Identification of active coronavirus infection by targeting the negative RNA strand

The method targets the negative RNA strand of coronaviruses to differentiate replicating from non-replicating viruses, enhancing detection accuracy and aiding in disease control.

WO2025144655A1PCT designated stage expired Publication Date: 2025-07-03HOWARD UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
PCT/US2024/060772
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-28
Filing Date
2024-12-18
Publication Date
2025-07-03

AI Technical Summary

Technical Problem

Current methods struggle to distinguish between replicating and non-replicating coronaviruses, particularly SARS-CoV-2, which complicates containment efforts and quarantine policies, as individuals can test positive for weeks without being infectious.

Method used

A method targeting the negative RNA strand of coronaviruses, using specific primers that bind to conserved sequences in the negative-sense RNA molecule, allowing for the detection of replicating viruses through cDNA synthesis and amplification.

Benefits of technology

Enables accurate and early detection of infectious coronaviruses, distinguishing them from non-infectious forms, thereby improving disease management and reducing transmission.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2024060772_03072025_PF_FP_ABST
    Figure US2024060772_03072025_PF_FP_ABST
Patent Text Reader

Abstract

A method for detecting a coronavirus in a sample, the method containing i) isolating RNA from a sample; ii) contacting the isolated RNA with a first primer in the presence of a reverse transcriptase and dNTP under conditions permissive for cDNA synthesis, thereby generating cDNA; iii) contacting the cDNA with forward and reverse primers in the presence of a DNA polymerase and dNTP under condition permissive for cDNA amplification, thereby generating an amplified product, and iv) identifying the amplified product, thereby detecting the presence or absence of the virus, wherein the first primer binds to or hybridizes with a negative-strand RNA molecule produced by the virus.
Need to check novelty before this filing date? Find Prior Art

Description

IDENTIFICATION OF ACTIVE CORONAVIRUS INFECTION BY TARGETING THE NEGATIVE RNA STRAND SEQUENCE LISTING

[0001] The content of the electronically submitted sequence listing, file name: F304750sequencelistingasfiled.xml; size 28 kilobytes; and date of creation: December 17, 2024, filed herewith, is incorporated herein by reference in its entirety. TECHNICAL FIELD

[0002] The present disclosure relates generally to compositions and methods for detecting active virus infection and, in particular, for early detection of active coronavirus infection, including active Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) infection. The disclosure also relates to the production of compositions for detecting active virus infection and, in particular, for detecting active coronavirus infection, including Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) infection. BACKGROUND

[0003] As of 2022, SARS-CoV-2 has infected more than six-hundred million individuals worldwide, resulting in more than 6 million deaths to date. Recent reports of long- term viral persistence in multiple organs of SARS-CoV-2- infected persons are making containment efforts more complicated. For example, the SARS-CoV-2 genome was found in the tonsils of 20% of 48 children that had tonsillectomies. None of the children had experienced signs or symptoms of COVID prior to the surgery. The use of reversetranscription polymerase chain reaction (RT- PCR), immunohistochemistry (IHC), flow cytometry, and neutralization assays on adenotonsillar tissues have enabled the detection of the SARS-CoV-2 genome. Similarly, SARS-CoV-2 nucleocapsid protein specific immune- histological stains have been seen in patients who undergone gastric and gallbladder surgery. The presence of the virus protein has been seen in patients who were COVID-19-free during surgery but were previously infected by the virus. In addition, autopsies of several patients that died of COVID detected persistent SARS-CoV-2 RNA throughout the central nervous system as late as 230 days following symptom onset. In another study, biopsies of patients with myocarditis showed the presence of SARS-CoV-2 spike proteins and nucleocapsid antigens 1-5 months after infection. The longest time after SARS-CoV-2 infection in which the virus was detected in the myocardium was 18 months.

[0004] Though the virus may be detected in different organs / tissues long after infection is over, whether these viruses represent replication-competent viruses remains an urgent matter to resolve. Containment efforts to manage the pandemic will be greatly affected if infectious virions reside in patients long after recovering from SARS-CoV-2 infection. There has been some discussion about detecting the presence of replication-competent viruses using sub-genomic positive mRNAs in the autopsied tissues. In addition, isolation of replication-competent viruses in cell culture could also indicate the presence of replicating virus. On the other hand, many investigators attribute the long-term presence of the SARS- CoV-2 to non-replicating viral fragments.

[0005] In addition, current CDC guidelines require 5-day isolation for individuals that test positive for SARS-CoV-2; however, many of these individuals have been found to remain positive in real time PCR tests for weeks after isolation, despite testing negative on antigendetection tests. Whether the persons that test positive on PCR tests remain infectious long after ending isolation remains a contentious issue. As such, it is now imperative to develop detection methods to distinguish replicating from non-replicating viruses. The availability of such detection systems would allow a myriad of advantages, ranging from better informed decisions regarding quarantine policies to effective therapeutic decisions.

[0006] People are thought to be most contagious early in the course of their illness with or without symptoms. "Without symptoms" can refer to two groups of people: those who eventually do have symptoms (pre-symptomatic) and those who never go on to have symptoms (asymptomatic). People without symptoms can spread the coronavirus infection to others. A person with SARS-CoV-2 may be contagious 48 hours before starting to experience symptoms. In fact, people without symptoms may be more likely to spread the illness, because they are unlikely to be isolating and may not adopt behaviors designed to prevent spread. As such, there is a pressing need to develop a method for detecting active coronavirus infections.

[0007] Mouse hepatitis virus (MHV) belongs to the coronavirus family of positive- strand RNA viruses. MHV, SARS-CoV, and SARS-CoV-2 share a common genus. MHV is the most studied coronavirus in animal other than humans. MHV has been used as a model for SARS-CoV and SARS-CoV-2 as well as mouse models for infection with SARS-CoV and SARS-CoV-2. The murine infection with MHV serves as an experimental model to study principles of the coronavirus family of positive-strand RNA viruses.

[0008] The present disclosure provides a negative RNA strand-specific detection method to replace or accompany current positive-strand specific real time PCR tests, in orderto readily discern infectious disease through a simple detection test. The method allows for the accurate detection of replicating virus infections at an early stage, within hours of infection. Since people tend to be most infectious early in the course of their infection, and because most transmission occurs during the one to two days before the onset of symptoms and in the two to three days afterward, the use of this early and accurate detection method would contribute to limiting the spread of the virus. SUMMARY

[0009] The present disclosure provides a method by which infectious coronaviruses, including SARS-CoV-2, can be readily detected and distinguished from noninfectious coronaviruses, including SARS-CoV-2. In particular, the viral detection targets are ribonucleic acid sequence present in, or generated by, coronaviruses, including SARS-CoV-2. More specifically, the viral detection target is the coronavirus antigenome, which is the negative RNA strand, that is generated from the positive genomic RNA strand, within the host cell while the coronavirus is actively infectious.

