quencher molecule of the CTO are structurally separated, thereby causing the quencher molecule to unquench a signal from the reporter molecule.

[0377] Considering the numerous factors and issues described above, a suitable LPHO must be designed. Details of the "PTOCE-LPHO method" are disclosed in WO 2024 / 181774, the teachings of which are incorporated herein by reference in their entirety.

[0378]

[0379] In another embodiment, when the second detection temperature is lower than the first detection temperature, the signal-change temperature range of the second target nucleic acid detection composition has a temperature sub-region showing a pattern in which the signal change decreases as the temperature increases. As an example, the UnderSC composition or the InterSC composition can be adopted as the second target nucleic acid detection composition of the present disclosure. Figures 4A and 4B show post-amplification melt curves of two types of UnderSC compositions, in which SChTR, ScoTR, and temperature sub-regions are indicated within each curve. Figures 5A and 5B show post-amplification melt curves of two types of InterSC compositions, in which 1 st SCoTR, SChTR, 2 nd ScoTR, and temperature sub-regions are indicated. As shown in FIGS. 4 and 5, the UnderSC composition and the InterSC composition have temperature sub-regions that exhibit a pattern in which the amount of signal change decreases as the temperature increases within their signal-change temperature range. When a first detection temperature is selected within the temperature sub-region, the intensity of the signal at the first detection temperature is always lower than the intensity of the signal at the second detection temperature. Those skilled in the art can appropriately select the first detection temperature and the second detection temperature so that the intensity of the signal for the second target nucleic acid at the first detection temperature is 0.5 times or less than the intensity of the signal for the second target nucleic acid at the second detection temperature.

[0380] In one embodiment, when the second detection temperature is lower than the first detection temperature, an OverSC or InterSC composition may be employed as the first target nucleic acid detection composition. Specifically, the signal generation method of the first target nucleic acid detection composition may be, but is not limited to, the quenching-TOCE method (WO 2024 / 106890) or the Yin-Yang probe method (US Patent No. 7,799,522).

[0381]

[0382] In one embodiment, the temperature sub-zone for the second target nucleic acid detection composition overlaps, in whole or in part, with the signal-change temperature range of the first target nucleic acid detection composition.

[0383] In one embodiment, the first detection temperature is selected from a temperature sub-region within the signal-change temperature range of the second target nucleic acid detection composition, and specifically, is selected from a temperature sub-region within the signal-change temperature range of the second target nucleic acid detection composition that overlaps the signal-change temperature range of the first target nucleic acid detection composition.

[0384] In one embodiment, the second detection temperature is selected from a signal-change temperature range of the second target nucleic acid detection composition, and specifically, is selected from a temperature range that does not overlap with the signal-change temperature range of the first target nucleic acid detection composition.

[0385] Various embodiments of the combination of the first and second target nucleic acid detection compositions that satisfy all of the above-described requirements are described with reference to the drawings, but are not limited thereto.

[0386] In the present disclosure, the first and second target nucleic acid detection compositions satisfying all of the following three conditions can be combined as shown in Tables 1 and 2 according to the order of the two detection temperatures.

[0387] (Condition 1) The first detection temperature is a temperature at which both a signal for the first target nucleic acid and a signal for the second target nucleic acid are detectable;

[0388] (Condition 2) The second detection temperature is a temperature at which a signal for the second target nucleic acid is detectable;

[0389] (Condition 3) The intensity of the signal for the second target nucleic acid at the first detection temperature is 0.5 times or less than the intensity of the signal for the second target nucleic acid at the second detection temperature.

[0390]

[0391] Implementation Example 1. When the first detection temperature is lower than the second detection temperature

[0392]

[0393] Table 1 shows various examples of combinations of first and second target nucleic acid detection compositions where the first detection temperature is lower than the second detection temperature.

[0394] The signal-change temperature range and signal-constant temperature range(s) of the target nucleic acid detection composition used in the present disclosure can be controlled by adjusting the length and / or sequence of the dimer (e.g., extended duplex, CTO / LPHO hybrid, etc.) provided by the target nucleic acid detection composition (i.e., controlling the Tm of the dimer). That is, by controlling the signal-change temperature range and signal-constant temperature range of each of the first and second target nucleic acid detection compositions, the first and second target nucleic acid detection compositions satisfying the above-described requirements can be configured, and the first and second detection temperatures can be selected from their signal-change temperature ranges.

[0395]

[0396] Composition for detecting target nucleic acid 1 Composition for detecting target nucleic acid 2 UnderSC composition InterSC composition 2 InterSC composition InterSC composition 3 UnderSC composition OverSC composition 4 InterSC composition OverSC composition

[0397] (Implementation Example 1-1) Combination 1

[0398] In one embodiment, the first target nucleic acid detection composition is an UnderSC composition, and the second target nucleic acid detection composition is an InterSC composition.

[0399] As a specific embodiment, the signal-change temperature ranges of each of the first and second target nucleic acid detection compositions comprising the UnderSC composition and the InterSC composition can be controlled as shown in FIG. 6. In this case, the first detection temperature is selected within a temperature range in which the signal-change temperature range of the first target nucleic acid detection composition overlaps with the temperature sub-range of the second target nucleic acid detection composition, and the second detection temperature is selected within a signal-change temperature range of the second target nucleic acid detection composition that does not overlap with the signal-change temperature range of the first target nucleic acid detection composition. In particular, the first and second detection temperatures are selected within a temperature range in which the signal intensity (i.e., signal change) for the second target nucleic acid by the second target nucleic acid detection composition at the first detection temperature is 0.5 times or less than the signal intensity (i.e., signal change) for the second target nucleic acid by the second target nucleic acid detection composition at the second detection temperature. In FIG. 6, the signal intensity (i.e., signal change depending on the presence or absence of the second target nucleic acid) for the second target nucleic acid at the selected first detection temperature (about 65°C) and second detection temperature (about 78°C) is indicated by a gray solid arrow, and the signal intensity (i.e., signal change depending on the presence or absence of the first target nucleic acid) for the first detection temperature is indicated by a gray dotted arrow. As shown in FIG. 6, the signal intensity for the second target nucleic acid at the first detection temperature (the length of the gray solid arrow at the first detection temperature; Delta RFU: about 1,200) is 0.5 times or less than the signal intensity for the second target nucleic acid at the second detection temperature (the length of the gray solid arrow at the second detection temperature; Delta RFU: about 3,500).

[0400]

[0401] (Implementation Example 1-2) Combination 2

[0402] In one embodiment, both the first and second target nucleic acid detection compositions are InterSC compositions.

[0403] As a specific embodiment, the signal-change temperature range of each of the first and second target nucleic acid detection compositions, which are all composed of the InterSC composition, can be controlled as shown in FIG. 7. In this case, the first detection temperature and the second detection temperature are selected in the same manner as in the above-described embodiment 1-1. In FIG. 7, the signal intensity (i.e., signal change depending on the presence or absence of the second target nucleic acid) for the second target nucleic acid at the selected first detection temperature (about 68°C) and second detection temperature (about 83°C) is indicated by a gray solid arrow, and the signal intensity (i.e., signal change depending on the presence or absence of the first target nucleic acid) for the first target nucleic acid at the first detection temperature is indicated by a gray dotted arrow. As shown in FIG. 7, the signal intensity for the second target nucleic acid at the first detection temperature (length of the gray solid arrow at the first detection temperature; Delta RFU: about 1,300) is 0.5 times or less than the signal intensity for the second target nucleic acid at the second detection temperature (length of the gray solid arrow at the second detection temperature; Delta RFU: about 3,100).

[0404]

[0405] (Example 1-3) Combination 3

[0406] In one embodiment, the first target nucleic acid detection composition is an UnderSC composition, and the second target nucleic acid detection composition is an OverSC composition.

[0407] As a specific embodiment, the signal-change temperature ranges of each of the first and second target nucleic acid detection compositions comprising the UnderSC composition and the OverSC composition can be controlled as shown in FIG. 8. In this case, the first detection temperature and the second detection temperature are selected in the same manner as in the above-described embodiment 1-1. In FIG. 8, the signal intensity (i.e., signal change depending on the presence or absence of the second target nucleic acid) for the second target nucleic acid at the selected first detection temperature (about 64°C) and second detection temperature (about 83°C) is indicated by a gray solid arrow, and the signal intensity (i.e., signal change depending on the presence or absence of the first target nucleic acid) for the first target nucleic acid at the first detection temperature is indicated by a gray dotted arrow. As shown in FIG. 8, the signal intensity for the second target nucleic acid at the first detection temperature (length of the gray solid arrow at the first detection temperature; Delta RFU: about 1,300) is 0.5 times or less than the signal intensity for the second target nucleic acid at the second detection temperature (length of the gray solid arrow at the second detection temperature; Delta RFU: about 4,000).

[0408]

[0409] (Example 1-4) Combination 4

[0410] In one embodiment, the first target nucleic acid detection composition is an InterSC composition, and the second target nucleic acid detection composition is an OverSC composition.

[0411] As a specific embodiment, the signal-change temperature ranges of each of the first and second target nucleic acid detection compositions comprising the InterSC composition and the OverSC composition can be controlled as shown in FIG. 9. In this case, the first detection temperature and the second detection temperature are selected in the same manner as in the above-described embodiment 1-1. In the case of FIG. 9, the signal intensity (i.e., signal change depending on the presence or absence of the second target nucleic acid) for the second target nucleic acid at the selected first detection temperature (about 69°C) and second detection temperature (about 88°C) is indicated by a gray solid arrow, and the signal intensity (i.e., signal change depending on the presence or absence of the first target nucleic acid) for the first target nucleic acid at the first detection temperature is indicated by a gray dotted arrow. As shown in FIG. 9, the signal intensity for the second target nucleic acid at the first detection temperature (length of the gray solid arrow at the first detection temperature; Delta RFU: about 1,300) is 0.5 times or less than the signal intensity for the second target nucleic acid at the second detection temperature (length of the gray solid arrow at the second detection temperature; Delta RFU: about 4,000).

[0412]

[0413] Implementation Example 2. When the first detection temperature is higher than the second detection temperature

[0414]

[0415] Table 2 shows various examples of combinations of first and second target nucleic acid detection compositions where the first detection temperature is higher than the second detection temperature.

[0416] As described above in Embodiment 1, the signal-change temperature range and signal-constant temperature range(s) of the target nucleic acid detection composition used in the present disclosure can be controlled by adjusting the length and / or sequence of the dimer provided by the target nucleic acid detection composition. That is, by controlling the signal-change temperature range and signal-constant temperature range of each of the first and second target nucleic acid detection compositions, the first and second target nucleic acid detection compositions satisfying the above-described requirements can be configured, and the first and second detection temperatures can be selected from their signal-change temperature ranges.

[0417]

[0418] Composition for detecting target nucleic acid 1 Composition for detecting target nucleic acid 2 Composition for detecting target nucleic acid 5 InterSC composition UnderSC composition 6 OverSC composition UnderSC composition 7 InterSC composition InterSC composition 8 OverSC composition InterSC composition

[0419] (Implementation Example 2-1) Combination 5

[0420] In one embodiment, the first target nucleic acid detection composition is an InterSC composition, and the second target nucleic acid detection composition is an UnderSC composition.

[0421] As a specific embodiment, the signal-change temperature ranges of each of the first and second target nucleic acid detection compositions comprising the InterSC composition and the UnderSC composition can be controlled as shown in FIG. 10. In this case, the first detection temperature is selected within a temperature range in which the signal-change temperature range of the first target nucleic acid detection composition overlaps with the temperature sub-range of the second target nucleic acid detection composition, and the second detection temperature is selected within a signal-change temperature range of the second target nucleic acid detection composition that does not overlap with the signal-change temperature range of the first target nucleic acid detection composition. In particular, the first and second detection temperatures are selected within a temperature range in which the signal intensity (i.e., signal change) for the second target nucleic acid by the second target nucleic acid detection composition at the first detection temperature is 0.5 times or less than the signal intensity (i.e., signal change) for the second target nucleic acid by the second target nucleic acid detection composition at the second detection temperature. In FIG. 10, the signal intensity (i.e., signal change depending on the presence or absence of the second target nucleic acid) for the second target nucleic acid at the selected first detection temperature (about 73°C) and second detection temperature (about 58°C) is indicated by a gray solid arrow, and the signal intensity (i.e., signal change depending on the presence or absence of the first target nucleic acid) for the first detection temperature is indicated by a gray dotted arrow. As shown in FIG. 10, the signal intensity (length of the gray solid arrow at the first detection temperature; Delta RFU: about 1,100) for the second target nucleic acid at the first detection temperature is 0.5 times or less than the signal intensity (length of the gray solid arrow at the second detection temperature; Delta RFU: about 4,000).

[0422]

[0423] (Implementation Example 2-2) Combination 6

[0424] In one embodiment, the first target nucleic acid detection composition is an OverSC composition, and the second target nucleic acid detection composition is an UnderSC composition.

[0425] As a specific embodiment, the signal-change temperature ranges of each of the first and second target nucleic acid detection compositions comprising the OverSC composition and the UnderSC composition can be controlled as shown in FIG. 11. In this case, the first detection temperature and the second detection temperature are selected in the same manner as in the above-described embodiment 2-1. In FIG. 11, the signal intensity (i.e., signal change depending on the presence or absence of the second target nucleic acid) for the second target nucleic acid at the selected first detection temperature (about 78°C) and second detection temperature (about 64°C) is indicated by a gray solid arrow, and the signal intensity (i.e., signal change depending on the presence or absence of the first target nucleic acid) for the first target nucleic acid at the first detection temperature is indicated by a gray dotted arrow. As shown in FIG. 11, the signal intensity for the second target nucleic acid at the first detection temperature (length of the gray solid arrow at the first detection temperature; Delta RFU: about 1000) is 0.5 times or less than the signal intensity for the second target nucleic acid at the second detection temperature (length of the gray solid arrow at the second detection temperature; Delta RFU: about 3,900).

[0426]

[0427] (Example 2-3) Combination 7

[0428] In one embodiment, both the first and second target nucleic acid detection compositions are InterSC compositions.

[0429] As a specific implementation example, the signal-change temperature ranges of each of the first and second target nucleic acid detection compositions, which are all composed of the InterSC composition, can be controlled as shown in FIG. 12. In this case, the first detection temperature and the second detection temperature are selected in the same manner as in the above-described implementation example 2-1. In FIG. 12, the signal intensity (i.e., signal change depending on the presence or absence of the second target nucleic acid) for the second target nucleic acid at the selected first detection temperature (about 78°C) and second detection temperature (about 61°C) is indicated by a gray solid arrow, and the signal intensity (i.e., signal change depending on the presence or absence of the first target nucleic acid) for the first target nucleic acid at the first detection temperature is indicated by a gray dotted arrow. As shown in FIG. 12, the signal intensity for the second target nucleic acid at the first detection temperature (length of the gray solid arrow at the first detection temperature; Delta RFU: about 800) is 0.5 times or less than the signal intensity for the second target nucleic acid at the second detection temperature (length of the gray solid arrow at the second detection temperature; Delta RFU: about 2,000).

[0430]

[0431] (Example 2-4) Combination 8

[0432] In one embodiment, the first target nucleic acid detection composition is an OverSC composition, and the second target nucleic acid detection composition is an InterSC composition.

[0433] As a specific embodiment, the signal-change temperature ranges of each of the first and second target nucleic acid detection compositions comprising the OverSC composition and the InterSC composition can be controlled as shown in FIG. 13. In this case, the first detection temperature and the second detection temperature are selected in the same manner as in the above-described embodiment 2-1. In FIG. 13, the signal intensity (i.e., signal change depending on the presence or absence of the second target nucleic acid) for the second target nucleic acid at the selected first detection temperature (about 85°C) and second detection temperature (about 65°C) is indicated by a gray solid arrow, and the signal intensity (i.e., signal change depending on the presence or absence of the first target nucleic acid) for the first target nucleic acid at the first detection temperature is indicated by a gray dotted arrow. As shown in FIG. 13, the signal intensity for the second target nucleic acid at the first detection temperature (length of the gray solid arrow at the first detection temperature; Delta RFU: about 600) is 0.5 times or less than the signal intensity for the second target nucleic acid at the second detection temperature (length of the gray solid arrow at the second detection temperature; Delta RFU: about 1,800).

[0434]

[0435] When the intensity of the signal for the second target nucleic acid at the first detection temperature exceeds 0.5 times the intensity of the signal for the second target nucleic acid at the second detection temperature, the proportion of the signal for the second target nucleic acid among the total signal (the sum of the signal for the first target nucleic acid and the signal for the second target nucleic acid) measured at the first detection temperature increases. This increase in the proportion affects the accuracy and reliability of the final target nucleic acid detection result due to the variability of the value (e.g., Ct value) for determining the presence or absence of the target nucleic acid. On the other hand, when the intensity of the signal for the second target nucleic acid at the first detection temperature is 0.5 times or less the intensity of the signal for the second target nucleic acid at the second detection temperature, the proportion of the signal for the second target nucleic acid among the total signal measured at the first detection temperature can be significantly reduced, which can contribute to obtaining a more accurate extraction signal. That is, when the proportion of the signal for the second target nucleic acid among the signals measured at the first detection temperature is high, when extracting only the signal for the first target nucleic acid from the signal measured at the first detection temperature, the signal for the second target nucleic acid may have a large influence, whereas when the proportion of the signal for the second target nucleic acid among the signals measured at the first detection temperature is low, when extracting only the signal for the first target nucleic acid from the signal measured at the first detection temperature, the influence of the signal for the second target nucleic acid may be reduced, which may contribute to obtaining a more accurate extraction signal.