[0010] In embodiments herein, the viral targets are present in a region that is not amenable to mutation (e.g., because mutations in the region would disrupt the viral replication cycle). In certain embodiments, the viral target is a conserved sequence present in a negative- sense RNA molecule transcribed from a coronavirus positive-sense viral genome, such as the SARS-CoV-2 positive-sense viral genome. Because the conserved sequence is indispensable for the virus to survive and / or replicate, a detection agent that is able to target this sequence would be a reliable tool for identifying the presence of viruses (i.e., the virus will not be able to evade the detection by mutating).

[0011] The present disclosure further provides nucleic acid molecules, and compositions containing such nucleic acid molecules, that hybridize to conserved sequence in a negative-sense RNA molecule transcribed from a coronavirus positive-sense viral genome, such as the SARS-CoV-2 positive-sense viral genome, and that are capable of amplifying a region of said negative-sense RNA molecule such that the levels of said negative-sense RNA molecule can be determined.

[0012] Non-limiting embodiments of the disclosure include the following.

[0013] [1] A composition comprising a first oligonucleotide that binds to or hybridizes with a negative-strand ribonucleic acid (RNA) molecule produced by a virus that is from family Coronaviridae.

[0014] [2] The composition of [1], wherein the first oligonucleotide does not bind to or hybridize with a positive-strand RNA molecule of the virus.

[0015] [3] The composition of [1], wherein the negative-strand RNA molecule comprises a conserved region and the first oligonucleotide binds to or hybridizes with the conserved region of the negative-strand RNA molecule.

[0016] [4] The composition of [1], wherein the first oligonucleotide is a primer comprising a nucleic acid sequence of SEQ ID NO: 1 (TGAACCCACCAAAGATGTGTATG).

[0017] [5] The composition of [1], further comprising a second oligonucleotide that binds to or hybridizes with a positive-strand RNA molecule produced by the virus.

[0018] [6] The composition of [2], further comprising a second oligonucleotide that binds to or hybridizes with a positive-strand RNA molecule produced by the virus and thesecond oligonucleotide does not binds to or hybridize with the negative-strand RNA molecule of the virus.

[0019] [7] The composition of [4], further comprising a second oligonucleotide that is a primer comprising a nucleic acid sequence of SEQ ID NO: 2 (ACCCTGATGTGAGCTCTTCCCAG).

[0020] [8] The composition of [1], wherein the virus is murine coronavirus MHV.

[0021] [9] The composition of [1], wherein the virus is SARS-CoV, MERS-CoV, or SARS-CoV-2.

[0022]

[0010] The composition of [1], wherein the virus is SARS-CoV-2.

[0023]

[0011] A composition comprising a second oligonucleotide that binds to or hybridizes with a positive-strand RNA molecule produced by a virus that is from family Coronaviridae.

[0024]

[0012] The composition of

[0011] , wherein the second oligonucleotide does not bind to or hybridize with a negative-strand RNA molecule of the virus.

[0025]

[0013] The composition of

[0011] , wherein the positive-strand RNA molecule comprises a conserved region and the second oligonucleotide binds to or hybridizes with the conserved region of the positive-strand RNA molecule.

[0026]

[0014] The composition of

[0011] , wherein the second oligonucleotide is a primer comprising a nucleic acid sequence of SEQ ID NO: 2 (ACCCTGATGTGAGCTCTTCCCAG).

[0027]

[0015] The composition of

[0011] , wherein the virus is murine coronavirus MHV.

[0028]

[0016] The composition of

[0011] , wherein the virus is SARS-CoV, MERS-CoV, or SARS-CoV-2.

[0029]

[0017] The composition of

[0011] , wherein the virus is SARS-CoV-2.

[0030]

[0018] A method for detecting a coronavirus in a sample, the method comprising: isolating RNA from a sample; contacting the isolated RNA with a first primer in the presence of a reverse transcriptase and dNTP under conditions permissive for cDNA synthesis, thereby generating cDNA; contacting the cDNA with forward and reverse primers in the presence of a DNA polymerase and dNTP under condition permissive for cDNA amplification, thereby generating an amplified product, and identifying the amplified product, thereby detecting the presence or absence of the virus.

[0031]

[0019] The method of

[0018] , wherein the first primer binds to or hybridizes with a negative-strand RNA molecule produced by the virus.

[0032]

[0020] The method of

[0019] , wherein the first primer does not bind to or hybridize with a positive-strand RNA molecules produced by the virus.

[0033]

[0021] The method of

[0019] , wherein the negative-strand RNA molecule comprises a conserved region and the first primer binds to or hybridizes with the conserved region of the negative-strand RNA molecule.

[0034]

[0022] The method of

[0018] , wherein the first primer comprises a nucleic acid sequence of SEQ ID NO: 1 (TGAACCCACCAAAGATGTGTATG).

[0035]

[0023] The method of

[0018] , wherein the first primer binds to or hybridizes with a positive-strand RNA molecule produced by the virus.

[0036]

[0024] The method of

[0023] , wherein the first primer does not bind to or hybridizes with a negative-strand RNA molecules produced by the virus.

[0037]

[0025] The method of

[0023] , wherein the positive-strand RNA molecule comprises a conserved region and the first primer binds to or hybridizes with the conserved region of the positive-strand RNA molecule.

[0038]

[0026] The method of

[0018] , wherein the first primer comprises a nucleic acid sequence of SEQ ID NO: 2 (ACCCTGATGTGAGCTCTTCCCAG).

[0039]

[0027] The method of

[0018] , wherein the forward primer comprises a nucleic acid sequence of SEQ ID NO: 1 (TGAACCCACCAAAGATGTGTATG) and the reverse primer comprises a nucleic acid sequence of SEQ ID NO. 2 (ACCCTGATGTGAGCTCTTCCCAG).

[0040]

[0028] The method of

[0018] , wherein the coronavirus is murine coronavirus MHV.

[0041]

[0029] The method of

[0018] , wherein the coronavirus is SARS-CoV, MERS-CoV, or SARS-CoV-2.

[0042]

[0030] The method of

[0018] , wherein the coronavirus is SARS-CoV-2.

[0043]

[0031] The method of

[0018] , wherein the primer is conjugated to a heterologous molecule.

[0044]

[0032] The method of

[0031] , wherein the heterologous molecule is a detectable label.

[0045]

[0033] The method of

[0018] , wherein the method distinguishes a replicating virus infection from a non-replicative virus infection.

[0046]

[0034] The method of

[0018] , wherein the method detects a stage of coronavirus infection.

[0047]

[0035] The method of

[0018] , wherein the method detects an infectivity of coronavirus infection.

[0048]

[0036] The method of

[0018] , wherein the method further comprises a step of identifying a subject who is infected with the virus and but fails to show symptoms of virus infection.

[0049]

[0037] A kit, comprising i) a first primer comprising a nucleic acid sequence of SEQ ID NO: 1 (TGAACCCACCAAAGATGTGTATG), ii) a second primer comprising a nucleic acid sequence of SEQ ID NO. 2 (ACCCTGATGTGAGCTCTTCCCAG) and iii) instructions for using for using the first and second primers for detecting the coronavirus. INCORPORATION BY REFERENCE

[0050] All patents, publications, and patent applications cited in the present specification are herein incorporated by reference as if each individual patent, publication, or patent application was specifically and individually indicated to be incorporated by reference in its entirety for all purposes. BRIEF DESCRIPTION OF THE FIGURES

[0051] FIG. 1A. Illustration of the organization of the SARS-CoV-2 genome.

[0052] FIG. 1B. Illustration of the organization of the Murine Hepatitis Virus genome.

[0053] FIG. 2. Flow chart depicting the experimental steps for detecting positive or negative RNA strand in the mouse coronavirus MHV-A59. Self-priming RNA based cDNAdeveloped without any primer shows the background level of expression. RT-PCR refers to the Reverse Transcriptase based PCR, whereas real time PCR is described as qPCR.

[0054] FIG. 3. RT-PCR of the PCR product specific to the negative RNA strand (lane 1 and 2 in duplicate) and the positive RNA strand band after 2h of infection of the 17CL-1 cells with the MOI 1.0 of mouse coronavirus- MHV-A59. The lower panel shows the loading control by amplifying the mouse actin band of 154 bp length.

[0055] FIG. 4. Developmental stages of the host cells (17CL-1) post infection with the MHV-A59. Note the host cells shows extensive signs of infection within the 24h post infection and by the time of 72h post infection, hardly any host cells can be seen. The Cytopathic effect is completed by 72h post infection.

[0056] FIG. 5. RT-PCR based PCR product targeting the positive or the negative RNA strand. Lane 1 and 4- 24h and 72h post infection with self-priming cDNA samples respectively. Lane 2 and 5- 24h and 72h post infection with negative RNA specific cDNA samples, and lane 3 and 6- 24h and 72h post infection with positive RNA strand specific cDNA samples. Lower panel shows mouse actin (154 bp) from the same RNA isolated after 24h and 72h post infection samples.

[0057] FIG. 6A. qPCR amplification plot of the negative and positive RNA strand specific cDNA samples. cDNAs from the 72h post infection samples were shown which was amplified at 0.01 and 0.1 dilutions of the cDNAs. Traces 5 and 6 represent the 0.01 dilution samples from self-priming and negative-RNA strand specific cDNAs, respectively. Trace 4 represents the 0.01 dilution sample from the positive RNA strand specific cDNA sample. Traces 3 and 2 represent the 0.1 dilution samples from the self-priming and negative strandspecific cDNA samples, respectively. Trace 1 represents the 0.1 dilution sample from the positive RNA strand specific cDNA.

[0058] FIG. 6B. Absorption spectra of all three cDNA samples from FIG. 6A.

[0059] FIG. 6C. Melting curve of the amplified products from FIG. 6A. DETAILED DESCRIPTION

[0060] The present disclosures provides a composition comprising a first oligonucleotide that binds to or hybridizes with a negative-strand ribonucleic acid (RNA) molecule produced by a virus that is from family Coronaviridae. In one embodiment, the first oligonucleotide does not bind to or hybridize with a positive-strand RNA molecule of the virus. In another embodiment, the negative-strand RNA molecule comprises a conserved region and the first oligonucleotide binds to or hybridizes with the conserved region of the negative-strand RNA molecule.

[0061] In one embodiment, the first oligonucleotide may be a primer comprising a nucleic acid sequence of SEQ ID NO: 1 (TGAACCCACCAAAGATGTGTATG). Here, the first oligonucleotide may be a primer comprising a nucleic acid sequence having at least 80% identity to SEQ ID NO: 1. In another embodiment, the first oligonucleotide may be a primer comprising a nucleic acid sequence having at least 85% identity to SEQ ID NO: 1. In another embodiment, the first oligonucleotide may be a primer comprising a nucleic acid sequence having at least 90% identity to SEQ ID NO: 1. In another embodiment, the first oligonucleotide may be a primer comprising a nucleic acid sequence having at least 91% identity to SEQ ID NO: 1. In another embodiment, the first oligonucleotide may be a primercomprising a nucleic acid sequence having at least 92% identity to SEQ ID NO: 1. In another embodiment, the first oligonucleotide may be a primer comprising a nucleic acid sequence having at least 93% identity to SEQ ID NO: 1. In another embodiment, the first oligonucleotide may be a primer comprising a nucleic acid sequence having at least 94% identity to SEQ ID NO: 1. In another embodiment, the first oligonucleotide may be a primer comprising a nucleic acid sequence having at least 95% identity to SEQ ID NO: 1. In another embodiment, the first oligonucleotide may be a primer comprising a nucleic acid sequence having at least 96% identity to SEQ ID NO: 1. In another embodiment, the first oligonucleotide may be a primer comprising a nucleic acid sequence having at least 97% identity to SEQ ID NO: 1. In another embodiment, the first oligonucleotide may be a primer comprising a nucleic acid sequence having at least 98% identity to SEQ ID NO: 1. In another embodiment, the first oligonucleotide may be a primer comprising a nucleic acid sequence having at least 99% identity to SEQ ID NO: 1. In another embodiment, the first oligonucleotide may be a primer comprising the nucleic acid sequence of SEQ ID NO: 1.

[0062] In one embodiment, the composition of the present disclosure may further comprise a second oligonucleotide that binds to or hybridizes with a positive-strand RNA molecule produced by the virus. In another embodiment, the composition of the present disclosure may further comprise a second oligonucleotide that binds to or hybridizes with a positive-strand RNA molecule produced by the virus and the second oligonucleotide does not binds to or hybridize with the negative-strand RNA molecule of the virus.