[0436] In one embodiment, the signal intensity for the second target nucleic acid at the first detection temperature may be no greater than 0.5 times, no greater than 0.45 times, no greater than 0.40 times, no greater than 0.35 times, no greater than 0.30 times, no greater than 0.25 times, no greater than 0.20 times, no greater than 0.15 times, no greater than 0.10 times, or any value therebetween, the signal intensity for the second target nucleic acid at the second detection temperature. However, this excludes the case where the signal intensity for the second target nucleic acid at the first detection temperature is too low compared to the signal intensity for the second target nucleic acid at the second detection temperature. In this case, the signal for the second target nucleic acid may be considered absent at the first detection temperature, which does not satisfy the requirement of the method of the present disclosure that the first detection temperature is a temperature at which both the signal for the first target nucleic acid and the signal for the second target nucleic acid are detectable.

[0437] In certain embodiments, the signal intensity for the second target nucleic acid at the first detection temperature is 0.1 to 0.5 times, or 0.2 to 0.5 times, the signal intensity for the second target nucleic acid at the second detection temperature.

[0438] According to the present disclosure, measurement of a signal is performed using a single detection channel.

[0439] The term “single detection channel” as used herein refers to a detection means for a single type of signal. In a detector comprising several channels (e.g., photodiodes) for several different types of signals, each channel (e.g., photodiodes) corresponds to a “single detection channel.”

[0440] In the present invention, each of the first and second target nucleic acid detection compositions comprises the same type of label, e.g., a fluorescent label, and thus the signals provided therefrom are not distinguished from each other by the single detection channel.

[0441] The term “signals that are not distinguished from each other by a single detection channel” above means that the signals are not distinguished from each other by a single detection channel due to their identical or substantially identical signal characteristics (e.g., optical characteristics, emission wavelengths, and electrical signals). For example, when the same label (e.g., FAM) is used for two target nucleic acids and a single detection channel is used to detect the emission wavelengths from the labels, the single detection channel cannot distinguish between the signals from the labels. For example, when both target nucleic acids are present, at a first detection temperature, the sum of the signal (signal change) for the first target nucleic acid and the signal (signal change) for the second target nucleic acid is detected. This will be explained with reference to FIG. 6, at the first detection temperature, the sum of the signal for the first target nucleic acid, indicated by the length of the gray dotted arrow, and the signal for the second target nucleic acid, indicated by the length of the gray solid arrow, is detected.

[0442] It is preferable that the first and second detection temperatures are spaced apart from each other by a predetermined interval to ensure the provision or non-provision of a signal by the target nucleic acid detection composition at each detection temperature. For example, the first and second detection temperatures may be spaced apart from each other by at least 2°C, 3°C, 4°C, 5°C, 7°C, 8°C, 9°C, 10°C, 11°C, 12°C, 15°C, or 20°C.

[0443] In one embodiment, the first and second detection temperatures are 45°C to 97°C, 45°C to 96°C, 45°C to 95°C, 45°C to 94°C, 45°C to 93°C, 45°C to 92°C, 45°C to 91°C, 45°C to 90°C, 46°C to 97°C, 46°C to 96°C, 46°C to 95°C, 46°C to 94°C, 46°C to 93°C, 46°C to 92°C, 46°C to 91°C, 46°C to 90°C, 47°C to 97°C, 47°C to 96°C, 47°C to 95°C, 47°C to 94°C, 47°C to 93°C, 47°C to 92°C, 47°C to 91℃, 47℃ to 90℃, 48℃ to 97℃, 48℃ to 96℃, 48℃ to 95℃, 48℃ to 94℃, 48℃ to 93℃, 48℃ to 92℃, 48℃ to 91℃, 48℃ to 90℃, 49℃ to 97℃, 49℃ to 96℃, 49℃ to 95℃, 49℃ to 94℃, 49℃ to 93℃, 49℃ to 92℃, 49℃ to 91℃, 49℃ to 90℃, 50℃ to 97℃, 50℃ to 96℃, 50℃ to 95℃, 50℃ to 94℃, 50℃ to 93℃, 50℃ to 92℃, 50℃ to 91℃ or It can be selected from a temperature range of 50℃ to 90℃.

[0444] In one embodiment, the lower detection temperature among the first and second detection temperatures can be selected from a temperature range of 45°C to 70°C, 45°C to 68°C, 45°C to 65°C, 45°C to 63°C, 45°C to 60°C, 45°C to 58°C, 45°C to 55°C, 48°C to 70°C, 48°C to 68°C, 48°C to 65°C, 48°C to 63°C, 48°C to 60°C, 48°C to 58°C, 48°C to 55°C, 50°C to 70°C, 50°C to 68°C, 50°C to 65°C, 50°C to 63°C, 50°C to 60°C, 50°C to 58°C, 50°C to 55°C.

[0445] In one embodiment, the higher detection temperature among the first and second detection temperatures is 70°C to 97°C, 70°C to 95°C, 70°C to 93°C, 70°C to 90°C, 73°C to 97°C, 73°C to 95°C, 73°C to 93°C, 73°C to 90°C, 75°C to 97°C, 75°C to 95°C, 75°C to 93°C, 75°C to 90°C, 78°C to 97°C, 78°C to 95°C, 78°C to 93°C, 78°C to 90°C, 80°C to 97°C, 80°C to 95°C, 80°C to 93°C, 80°C to 90°C, 83°C to 97°C, 83°C to 95°C, 83°C to It can be selected from the temperature range of 93°C, 83°C to 90°C, 85°C to 97°C, 85°C to 95°C, 85°C to 93°C or 85°C to 90°C.

[0446] The detection temperatures mentioned above are for illustrative purposes only, and those skilled in the art will be able to adjust the detection temperatures appropriately to achieve the best results.

[0447]

[0448] Step (b): Determination of the presence of the first and second target nucleic acids

[0449] In this step, the presence of the first and second target nucleic acids is determined from signals measured at the first and second detection temperatures.

[0450] In the present disclosure, since a signal measured at a single-signal detection temperature (i.e., a second detection temperature) is derived from one target nucleic acid (i.e., a second target nucleic acid), the presence of the one target nucleic acid can be directly determined from the signal itself measured at the single-signal detection temperature, whereas a signal measured at a combined-signal detection temperature (i.e., a first detection temperature) is derived from two target nucleic acids (i.e., the first and second target nucleic acids), it is not possible to know which target nucleic acid the signal measured at the combined-signal detection temperature indicates. Therefore, the presence of the second target nucleic acid is determined by the signal measured at the second detection temperature. The presence of the first target nucleic acid is determined by the difference between the signal measured at the first detection temperature and the signal measured at the second detection temperature.

[0451] The signal used to determine the presence of the target nucleic acid includes various signal characteristics obtained from signal measurement, such as signal intensity (e.g., RFU (relative fluorescence unit) value or, in the case of performing amplification, RFU value at a specific cycle, selected cycle or end-point), signal change shape (or pattern) or Ct value, or values ​​obtained by mathematically processing the above characteristics.

[0452] In one embodiment, when the amplification curve is obtained by real-time PCR, various signal values ​​(or characteristics) from the amplification curve can be selected for use in determining the presence of the target.

[0453] The characteristics of the signal obtained at the second detection temperature itself can be used to determine the presence of the second target nucleic acid.

[0454] Alternatively, a modified signal provided by mathematically processing the characteristics of the signal may be used to determine the presence of the second target nucleic acid.

[0455] The signal characteristics at the first detection temperature itself and the signal characteristics at the second detection temperature itself can be used to obtain the difference between the signals at the first and second detection temperatures.

[0456] Alternatively, one or both of the signals at the first and second detection temperatures can be modified by mathematically processing the characteristics of the signals and used to obtain the difference between the signals at the first and second detection temperatures.

[0457] The term “signal” herein includes not only the signal itself obtained at the detection temperature but also a modified signal provided by mathematically processing the signal.

[0458] In one embodiment, when the mathematical processing is performed, the characteristics of the signal must be characteristics that allow mathematical processing. In a specific embodiment, the mathematical processing includes performing calculations using the signal (e.g., addition, multiplication, subtraction, and division) or obtaining another value derived from the signal. In the present disclosure, the signal used to determine the presence of the target nucleic acid is generally a significant signal. That is, the signal is a signal that is generated dependently on the presence of the target nucleic acid.

[0459] In one embodiment, the significance of the signal can be determined using a threshold value. For example, a threshold value can be predetermined from a negative control, taking into account the background signal, sensitivity, or label used of the detector, and then the signal significance can be determined.

[0460] Meanwhile, when calculating the difference between signals measured at the first and second detection temperatures, insignificant signals, such as background signals, may be used to calculate the difference. In this regard, it should be understood that the signal used to determine the presence of a target nucleic acid encompasses not only significant signals but also insignificant signals, as long as they can be used to calculate the difference or participate in the determination process. Insignificant signals may be expressed herein as "absence of a signal" or "non-detection of a signal."

[0461] In one implementation, the significance of a detected signal can be determined using a threshold value. For example, a threshold value can be pre-determined from a negative control, taking into account the background signal, sensitivity, or label used in the detector, and then the significance of the signal from the sample can be determined.

[0462]

[0463] According to the method of the present disclosure, for a second detection temperature, which is a single-signal detection temperature, the presence of a second target nucleic acid is determined by a single signal measured at the second detection temperature. That is, if a signal (i.e., a significant signal) is detected at the second detection temperature, the presence of the second target nucleic acid is determined. Conversely, if no significant signal is detected at the second detection temperature, the presence of the second target nucleic acid is determined to be absent.

[0464] The term “by a signal” as used herein in connection with determining the presence of a target nucleic acid means that the presence of a target nucleic acid is determined by directly or indirectly utilizing or modifying a measured signal, including utilizing the numerical value of the signal or a modification thereof, utilizing the presence / absence of the signal, and comparing the signal to a threshold.

[0465] The term “determination by a signal” as used herein in connection with determining the presence of a target nucleic acid may include determining the presence of a target nucleic acid by considering the significance of a signal measured at a detection temperature.

[0466] In the present disclosure, the presence of the first target nucleic acid is determined by a signal measured at a first detection temperature and a signal measured at a second detection temperature.

[0467] The signal measured at the first detection temperature alone cannot determine the presence of the first target nucleic acid. This is because, at the first detection temperature, signals for the first and second target nucleic acids may be detected in an indistinguishable manner. For example, at the first detection temperature, signals that are indistinguishable (i.e., a combined signal) may be provided by both the first and second target nucleic acid detection compositions, making it impossible to determine whether the measured signal is provided by the first target nucleic acid detection composition, the second target nucleic acid detection composition, or both the first and second target nucleic acid detection compositions.

[0468] Therefore, the method of the present disclosure uses the signal measured at the second detection temperature to analyze the signal measured at the first detection temperature.

[0469] When a signal indicating the presence of a single target nucleic acid in a single reaction vessel is detected at two predetermined detection temperatures, a signal change in a specific pattern (rule) exists (U.S. Patent Application Publication No. 2017-0247750 or 2019-0024155). That is, the signal change between the signal detected at the first detection temperature and the signal detected at the second detection temperature for the second target nucleic acid exhibits a specific pattern (rule). For example, the intensities of the signals at the two detection temperatures may be the same or substantially the same, or the intensities of the signals may be different but exist within a specific range. Based on the specific pattern (rule) in the signal change between these two detection temperatures, the signal detected at the second detection temperature can be used to analyze the signal detected at the first detection temperature.

[0470] In one embodiment, the method of the present disclosure is performed under conditions where there is a specific pattern (rule) in the signal change between two detection temperatures for the target nucleic acid.

[0471] In one embodiment, the presence of the first target nucleic acid is determined by analyzing the signal detected at the first detection temperature using the signal detected at the second detection temperature to determine whether the signal detected at the first detection temperature includes a signal provided by the first target nucleic acid.

[0472] Analysis of the signal detected at the first detection temperature using the signal detected at the second detection temperature can be performed by obtaining the difference between the signal detected at the first detection temperature and the signal detected at the second detection temperature and analyzing the difference.

[0473] The difference between the signals detected at the two detection temperatures can be obtained using a wide variety of approaches.

[0474] The term "difference" as used herein in connection with "difference between signals (or utilizing the difference between signals)" includes not only differences obtained by mathematically processing the signals themselves or transformed signals, but also differences resulting from the presence or absence of signals. For example, the difference may be obtained by calculating a ratio or subtraction between signals measured at two detection temperatures. Alternatively, the difference may be obtained by transforming a signal at one detection temperature and comparing it to a signal at another detection temperature. The difference between signals measured at two detection temperatures may be expressed in various aspects. For example, the difference may be expressed as a number, as the presence / absence of a signal, or as a plot of signal characteristics.

[0475] In one embodiment, the difference between the signals measured at the two detection temperatures comprises a difference obtained by mathematically processing the signals measured at the two detection temperatures.

[0476] In one embodiment, if no signal is detected at the second detection temperature, the presence of the first target nucleic acid is determined by the signal measured at the first detection temperature, taking into account that no signal is detected at the second detection temperature. This embodiment demonstrates that the presence of the first target nucleic acid can be determined by utilizing the difference between the presence and absence of a signal at two detection temperatures.

[0477] In one implementation, the background signal detected at the second detection temperature may be processed as “0” or “1” to calculate the difference.

[0478] In one implementation, if a negative value is obtained during the calculation, the negative value can be converted to an absolute value and used to obtain the difference.

[0479] In one embodiment, the signal for the second target nucleic acid is a calculation parameter for analyzing the signal for the first target nucleic acid.

[0480] In one embodiment, the difference between the signal measured at the first detection temperature and the signal measured at the second detection temperature and the signal for determining the presence of the second target nucleic acid may have different dimensions or units, or may have the same dimensions or units.

[0481] The term "determined by a difference" as used herein includes determining by the occurrence / non-occurrence of a difference, determining by the value or range of the difference having a numerical value, and determining by the result of plotting the difference. Furthermore, "determined by a difference" includes obtaining a value (e.g., Ct) for the first target nucleic acid based on the difference.

[0482] The term “by a difference” as used in connection with determining the presence of a target nucleic acid in the specification means that the presence of the target nucleic acid is determined by directly or indirectly utilizing or modifying the difference, including utilizing the numerical value of the difference or a variation thereof, utilizing the presence / absence of a signal, and comparing the difference to a threshold. The terms “by a difference” and “by using a difference” may be used interchangeably herein.

[0483] Mathematical processing of the above signal can be performed by various computational methods and their variations.

[0484] In one embodiment, the mathematical processing of the signals to obtain the difference between the signals is the calculation of the ratio of the signals measured at the two detection temperatures.

[0485] The term “ratio” as used herein refers to the relationship between two numbers. By using the ratio, the presence of the first target nucleic acid can be determined. If the ratio of the signals measured at the two detection temperatures is significant, this is an indicator of the presence of the first target nucleic acid. For example, if the ratio of the endpoint intensities of the signals measured at the two detection temperatures is significant (i.e., an increase in the endpoint intensity), this indicates the presence of the first target nucleic acid. For example, if the ratio is significantly greater or significantly lower than the ratio of the endpoint intensities of the signals at the two detection temperatures exhibited by a sample in which only the second target nucleic acid is present, this may indicate the presence of the first target nucleic acid.

[0486] In one embodiment, depending on the approach for obtaining the difference, a threshold may be used to analyze whether the obtained difference indicates the presence of the first target nucleic acid. For example, the threshold may be predetermined based on differences obtained from reference samples containing the first and second target nucleic acids. Negative controls, sensitivity, or the label used may additionally be considered in determining the threshold.

[0487] In one embodiment, depending on the approach for obtaining the difference, the presence of the first target nucleic acid can be determined using the obtained difference itself. For example, the signal at the second detection temperature can be multiplied by a threshold, and then the difference between the multiplied signal and the signal at the first detection temperature can be obtained. In particular, the threshold is predetermined in consideration of the difference obtained from a reference sample containing the first and second target nucleic acids.

[0488] In one implementation, the threshold is determined by the user or automatically.

[0489] In one embodiment, when the difference between the signal at the first detection temperature and the signal at the second detection temperature for the second target nucleic acid becomes larger, the threshold can be used to reduce detection errors.

[0490] In one embodiment, if the signal provided by the second target nucleic acid has a pattern (or rule) that shows little or no difference between the two detection temperatures, the signal measured at the second detection temperature can be used without further modification to calculate the difference or use the difference to determine the presence of the first target nucleic acid.

[0491] In one embodiment, if the signal has a pattern (or rule) indicating a difference within a specific range, the signal at the second detection temperature can be modified to reflect the difference in determining the presence of the first target nucleic acid.

[0492] In one embodiment, the difference between the signals provided by the second target nucleic acid at the first and second detection temperatures can be expressed through a reference value. That is, the presence of the first target nucleic acid can be determined by the difference between the signals measured at the first and second detection temperatures using the reference value.

[0493] The term “reference value” as used herein describes, particularly numerically, the relationship or degree of signal change, signal variation, or signal difference when two signals occur at different detection temperatures (i.e., a first detection temperature and a second detection temperature). In other words, the “reference value” includes any value that reflects a pattern (rule) of signal variation at different detection temperatures. Furthermore, the term “reference value” refers to a value indicating the degree of variation between signals measured at two detection temperatures for a specific target nucleic acid. The reference value may refer to a value used to convert, transform, adjust, or transform a signal detected at one temperature into a signal at another temperature. The reference value may vary depending on the type of target nucleic acid, the type of composition for detecting the target nucleic acid, and the conditions of incubation and detection. Therefore, various reference values ​​may be determined for different or the same target nucleic acid.

[0494] A reference value can be expressed in various ways. For example, a reference value can be expressed as a numerical value, the presence / absence of a signal, or a plot with signal characteristics.

[0495] In one embodiment, the reference value may be determined by considering the signal value in the selected cycle. That is, the reference value may be determined by considering the signal value in the selected cycle among the signals measured at the first and second detection temperatures. In this case, the selected cycle may be one of the cycles following the baseline region of the amplification curve, specifically, one of the cycles in the plateau region, and more specifically, the last cycle.

[0496] In an alternative implementation, the reference value may be determined by considering multiple signal values ​​in different selected cycles. For example, the reference value may be determined by considering the average of multiple signal values ​​in different selected cycles.

[0497] The reference values ​​will be explained in more detail below.

[0498] The reference value can be determined in advance by incubating the target nucleic acid with the composition for detecting the target nucleic acid, measuring signals at first and second detection temperatures, and then obtaining a relationship between changes in the signals measured at the first and second detection temperatures.

[0499] In one embodiment, the reference value is predetermined using a standard material corresponding to the target nucleic acid.

[0500] In one embodiment, the reference value is predetermined from a control reaction. For example, the reference value is obtained by a method comprising: (i) incubating the second target nucleic acid with the composition for detecting the second target nucleic acid in a reaction vessel different from the single reaction vessel used in step (a); (ii) measuring signals at both the first detection temperature and the second detection temperature; and (iii) calculating the difference between the signal measured at the first detection temperature and the signal measured at the second detection temperature. In one embodiment, the difference between the signals measured at the two detection temperatures obtained in (iii) is a single value, and the value is used as the reference value with or without modification.

[0501] The reference value can be determined in advance by obtaining a certain range of values ​​through repeated reactions for a control reaction (or control sample) under various conditions (e.g., concentration of target nucleic acid and type of primer) and selecting an appropriate value from among the obtained values.

[0502] In one embodiment, the reference value may be selected such that signals for target nucleic acids that are not to be extracted are removed in the mathematical expression II described below. In another embodiment, the reference value may be selected such that signals for target nucleic acids to be extracted are not removed or are removed as little as possible. In yet another embodiment, the reference value may be selected such that signals for target nucleic acids that are not to be extracted are removed and signals for target nucleic acids to be extracted are not removed or are removed as little as possible. For example, when extracting signals for a first target nucleic acid using a reference value, the reference value may be selected such that signals for a second target nucleic acid are removed and signals for the first target nucleic acid are not removed.

[0503] The reference value can be obtained empirically by repeated experiments.

[0504] The reference value can be selected from a specific range empirically obtained through repeated experiments. In this regard, it is advantageous to select a relatively high value within the above range as the reference value, as a relatively high reference value is more likely to eliminate signals that are not intended to be extracted compared to a relatively low reference value. For example, if a range of 0.3 to 0.5 is obtained, a value of about 0.5 may be more suitable as the reference value. Alternatively, a value exceeding the above range can be selected as the reference value. For example, a value that is 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% greater than the upper limit of the above range can be selected as the reference value. However, it should be noted that an excessively high reference value is not desirable, as it may eliminate signals that are intended to be extracted.

[0505] In one embodiment, the reference value can be calculated by the difference between the signal for the second target nucleic acid at the first detection temperature and the signal for the second target nucleic acid at the second detection temperature.

[0506] In one embodiment, the reference value can be calculated by mathematically processing the signal for the second target nucleic acid at the first detection temperature and the signal for the second target nucleic acid at the second detection temperature.

[0507] In certain implementations, mathematical processing includes computations (e.g., addition, multiplication, subtraction, and division) using signals or other values ​​derived from signals.

[0508] The mathematical processing to obtain a reference value can be performed in various ways. The mathematical processing can be performed mechanically. For example, the signal can be processed mathematically by a processor in a detector or real-time PCR device. Alternatively, the signal can be processed manually, specifically according to a predetermined algorithm.

[0509] In one embodiment, the reference value can be obtained by calculating the ratio or subtraction between the signals measured at the two detection temperatures. In one embodiment, the reference value is obtained by calculating the ratio of the signal measured at the first detection temperature to the signal measured at the second detection temperature. In one embodiment, the reference value is obtained by calculating the ratio of the signal measured at the second detection temperature to the signal measured at the first detection temperature.

[0510] In one implementation, the reference value can be calculated by averaging the ratios in several cycles, for example, two consecutive cycles, three cycles, four cycles, five cycles, etc. In addition, the reference value can be suitably selected by considering the ratios in several cycles. For example, the reference value can be selected as a ratio of the signal value in a selected cycle or a value slightly higher than the ratios of the signal values ​​in several cycles.

[0511] In certain embodiments, the reference value may be calculated according to the following mathematical formula (I):

[0512] [Formula I]

[0513] Reference value = [Signal measured at the first detection temperature for a sample containing only the second target nucleic acid] ÷ [Signal measured at the second detection temperature for a sample containing only the second target nucleic acid]

[0514] In the mathematical formulas described herein, the symbol “÷” represents division.

[0515] In a specific example, when the signals at the first and second detection temperatures for the second target nucleic acid are the same or substantially the same, and the degree of difference between the first and second signals is calculated by subtraction of the signals, the reference value is '0' for the signals at the two detection temperatures for the second target nucleic acid, and when the degree of difference between the signals at the two detection temperatures is calculated by division of the signals, the reference value is '1' for the signals at the two detection temperatures for the second target nucleic acid. In another specific example, when the signals at the first and second detection temperatures for the second target nucleic acid are different from each other, and the degree of difference between the two signals is calculated by subtraction of the signals, the reference value for the signals at the two detection temperatures for the second target nucleic acid is a positive value other than '0' or a negative value, and when the degree of difference between the signals at the two detection temperatures is calculated by division of the signals, the reference value for the signals at the two detection temperatures for the second target nucleic acid is more than 1 or less than 1 other than '1'.

[0516] The present inventors have confirmed that the variability of the value (e.g., Ct value) for determining the presence of a target nucleic acid due to errors between reactions, such as errors between reagents (e.g., changes in Tm values ​​of primers, probes, etc.), errors between equipment (e.g., temperature errors between wells or equipment), or errors between experimenters, in determining the presence of a target nucleic acid by the difference between signals detected at different detection temperatures (i.e., first and second detection temperatures) may affect the accuracy and reliability of the final target nucleic acid detection result. Accordingly, the present inventors have endeavored to develop a method by which such variability can be minimized. As a result, the present inventors have confirmed that the variability of the result (e.g., Ct value) can be reduced by making the intensity of the signal for the second target nucleic acid at the first detection temperature 0.5 times or less of the intensity of the signal for the second target nucleic acid at the second detection temperature, thereby improving the accuracy and reliability of the result.

[0517] Therefore, a feature of the method according to the present disclosure is that it uses a composition for detecting a target nucleic acid and a detection temperature at which the intensity of the signal for the second target nucleic acid at the first detection temperature is 0.5 times or less than the intensity of the signal for the second target nucleic acid at the second detection temperature. In other words, when the degree of difference between the signals for the second target nucleic acid at the first and second detection temperatures in the present disclosure is calculated by division of the signals, the reference value for the signals for the second target nucleic acid at the two detection temperatures is 0.5 or less.

[0518] In one embodiment, the reference value may be used to obtain the difference between the signals at the two detection temperatures. For example, the signal at the second detection temperature may be multiplied or divided by the reference value of the second target nucleic acid, and then the difference between the multiplied or divided signal and the signal at the first detection temperature may be obtained. In another example, the signal at the first detection temperature may be multiplied or divided by the reference value of the second target nucleic acid, and then the difference between the multiplied or divided signal and the signal at the second detection temperature may be obtained.

[0519] In one embodiment, a reference value is used to determine a threshold. In one embodiment of the present disclosure, the reference value is used as a threshold, with or without modification. The terms "threshold" and "reference value" used herein to determine the presence of a target nucleic acid by analyzing the difference between signals may have the same value or have the same meaning.

[0520] Alternatively, when the reference value is used to obtain the difference between the signals at the first and second detection temperatures, it may be used as an additional threshold to determine the significance of the difference, i.e., to determine whether the difference indicates the presence of the first target nucleic acid.

[0521] For a target nucleic acid, a reference value can be obtained under various reaction conditions, including the amount of a component (e.g., target nucleic acid, target nucleic acid detection composition), buffer pH, or reaction time. In one embodiment, the reference value can be obtained under reaction conditions sufficient to provide a saturated signal upon completion of the reaction. In one embodiment, the difference between signals obtained during reference value calculation has a specific range, and the reference value is selected within or with reference to the specific range. In one embodiment, the reference value can be selected as the maximum or minimum value of the specific range, or can be selected with reference to the maximum or minimum value of the specific range.

[0522] In particular, the reference value can be modified by taking into account the standard variation, acceptable error ranges, specificity or sensitivity of the reference value obtained under various conditions.

[0523] In one embodiment, the reference value can be obtained under the same reaction conditions used in the sample, including the components (enzyme or amplification primer, if used), buffer pH, and reaction process. In one embodiment, the reference value can be obtained using a signal amplification process involving nucleic acid amplification or a signal amplification process without nucleic acid amplification.

[0524] In one embodiment, if there is a significant difference between the reference value and the difference obtained to determine the presence of the first target nucleic acid, the first target nucleic acid is determined to be present. The reference value may be expressed as a value of the same type as the difference obtained to determine the presence of the target nucleic acid (e.g., a ratio of end-point values ​​of signal intensity).

[0525] In a specific example, if the ratio of the end-point value of the signal intensity measured at the first detection temperature to the end-point value of the signal intensity measured at the second detection temperature is 0.9 and the reference value is 0.4, it can be determined that there is a significant difference between the reference value and the difference obtained to determine the presence of the first target nucleic acid. This indicates the presence of the first target nucleic acid.

[0526] Alternatively, the reference value may be used to calculate the difference between the signals measured at the first and second detection temperatures. For example, the difference for determining the presence of the first target nucleic acid is calculated by multiplying (or dividing) the signal measured at the second detection temperature (e.g., RFU) by the reference value of the second target nucleic acid, and then subtracting the result of the multiplication (or division) by the signal measured at the first detection temperature (e.g., RFU). If the difference is greater than (or less than) “0” or a predetermined value, the presence of the first target nucleic acid may be determined.

[0527] As another example, the difference for determining the presence of the first target nucleic acid is calculated by multiplying (or dividing) the signal (e.g., RFU) measured at the first detection temperature by the reference value of the second target nucleic acid, and then subtracting the result of the multiplication (or division) by the signal (e.g., RFU) measured at the second detection temperature. If the difference is greater than (or less than) “0” or a predetermined value, the presence of the first target nucleic acid can be determined.

[0528] In one implementation, a predetermined value may serve as a threshold.

[0529] In one embodiment, the reference value is used to determine the presence of the first target nucleic acid when a signal for the second target nucleic acid is detected or when a difference between a signal at the first detection temperature and a signal at the second detection temperature is obtained by a mathematical process.

[0530] In one embodiment, when the signal is generated in real time in relation to target amplification by PCR, the mathematical processing of the signal comprises calculating a ratio of the signal intensity measured at the first detection temperature to the signal intensity measured at the second detection temperature for each amplification cycle. The result of the calculation is plotted over the cycle and used to determine the presence of the first target nucleic acid.

[0531] In one implementation, when the signal is generated in a real-time manner related to target amplification by PCR, the Ct value is the signal for target nucleic acid detection.

[0532] The Ct value of the first target nucleic acid can be determined using signals measured at the first and second detection temperatures, and can be explained by the following example: First, real-time PCR is performed on a sample to be analyzed, and signals measured at the first and second detection temperatures are obtained, and then amplification curves for the two detection temperatures are obtained.

[0533] In the detection at the second detection temperature, if the Ct value of the second target nucleic acid is absent, the second target nucleic acid can be determined to not exist. Thereafter, the Ct value of the first target nucleic acid is calculated from the amplification curve obtained at the first detection temperature. If the first target nucleic acid is also absent, the Ct value of the first target nucleic acid is also absent.

[0534] In the detection at the second detection temperature, if the Ct value of the second target nucleic acid exists, the ratio of the RFU value obtained at the first detection temperature to the RFU value obtained at the second detection temperature in the cycle indicating the Ct value is calculated. In addition, the ratio of the RFU value obtained in the cycle after the cycle indicating the Ct value is also calculated. (i) If the ratio of all RFU values ​​is less than a reference value (e.g., a value obtained using only the second target nucleic acid as described above), the first target nucleic acid is determined not to exist. Therefore, the Ct value of the first target nucleic acid does not exist. (ii) If the ratio of all RFU values ​​is greater than the reference value, the Ct value calculated from the amplification curve obtained at the first detection temperature is determined as the Ct value of the first target nucleic acid. (iii) If the ratio of the RFU value in the cycle indicating the Ct value is less than the reference value, and the ratio of the RFU value after a specific cycle is greater than the reference value, the specific cycle is determined as the Ct value of the first target nucleic acid.

[0535] If the calculated ratio is equal to the reference value, the decision can be made arbitrarily. For example, the example described above stipulates that the decision is made based on whether the ratio is less than or greater than the reference value. Furthermore, the decision can be made based on whether the ratio is less than or greater than the reference value.

[0536] The Ct value of the first target nucleic acid may alternatively be calculated as follows: calculating the ratio of the RFU value obtained at the first detection temperature to the RFU value obtained at the second detection temperature in each cycle; and calculating the Ct value taking into account the threshold value.

[0537] The Ct value of the first target nucleic acid may alternatively be calculated as follows: the RFU value obtained at the second detection temperature for each cycle is transformed using the reference value for each cycle; the ratio of the RFU value obtained at the first detection temperature to the transformed RFU value for each cycle is calculated; and the Ct value is then calculated.

[0538] In one embodiment, utilizing the signal measured at the second detection temperature includes obtaining a qualifying value for determining the presence of the second target nucleic acid, and utilizing the difference includes obtaining a qualifying value for determining the presence of the first target nucleic acid.

[0539] In one embodiment, utilizing the difference comprises obtaining a qualitative value for determining the presence of the first target nucleic acid, wherein the qualitative value is obtained by (i) mathematically processing a signal measured at the first detection temperature and a signal measured at the second detection temperature, or (ii) if no signal is detected at the second detection temperature, using the signal measured at the first detection temperature while taking into account that no signal is detected at the second detection temperature.

[0540] The above qualitative value can be further mathematically processed to obtain a transformed value. The above qualitative value is used to determine the presence of two target nucleic acids in the sample.

[0541] In one embodiment, in step (b), the presence of the first target nucleic acid can be determined by an analysis signal. The analysis signal is obtained by a method comprising: (i-1) extracting a signal for the first target nucleic acid from a signal measured at the first detection temperature using a signal measured at the second detection temperature modified by a reference value; (i-2) selecting a cycle having a maximum signal value or a minimum signal value from the extracted signal for the first target nucleic acid; and (i-3) obtaining a signal value from the selected cycle to the last cycle as an analysis signal for the first target nucleic acid.

[0542] The above reference value is obtained by a method comprising the steps of: (ii-1) incubating the second target nucleic acid with the composition for detecting the second target nucleic acid in a reaction vessel different from the single reaction vessel used in step (a); (ii-2) measuring a signal at both the first detection temperature and the second detection temperature; and (ii-3) calculating a difference between the signal measured at the first detection temperature and the signal measured at the second detection temperature.

[0543]

[0544] In one embodiment, the extraction of the signal for the first target nucleic acid is performed by the following mathematical formula II:

[0545]

[0546] [Formula II]

[0547] Extracted signal for the first target nucleic acid = [signal measured at the first detection temperature in step (a)] - [(signal measured at the second detection temperature in step (a)) x (reference value)]

[0548] In the mathematical formulas described herein, the symbol “x” represents multiplication.

[0549] In the mathematical formulas described herein, the symbol “-” represents subtraction, specifically signal subtraction. For example, signal subtraction can be performed in each cycle by subtracting the signal value in one cycle from the signal value in the corresponding cycle in another cycle.

[0550] According to the extraction of the signal for the first target nucleic acid by mathematical equation II, the signal measured at the first detection temperature reflects a combination of the signal for the first target nucleic acid and the signal for the second target nucleic acid, whereas the signal measured at the second detection temperature reflects only the signal for the second target nucleic acid. Therefore, the signal for the first target nucleic acid can be obtained by subtracting the signal measured at the second detection temperature from the signal measured at the first detection temperature, assuming that the signal for the second target nucleic acid does not change at the first and second detection temperatures. However, considering that the signal varies depending on the detection temperature, it is necessary to adjust (convert) the signal measured at the second detection temperature to the signal expected at the first detection temperature before signal subtraction. For this purpose, a reference value is used.

[0551] Details of “extraction of signals for target nucleic acids” are disclosed in International Application Publication No. WO2018-182281, the teachings of which are incorporated herein by reference in their entirety.

[0552] As described above, it will be understood by those skilled in the art that signal extraction for the first target nucleic acid can be achieved by modifying the reference value. Those skilled in the art will appreciate that such modifications fall within the spirit and scope of the present disclosure.

[0553] Meanwhile, using the extracted signal to determine the presence of a target nucleic acid can result in false positive or false negative results when an inappropriate reference value is used. To overcome this problem, the method of the present disclosure can provide only a specific region as an analysis signal for use in determining the presence of a target nucleic acid. That is, a cycle having a maximum or minimum signal value is selected from the extracted signal for the first target nucleic acid, and then the signal values ​​from the selected cycle to the last cycle are obtained as an analysis signal for the first target nucleic acid. Subsequently, the presence of the first target nucleic acid is determined based on the obtained analysis signal.