[0063] In one embodiment, the composition of the present disclosure may further comprise a second oligonucleotide that is a primer comprising a nucleic acid sequence of SEQ ID NO: 2 (ACCCTGATGTGAGCTCTTCCCAG). Here, the second oligonucleotide may bea primer comprising a nucleic acid sequence having at least 80% identity to SEQ ID NO: 2. In another embodiment, the second oligonucleotide may be a primer comprising a nucleic acid sequence having at least 85% identity to SEQ ID NO: 2. In another embodiment, the second oligonucleotide may be a primer comprising a nucleic acid sequence having at least 90% identity to SEQ ID NO: 2. In another embodiment, the second oligonucleotide may be a primer comprising a nucleic acid sequence having at least 91% identity to SEQ ID NO: 2. In another embodiment, the second oligonucleotide may be a primer comprising a nucleic acid sequence having at least 92% identity to SEQ ID NO: 2. In another embodiment, the second oligonucleotide may be a primer comprising a nucleic acid sequence having at least 93% identity to SEQ ID NO: 2. In another embodiment, the second oligonucleotide may be a primer comprising a nucleic acid sequence having at least 94% identity to SEQ ID NO: 2. In another embodiment, the second oligonucleotide may be a primer comprising a nucleic acid sequence having at least 95% identity to SEQ ID NO: 2. In another embodiment, the second oligonucleotide may be a primer comprising a nucleic acid sequence having at least 96% identity to SEQ ID NO: 2. In another embodiment, the second oligonucleotide may be a primer comprising a nucleic acid sequence having at least 97% identity to SEQ ID NO: 2. In another embodiment, the second oligonucleotide may be a primer comprising a nucleic acid sequence having at least 98% identity to SEQ ID NO: 2. In another embodiment, the second oligonucleotide may be a primer comprising a nucleic acid sequence having at least 99% identity to SEQ ID NO: 2. In another embodiment, the second oligonucleotide may be a primer comprising the nucleic acid sequence of SEQ ID NO: 2.

[0064] In one embodiment, the virus may be murine coronavirus MHV. In another embodiment, the virus may be SARS-CoV, MERS-CoV, or SARS-CoV-2. In some embodiment, the virus is SARS-CoV-2.

[0065] The present disclosure also provides a composition comprising a second oligonucleotide that binds to or hybridizes with a positive-strand RNA molecule produced by a virus that is from family Coronaviridae. In one embodiment, the second oligonucleotide does not bind to or hybridize with a negative-strand RNA molecule of the virus. In some embodiment, the positive-strand RNA molecule comprises a conserved region and the second oligonucleotide binds to or hybridizes with the conserved region of the positive-strand RNA molecule.

[0066] In one embodiment, the second oligonucleotide is a primer comprising a nucleic acid sequence of SEQ ID NO: 2 (ACCCTGATGTGAGCTCTTCCCAG). Here, the second oligonucleotide may be a primer comprising a nucleic acid sequence having at least 80% identity to SEQ ID NO: 2. In another embodiment, the second oligonucleotide may be a primer comprising a nucleic acid sequence having at least 85% identity to SEQ ID NO: 2. In another embodiment, the second oligonucleotide may be a primer comprising a nucleic acid sequence having at least 90% identity to SEQ ID NO: 2. In another embodiment, the second oligonucleotide may be a primer comprising a nucleic acid sequence having at least 91% identity to SEQ ID NO: 2. In another embodiment, the second oligonucleotide may be a primer comprising a nucleic acid sequence having at least 92% identity to SEQ ID NO: 2. In another embodiment, the second oligonucleotide may be a primer comprising a nucleic acid sequence having at least 93% identity to SEQ ID NO: 2. In another embodiment, the second oligonucleotide may be a primer comprising a nucleic acid sequence having at least 94%identity to SEQ ID NO: 2. In another embodiment, the second oligonucleotide may be a primer comprising a nucleic acid sequence having at least 95% identity to SEQ ID NO: 2. In another embodiment, the second oligonucleotide may be a primer comprising a nucleic acid sequence having at least 96% identity to SEQ ID NO: 2. In another embodiment, the second oligonucleotide may be a primer comprising a nucleic acid sequence having at least 97% identity to SEQ ID NO: 2. In another embodiment, the second oligonucleotide may be a primer comprising a nucleic acid sequence having at least 98% identity to SEQ ID NO: 2. In another embodiment, the second oligonucleotide may be a primer comprising a nucleic acid sequence having at least 99% identity to SEQ ID NO: 2. In another embodiment, the second oligonucleotide may be a primer comprising the nucleic acid sequence of SEQ ID NO: 2.

[0067] In one embodiment, the virus is murine coronavirus MHV. In another embodiment, the virus is SARS-CoV, MERS-CoV, or SARS-CoV-2. In some embodiment, the virus is SARS-CoV-2.

[0068] The present disclosure also provides a method for detecting a coronavirus in a sample, the method comprising isolating RNA from a sample; contacting the isolated RNA with a first primer in the presence of a reverse transcriptase and dNTP under a condition permissive for cDNA synthesis, thereby generating cDNA; contacting the cDNA with forward and reverse primers in the presence of a DNA polymerase and dNTP under a condition permissive for cDNA amplification, thereby generating an amplified product, and identifying the amplified product, thereby detecting the presence or absence of the virus.

[0069] In one embodiment, the first primer binds to or hybridizes with a negative- strand RNA molecule produced by the virus. In another embodiment, the first primer doesnot bind to or hybridize with a positive-strand RNA molecules produced by the virus. In some embodiment, the negative-strand RNA molecule comprises a conserved region and the first primer binds to or hybridizes with the conserved region of the negative-strand RNA molecule.