[0554] The cycle with the maximum signal value (also referred to herein as the "maximum cycle") or the cycle with the minimum signal value (also referred to herein as the "minimum cycle") can serve as an important indicator in analyzing the extracted signal. Based on this principle, the cycle with the maximum or minimum signal value serves as a reference point for distinguishing between target-related and target-unrelated signal regions.

[0555] As used herein, the term "target-related signal region" refers to a region of an extracted signal that is considered significant for determining the presence or absence of a target nucleic acid of interest because it contains the precise signal associated with the target nucleic acid. Therefore, a "signal in a target-related signal region" is used as an analytical signal for determining the presence / absence of a target nucleic acid.

[0556] As used herein, the term “target-unrelated signal region” refers to a region of extracted signals that is considered negligible for determining the presence or absence of a target nucleic acid of interest, because the region contains inaccurate signals unrelated to the target nucleic acid. Therefore, “signals in the target-unrelated signal region” are not used as analytical signals for determining the presence / absence of a target nucleic acid.

[0557] In an exemplary implementation to more comprehensively understand the role of cycles having maximum or minimum signal values ​​when analyzing extracted signals, when a suitable reference value is used, the extracted signal for the first target nucleic acid may exhibit (i) an increasing pattern or (ii) substantially zero, whereas when an inappropriate reference value is applied, all or part of the generated extracted signal may exhibit a decreasing pattern.

[0558] Considering the above pattern, the cycle with the minimum signal value can play an important role in interpreting the extracted signal, especially the incorrectly extracted signal.

[0559] Typically, a cycle with a minimum signal value may be an inflection point where the signal changes from a decreasing pattern (i.e., a downward pattern) to an increasing pattern (i.e., an upward pattern).

[0560] Based on the above reasoning, the region before the cycle with the minimum signal value indicating a decreased pattern can be considered to reflect a faulty extraction, and the region after the cycle with the minimum signal value indicating an increased pattern can be considered to reflect a proper extraction.

[0561] In particular, a decreasing pattern appearing prior to a cycle with a minimum signal value may indicate that the signal for the first target nucleic acid was not adequately extracted to a level that substantially contributes to the signal at the first detection temperature (the expected level for adequate extraction).

[0562] Additionally, the signal value at the cycle with the minimum signal value may indicate that the signal for the target nucleic acid has been extracted to the lowest level. Conversely, an increasing pattern that appears after the cycle with the minimum signal value may indicate that the signal for the target nucleic acid has been properly extracted (if the signal value is greater than RFU 0) or that an incorrectly extracted signal is being improved or recovered (if the signal value is less than RFU 0).

[0563] Therefore, when the cycle with the minimum signal value is selected, the region showing the increasing pattern is considered significant for determining the presence or absence of the target nucleic acid, and this corresponds to the target-related signal region.

[0564] This reasoning can be applied to the role of the cycle with the maximum signal value when analyzing the extracted signal. In an exemplary embodiment, when a suitable reference value is used, the extracted signal for the target nucleic acid may exhibit (i) a decreasing pattern or (ii) substantially zero, whereas when an inappropriate reference value is used, all or part of the generated extracted signal may exhibit an increasing pattern.

[0565] Therefore, when the cycle with the maximum signal value is selected, the region showing the decreasing pattern is considered significant for determining the presence or absence of the target nucleic acid of interest, and this corresponds to the target-related signal region.

[0566] In all embodiments of the present disclosure, the target-related signal region can be used to determine the presence of a target nucleic acid, even if it contains a signal pattern that is not theoretically predicted. The target-related region can be considered to correspond to the exponential phase of the amplification curve.

[0567] It will be understood that the target-related signal region may consist of a single cycle or multiple cycles. For example, if the cycle with the maximum or minimum signal value is the last cycle, the target-related signal region consists of only one cycle; if the cycle with the maximum or minimum signal value is any cycle other than the last cycle, the target-related signal region consists of multiple cycles.

[0568] As used herein, a cycle having a maximum signal value or a minimum signal value may be referred to as a “selected cycle” or a “selected cycle.”

[0569] The selected cycle described above may be a cycle having a maximum signal value (largest signal value) or a cycle having a minimum signal value (smallest signal value).

[0570] In one embodiment, if the suitably extracted signal for the target nucleic acid exhibits a signal pattern that increases in the presence of the target nucleic acid in the sample, the selected cycle described above may be the cycle having the minimum signal value (the cycle having the smallest signal value).

[0571] In one embodiment, if the suitably extracted signal for the target nucleic acid exhibits a signal pattern that decreases in the presence of the target nucleic acid in the sample, the selected cycle described above may be the cycle having the maximum signal value (the largest signal value).

[0572] The signal value(s) (target-related region) from the above-mentioned selected cycle to the last cycle is provided as an analysis signal for determining the presence of the first target nucleic acid.

[0573] As used herein, the term “analytical signal” refers to a signal provided to determine the presence of a target nucleic acid. The term also refers to a signal ultimately used to determine the presence of a target nucleic acid.

[0574] The signal value(s) provided as the assay signal are used to determine the presence of the target nucleic acid by various methods well known in the art. For example, a predetermined threshold may be applied to the assay signal to determine the presence of the target nucleic acid. In a specific embodiment, this can be achieved by applying a threshold to a plot of the assay signal and determining whether there is an intersection between the plot and the threshold. If there is an intersection, the presence of the target nucleic acid sequence is determined; if there is no intersection, the absence of the target nucleic acid sequence is determined.

[0575] In one embodiment, the signal value(s) from the selected cycle to the last cycle are modified before being provided as an analysis signal and are then applied to determine the presence of a target nucleic acid. To this end, the method further comprises the step of modifying the signal value(s) from the selected cycle to the last cycle before being provided as an analysis signal.

[0576] As used herein, “transformation” means the process by which one signal value(s) is converted into another signal value(s) using mathematical operations (such as addition, subtraction, multiplication, division, differentiation, integration, etc.).

[0577] Modification refers to a process performed to improve user convenience when determining the presence of a target nucleic acid.

[0578] The transformation can be performed on all extracted signals, or only when certain criteria are met. The transformation can be performed only when the signal value in the selected cycle is not within a certain range (e.g., approximately RFU 0). For example, if the cycle with the maximum signal value is selected, the transformation can be performed only if the selected cycle has a signal value greater than a certain value (e.g., RFU 0). If the cycle with the minimum signal value is selected, the transformation can be performed only if the selected cycle has a signal value less than a certain value (e.g., RFU 0).

[0579] Modification of the signal can be accomplished using many methods well known in the art, as long as the modification does not adversely affect the determination of the presence or absence of the target nucleic acid.

[0580] As an example, the transformation includes shifting the signal value(s) upward or downward from the selected cycle to the last cycle.

[0581] In certain implementations, the transformation comprises shifting the signal value(s) up or down from the selected cycle to the last cycle such that the selected cycle has a signal value of 0.

[0582] As used herein, “translate” or “translates” means that the signal value(s) are moved vertically by the same amount along the Y axis.

[0583] As another example, the transformation can be performed by baselining (US 8,219,324; US 2003 / 0148332; US 2006 / 0269947; KR 10-2012-0097215).

[0584] The signal value(s) from the cycle selected as the analysis signal to the last cycle do not include the baseline region. Therefore, baseline subtraction can be performed by assuming that the signal value(s) from the first cycle to the cycle immediately preceding the selected cycle constitute the baseline region (background level). For example, if the selected cycle is the 35th cycle, baseline subtraction is performed by assuming that the region from the first cycle to the 34th cycle constitutes the baseline region.

[0585] The above described shift and baseline deductions can produce the same results.

[0586] According to the present disclosure, signal value(s) from the first cycle to the cycle immediately preceding the selected cycle can be additionally provided as analysis signals after signal adjustment.

[0587] In one embodiment, the method further comprises adjusting signal value(s) from the first cycle to the cycle immediately preceding the selected cycle to an extent that does not affect the determination of the presence of the target nucleic acid, and combining the adjusted signal value(s) with the signal value(s) from the selected cycle to the last cycle to provide an analysis signal.

[0588] That is, the target unrelated region, i.e., the signal region from the first cycle to the cycle immediately preceding the selected cycle, can be adjusted and then additionally provided as an analysis signal.

[0589] The signal value(s) from the first cycle to the cycle immediately preceding the selected cycle are target-unrelated regions, and therefore, to obtain more accurate results, these signal value(s) should be ignored when determining the presence of the target nucleic acid. Furthermore, if the signal value(s) from the first cycle to the cycle immediately preceding the selected cycle are accurately extracted, they correspond to the background region.

[0590] Therefore, in order to additionally provide the signal value(s) from the first cycle to the cycle immediately preceding the selected cycle as analysis signals, the signal value(s) must be applied to the signal adjustment process.

[0591] As used herein, the term “adjust” or “adjust” means converting a signal value(s) to a single value or values ​​within a specified range.

[0592] In one embodiment of the present invention, the adjustment comprises adjusting the signal value(s) from the first cycle to the cycle immediately preceding the selected cycle to a background level (or background signal). The adjustment refers to a process in which the signal value(s) are converted into a signal generated in the absence of any target nucleic acid, or a process in which the signal value(s) are converted into a signal indicating the absence of any target nucleic acid.

[0593] In another implementation, the adjustment to the background level comprises adjusting the signal value(s) from the first cycle to the cycle immediately preceding the selected cycle so that they are substantially equal to the signal value(s) in the selected cycle.

[0594] The phrase “substantially the same as the signal value in the selected cycle” means a value within a predetermined range taking into account the signal value in the selected cycle or a value that is the same as the signal value in the selected cycle.

[0595] In one example, adjusting to a background level involves adjusting the signal value(s) from the first cycle to the cycle immediately preceding the selected cycle to be within a predetermined range, taking into account the signal value(s) in the selected cycle.

[0596] In another example, adjusting to a background level involves adjusting the signal value(s) from the first cycle to the cycle immediately preceding the selected cycle to be equal to the signal value(s) in the selected cycle.

[0597] Note that the signal value(s) being adjusted may include signal values ​​from the selected cycle. If the selected cycle is the 35th cycle, signal values ​​from the 1st cycle to the 35th cycle may be adjusted. Alternatively, signal values ​​from the 1st cycle to the 34th cycle may be adjusted.

[0598] According to the present disclosure, the entire signal value including the adjusted signal value(s) from the first cycle to the cycle immediately preceding the selected cycle and the unadjusted signal value(s) from the selected cycle to the last cycle is provided as an analysis signal for determining the presence of a target nucleic acid.

[0599] Details of the “analysis signal” are disclosed in International Application Publication No. WO2018-182281, the teachings of which are incorporated herein by reference in their entirety.

[0600]

[0601] Hereinafter, the present invention will be described in more detail through examples. These examples are intended to illustrate the present invention more specifically, and it will be apparent to those skilled in the art that the scope of the present invention, as set forth in the appended claims, is not limited by these examples.

[0602]

[0603] Example

[0604]

[0605] Example 1: Reference value range to improve accuracy and reliability of results

[0606]

[0607] As mentioned above, errors between reactions, such as errors between reagents (e.g., variations in Tm of primers, probes, etc.), errors between equipment (e.g., temperature errors between wells or equipment), or errors between experimenters, can cause variations in the signal values ​​measured at each detection temperature, which in turn can cause variations in the reference value. This variability in the reference value causes variations in the result value for detecting the target nucleic acid (e.g., Ct value).

[0608] According to the present disclosure, by controlling the ratio (e.g., reference value) between the signal intensities provided by the same target nucleic acid among two target nucleic acids at two detection temperatures, two target nucleic acids can be detected using a single type of label in one reaction vessel with greatly improved precision and accuracy.

[0609] The present inventors used real-time PCR simulation data sets obtained under various conditions as in the examples below to identify a reference value range that can improve the accuracy and reliability of the results.

[0610] According to the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE), a guide to real-time PCR signal quantification, the target signal amplification reaction is amplified as the number of cycles increases. Assuming an amplification efficiency of 100%, one cycle means that the nucleic acid is amplified twice. For example, in repeated experiments under the same conditions, the amplification efficiency of an experiment that obtained a higher Ct value is lower than that of an experiment that obtained a lower Ct value. Therefore, the degree of variation in the Ct value can affect the degree of amplification efficiency depending on the degree of variation, which can be calculated as an unclear signal when performing signal correction for duplicate target detection or quantitative analysis. In addition, the sensitivity (LOD: limit of detection), which is one of the important factors in target nucleic acid amplification performance, is also affected depending on the degree of variation in the Ct value. In the case of a relatively low concentration of target nucleic acid, the signal may be lost, resulting in a false negative. For the above reasons, the inventors of the present invention evaluated the range of reference values ​​where the variability of the Ct value is less than 1 as a condition for improving the accuracy and reliability of the result value.

[0611]

[0612] <1-1> When the first detection temperature is lower than the second detection temperature

[0613]

[0614] (i) Obtaining the initial data set

[0615]

[0616] First, the first detection temperature was set lower than the second detection temperature. Next, a 4-Parameter Sigmoid Function was used as in Mathematical Formula III below to generate virtual signals at each of the first and second detection temperatures, and an initial data set was obtained from the generated signals.

[0617]

[0618] [Formula III]

[0619]

[0620] α1: Minimum asymptote;

[0621] α2: Maximum asymptote;

[0622] α3: Inflection point;

[0623] α4: Sharpness of the sigmoid function;

[0624] x: cycle number

[0625]

[0626] The 4-Parameter values ​​in Equation III were used as values ​​that can represent the actual real-time PCR amplification curve. Based on the baseline-corrected signal, α1 and α2 were set to arbitrary values ​​assuming a general PCR amplification situation, and α3 was set considering the target nucleic acid concentration. α4 was set based on a PCR amplification efficiency of 90% to satisfy the suitability criteria (PCR amplification efficiency of 90-105%) of the quantitative method disclosed in the literature [Johnson, G., et al., Methods Mol. Biol. 943, 1-16. (2013)]. The PCR amplification efficiency was calculated using the efficiency calculation formula in the previously known second derivative maximum cycle (Spiess, AN., et al., BMC Bioinformatics 9, 221. (2008)), as shown in Equation IV below, and the cycle number was designated as 1 to 50.

[0627]

[0628] [Formula IV]

[0629]

[0630] cpD2: Cycle number at the maximum of the second derivative of the curve;

[0631] F: intensity value of the raw signal at cycle number x;

[0632] EFFcpD2: PCR efficiency at the maximum cycle of the second derivative of the curve

[0633]

[0634] For a sample having a lower concentration of the first target nucleic acid than the second target nucleic acid, a sample having the same concentration of the first target nucleic acid as the second target nucleic acid, and a sample having a higher concentration of the first target nucleic acid than the second target nucleic acid, 4-parameter values ​​were set for each target nucleic acid. These are shown in Tables 3 to 5 below. Here, in the case where the target nucleic acid is absent, all parameter values ​​were set to 0. Table 3 shows the 4-parameter setting values ​​for a sample having a lower concentration of the first target nucleic acid than the second target nucleic acid, Table 4 shows the 4-parameter setting values ​​for a sample having the same concentration of the first target nucleic acid and the second target nucleic acid, and Table 5 shows the 4-parameter setting values ​​for a sample having a higher concentration of the first target nucleic acid than the second target nucleic acid.

[0635]

[0636] Target nucleic acid 1 Target nucleic acid 2 Target nucleic acid Detection temperature 1st detection temperature 2nd detection temperature 1st detection temperature 2nd detection temperature Parameter α 1 0000 α 2 30000 3000 x Reference value 3000 α 3 4 30 35 35 α 4 0.3 1 0 0.3 1 0.3 1

[0637] Target nucleic acid 1 Target nucleic acid 2 Target nucleic acid Detection temperature 1st detection temperature 2nd detection temperature 1st detection temperature 2nd detection temperature Parameter α 1 0000 α 2 30000 3000 x Reference value 3000 α 3 350 3535 α 4 0.3 100.3 10.31

[0638] Target nucleic acid 1 Target nucleic acid 2 Target nucleic acid Detection temperature 1st detection temperature 2nd detection temperature 1st detection temperature 2nd detection temperature Parameter α 1 0000 α 2 30000 3000 x Reference value 3000 α 3 2 50 3 5 3 5 5 α 4 0.3 1 0 0.3 1 0.3 1

[0639]

[0640] Finally, as shown in the following mathematical expression V, the intensity of the virtual signal at the first detection temperature in a specific cycle (hereinafter, the first virtual signal) was generated to correspond to the sum of the intensity of the signal at the first detection temperature for the first target nucleic acid in a specific cycle (hereinafter, the first signal of the first target nucleic acid) and the intensity of the signal at the first detection temperature for the second target nucleic acid in a specific cycle (hereinafter, the first signal of the second target nucleic acid). The virtual signal at the second detection temperature in a specific cycle (hereinafter, the second virtual signal) was generated to correspond to the sum of the intensity of the signal at the second detection temperature for the first target nucleic acid in a specific cycle (hereinafter, the second signal of the first target nucleic acid) and the intensity of the signal at the second detection temperature for the second target nucleic acid in a specific cycle (hereinafter, the second signal of the second target nucleic acid). In effect, the second signal of the first target nucleic acid is 'O'.

[0641]

[0642] [Formula V]

[0643] First virtual signal = [First signal of first target nucleic acid] + [First signal of second target nucleic acid]

[0644]

[0645] [Formula VI]

[0646] Second virtual signal = [Second signal of first target nucleic acid] + [Second signal of second target nucleic acid]

[0647]

[0648] The reference values ​​in Tables 3 to 5 above were calculated using the first virtual signal when only the second target nucleic acid exists and the second virtual signal when only the second target nucleic acid exists at 50 cycles, as shown in the following mathematical formula VII.