[0070] In one embodiment, the first primer comprises a nucleic acid sequence of SEQ ID NO: 1 (TGAACCCACCAAAGATGTGTATG). Here, the first primer may comprise a nucleic acid having at least 80% identity to SEQ ID NO: 1. In another embodiment, the first primer may comprise a nucleic acid having at least 85% identity to SEQ ID NO: 1. In another embodiment, the first primer may comprise a nucleic acid having at least 90% identity to SEQ ID NO: 1. In another embodiment, the first primer may comprise a nucleic acid having at least 91% identity to SEQ ID NO: 1. In another embodiment, the first primer may comprise a nucleic acid having at least 92% identity to SEQ ID NO: 1. In another embodiment, the first primer may comprise a nucleic acid having at least 93% identity to SEQ ID NO: 1. In another embodiment, the first primer may comprise a nucleic acid having at least 94% identity to SEQ ID NO: 1. In another embodiment, the first primer may comprise a nucleic acid having at least 94% identity to SEQ ID NO: 1. In another embodiment, the first primer may comprise a nucleic acid having at least 95% identity to SEQ ID NO: 1. In another embodiment, the first primer may comprise a nucleic acid having at least 96% identity to SEQ ID NO: 1. In another embodiment, the first primer may comprise a nucleic acid having at least 97% identity to SEQ ID NO: 1. In another embodiment, the first primer may comprise a nucleic acid having at least 98% identity to SEQ ID NO: 1. In another embodiment, the first primer may comprise a nucleic acid having at least 99% identity to SEQ ID NO: 1. In another embodiment, the first primer may comprise the nucleic acid of SEQ ID NO: 1.

[0071] In one embodiment, the first primer binds to or hybridizes with a positive- strand RNA molecule produced by the virus. In another embodiment, the first primer does not bind to or hybridizes with a negative-strand RNA molecules produced by the virus. In one embodiment, the positive-strand RNA molecule comprises a conserved region and the first primer binds to or hybridizes with the conserved region of the positive-strand RNA molecule.

[0072] In some embodiment, the first primer comprises a nucleic acid sequence of SEQ ID NO: 2 (ACCCTGATGTGAGCTCTTCCCAG). Here, the first primer may comprise a nucleic acid sequence having at least 80% identity to SEQ ID NO: 2. In another embodiment, the first primer may comprise a nucleic acid sequence having at least 85% identity to SEQ ID NO: 2. In another embodiment, the first primer may comprise a nucleic acid sequence having at least 90% identity to SEQ ID NO: 2. In another embodiment, the first primer may comprise a nucleic acid sequence having at least 91% identity to SEQ ID NO: 2. In another embodiment, the first primer may comprise a nucleic acid sequence having at least 92% identity to SEQ ID NO: 2. In another embodiment, the first primer may comprise a nucleic acid sequence having at least 93% identity to SEQ ID NO: 2. In another embodiment, the first primer may comprise a nucleic acid sequence having at least 94% identity to SEQ ID NO: 2. In another embodiment, the first primer may comprise a nucleic acid sequence having at least 95% identity to SEQ ID NO: 2. In another embodiment, the first primer may comprise a nucleic acid sequence having at least 96% identity to SEQ ID NO: 2. In another embodiment, the first primer may comprise a nucleic acid sequence having at least 97% identity to SEQ ID NO: 2. In another embodiment, the first primer may comprise a nucleic acid sequence having at least 98% identity to SEQ ID NO: 2. In anotherembodiment, the first primer may comprise a nucleic acid sequence having at least 99% identity to SEQ ID NO: 2. In another embodiment, the first primer may comprise the nucleic acid sequence of SEQ ID NO: 2.

[0073] In one embodiment, the forward primer comprises a nucleic acid sequence of SEQ ID NO: 1 (TGAACCCACCAAAGATGTGTATG) and the reverse primer comprises a nucleic acid sequence of SEQ ID NO. 2 (ACCCTGATGTGAGCTCTTCCCAG). In one embodiment, the forward primer may comprise a nucleic acid sequence having at least 80% identity to SEQ ID NO: 1 and the reverse primer may comprise a nucleic acid sequence having at least 80% identity to SEQ ID NO. 2. In another embodiment, the forward primer may comprise a nucleic acid sequence having at least 85% identity to SEQ ID NO: 1 and the reverse primer may comprise a nucleic acid sequence having at least 85% identity to SEQ ID NO. 2. In another embodiment, the forward primer may comprise a nucleic acid sequence having at least 90% identity to SEQ ID NO: 1 and the reverse primer may comprise a nucleic acid sequence having at least 90% identity to SEQ ID NO. 2. In another embodiment, the forward primer may comprise a nucleic acid sequence having at least 91% identity to SEQ ID NO: 1 and the reverse primer may comprise a nucleic acid sequence having at least 91% identity to SEQ ID NO. 2. In another embodiment, the forward primer may comprise a nucleic acid sequence having at least 92% identity to SEQ ID NO: 1 and the reverse primer may comprise a nucleic acid sequence having at least 92% identity to SEQ ID NO. 2. In another embodiment, the forward primer may comprise a nucleic acid sequence having at least 93% identity to SEQ ID NO: 1 and the reverse primer may comprise a nucleic acid sequence having at least 93% identity to SEQ ID NO. 2. In another embodiment, the forward primer may comprise a nucleic acid sequence having at least 94% identity to SEQ ID NO: 1and the reverse primer may comprise a nucleic acid sequence having at least 94% identity to SEQ ID NO. 2. In another embodiment, the forward primer may comprise a nucleic acid sequence having at least 95% identity to SEQ ID NO: 1 and the reverse primer may comprise a nucleic acid sequence having at least 95% identity to SEQ ID NO. 2. In another embodiment, the forward primer may comprise a nucleic acid sequence having at least 96% identity to SEQ ID NO: 1 and the reverse primer may comprise a nucleic acid sequence having at least 96% identity to SEQ ID NO. 2. In another embodiment, the forward primer may comprise a nucleic acid sequence having at least 97% identity to SEQ ID NO: 1 and the reverse primer may comprise a nucleic acid sequence having at least 97% identity to SEQ ID NO. 2. In another embodiment, the forward primer may comprise a nucleic acid sequence having at least 98% identity to SEQ ID NO: 1 and the reverse primer may comprise a nucleic acid sequence having at least 98% identity to SEQ ID NO. 2. In another embodiment, the forward primer may comprise a nucleic acid sequence having at least 99% identity to SEQ ID NO: 1 and the reverse primer may comprise a nucleic acid sequence having at least 99% identity to SEQ ID NO. 2. In another embodiment, the forward primer may comprise the nucleic acid sequence of SEQ ID NO: 1 and the reverse primer may comprise the nucleic acid sequence of SEQ ID NO. 2.

[0074] In one embodiment, the coronavirus is murine coronavirus MHV. In another embodiment, the coronavirus is SARS-CoV, MERS-CoV, or SARS-CoV-2. In another embodiment, the coronavirus is SARS-CoV-2.

[0075] In one embodiment, wherein the primer is conjugated to a heterologous molecule. In another embodiment, the heterologous molecule is a detectable label.

[0076] In one embodiment, the method of the present disclosure distinguishes a replicating virus infection from a non-replicative virus infection. In another embodiment, method detects a stage of coronavirus infection. In another embodiment, the method detects an infectivity of coronavirus infection. In one embodiment, the method further comprises a step of identifying a subject who is infected with the virus and but fails to show symptoms of virus infection.

[0077] The present disclosure also provides a kit comprising i) a first primer comprising a nucleic acid sequence of SEQ ID NO: 1 (TGAACCCACCAAAGATGTGTATG), ii) a second primer comprising a nucleic acid sequence of SEQ ID NO. 2 (ACCCTGATGTGAGCTCTTCCCAG) and iii) instructions for using for using the first and second primers for detecting the coronavirus.

[0078] SARS-CoV-2, the causative agent of COVID-19, is an enveloped RNA virus within the family Coronaviridae, and contains a single-stranded, positive-sense (+) RNA genome. The organization of the SARS-CoV-2 genome is depicted in FIG. 1. This is in contrast to the human genome, which is double-stranded DNA. Infection of a cell with the SARS-CoV-2 virus begins with attachment of the SARS-CoV-2 spike (S) protein to its cognate cellular receptor (angiotensin-converting enzyme 2; ACE2), followed by internalization, fusion with the endosomal membrane and uncoating, and translation of viral non-structural proteins (encoded by the single-stranded, positive-sense (+) RNA genome of SARS-CoV-2) to form the viral replicase complex. Following assembly of viral replicase complexes, viral RNA synthesis ensues, which results in the production of both genomic and sub-genomic RNAs (the sub-genomic RNAs are used as mRNAs for the translation ofstructural and accessory genes). The sub-genomic mRNA cannot serve as templates for negative-strand synthesis, because they lack the 5’- replication signal.

[0079] The negative-strand intermediates are synthesized throughout infection (via RNA-dependent RNA polymerase), although their synthesis declines after approximately six to seven hours post-infection. In contrast, human cells do not typically produce any negative- strand RNA molecules, and therefore, negative strand RNA molecules are typically absent in normal human cells.

[0080] The polynucleotide primer of the present disclosure may be labeled, as described below, by incorporating moieties detectable by spectroscopic, photochemical, biochemical, immunochemical, enzymatic or chemical means. The method of linking or conjugating the label to the oligonucleotide primer depends, of course, on the type of label(s) used and the position of the label on the primer. A primer that is useful according to the disclosure can be labeled at the 5' end, the 3' end or labeled throughout the length of the primer.

[0081] A variety of labels that would be appropriate for use in the disclosure, as well as methods for their inclusion in the primer, are known in the art and include, but are not limited to, enzymes (e.g., alkaline phosphatase and horseradish peroxidase) and enzyme substrates, radioactive atoms, fluorescent dyes, chromophores, chemiluminescent labels, electrochemiluminescent labels, that may interact with each other to enhance, alter, or diminish a signal.

[0082] As described herein, the present inventors have demonstrated that, by detecting the presence or absence of the negative-strand intermediates of the coronavirus RNA, the extent to which viral replication is occurring can be determined.

[0083] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. As used in the present specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a primer” includes one or more primers.

[0084] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosure pertains. Although other methods and materials similar, or equivalent, to those described herein can be useful in the present disclosure, preferred materials and methods are described herein.

[0085] In view of the teachings of the present specification, one of ordinary skill in the art can apply conventional techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics, and recombinant polynucleotides, as taught, for example, by the following standard texts: Abbas et al. (Cellular and Molecular Immunology, 2017, 9th Edition, Elsevier, ISBN 978-0323479783); Butterfield et al. (Cancer Immunotherapy Principles and Practice, 2017, 1st Edition, Demos Medical, ISBN 978- 1620700976); Kenneth Murphy (Janeway’s Immunobiology, 2016, 9th Edition, Garland Science, ISBN 978-0815345053); Stevens et al. (Clinical Immunology and Serology: A Laboratory Perspective, 2016, 4th Edition, Davis Company, ISBN 978-0803644663); E.A.Greenfield (Antibodies: A Laboratory Manual, 2014, Second edition, Cold Spring Harbor Laboratory Press, ISBN 978-1-936113-81-1); R.I. Freshney (Culture of Animal Cells: A Manual of Basic Technique and Specialized Applications, 2016, 7th Edition, Wiley- Blackwell, ISBN 978-1118873656); C.A. Pinkert (Transgenic Animal Technology, Third Edition: A Laboratory Handbook, 2014, Elsevier, ISBN 978-0124104907); H. Hedrich (The Laboratory Mouse, 2012, Second Edition, Academic Press, ISBN 978-0123820082); Behringer et al. (Manipulating the Mouse Embryo: A Laboratory Manual, 2013, Fourth Edition, Cold Spring Harbor Laboratory Press, ISBN 978-1936113019); McPherson et al. (PCR 2: A Practical Approach, 1995, IRL Press, ISBN 978-0199634248); J.M. Walker (Methods in Molecular Biology (Series), Humana Press, ISSN 1064-3745); Rio et al. (RNA: A Laboratory Manual, 2010, Cold Spring Harbor Laboratory Press, ISBN 978-0879698911); Methods in Enzymology (Series), Academic Press; Green et al. (Molecular Cloning: A Laboratory Manual, 2012, Fourth Edition, Cold Spring Harbor Laboratory Press, ISBN 978- 1605500560); and G.T. Hermanson (Bioconjugate Techniques, 2013, Third Edition, Academic Press, ISBN 978-0123822390).

[0086] As used herein, “Coronaviridae”, known by the common name of “Coronavirus” or “CoV” are enveloped, positive sense, single-stranded RNA viruses. The family of Coronaviridae viruses belong to the broader realm of Riboviria viruses. The family Coronaviridae includes, but is not limited to, viruses such as Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV), Middle East Respiratory Syndrome Coronavirus (MERS-CoV), and Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2; the causative agent of COVID-19).

[0087] As used herein, "Mouse Hepatitis Virus" (MHV) refers to enveloped, positive sense RNA mouse coronaviruses (reviewed by Homberger FR, Lab Anim 199731 : 97 - 115). There are many different MHV strains that vary in virulence, organotropism and cell tropism, and are constantly evolving by naturally occurring mutation and recombination. Ubiquitous and highly contagious, MHVs typically infect the respiratory (respiratory tropic) or gastrointestinal tract (entro tropic) and cause a wide variety of diseases such as hepatitis, enteritis and encephalomyelitis. The severity of the disease depends on the strain, age and immune status of the infected mouse.