[0649]

[0650] [Formula VII]

[0651] Reference value = [First virtual signal when only the second target nucleic acid exists] ÷ [Second virtual signal when only the second target nucleic acid exists]

[0652]

[0653] The signal value detected at each detection temperature may vary due to errors between reactions, such as errors between reagents (e.g., changes in Tm of primers, probes, etc.), errors between equipment (e.g., temperature errors between wells or equipment), or errors between experimenters, which may result in variations in the reference value. The inventors of the present invention have confirmed that a reaction under the same PCR equipment can cause a signal variation of up to about 12%, and based on this, in this embodiment, it was assumed that a variation rate of up to 15% may occur compared to the signal value at each detection temperature generated through the mathematical formulas described above.

[0654] Next, for the second target nucleic acid having a specific initial reference value, the changed values ​​of the signal at the first detection temperature and the second detection temperature according to the signal change rate were calculated. In addition, the changed reference value was calculated according to the changed signal value. Tables 6 and 7 show the changed signal value and the changed reference value according to the change ratio. Specifically, in Tables 6 and 7, the first change ratio refers to the signal change rate at the first detection temperature, and the second change ratio refers to the signal change rate at the second detection temperature. For example, for change ratios of -15%, -10%, -5%, 0%, 5%, 10%, and 15%, the change ratios can be expressed as 0.85 (-15%), 0.90 (-10%), 0.95 (-5%), 1.00 (0%), 1.05 (+5%), 1.10 (+10%), and 1.15 (+15%).

[0655]

[0656] Variable cost initial reference value 0.30 0.40 0.50 Variable signal value (RFU) Variable reference value Variable signal value (RFU) Variable reference value Variable signal Value (RFU) Fluctuation Reference Value 1st 2nd 1st 2nd 1st 2nd 1st 21.151.15103534500.30138034500.40172534500.501.151.10103533000.31138033000.42172533000.521.151.05103531500.33138031500.44172531500.551.151.00103530000.35138030000.46172530000.581.150.95103528500.36138028500. 48172528500.611.150.90103527000.38138027000.51172527000.641.150.85103525500.41138025500.54172525500.681.101.1599034500.29132034500.38165034500.481.101.1099033000.30132033000.40165033000.501.101.0599031500.31132031500.42165031500.521.1 01.0099030000.33132030000.44165030000.551.100.9599028500.35132028500.46165028500.581.100.9099027000.37132027000.49165027000.611.100.8599025500.39132025500.52165025500.651.051.1594534500.27126034500.37157534500.461.051.1094533000.29126 033000.38157533000.481.051.0594531500.30126031500.40157531500.501.051.0094530000.32126030000.42157530000.531.050.9594528500.33126028500.44157528500.551.050.9094527000.35126027000.47157527000.581.050.8594525500.37126025500.49157525500.621.001.1590034500.26120034500.35150034500.431.001.1090033000.27120033000.36150033000.451.001.0590031500.29120031500.38150031500.481.001.0090030000.30120030000.40150030000.501.000.9590028500.32120028500.42150028500.531.000.9090027000.33120027000.44150027000.561.000.8590025500.35120025500.47150025500.590.951.1585534500.25114034500.33142534500.410.951.1085533000.26114033000.35142533000.430.951.0585531500.27114031500.36142531500.450.951.0085530000.29114030000.38142530000.480.950.9585528500.30114028500.40142528500.500.950.9085527000.32114027000.42142527000.530.950.8585525500.34114025500.45142525500.560.901.1581034500.23108034500.31135034500.390.901.1081033000.25108033000.33135033000.410.901.0581031500.26108031500.34135031500.430.901.0081030000.27108030000.36135030000.450.900.9581028500.28108028500.38135028500.470.900.9081027000.30108027000.40135027000.500.900.8581025500.32108025500.42135025500.530.851.1576534500.22102034500.30127534500.370.851.1076533000.23102033000.31127533000.390.851.0576531500.24102031500.32127531500.400.851.0076530000.26102030000.34127530000.430.850.9576528500.27102028500.36127528500.450.850.9076527000.28102027000.38127527000.470.850.8576525500.30102025500.40127525500.50.

[0657] Variable cost initial reference value 0.60 0.70 Variable signal value (RFU) Variable reference value Variable signal Value (RFU) Fluctuation Reference Value 1st 2nd 1st 2nd 1st 21.151.15207034500.60241534500.701.151.10207033000.63241533000.731.151.05207031500.66241531500.771.151.00207030000.69241530000.811.150.95207028500.73241528500.851.150.90207027000.77241527000.891.150.85207025500.812415 25500.951.101.15198034500.57231034500.671.101.10198033000.60231033000.701.101.05198031500.63231031500.731.101.00198030000.66231030000.771.100.95198028500.69231028500.811.100.90198027000.73231027000.861.100.85198025500.78231025500.911.051.1 5189034500.55220534500.641.051.10189033000.57220533000.671.051.05189031500.60220531500.701.051.00189030000.63220530000.741.050.95189028500.66220528500.771.050.90189027000.70220527000.821.050.85189025500.74220525500.861.001.15180034500.5221 0034500.611.001.10180033000.55210033000.641.001.05180031500.57210031500.671.001.00180030000.60210030000.701.000.95180028500.63210028500.741.000.90180027000.67210027000.781.000.85180025500.71210025500.820.951.15171034500.50199534500.580.951.10171033000.52199533000.600.951.05171031500.54199531500.630.951.00171030000.57199530000.670.950.95171028500.60199528500.700.950.90171027000.63199527000.740.95 0.85171025500.67199525500.780.901.15162034500.47189034500.550.901.10162033000.49189033000.570.901.05162031500.51189031500.600.901.00162030000.54189030000.630.9 00.95162028500.57189028500.660.900.90162027000.60189027000.700.900.85162025500.64189025500.740.851.15153034500.44178534500.520.851.10153033000.46178533000.540. 851.05153031500.49178531500.570.851.00153030000.51178530000.600.850.95153028500.54178528500.630.850.90153027000.57178527000.660.850.85153025500.60178525500.70.

[0658] As shown in Tables 6 and 7 above, the variation signal value and variation reference value change at the same variation ratio at each detection temperature, so the coefficient of variation (CV (%)) is the same regardless of the initial reference value, but it can be confirmed that the maximum / minimum value variation range increases as the initial reference value increases (see Table 8).

[0659]

[0660] Fluctuation Baseline Statistics Initial Baseline 0.300.400.500.600.70 RV Min 0.220.300.370.440.52 RV Max 0.410.540.680.810.95 RV Range (Max-Min) 0.180.250.310.370.43 RV Mean 0.300.400.510.610.71 SD 0.040.060.070.090.10 CV (%) 14.4% 14.4% 14.4% 14.4% 14.4%

[0661] RV Min: Minimum variation reference value; RV Max: Maximum variation reference value;

[0662] RV Mean: Average reference value;

[0663] SD: Standard Deviation;

[0664] CV: Coefficient of Variation

[0665]

[0666] FIG. 14 is a graph showing first and second virtual signals generated using the parameters of Table 3 and mathematical equations V and VI, along with the signal fluctuation rates (-15%, -10%, -5%, 5%, 10%, and 15%) described above. That is, FIG. 14 shows virtual signals that can be generated by the signal fluctuation rates for samples in which the concentration of the first target nucleic acid is lower than that of the second target nucleic acid.

[0667] FIG. 15 is a graph showing first and second virtual signals generated using the parameters of Table 4 and mathematical equations V and VI, along with the signal fluctuation rates (-15%, -10%, -5%, 5%, 10%, and 15%) described above. That is, FIG. 15 shows virtual signals that can be generated by the signal fluctuation rates for samples in which the concentration of the first target nucleic acid is the same as that of the second target nucleic acid.

[0668] FIG. 16 is a graph showing first and second virtual signals generated using the parameters of Table 5 and mathematical equations V and VI, along with the signal fluctuation rates (-15%, -10%, -5%, 5%, 10%, and 15%) described above. That is, FIG. 16 shows virtual signals that can be generated by the signal fluctuation rates for a sample having a higher concentration of the first target nucleic acid compared to the second target nucleic acid.

[0669] As shown in FIGS. 14 to 16, it can be confirmed that the variability between the changed signals of the first virtual signal (e.g., the difference between the minimum and maximum RFU values ​​in the last cycle) increases as the reference value increases. This ultimately means that the variability of the result value for detecting the target nucleic acid increases as the initial reference value increases. Meanwhile, it can be confirmed that the variability between the signals changed by the signal fluctuation rate of the second virtual signal is constant regardless of the reference value.

[0670]

[0671] (ii) Obtaining a correction data set

[0672]

[0673] Next, in this embodiment, a correction reference value was calculated using the statistical results of the variation reference value in Table 8 as a reference value for extracting only the signal of the first target nucleic acid from the first virtual signal. The correction reference value was obtained as shown in Table 9 using the following mathematical formula VIII to eliminate false positive results.

[0674]

[0675] [Formula VIII]

[0676] Correction threshold = [Maximum variation threshold] + [Standard deviation]

[0677]

[0678] Initial Reference Value 0.300.400.500.600.70 Max 0.410.540.680.810.95 SD 0.040.060.070.090.10 Corrected Reference Value (Max+SD) 0.450.600.750.901.05

[0679] SD: Standard Deviation

[0680] In (i) of the above Example <1-1>, the first virtual signal and the second virtual signal (Figs. 14 to 16) obtained according to the first target nucleic acid concentration and the above correction reference value were used to extract a signal for the first target nucleic acid from the first virtual signal. This was performed using mathematical equation IX.

[0681]

[0682] [Formula IX]

[0683] Extracted signal for the first target nucleic acid sequence = [first virtual signal] - [(second virtual signal] x (calibration reference value)]

[0684]

[0685] As described above, the extracted signal for the first target nucleic acid is a signal extracted by applying an excessive reference value (i.e., a correction reference value) to eliminate false positives. Therefore, a correction step was performed on the extracted signal using a conventionally known method for providing an analysis signal (WO2018-182281).

[0686] FIG. 17 shows a first virtual signal generated for a sample having a lower concentration of the first target nucleic acid than the second target nucleic acid, i.e., an extraction signal for the first target nucleic acid extracted using mathematical formula IX from the first virtual signal of FIG. 14, and an analysis signal therefor.

[0687] FIG. 18 shows a first virtual signal generated for a sample having the same concentration of the first target nucleic acid as the second target nucleic acid, i.e., an extracted signal for the first target nucleic acid extracted using mathematical formula IX from the first virtual signal of FIG. 15, and an analysis signal therefor.

[0688] FIG. 19 shows a first virtual signal generated for a sample having a higher concentration of the first target nucleic acid than the second target nucleic acid, i.e., an extracted signal for the first target nucleic acid extracted using mathematical formula IX from the first virtual signal of FIG. 16, and an analysis signal therefor.

[0689]

[0690] (iii) Determination of the presence of target nucleic acid

[0691] The presence of the target nucleic acid was determined using the second virtual signal obtained in (i) of Example <1-1> and the analytical signal obtained in (ii) of Example <1-1>. For this purpose, a screening threshold was applied.

[0692] The screening threshold was used as a value (i) of 10% (i.e., RUF: 300) of the signal value for the first target nucleic acid at the first detection temperature (i.e., RFU: 3,000) and the signal value for the second target nucleic acid at the second detection temperature (i.e., RFU: 3,000) when the variation ratio was 1.0 (i.e., the variation rate was 0%) in (i) of the above Example <1-1>. The Ct (Threshold Cycle) value was obtained using the above screening threshold, and when the difference (Range) between the maximum Ct value and the minimum Ct value was less than 1, the variation of the target nucleic acid detection result value was determined to be low.

[0693] Table 10 shows the results for samples having a lower concentration of the first target nucleic acid than the second target nucleic acid, Table 11 shows the results for samples having the same concentration of the first target nucleic acid as the second target nucleic acid, and Table 12 shows the results for samples having a higher concentration of the first target nucleic acid than the second target nucleic acid. As a result, as shown in Tables 10 and 11, in the case of samples having a lower or the same concentration of the first target nucleic acid than the second target nucleic acid, it was confirmed that the difference in the Ct value increased as the reference value increased, and in particular, when the reference value was 0.5 or less, the difference in the Ct value was less than 1, confirming that the variability was low. On the other hand, as shown in Table 12, in the case of samples having a higher concentration of the first target nucleic acid than the second target nucleic acid, the signal fluctuation occurred after the point where it crossed the screening threshold (i.e., the Ct value), so that the same Ct value was confirmed even when the reference value increased. These results show that detecting a target nucleic acid under the condition that the intensity of the signal for the second target nucleic acid at the first detection temperature is 0.5 times or less than the intensity of the signal for the second target nucleic acid at the second detection temperature according to the method of the present disclosure can reduce the variability of the Ct value to less than 1 regardless of the concentration of the target nucleic acid in the sample.

[0694]

[0695] Analysis signal 2nd virtual signal reference value 0.300.400.500.600.70 Ct min 39.69 39.75 39.80 39.86 39.89 31.59 Ct max 40.57 40.66 40.77 40.87 40.92 32.11 Ct range 0.87 0.92 0.96 1.01 1.03 0.52 mean 40.20 40.27 40.33 40.38 40.43 31.85 SD 0.210 210 220 230 240.18 CV(%) 0.52% 0.52% 0.54% 0.57% 0.60% 0.56%

[0696] Ct Min: Minimum variation Ct value; Ct Max: Maximum variation Ct value;

[0697] Ct Mean: Average Ct value;

[0698] SD: Standard Deviation;

[0699] CV: Coefficient of Variation

[0700]

[0701] Analysis signal 2nd virtual signal reference value 0.300.400.500.600.70 Ct min 30.5130.5230.5330.5330.5431.59 Ct max 31.2631.3631.4731.6131.7732.11 Ct range 0.750.840.951.081.230.52 mean 30.8730.9230.9731.0231.0731.85 SD 0.220.240.250.270.300.18 CV(%) 0.72% 0.76% 0.82% 0.89% 0.97% 0.56%

[0702] Ct Min: Minimum variation Ct value; Ct Max: Maximum variation Ct value;

[0703] Ct Mean: Average Ct value;

[0704] SD: Standard Deviation;

[0705] CV: Coefficient of Variation

[0706]

[0707] Analysis signal 2nd virtual signal reference value 0.300.400.500.600.70 Ct min 21.2021.2021.2021.2021.2021.2031.59 Ct max 21.6821.6821.6821.6821.6832.11 Ct range 0.470.470.470.470.470.52 mean 21.4221.4221.4221.4221.4221.4231.85 SD 0.160.160.160.160.160.18 CV(%) 0.74% 0.74% 0.74% 0.74% 0.74% 0.56%

[0708] Ct Min: Minimum variation Ct value; Ct Max: Maximum variation Ct value;

[0709] Ct Mean: Average Ct value;

[0710] SD: Standard Deviation;

[0711] CV: Coefficient of Variation

[0712]

[0713] In summary, when the first detection temperature is lower than the second detection temperature, the method according to the present disclosure can detect the target nucleic acid with high accuracy and high reliability by lowering the variability of the result value for determining the presence or absence of the target nucleic acid by making the intensity of the signal for the second target nucleic acid at the first detection temperature 0.5 times or less than the intensity of the signal for the second target nucleic acid at the second detection temperature (specifically, the variability of the Ct value becomes less than 1).

[0714]

[0715] <1-2> When the first detection temperature is higher than the second detection temperature

[0716]

[0717] (i) Obtaining the initial data set

[0718]

[0719] In Example <1-2>, the first detection temperature was set higher than the second detection temperature. Next, an initial data set was obtained using the same method as Example <1-1>, and a correction data set was obtained using this, and then the presence of the target nucleic acid was determined. First, a 4-Parameter Sigmoid Function was used to generate virtual signals at each of the first and second detection temperatures, and an initial data set was obtained from the generated signals.

[0720] Table 13 shows the 4-parameter setting values ​​for the case of a sample having a lower concentration of the first target nucleic acid than the second target nucleic acid, Table 14 shows the 4-parameter setting values ​​for the case of a sample having the same concentration of the first and second target nucleic acids, and Table 15 shows the 4-parameter setting values ​​for the case of a sample having a higher concentration of the first target nucleic acid than the second target nucleic acid. Here, in the case of the absence of the target nucleic acid, all parameter values ​​were set to 0.

[0721]

[0722] Target nucleic acid 2nd target nucleic acid 1st target nucleic acid detection temperature 2nd detection temperature 1st detection temperature 2nd detection temperature 1st detection temperature Parameter α 1 0 ...

[0723] Target nucleic acid 2nd target nucleic acid 1st target nucleic acid detection temperature 2nd detection temperature 1st detection temperature 2nd detection temperature 1st detection temperature Parameter α 1 0 ...

[0724] Target nucleic acid 2nd target nucleic acid 1st target nucleic acid detection temperature 2nd detection temperature 1st detection temperature 2nd detection temperature 1st detection temperature Parameter α 1 0 ...

[0725] Next, the first virtual signal and the second virtual signal were generated using mathematical formulas V and VI.

[0726]

[0727] The reference values ​​in Tables 13 to 15 above were calculated using Mathematical Formula VII. Next, assuming that a maximum fluctuation rate of 15% may occur compared to the signal value at each detection temperature generated through the aforementioned mathematical formulas, the fluctuation values ​​of the signal at the first detection temperature and the second detection temperature according to the signal fluctuation rate were calculated for the second target nucleic acid having a specific initial reference value. In addition, the fluctuation reference value was calculated according to the fluctuation signal value. Tables 16 and 17 show the fluctuation signal value and the fluctuation reference value according to the fluctuation ratio.

[0728]

[0729] Variable cost initial reference value 0.30 0.40 0.50 Variable signal value (RFU) Variable reference value Variable signal value (RFU) Variable reference value Variable signal Value (RFU) Fluctuation Reference Value 1st 2nd 1st 2nd 1st 2nd 1st 21.151.15103534500.30138034500.40172534500.501.151.10103533000.31138033000.42172533000.521.151.05103531500.33138031500.44172531500.551.151.00103530000.35138030000.46172530000.581.150.95103528500.36138028500. 48172528500.611.150.90103527000.38138027000.51172527000.641.150.85103525500.41138025500.54172525500.681.101.1599034500.29132034500.38165034500.481.101.1099033000.30132033000.40165033000.501.101.0599031500.31132031500.42165031500.521.1 01.0099030000.33132030000.44165030000.551.100.9599028500.35132028500.46165028500.581.100.9099027000.37132027000.49165027000.611.100.8599025500.39132025500.52165025500.651.051.1594534500.27126034500.37157534500.461.051.1094533000.29126 033000.38157533000.481.051.0594531500.30126031500.40157531500.501.051.0094530000.32126030000.42157530000.531.050.9594528500.33126028500.44157528500.551.050.9094527000.35126027000.47157527000.581.050.8594525500.37126025500.49157525500.621.001.1590034500.26120034500.35150034500.431.001.1090033000.27120033000.36150033000.451.001.0590031500.29120031500.38150031500.481.001.0090030000.30120030000.40150030000.501.000.9590028500.32120028500.42150028500.531.000.9090027000.33120027000.44150027000.561.000.8590025500.35120025500.47150025500.590.951.1585534500.25114034500.33142534500.410.951.1085533000.26114033000.35142533000.430.951.0585531500.27114031500.36142531500.450.951.0085530000.29114030000.38142530000.480.950.9585528500.30114028500.40142528500.500.950.9085527000.32114027000.42142527000.530.950.8585525500.34114025500.45142525500.560.901.1581034500.23108034500.31135034500.390.901.1081033000.25108033000.33135033000.410.901.0581031500.26108031500.34135031500.430.901.0081030000.27108030000.36135030000.450.900.9581028500.28108028500.38135028500.470.900.9081027000.30108027000.40135027000.500.900.8581025500.32108025500.42135025500.530.851.1576534500.22102034500.30127534500.370.851.1076533000.23102033000.31127533000.390.851.0576531500.24102031500.32127531500.400.851.0076530000.26102030000.34127530000.430.850.9576528500.27102028500.36127528500.450.850.9076527000.28102027000.38127527000.470.850.8576525500.30102025500.40127525500.50.

[0730] Variable cost initial reference value 0.60 0.70 Variable signal value (RFU) Variable reference value Variable signal Value (RFU) Fluctuation Reference Value 1st 2nd 1st 2nd 1st 21.151.15207034500.60241534500.701.151.10207033000.63241533000.731.151.05207031500.66241531500.771.151.00207030000.69241530000.811.150.95207028500.73241528500.851.150.90207027000.77241527000.891.150.85207025500.812415 25500.951.101.15198034500.57231034500.671.101.10198033000.60231033000.701.101.05198031500.63231031500.731.101.00198030000.66231030000.771.100.95198028500.69231028500.811.100.90198027000.73231027000.861.100.85198025500.78231025500.911.051.1 5189034500.55220534500.641.051.10189033000.57220533000.671.051.05189031500.60220531500.701.051.00189030000.63220530000.741.050.95189028500.66220528500.771.050.90189027000.70220527000.821.050.85189025500.74220525500.861.001.15180034500.5221 0034500.611.001.10180033000.55210033000.641.001.05180031500.57210031500.671.001.00180030000.60210030000.701.000.95180028500.63210028500.741.000.90180027000.67210027000.781.000.85180025500.71210025500.820.951.15171034500.50199534500.580.951.10171033000.52199533000.600.951.05171031500.54199531500.630.951.00171030000.57199530000.670.950.95171028500.60199528500.700.950.90171027000.63199527000.740.95 0.85171025500.67199525500.780.901.15162034500.47189034500.550.901.10162033000.49189033000.570.901.05162031500.51189031500.600.901.00162030000.54189030000.630.9 00.95162028500.57189028500.660.900.90162027000.60189027000.700.900.85162025500.64189025500.740.851.15153034500.44178534500.520.851.10153033000.46178533000.540. 851.05153031500.49178531500.571.000.85300015300.51300017850.600.950.85285015300.54285017850.630.900.85270015300.57270017850.660.850.85255015300.60255017850.70.

[0731] As shown in Tables 16 and 17 above, the variation signal value and variation reference value change at the same variation ratio at each detection temperature, so the coefficient of variation (CV (%)) is the same regardless of the initial reference value, but it can be confirmed that the maximum / minimum value variation range increases as the initial reference value increases (see Table 18).

[0732]

[0733] Fluctuation Baseline Statistics Initial Baseline 0.300.400.500.600.70 RV Min 0.220.300.370.440.52 RV Max 0.410.540.680.810.95 RV Range (Max-Min) 0.180.250.310.370.43 RV Mean 0.300.400.510.610.71 SD 0.040.060.070.090.10 CV (%) 14.4% 14.4% 14.4% 14.4% 14.4%

[0734] RV Min: Minimum variation reference value; RV Max: Maximum variation reference value;

[0735] RV Mean: Average reference value;

[0736] SD: Standard Deviation;

[0737] CV: Coefficient of Variation

[0738]

[0739] FIG. 20 is a graph showing first and second virtual signals generated using the parameters of Table 13 and mathematical equations V and VI, along with the signal fluctuation rates (-15%, -10%, -5%, 5%, 10%, and 15%) described above. That is, FIG. 20 shows virtual signals that can be generated by the signal fluctuation rates for a sample in which the concentration of the first target nucleic acid is lower than that of the second target nucleic acid.

[0740] Figure 21 is a graph showing first and second virtual signals generated using the parameters of Table 14 and mathematical equations V and VI, along with the signal fluctuation rates (-15%, -10%, -5%, 5%, 10%, and 15%) described above. That is, Figure 21 shows virtual signals that can be generated by the signal fluctuation rates for samples in which the concentration of the first target nucleic acid is the same as that of the second target nucleic acid.

[0741] FIG. 22 is a graph showing first and second virtual signals generated using the parameters of Table 15 and mathematical equations V and VI, along with the signal fluctuation rates (-15%, -10%, -5%, 5%, 10%, and 15%) described above. That is, FIG. 22 shows virtual signals that can be generated by the signal fluctuation rates for a sample having a higher concentration of the first target nucleic acid compared to the second target nucleic acid.

[0742] As shown in FIGS. 20 to 22, it can be confirmed that the variability between the changed signals of the first virtual signal (e.g., the difference between the minimum RFU value and the maximum RFU value in the last cycle) increases as the reference value increases. This ultimately means that the variability of the result value for detecting the target nucleic acid increases as the initial reference value increases. Meanwhile, it can be confirmed that the variability between the signals changed by the signal fluctuation rate of the second virtual signal is constant regardless of the reference value.

[0743]

[0744] (ii) Obtaining a correction data set

[0745]

[0746] Next, a correction reference value was calculated using the statistical results of the variation reference value in Table 18 as a reference value for extracting only the signal of the first target nucleic acid from the first virtual signal. The correction reference value was obtained using mathematical formula VIII as shown in Table 19 to eliminate false positive results.

[0747]

[0748] Initial Reference Value 0.300.400.500.600.70 Max 0.410.540.680.810.95 SD 0.040.060.070.090.10 Corrected Reference Value (Max+SD) 0.450.600.750.901.05

[0749] SD: Standard Deviation

[0750] In (i) of the above Example <1-2>, the first virtual signal and the second virtual signal (Figs. 20 to 22) obtained according to the first target nucleic acid concentration and the above correction reference value were used to extract a signal for the first target nucleic acid from the first virtual signal. This was performed using mathematical formula IX.

[0751]

[0752] As described above, the extracted signal for the first target nucleic acid is a signal extracted by applying an excessive reference value (i.e., a correction reference value) to eliminate false positives. Therefore, a correction step was performed on the extracted signal using a conventionally known method for providing an analysis signal (WO2018-182281).

[0753] FIG. 23 shows a first virtual signal generated for a sample having a lower concentration of the first target nucleic acid than the second target nucleic acid, i.e., an extraction signal for the first target nucleic acid extracted using mathematical formula IX from the first virtual signal of FIG. 20, and an analysis signal therefor.

[0754] FIG. 24 shows the first virtual signal generated for a sample having the same concentration of the first target nucleic acid as the second target nucleic acid, i.e., the extracted signal for the first target nucleic acid extracted using mathematical formula IX from the first virtual signal of FIG. 21, and the analysis signal therefor.

[0755] FIG. 25 shows the first virtual signal generated for a sample having a higher concentration of the first target nucleic acid than the second target nucleic acid, i.e., the extracted signal for the first target nucleic acid extracted using mathematical formula IX from the first virtual signal of FIG. 22, and the analysis signal therefor.

[0756]

[0757] (iii) Determination of the presence of target nucleic acid

[0758]

[0759] The presence of the target nucleic acid was determined using the second virtual signal obtained in (i) of Example <1-2> and the analytical signal obtained in (ii) of Example <1-2>. For this purpose, a screening threshold was applied.

[0760] The screening threshold was used as a value (i.e., RUF: 300) which is 10% of the signal value for the first target nucleic acid at the first detection temperature (i.e., RFU: 3,000) and the signal value for the second target nucleic acid at the second detection temperature (i.e., RFU: 3,000) when the variation ratio in (i) of the above Example <1-2> is 1.0 (i.e., the variation rate is 0%). The Ct (Threshold Cycle) value was obtained using the screening threshold. Thereafter, the variability was calculated by the difference (Range) between the maximum Ct value and the minimum Ct value, and a variability less than 1 was considered as low variability.

[0761] Table 20 shows the results for samples having a lower concentration of the first target nucleic acid compared to the second target nucleic acid, Table 21 shows the results for samples having the same concentration of the first target nucleic acid compared to the second target nucleic acid, and Table 22 shows the results for samples having a higher concentration of the first target nucleic acid compared to the second target nucleic acid.

[0762] As a result, as shown in Tables 20 and 21, in the case of samples in which the concentration of the first target nucleic acid is lower or the same as that of the second target nucleic acid, it was confirmed that the variability of the Ct value increases as the reference value increases, and in particular, when the reference value is 0.5 or lower, a variability of a low Ct value of less than 1 was confirmed. On the other hand, as shown in Table 22, in the case of samples in which the concentration of the first target nucleic acid is higher than that of the second target nucleic acid, the signal fluctuation occurred after the point where it intersected the screening threshold value (i.e., the Ct value), so that the same Ct value was confirmed even when the reference value increased. These results show that detecting a target nucleic acid under the condition that the intensity of the signal for the second target nucleic acid at the second detection temperature is 0.5 times or less of the intensity of the signal for the second target nucleic acid at the first detection temperature according to the method of the present disclosure can reduce the variability of the Ct value to less than 1 regardless of the concentration of the target nucleic acid in the sample.

[0763]

[0764] Analysis signal 1st virtual signal reference value 0.300.400.500.600.70 Ct min 37.5237.5837.6437.7037.7532.21 Ct max 38.4638.5438.6238.7138.8132.59 Ct range 0.940.950.981.021.050.38 mean 38.0838.1738.2438.3038.3532.38 SD 0.220.220.220.220.220.13 CV(%) 0.570.570.560.570.580.39%

[0765] Ct Min: Minimum variation Ct value; Ct Max: Maximum variation Ct value;

[0766] Ct Mean: Average Ct value;

[0767] SD: Standard Deviation;

[0768] CV: Coefficient of Variation

[0769]

[0770] Analysis signal 1st virtual signal reference value 0.300.400.500.600.70 Ct min 31.7431.7631.7731.7831.7932.21 Ct max 32.4132.5532.7232.9333.1532.59 Ct range 0.670.790.951.151.360.38 mean 32.0732.1232.1832.2432.3132.38 SD 0.170.200.220.260.310.13 CV(%) 0.550.610.700.820.970.39%

[0771] Ct Min: Minimum variation Ct value; Ct Max: Maximum variation Ct value;

[0772] Ct Mean: Average Ct value;

[0773] SD: Standard Deviation;

[0774] CV: Coefficient of Variation

[0775]

[0776] Analysis signal 2nd virtual signal reference value 0.300.400.500.600.70 Ct min 27.2127.2127.2127.2127.2132.21 Ct max 27.6027.6027.6027.6027.6132.59 Ct range 0.380.390.390.390.390.390.38 mean 27.3927.3927.3927.3927.3927.3932.38 SD 0.130.130.130.130.130.130.13 CV(%) 0.470.470.470.470.470.39%

[0777] Ct Min: Minimum variation Ct value; Ct Max: Maximum variation Ct value;

[0778] Ct Mean: Average Ct value;

[0779] SD: Standard Deviation;

[0780] CV: Coefficient of Variation

[0781]

[0782] In summary, when the first detection temperature is higher than the second detection temperature, the method according to the present disclosure can detect the target nucleic acid with high accuracy and high reliability by lowering the variability of the Ct value for determining the presence or absence of the target nucleic acid to less than 1 by making the intensity of the signal for the second target nucleic acid at the first detection temperature 0.5 times or less than the intensity of the signal for the second target nucleic acid at the second detection temperature.

[0783]

[0784]

[0785] Example 2: Verification of variability in reference and result values ​​due to inter-reaction errors

[0786]

[0787] In Example 2, the variability of the reference value due to inter-reaction errors was confirmed through actual experiments. Furthermore, in Example 3, the impact of this variability of the reference value on the results (e.g., Ct value) for detecting target nucleic acids was analyzed.

[0788] In particular, the results confirmed through the real-time PCR simulation data set in Example 1 were applied to actual experiments to verify whether the accuracy and reliability of the results could be improved according to the setting of the reference value.

[0789]

[0790] <2-1> Preparation of target nucleic acid and composition for target nucleic acid detection

[0791] The genomic DNA of Human Papillomavirus 35 (HPV35) was used as a template for the first target nucleic acid, and the genomic DNA of Human Papillomavirus 18 (HPV18) was used as a template for the second target nucleic acid.

[0792]

[0793] Detection of the first target nucleic acid (HPV35) was based on the PTOCE (PTO cleavage and extension) method (WO 2012 / 096523), which is an UnderSC signal generation method, and detection of the second target nucleic acid (HPV18) was based on two signal generation methods that provide different reference values, the PTOCE method (WO 2012 / 096523), which is an UnderSC signal generation method, and the PTOCE-LPHO (labeled portion hybridizing oligonucleotide) method (WO 2024 / 181774), which is an InterSC-type signal generation method. The first detection temperature, which is the temperature at which both the signal for the first target nucleic acid and the signal for the second target nucleic acid can be detected, was set to 72°C, and the second detection temperature, which is the temperature at which only the signal for the second target nucleic acid can be detected, was set to 82°C. Next, one first target nucleic acid detection composition and two second target nucleic acid detection compositions having different reference values ​​were prepared as follows.

[0794]

[0795] (I composition) Composition for detecting first target nucleic acid (UnderSC composition)

[0796] First, a first target nucleic acid detection composition for detecting a first target nucleic acid (HPV35) was prepared, comprising (a) a primer pair comprising a forward primer (referred to as 'HPV35-F' herein) and a reverse primer (referred to as 'HPV35-R' herein) for amplifying HPV35; and (b) a first oligonucleotide (referred to as 'HPV35-PTO' herein) and a second oligonucleotide (referred to as 'HPV35-CTO' herein) for generating a signal from HPV35. Specifically, HPV35-PTO was designed to include, in 5' to 3' order, (i) a 5'-tagging portion including a nucleotide sequence that does not hybridize to the first and second target nucleic acids, and (ii) a 3'-targeting portion including a nucleotide sequence that does hybridize to the first target nucleic acid. Meanwhile, HPV35-CTO was designed to include, in 3' to 5' order, (i) a 3'-capturing portion comprising a nucleotide sequence that hybridizes to the 5'-tagging portion or a part of the 5'-tagging portion of the HPV35-PTO, and (ii) a 5'-templating portion comprising a nucleotide sequence that non-hybridizes to the 5'-tagging portion and 3'-targeting portion of the HPV35-PTO. The 3'-terminus of the HPV35-PTO and HPV35-CTO was blocked with Spacer C3 to prevent extension by DNA polymerase; and the HPV35-CTO was linked to a quencher molecule (BHQ-2) at its 5'-terminus and to a reporter molecule (Quasar670) at its 3'-targeting portion.

[0797]

[0798] (II-1 Composition) Composition for detecting second target nucleic acid (UnderSC composition)

[0799] A composition for detecting a second target nucleic acid using an UnderSC signal generation method is prepared, comprising: (a) a primer pair comprising a forward primer (referred to herein as 'HPV18-F') and a reverse primer (referred to herein as 'HPV18-R') for amplifying HPV18; and (b) a first oligonucleotide (referred to herein as 'HPV18-PTO') and a second oligonucleotide (referred to herein as 'HPV18-CTO') for providing a signal for a second target nucleic acid. Specifically, HPV18-PTO is designed to include, in 5' to 3' order, (i) a 5'-tagging portion including a nucleotide sequence that does not hybridize to the first and second target nucleic acids, and (ii) a 3'-targeting portion including a nucleotide sequence that does hybridize to the second target nucleic acid. Meanwhile, HPV18-CTO was designed to include, in 3' to 5' order, (i) a 3'-capturing portion comprising a nucleotide sequence that hybridizes to the 5'-tagging portion or a part of the 5'-tagging portion of the HPV18-PTO, and (ii) a 5'-templating portion comprising a nucleotide sequence that non-hybridizes to the 5'-tagging portion and 3'-targeting portion of the HPV18-PTO. The 3'-terminus of the HPV18-PTO and HPV18-CTO was blocked with Spacer C3 to prevent extension by DNA polymerase; and the HPV18-CTO was linked to a quencher molecule (BHQ-2) at its 5'-terminus and to a reporter molecule (Quasar670) at its 3'-targeting portion.