[0088] As used herein, “infection” refers to entry of virus into a cell, and it includes productive infection, latent infection, and abortive infection. As used herein, latent infection refers to a situation where production of infectious virus is suspended with the viral genes retained in the virus. As used herein, abortive infection refers to a situation where a virus that has entered a cell does not actively retain viral genes while no infectious virus is produced.

[0089] As used herein, the term "cDNA" (complementary DNA) refers to DNA that has been derived from messenger RNA (mRNA). As known in the art, cDNA is typically generated by first reverse transcribing a first strand of cDNA from a template mRNA using a RNA dependent DNA polymerase.

[0090] As used herein, “isolating” refers to a polypeptide, that the indicated molecule is separate and discrete from the whole organism with which the molecule is found in nature or is present in the substantial absence of other biological macromolecules of the same type. The term “isolating” with respect to a polynucleotide is a nucleic acid molecule devoid, in whole or part, of sequences normally associated with it in nature; or a sequence, as it exists innature, but having heterologous sequences in association therewith; or a molecule disassociated from the chromosome.

[0091] As used herein, “hybridize” or “hybridizing” is the process of combining two complementary single-stranded DNA or RNA molecules so as to form a single double- stranded molecule (DNA / DNA, DNA / RNA, RNA / RNA) through hydrogen base pairing.

[0092] As used herein, “complementarity” refers to the ability of a nucleic acid sequence to form hydrogen bonds with another nucleic acid sequence (e.g., through canonical Watson-Crick base pairing). A percent complementarity indicates the percentage of residues in a nucleic acid sequence that can form hydrogen bonds with a second nucleic acid sequence. If two nucleic acid sequences have 100% complementarity, the two sequences are perfectly complementary, i.e., all of the contiguous residues of a first polynucleotide hydrogen bond with the same number of contiguous residues in a second polynucleotide.

[0093] As used herein, "sample" refers to a viral sample obtained from a human or other animal suspected of having a coronavirus or other viral disease. It comprises extracts from throat swab, nasal swab, nasopharyngeal or respiratory tract extract, deep expectorant, bronchial lavage, alveolar lavage, blood, serum, feces, conjunctival swab, urine, spinal fluid and tissue. In addition, a sample including, for example, cells used for infection experiments and the like, and a culture solution thereof, or a virus isolated from a sample or cultured cells obtained from a human or other animal can also be used as the sample. Such samples may be subjected to such pre-treatments as separation, extraction, concentration or purification.

[0094] As used herein, "infectivity" refers to the capacity of a pathogenic organism to enter, survive, and multiply in a host organism, while "infectiousness" refers to therelative / comparative ease with which the disease is transmitted among host organisms. Transmission of pathogen can occur in various ways including, but not limited to, direct physical contact with an infected host or a contaminated object, contact with or ingestion of contaminated food or bodily fluid, airborne inhalation of pathogenic particles, or transmission through vector organisms.

[0095] As used herein, the term "amplifying", when applied to a nucleic acid sequence, refers to a process whereby one or more copies of a particular nucleic acid sequence is generated from a template nucleic acid, preferably by the method of polymerase chain reaction

[0096] As used herein, “polymerase chain reaction” or “PCR” technologies are well known in the art (Dieffenbach C W and G S Dveksler (1995) PCR Primer, a Laboratory Manual, Cold Spring Harbor Press, Plainview N.Y.). PCR describes a method for increasing the concentration of a segment of a target sequence in a mixture of DNA without cloning or purification. This process for amplifying the target sequence consists of introducing a large excess of two oligonucleotide primers to the DNA mixture containing the desired target sequence, followed by a precise sequence of thermal cycling in the presence of a DNA polymerase. The two primers are complementary to their respective strands of the double stranded target sequence. To effect amplification, the mixture is denatured and the primers then annealed to their complementary sequences within the target molecule. Following annealing, the primers are extended with a polymerase so as to form a new pair of complementary strands. The steps of denaturation, primer annealing and polymerase extension can be repeated many times (i.e., denaturation, annealing and extension constitute one “cycle”; there can be numerous “cycles”) to obtain a high concentration of an amplifiedsegment of the desired target sequence. The length of the amplified segment of the desired target sequence is determined by the relative positions of the primers with respect to each other.

[0097] As used herein, “primer” refers to an oligonucleotide, whether occurring naturally as in a purified restriction digest or produced synthetically, which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product which is complementary to a nucleic acid strand is induced, (i.e., in the presence of nucleotides and an inducing agent such as DNA polymerase and at a suitable temperature and pH).

[0098] As used herein, "conjugated" means two entities stably bound to one another by any physiochemical means. Examples

[0099] Non-limiting embodiments of the present disclosure are illustrated in the following Examples. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, concentrations, percent changes, and the like), but some experimental errors and deviations should be accounted for.

[0100] Unless indicated otherwise, temperature is in degrees Centigrade and pressure is at or near atmospheric. It should be understood that these Examples are given by way of illustration only and are not intended to limit the scope of what the inventor regards as various embodiments of the present disclosure. Not all of the following steps set forth in each example are required nor must the order of the steps in each example be as presented.Example 1 Design of DNA oligonucleotide primers to be used in detecting levels of either the antigenome (minus RNA genome) or genome (plus RNA genome) of MHV-A59

[0101] This Example illustrates the design and synthesis of nucleic acid molecules targeting either the negative or positive RNA strands of mouse coronavirus, murine hepatitis virus strain A59 (MHV-A59). To detect the negative strand, MHV- A59 was used as the target virus and mouse fibroblast 17CL-1 cells were used to infect with the virus. A specific primer was designed to target the negative strand, such that the primer could be used to synthesize negative strand-specific cDNA. Similarly, another primer was designed to target the positive RNA strand and synthesize positive RNA strand-based cDNA. The negative cDNA primer sequence, named NegcDNA.F, spanned 30691 to 30713 bp of the complete genome of the murine hepatitis virus (accession #AY910861) with the following sequence:5’ TGAACCCACCAAAGATGTGTATG 3’ (SEQ ID NO: 1). For the positive RNA strand, the primer (PoscDNA.R) sequence spanned the 31251 to 31273 bp of the complete genome of the murine hepatitis virus (accession #AY910861) with the following sequence: 5’ ACCCTGATGTGAGCTCTTCCCAG 3’ (SEQ ID NO: 2). Example 2 Detection of the presence of either the antigenome (minus RNA genome) or genome (plus RNA genome) of MHV-A59 in MHV-A59 infected 17CL-1 cell lines

[0102] MHV has been widely used as a model for the family of enveloped plus RNA viruses from Coronaviridae, and the MHV-A59 strain is the prototype coronavirus (CoV). Strain MHV-A59, which harbors an eGFP fluorescent tag inserted by replacing a pseudogene-ORF4, was used in this example. The virus was obtained from NIAID BEI resources, and a stock was prepared in the laboratory by infecting the mouse fibroblast cell line 17CL-1.