[0800]

[0801] (II-2 Composition) Composition for detecting second target nucleic acid (InterSC composition)

[0802] As a second target nucleic acid detection composition using an InterSC signal generation method, a third oligonucleotide (referred to herein as 'HPV18-LPHO') was additionally prepared together with HPV18-F, HPV18-R, HPV18-PTO, and HPV18-CTO prepared in the above (II-1) composition. HPV18-LPHO was designed to have a nucleotide sequence that hybridizes to a label portion including nucleotides to which a reporter molecule and a quencher molecule of HPV18-CTO are linked. The 3'-end of the HPV18-LPHO was blocked with Spacer C3 to prevent extension by DNA polymerase.

[0803] Since the signals indicating the presence of each of the above target nucleic acids originate from a single type of label (i.e., Quasar 670), they cannot be distinguished by a single detector (single detection channel) in a single reaction vessel.

[0804] The sequences of the first and second target nucleic acid detection oligonucleotides included in the above-prepared composition I, composition II-1, and composition II-2 are as shown in Table 23.

[0805]

[0806] Oligo Name Sequence Number Sequence (5' → 3')HPV35-F1CAGGGCTGTAACKTGTCAAAHPV35-R2TTACTTTTCTACGTTTAGTAGAAGHPV35-PTO3GTAATAGGTCGCCCAGGYAAGCGTGCAGCTCCRGCAT[Spacer C3]HPV35-CTO4[BHQ-2]TAAAAGGGACCAATG / iQS670_T / GGCTTCTTCCTGAGGGCGACCTATTAC[Spacer C3]HPV18-F5TTTTTGCTAGGCATTTTTGGAAHPV18-R6AATTTGGTAGCATCATATTGCCCHPV18-PTO7AACCAGCTCGCAGCGGCACAGGTATGCGTGCTTCACCT[Spacer C3]HPV18-CTO8[BHQ-2]CTCCTCGTGGCGCCG / iQS670_T / CGGCCCTGCGTTAGCTGCGAGCTGGTT[Spacer C3]HPV18-LPHO9ACGCAGGGCCGACGGCGCCACGAGGAG[Spacer C3]

[0807] BHQ-2: Black Hole Quencher-2

[0808]

[0809] <2-2> Confirmation of reference value variability according to PCR equipment and acquisition of correction reference value

[0810] Considering the possibility of differences in target concentrations as causes of errors between reactions, the signal characteristics of the user's PCR equipment, and the variability of the experimenter, the inventors conducted repeated experiments by setting the concentration of the second target nucleic acid in multiple PCR devices to two values, 50 pg and 100 pg, and confirmed the variability of the signal value (RFU value) measured at each detection temperature. Subsequently, the variability of the reference value due to this variability in the signal value was confirmed.

[0811] First, using the three compositions prepared in Example <2-1>, reaction mixtures of three combinations were prepared as follows. Next, PCR was repeated twice under the same conditions using three PCR devices of the same model for the three combinations, and the variability of the reference value was confirmed through this.

[0812]

[0813] (Combination 1) (I) Composition + (II-1) Composition

[0814] A final reaction mixture of 20 μL was prepared by adding 4 pmoles each of HPV35-F and HPV35-R (SEQ ID NOs: 1 and 2), 2 pmoles of HPV35-PTO (SEQ ID NO: 3), and 1 pmole of HPV35-CTO (SEQ ID NO: 4), which are compositions for detecting the first target nucleic acid, and 4 pmoles each of HPV18-F and HPV18-R (SEQ ID NOs: 5 and 6), 2 pmoles of HPV18-PTO (SEQ ID NO: 7), and 1 pmole of HPV18-CTO (SEQ ID NO: 8), which are compositions for detecting the second target nucleic acid, and 5 μL of 4X Master mix (final, 200 uM dNTPs, 2 mM MgCl2, 2 U of Taq DNA polymerase) (Enzynomics, Korea).

[0815]

[0816] (Combination 2) (I) Composition + (II-2) Composition

[0817] 4 pmoles each of HPV35-F and HPV35-R (SEQ ID NO: 1 and 2), 2 pmoles of HPV35-PTO (SEQ ID NO: 3), 1 pmole of HPV35-CTO (SEQ ID NO: 4), and 4 pmoles each of HPV18-F and HPV18-R (SEQ ID NO: 5 and 6), 2 pmoles of HPV18-PTO (SEQ ID NO: 7), 1 pmole of HPV18-CTO (SEQ ID NO: 8), 0.5 pmole of HPV18-LPHO (SEQ ID NO: 9) and 5 μL of 4X Master mix (final, 200 uM dNTPs, 2 mM MgCl2, 2 U of Taq DNA polymerase) (Enzynomics, Korea) were added to a final 20 μL reaction volume. A mixture was prepared.

[0818]

[0819] (Combination 3) (I) Composition + (II-2) Composition

[0820] 4 pmoles each of HPV35-F and HPV35-R (SEQ ID NO: 1 and 2), 2 pmoles of HPV35-PTO (SEQ ID NO: 3), 1 pmole of HPV35-CTO (SEQ ID NO: 4), and 4 pmoles each of HPV18-F and HPV18-R (SEQ ID NO: 5 and 6), 2 pmoles of HPV18-PTO (SEQ ID NO: 7), 1 pmole of HPV18-CTO (SEQ ID NO: 8), 1 pmole of HPV18-LPHO (SEQ ID NO: 9) and 5 μL of 4X Master mix (final, 200 uM dNTPs, 2 mM MgCl2, 2 U of Taq DNA polymerase) (Enzynomics, Korea) were added to make a final 20 μL reaction mixture. It was manufactured.

[0821]

[0822] Two concentrations of the second target nucleic acid (50 pg of HPV 18 genomic DNA and 100 pg of HPV 18 genomic DNA) were added to each of the three reaction mixtures of Combinations 1 to 3, and placed in a real-time thermocycler (CFX96 Real-time Cycler, Bio-Rad). Subsequently, denaturation was performed at 95°C for 15 minutes, and 50 cycles of 60°C for 60 seconds, 72°C for 10 seconds, 82°C for 5 seconds, and 95°C for 30 seconds were performed. Signal measurement was performed at 72°C (first detection temperature) and 82°C (second detection temperature) for each cycle, and the reference value for each combination was calculated using the following mathematical formula I based on the RFU value at the last cycle of the amplification curve measured at each detection temperature.

[0823]

[0824] [Formula I]

[0825] Reference value = [Signal measured at the first detection temperature for a sample containing only the second target nucleic acid] ÷ [Signal measured at the second detection temperature for a sample containing only the second target nucleic acid]

[0826]

[0827] All experiments were performed in duplicate using three real-time thermocyclers (CFX96 Real-time Cycler, Bio-Rad). As a result, the reference values ​​(RV) for each experiment were obtained as shown in Table 24, and the minimum variation reference value, maximum variation reference value, average reference value, standard deviation (SD), and coefficient of variation (CV) were obtained as shown in Table 25.

[0828]

[0829] Combination 1 Target concentration 50pg 100pg Number of repetitions 1212 Reference value PCR equipment 11.431.41.411.4 PCR equipment 21.431.441.431.42 PCR equipment 31.421.411.451.39 Combination 2 Target concentration 50pg 100pg Number of repetitions 1212 Reference value PCR equipment 10.730.730.780.79 PCR equipment 20.830.760.790.78 PCR equipment 30.770.740.740.74 Combination 3 Target concentration 50pg 100pg Number of repetitions 1212 Reference value PCR equipment 10.420.390.380.41 PCR equipment 20.440.450.420.37 PCR equipment 30.350.340.330.31

[0830] Combination 1 Combination 2 Combination 3 RV Min 1.39 0.73 0.31 RV Max 1.45 0.83 0.45 Range (Max-Min) 0.06 0.10.14 RV Mean 1.42 0.76 0.38 SD 0.02 0.03 0.05 CV (%) 0.01 0.04 0.12

[0831] RV Min: Minimum variation reference value; RV Max: Maximum variation reference value;

[0832] RV Mean: Average reference value;

[0833] SD: Standard Deviation;

[0834] CV: Coefficient of Variation

[0835]

[0836] Next, a correction reference value was calculated using the maximum variation reference value as a reference value for extracting only the signal of the first target nucleic acid from the signal measured at the first detection temperature. The correction reference value was obtained using mathematical formula VIII as shown in Table 26 to eliminate false positive results.

[0837]

[0838] Combination 1 Combination 2 Combination 3 Maximum variation criterion 1.45 0.83 0.45 SD 0.02 0.03 0.05 Correction criterion 1.47 0.86 0.49

[0839] Therefore, through this example, the variability of the reference value due to errors between reactions (e.g., errors between equipment) was confirmed, and further, a correction reference value was obtained.

[0840]

[0841] Example 3: Detection of target nucleic acid

[0842] Next, using the correction reference values ​​obtained in Example 2, two target nucleic acids in the sample were detected. In particular, the variability of the result values ​​according to the reference values ​​was also confirmed.

[0843] For this purpose, the target nucleic acid and combination reaction mixture prepared in Example 2 were used. Specifically, real-time PCR was performed using three combination reaction mixtures with different reference values ​​for samples containing target nucleic acids at various concentration ratios. Nine tubes were prepared as shown in Table 27, and each tube was placed with target nucleic acids at various concentration ratios and three combination reaction mixtures, and placed in a real-time thermocycler (CFX96 Real-time Cycler, Bio-Rad). Subsequently, denaturation was performed at 95°C for 15 minutes, and 50 cycles of 60°C for 60 seconds, 72°C for 10 seconds, 82°C for 5 seconds, and 95°C for 30 seconds were performed. Signal measurement was performed at 72°C (first detection temperature) and 82°C (second detection temperature) for each cycle.

[0844]

[0845] Example Tube Combination Reaction Mixture First Target Nucleic Acid Concentration Second Target Nucleic Acid Concentration 3-11 150 pg 100 pg 2 250 pg 100 pg 3 350 pg 100 pg 3-24 1100 pg 100 pg 5 2100 pg 100 pg 6 3100 pg 100 pg 3-37 1150 pg 100 pg 8 2150 pg 100 pg 9 3150 pg 100 pg

[0846] Next, only the signal for the first target nucleic acid was extracted from the signal measured at the first detection temperature using the following mathematical formula X.

[0847]

[0848] [Formula X]

[0849] Extracted signal for the first target nucleic acid = [signal measured at the first detection temperature] - [(signal measured at the second detection temperature] x (correction reference value)]

[0850]

[0851] The extracted signal for the first target nucleic acid was extracted by applying an excessive reference value (i.e., a correction reference value) to eliminate false positives. Therefore, a correction step was performed on the extracted signal using a conventionally known method for providing an analysis signal (WO2018-182281), thereby obtaining an analysis signal. Subsequently, the presence of the first target nucleic acid was determined from the analysis signal, and the presence of the second target nucleic acid was determined from the signal measured at the second detection temperature.

[0852] All experiments were performed four times using three real-time thermocyclers (CFX96 Real-time Cycler, Bio-Rad).

[0853] As a result, the following results were obtained for each tube.

[0854]

[0855] <3-1> Samples with lower concentrations of the first target nucleic acid compared to the second target nucleic acid

[0856] Using three real-time thermocyclers (CFX96 Real-time Cycler, Bio-Rad), the real-time PCR graphs of tubes 1 to 3 were shown in Figure 26 as a result of four repetitions.

[0857] The extraction signal for the first target nucleic acid extracted using mathematical formula IX from the graph of FIG. 26 and the analysis signal obtained by correcting the same are shown in FIG. 27.

[0858] Next, the presence of the first target nucleic acid was determined from the analysis signal (Fig. 27), and the presence of the second target nucleic acid was determined from the signal measured at the second detection temperature (Fig. 26). Specifically, if the signal value at 72°C and 82°C was higher than a specified threshold value, that is, a value that was 10% of the signal value for the second target nucleic acid at the second detection temperature (i.e., RFU: 80), it was determined that the signal had changed (i.e., the target nucleic acid was present). As a result, the Ct value for each experiment was obtained as shown in Table 28, and the minimum variation Ct value, maximum variation Ct value, average Ct value, standard deviation (SD), and coefficient of variation (CV) thereof were obtained as shown in Table 29.

[0859]

[0860] Combination 1 Number of repetitions 1234 Reference value PCR equipment 136.54 35.66 37.01 35.68 PCR equipment 236.43 35.9 36.48 36.44 PCR equipment 335.97 36.69 36.75 36.62 Combination 2 Number of repetitions 1234 Reference value PCR equipment 137.18 37.02 37.74 36.82 PCR equipment 237.19 36.97 37.136.79 PCR equipment 336.83 36.73 37.68 37.21 Combination 3 Number of repetitions 1234 Reference value PCR equipment 137.22 37.47 36.65 36.95 PCR equipment 236.85 36.61 36.76 36.84 PCR equipment 336.6337.5237.537.05

[0861] Tube 1 Tube 2 Tube 3 First detection temperature (analysis signal) Second detection temperature First detection temperature (analysis signal) Second detection temperature First detection temperature (analysis signal) Second detection temperature Ct Min 35.66 33.17 36.733.38 36.61 32.44 Ct MAX 37.01 34.06 37.74 34.85 37.52 33.39 Ct Range (Max-Min) 1.35 0.89 1.03 0.97 0.92 0.95 Mean 36.34 33.47 37.134.38 37 32.82 SD 0.44 0.23 0.33 0.37 0.35 0.46 CV (%) 0.01 0.01 0.01 0.01 0.01 0.01

[0862] Ct Min: Minimum variation Ct value; Ct Max: Maximum variation Ct value;

[0863] Ct Mean: Average Ct value;

[0864] SD: Standard Deviation;

[0865] CV: Coefficient of Variation

[0866]

[0867] As shown in Table 29, the Ct value variability for the first target nucleic acid in tube 1 was 1.35, the Ct value variability for the first target nucleic acid in tube 2 was 1.03, and the Ct value variability for the first target nucleic acid in tube 3 was 0.92.

[0868]

[0869] <3-2> Samples in which the concentration of the first target nucleic acid is the same as that of the second target nucleic acid

[0870] Using three real-time thermocyclers (CFX96 Real-time Cycler, Bio-Rad), the real-time PCR graphs of tubes 4 to 6 were shown in Figure 28 as a result of four repetitions.

[0871] The extraction signal for the first target nucleic acid extracted using mathematical formula IX from the graph of FIG. 28 and the analysis signal obtained by correcting the same are shown in FIG. 29.

[0872] Next, the presence of the first target nucleic acid was determined from the analysis signal (Fig. 29), and the presence of the second target nucleic acid was determined from the signal measured at the second detection temperature (Fig. 28). Specifically, if the signal value at 72°C and 82°C was higher than a specified threshold value, that is, a value that was 10% of the signal value for the second target nucleic acid at the second detection temperature (i.e., RUF: 80), it was determined that the signal had changed (i.e., the target nucleic acid was present). As a result, the Ct value for each experiment was obtained as in Table 30, and the minimum variation Ct value, maximum variation Ct value, average Ct value, standard deviation (SD), and coefficient of variation (CV) thereof were obtained as in Table 31.

[0873]

[0874] Combination 1 Number of repetitions 1234 Reference value PCR equipment 133.88 33.56 34.06 33.67 PCR equipment 233.5 33.94 33.69 33.52 PCR equipment 334.15 33.84 33.05 33.67 Combination 2 Number of repetitions 1234 Reference value PCR equipment 133.83 33.85 33.96 33.95 PCR equipment 233.45 32.92 33.06 33.23 PCR equipment 333.63 33.19 33.5 333.35 Combination 3 Number of repetitions 1234 Reference value PCR equipment 133.92 33.92 33.66 33.76 PCR equipment 233.93 33.5 233.8 133.94 PCR equipment 333.333.5534.1433.38

[0875] Tube 4 Tube 5 Tube 6 First detection temperature (analysis signal) Second detection temperature First detection temperature (analysis signal) Second detection temperature First detection temperature (analysis signal) Second detection temperature Ct Min 33.05 33.38 32.92 33.04 33.33 2.73 Ct MAX 34.15 34.16 33.96 33.85 34.14 33.59 Ct Range (Max-Min) 1.10.78 1.04 0.8 10.84 0.86 Mean 33.71 33.69 33.47 33.52 33.74 33.15 SD 0.30.28 0.36 0.27 0.26 0.26 CV (%) 0.01 0.01 0.01 0.01 0.01 0.01

[0876] Ct Min: Minimum variation Ct value; Ct Max: Maximum variation Ct value;

[0877] Ct Mean: Average Ct value;

[0878] SD: Standard Deviation;

[0879] CV: Coefficient of Variation

[0880]

[0881] As shown in Table 31, the Ct value variability for the first target nucleic acid of tube 4 was confirmed to be 1.1, the Ct value variability for the first target nucleic acid of tube 5 was confirmed to be 1.04, while the Ct value variability for the first target nucleic acid of tube 6 was confirmed to be 0.84.

[0882]

[0883] <3-3> Sample with a higher concentration of the first target nucleic acid than the second target nucleic acid

[0884] Using three real-time thermocyclers (CFX96 Real-time Cycler, Bio-Rad), the real-time PCR graphs of tubes 7 to 9 were shown in Figure 28 as a result of four repetitions.

[0885] The extraction signal for the first target nucleic acid extracted using mathematical formula IX from the graph of FIG. 30 and the analysis signal obtained by correcting the same are shown in FIG. 31.

[0886] Next, the presence of the first target nucleic acid was determined from the analysis signal (Fig. 31), and the presence of the second target nucleic acid was determined from the signal measured at the second detection temperature (Fig. 30). Specifically, if the signal value at 72°C and 82°C was higher than a specified threshold value, that is, a value that was 10% of the signal value for the second target nucleic acid at the second detection temperature (i.e., RFU: 80), it was determined that the signal had changed (i.e., the target nucleic acid was present). As a result, the Ct value for each experiment was obtained as shown in Table 32, and the minimum variation Ct value, maximum variation Ct value, average Ct value, standard deviation (SD), and coefficient of variation (CV) thereof were obtained as shown in Table 33.

[0887]

[0888] Combination 1 Number of repetitions 1234 Reference value PCR equipment 130.78 30.3 30.8 30.49 PCR equipment 230.2 30.16 30.36 30.36 PCR equipment 330.5 30.25 30.16 30.69 Combination 2 Number of repetitions 1234 Reference value PCR equipment 130.06 30.1 30.28 30.1 PCR equipment 229.9 29.95 29.64 29.86 PCR equipment 329.58 29.54 29.89 29.98 Combination 3 Number of repetitions 1234 Reference value PCR equipment 130.02 29.97 29.94 29.93 PCR equipment 230.05 29.92 29.77 29.92 PCR equipment 329.8729.7229.6929.76

[0889] Tube 7 Tube 8 Tube 9 First detection temperature (analysis signal) Second detection temperature First detection temperature (analysis signal) Second detection temperature First detection temperature (analysis signal) Second detection temperature Ct Min 30.16 33.79 29.54 33.16 29.37 32.81 Ct MAX 30.8 34.69 30.28 34.05 30.05 33.61 Ct Range (Max-Min) 0.65 0.90 74 0.89 0.69 0.8 Mean 30.4 34.19 29.91 33.66 29.84 33.26 SD 0.23 0.31 0.26 0.28 0.19 0.23 CV (%) 0.01 0.01 0.07 0.01 0.01 0.01

[0890] Ct Min: Minimum variation Ct value; Ct Max: Maximum variation Ct value;

[0891] Ct Mean: Average Ct value;

[0892] SD: Standard Deviation;

[0893] CV: Coefficient of Variation

[0894]

[0895] As shown in Table 33, it was confirmed that the Ct value variability for the first target nucleic acid of tube 7 was 0.65, the Ct value variability for the first target nucleic acid of tube 8 was 0.74, and the Ct value variability for the first target nucleic acid of tube 9 was 0.69.

[0896]

[0897] In summary, as a result of confirming the influence of the variability of the reference value on the variability of the result value for the first target nucleic acid, in the case of tube 1 and tube 4 using combination 1, the variability of the Ct value for the first target nucleic acid was 1.35 and 1.1, respectively, and in the case of tube 2 and tube 5 using combination 2, the variability of the Ct value for the first target nucleic acid was 1.03 and 1.04, respectively, whereas in the case of tube 3 and 6 using combination 3, the variability of the Ct value for the first target nucleic acid was 0.92 and 0.84, respectively. That is, it was confirmed that the larger the reference value, the greater the variability of the result value tends to be. In particular, in the case of combination 1 and combination 2, it was confirmed that the variability of the Ct value for the first target nucleic acid exceeded 1, so the accuracy and reliability of the result value were relatively low. On the other hand, in the case of combination 3, the variability of the Ct value for the first target nucleic acid was less than 1, so it was confirmed that the accuracy and reliability of the result value were relatively high.

[0898] Meanwhile, in the case of tube 7 using combination 1, tube 8 using combination 2, and tube 9 using combination 3, that is, when the concentration of the first target nucleic acid is higher than the concentration of the second target nucleic acid, the variability of the Ct value for the first target nucleic acid was confirmed to be 0.65, 0.74, and 0.69, respectively, which means that the variability of the Ct value is less than 1. This is interpreted to mean that, as explained in the results of Example 1 above, in the case of samples in which the concentration of the first target nucleic acid is higher than that of the second target nucleic acid, the variability of the signal occurs after the point where it crosses the threshold value (i.e., the Ct value), and thus the variability of the reference value does not affect the variability of the Ct value.

[0899] In addition, for tubes 1, 4, and 7 using combination 1, the variability of the Ct values ​​for the second target nucleic acid was confirmed to be 0.78 to 0.9, for tubes 2, 5, and 8 using combination 2, the variability of the Ct values ​​for the second target nucleic acid was 0.81 to 0.97, and for tubes 3, 6, and 9 using combination 3, the variability of the Ct values ​​for the first target nucleic acid was confirmed to be 0.8 to 0.95. That is, it was confirmed that the variability of the Ct values ​​for the second target nucleic acid was less than 1 in all of combinations 1, 2, and 3. The presence of the second target nucleic acid is determined only by the signal measured at the second detection temperature regardless of the reference value. That is, the result that the Ct value variability observed in tubes 3, 6, and 9 is less than 1 indicates that the variability is not caused by the variability of the reference value. Through these results, the inventors confirmed that the standard set by the inventors for the variability of the Ct value to be less than 1 was an appropriate standard for further improving the accuracy and reliability of the results.

[0900] In conclusion, it was confirmed that when applying a reference value range of 0.5 or less, where the variability of the Ct value is less than 1 according to the present disclosure, the variability of the result value due to the variability of the reference value is effectively eliminated, thereby further improving the accuracy and reliability of the result.

[0901]

[0902] While specific aspects of the present invention have been described in detail above, it should be apparent to those skilled in the art that these specific descriptions are merely preferred embodiments and do not limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A method for detecting two target nucleic acids in a sample using two detection temperatures, comprising the following steps: (a) a step of incubating, in one reaction vessel, a sample suspected of containing at least one of a first target nucleic acid and a second target nucleic acid with (i) a composition for detecting a first target nucleic acid and (ii) a composition for detecting a second target nucleic acid, and measuring a signal at a first detection temperature and a second detection temperature; The above incubation and signal measurement are performed by real-time nucleic acid amplification reaction, The first target nucleic acid is amplified and detected by the first target nucleic acid detection composition, and the second target nucleic acid is amplified and detected by the second target nucleic acid detection composition. The composition for detecting the first target nucleic acid reacts with the first target nucleic acid to provide a signal for the first target nucleic acid at a first detection temperature, and the composition for detecting the second target nucleic acid reacts with the second target nucleic acid to provide a signal for the second target nucleic acid at both the first detection temperature and the second detection temperature. The first detection temperature is a temperature at which both a signal for the first target nucleic acid and a signal for the second target nucleic acid are detectable, and the second detection temperature is a temperature at which a signal for the second target nucleic acid is detectable, provided that the intensity of the signal for the second target nucleic acid at the first detection temperature is 0.5 times or less than the intensity of the signal for the second target nucleic acid at the second detection temperature. At the first detection temperature, the signal for the first target nucleic acid and the signal for the second target nucleic acid are not distinguished from each other by a single type detector, (b) a step of determining the presence of the two target nucleic acids by the signals measured in the step (a), (i) the presence of the second target nucleic acid is determined by a signal measured at the second detection temperature, and (ii) the presence of the first target nucleic acid is determined by a difference between a signal measured at the first detection temperature and a signal measured at the second detection temperature.

2. In the first paragraph, in the step (b), the presence of the first target nucleic acid is determined by the difference between the signal measured at the first detection temperature and the signal measured at the second detection temperature using a reference value, and the reference value is obtained by the following steps: (i) a step of incubating the second target nucleic acid together with the composition for detecting the second target nucleic acid in a reaction vessel different from the single reaction vessel used in step (a); (ii) a step of measuring a signal at both the first detection temperature and the second detection temperature; and (iii) a step of calculating the difference between the signal measured at the first detection temperature and the signal measured at the second detection temperature.

3. In the second paragraph, the method is characterized in that the reference value is obtained using the following mathematical formula I: [Formula I] Reference value = [Signal measured at the first detection temperature for a sample containing only the second target nucleic acid] ÷ [Signal measured at the second detection temperature for a sample containing only the second target nucleic acid] 4. In the first paragraph, in the step (b), the presence of the first target nucleic acid is determined by an analysis signal, and the analysis signal is obtained by the following steps: (i-1) a step of extracting a signal for a first target nucleic acid from a signal measured at the first detection temperature using a signal measured at the second detection temperature modified by a reference value; (i-2) a step of selecting a cycle having a maximum signal value or a minimum signal value from the extracted signal for the first target nucleic acid; and (i-3) a step of obtaining signal values ​​from the selected cycle to the last cycle as analysis signals for the first target nucleic acid; A method characterized in that the above reference value is obtained by the following steps: (ii-1) a step of incubating the second target nucleic acid together with the composition for detecting the second target nucleic acid in a reaction vessel different from the single reaction vessel used in the step (a); (ii-2) a step of measuring a signal at both the first detection temperature and the second detection temperature; and (ii-3) A step of calculating the difference between the signal measured at the first detection temperature and the signal measured at the second detection temperature.

5. In the third paragraph, a method characterized in that the extraction of a signal for the first target nucleic acid is performed by the following mathematical formula II: [Formula II] Extracted signal for the first target nucleic acid = [signal measured at the first detection temperature in step (a)] - [(signal measured at the second detection temperature in step (a)) x (reference value)] 6. A method according to claim 1, wherein the second detection temperature is higher than the first detection temperature, the second target nucleic acid detection composition has a signal-changing temperature range (SChTR) in which a signal changes as the second target nucleic acid reacts with the second target nucleic acid and amplifies the second target nucleic acid, and the signal-changing temperature range includes a temperature subrange showing a pattern in which the signal change increases as the temperature increases.

7. A method according to claim 1, wherein the second detection temperature is lower than the first detection temperature, the second target nucleic acid detection composition has a signal-change temperature range in which a signal changes as the second target nucleic acid reacts with the second target nucleic acid and amplifies the second target nucleic acid, and the signal-change temperature range includes a temperature sub-region showing a pattern in which the signal change decreases as the temperature increases.

8. A method according to claim 6, characterized in that the first target nucleic acid detection composition and the second target nucleic acid detection composition each provide a dimer formed by a cleavage reaction dependent on the presence of the corresponding target nucleic acid.

9. In the 6th paragraph, the method is characterized in that the composition for detecting the first target nucleic acid comprises the following: (i) primer, The above primer comprises a nucleotide sequence that hybridizes to a first region of a first target nucleic acid; (ii) Probing and Tagging Oligonucleotide (PTO), The PTO comprises, in 5' to 3' order, (i) a 5'-tagging portion comprising a nucleotide sequence that non-hybridizes to a first target nucleic acid, and (ii) a 3'-targeting portion comprising a nucleotide sequence that hybridizes to a second region of the first target nucleic acid; and (iii) Capturing and Templating Oligonucleotide (CTO); The CTO comprises, in 3' to 5' order, (i) a capturing portion comprising a nucleotide sequence that hybridizes to the 5'-tagging portion or a part of the 5'-tagging portion of the PTO, and (ii) a templating portion comprising a nucleotide sequence that non-hybridizes to the 5'-tagging portion and the 3'-targeting portion of the PTO, The above CTO comprises a reporter molecule and a quencher molecule linked thereto.

10. In the 9th paragraph, the composition for detecting the first target nucleic acid is characterized in that it provides a signal by a method including the following steps: (a') a step of hybridizing the first target nucleic acid with the primer and the PTO, The 5'-tagging portion of the PTO does not hybridize to the first target nucleic acid, the 3'-targeting portion of the PTO hybridizes to the first target nucleic acid, and the primer is located upstream of the PTO; (b') a step of contacting the resultant of step (a') with a DNA polymerase having 5'nuclease activity under conditions for cleavage of the PTO, The above primer is extended by a DNA polymerase having the 5' nuclease activity to induce cleavage of the PTO, which cleavage releases a fragment comprising the 5'-tagging portion or a part of the 5'-tagging portion of the PTO; (c') A step of hybridizing the fragment released from the PTO and the CTO, The above fragment hybridizes to the capturing portion of the CTO; (d') A step of performing an extension reaction using the result of the above step (c') and the DNA polymerase having the above 5'nuclease activity, The fragment hybridized to the capturing portion of the CTO is extended to generate an extended strand complementary to the templating portion of the CTO, thereby generating an extended duplex between the extended strand and the CTO. (e') a step of detecting the presence of the above extended strand, The presence of the above extended strand indicates the presence of the first target nucleic acid.

11. A method according to claim 10, characterized in that the presence of the extended strand is detected by measuring a signal provided from the extended duplex at the first detection temperature.

12. A method according to claim 10, wherein when the CTO exists as a single strand, the reporter molecule and the quencher molecule of the CTO are structurally close to each other, thereby causing the quencher molecule to quench a signal from the reporter molecule.

13. A method according to claim 10, wherein when the CTO hybridizes with the extended strand, the reporter molecule and the quencher molecule of the CTO are structurally separated, whereby the quencher molecule unquenches a signal from the reporter molecule.

14. In the sixth paragraph, the method is characterized in that the second target nucleic acid detection composition comprises the following: (i) primer, The primer comprises a nucleotide sequence that hybridizes to a first region of the second target nucleic acid; (ii) Probing and Tagging Oligonucleotide (PTO), The PTO comprises, from 5' to 3', (i) a 5'-tagging portion comprising a nucleotide sequence that non-hybridizes to a second target nucleic acid, and (ii) a 3'-targeting portion comprising a nucleotide sequence that hybridizes to a second region of the second target nucleic acid; (iii) Capturing and Templating Oligonucleotide (CTO); The CTO comprises, in 3' to 5' order, (i) a capturing portion comprising a nucleotide sequence that hybridizes to the 5'-tagging portion or a part of the 5'-tagging portion of the PTO, and (ii) a templating portion comprising a nucleotide sequence that non-hybridizes to the 5'-tagging portion and the 3'-targeting portion of the PTO, The CTO comprises a reporter molecule and a quencher molecule linked thereto, defining a labeled portion; and (iv) labeled portion hybridizing oligonucleotide (LPHO), The above LPHO comprises a nucleotide sequence that hybridizes to the labeling portion of the CTO.

15. In the 14th paragraph, the second target nucleic acid detection composition is characterized in that it provides a signal by a method comprising the following steps: (a”) A step of hybridizing the second target nucleic acid with the primer and the PTO, The 5'-tagging portion of the PTO does not hybridize to the second target nucleic acid, the 3'-targeting portion of the PTO hybridizes to the second target nucleic acid, and the primer is located upstream of the PTO; (b”) A step of contacting the resultant of step (a”) with a DNA polymerase having 5'nuclease activity under conditions for cleavage of the PTO, The above primer is extended by a DNA polymerase having the 5' nuclease activity to induce cleavage of the PTO, which cleavage releases a fragment comprising the 5'-tagging portion or a part of the 5'-tagging portion of the PTO; (c”) A step of hybridizing the fragment released from the PTO and the CTO, The above fragment hybridizes to the capturing portion of the CTO; (d”) A step of performing an extension reaction using the resultant of step (c”) and a DNA polymerase having 5'nuclease activity in the presence of the LPHO, When the second target nucleic acid is present in the sample, the fragment hybridized to the capturing portion of the CTO is extended to generate an extended strand complementary to the templating portion of the CTO, thereby generating an extended duplex between the extended strand and the CTO, and the generation of the extended duplex prevents the formation of a CTO / LPHO hybrid between the CTO and the LPHO. If the second target nucleic acid is not present in the sample, the extended strand is not generated, but instead a CTO / LPHO hybrid is formed between the CTO and the LPHO; and (e”) A step of detecting the presence of the extended duplex, The presence of the above extended duplex indicates the presence of the second target nucleic acid.

16. A method in claim 15, wherein the presence of the extended duplex is detected by measuring (i) a signal provided from the extended duplex, (ii) a signal provided from the CTO / LPHO hybrid, or (iii) signals provided from the extended duplex and the CTO / LPHO hybrid at the second detection temperature.

17. A method according to claim 15, wherein when the CTO exists as a single strand, the reporter molecule and the quencher molecule of the CTO are structurally close to each other, thereby causing the quencher molecule to quench a signal from the reporter molecule.

18. A method according to claim 15, wherein when the CTO is hybridized with the extended strand or the LPHO, the reporter molecule and the quencher molecule of the CTO are structurally separated, thereby causing the quencher molecule to unquench a signal from the reporter molecule.

19. A method in claim 15, wherein the formation of the extended duplex is characterized in that formation of the CTO / LPHO hybrid is prevented due to cleavage of the LPHO during the extension reaction of step (d”).

20. A method according to claim 15, characterized in that the melting temperature (Tm) of the extended dimer is different from the Tm of the CTO / LPHO hybrid.

Citation Information

Patent Citations

  • Detection of Target Nucleic Acid Sequences Using Different Detection Temperatures

    KR1020160126092A

  • Detection of target nucleic acid sequences using different detection temperatures and reference values

    KR1020170085598A

  • Signal extraction for a target nucleic acid sequence

    KR1020180085061A

  • Semiconductor package and method of manufacturing semiconductor package

    KR102674128B1

  • Detection of multiple target nucleic acid using multiple detection temperatures

    WO2022265463A1