[0103] FIG. 2 contains a flow chart that depicts the methodology used to detect the presence of the negative or positive strand in the MHV-A59 infected 17CL-1 cell lines.

[0104] 500 ng of the total RNA isolated after two hours of infection by 1.0 MOI MHV-A59 in 17CL-1 cells were used to synthesize the strand-specific cDNA. Using the two primers described in the previous example, NegcDNA.F and PoscDNA.R, an approximately 600 bp long PCR product was amplified from the respective cDNA. As a control for the loading, mouse actin primers, named mActin.F with the sequence 5′- GGCTGTATTCCCCTCCATCG-3′ (SEQ ID NO: 3) and mActin.R with the sequence 5′- CCAGTTGGTAACAATGCCATGT-3′ (SEQ ID NO: 4) were used to amplify a 154 bp long PCR product.

[0105] Both PCR products are depicted in FIG. 3, which shows both the negative and positive strand-specific bands from the cDNA synthesized two hours following viral infection. The intensity of the negative strand-specific bands indicates more negative strand synthesis immediately after infection. As such, the present detection system can be used to robustly detect both the negative and positive strands of a coronavirus, and can not only detect the presence of the virus, but can estimate the current stage of the infection and level of infectivity at the time of testing as well. Example 3 Continuous Detection of the antigenome (minus RNA genome) of MHV-A59 in MHV-A59 infected 17CL-1 cell lines during active infection

[0106] Because antigenome production is necessary to sustain the replication of the virus, it was next determined whether the present method is capable of detecting the negative strand continuously over time when active infection was underway. As active infection requires the presence of host cells and the virus cytopathic effect depletes the host cells over time, RNA samples were isolated from different time points of infection, as well as when almost all host cells were depleted from the cytopathic effect of the infecting virus. The RNA was isolated from the 2h point until the end of the total cytopathic effect. FIG. 4 shows some of the stages of the cells from which total RNA was isolated for strand-specific RNA identification.

[0107] FIG. 4 shows that after 3 days of infection with an MOI 1.0 MHV-A59 virus, almost all the host cells were depleted. In all samples throughout the infection, both positive and negative RNA strands were detected. Next, it was determined whether both strands could be detected in RNA samples isolated from host cell-depleted media collected after 72h post infection. As no host cells were available, no active infection demonstrably occurred in those samples. cDNA synthesis from the same RNA sample, albeit with no primer, was also performed as a control for ‘self-priming’ based cDNA synthesis that may occur in the background.

[0108] FIG. 5 shows the RT-PCR-based detection of MHV-A59 in the no-primer, negative, and positive cDNA from the 72h post infection media. Similar to the samples in Example 2, PCR amplification was carried out using the same two primers, NegcDNA.F and PoscDNA.R, which amplify a 600 bp product. Lanes 1, 2, and 3 represent cDNA synthesized 24h post infection while lanes 4, 5, and 6 represent cDNA synthesized 72 h post-infection. Lanes 1 and 4 represent the band detected from the no-primer cDNA, showing thebackground level of the PCR band amplified from the self-primed cDNA. Lanes 2 and 5 represent the bands from the negative RNA-specific cDNA. Note that lanes 4 and 5 show almost identical levels of expression at 72h post infection- indicating that there was no amplification from the minus RNA strand, as the expression represents the background level of expression, similar to the no-primer expression. This establishes that no negative RNA strands can be detected when no host cells are available. In contrast, an intense band was seen from the positive strand-specific cDNA at 72h post infection. As there were no host cells available (FIG. 5) at 72h post infection, this band likely originates from the broken-down genome, remnant / residual virus fragments, or non-replicating virions in the media. Thus, positive RNA can be detected from non-replicating viruses, but to detect the negative strand, a sample from replicating viruses within host cells is needed. As a control, mouse actin primers were used for the same cDNA samples (lower panel). Example 4 qPCR confirmation of RT-PCR results from Example 3

[0109] To confirm the RT-PCR results, a qPCR experiment was performed using the same cDNA (72h post-infection) from Example 3. The results of this experiment are depicted in FIG. 6A. In concordance with the RT-PCR experiment, serial dilution of the cDNA produced the exact same level of Cycle Threshold (Ct) values as that in the no-primer and negative strand specific-cDNA conditions, while the positive RNA-specific cDNA sample showed lower Ct values, indicating higher expression. In this experiment, a higher level of cDNA dilutions (0.01 and 0.1 dilution) was used to obtain robust amplification.

[0110] The three cDNA samples (negative RNA strand specific cDNA sample, positive RNA strand specific cDNA sample and no-primer cDNA sample) were quantified in a nanodrop machine, and the same level of concentrations in each of the cDNA samples is indicated in the nanodrop light absorption chart (FIG. 6B). The melting curve for all samples, as shown in FIG. 6C, clearly shows that all samples amplified the same targeted band without amplifying any non-specific bands.

[0111] Overall, as demonstrated by both RT-PCR and qPCR, when the virus is not replicating actively, the virus-positive strand-specific signals can still be detected, whereas only the background level of the signal (similar to the no-primer cDNA) can be detected from the negative strand-specific RNA.

[0112] The use of the negative mRNA strand as a marker allows for the direct detection of replicating viruses, rather than relying on indirect indicators, such as the presence of viral proteins or antigens. This results in a more sensitive and specific detection method. The use of the negative mRNA strand as a marker allows for real-time monitoring of virus replication, as the negative strand is produced during active viral replication. This can provide valuable information for disease management and control.

[0113] Sequence Information SEQ ID NO: 1 TGAACCCACCAAAGATGTGTATG SEQ ID NO: 2 ACCCTGATGTGAGCTCTTCCCAG

Claims

Claims 1. A composition comprising a first oligonucleotide that binds to or hybridizes with a negative-strand ribonucleic acid (RNA) molecule produced by a virus that is from family Coronaviridae.

2. The composition of claim 1, wherein the first oligonucleotide does not bind to or hybridize with a positive-strand RNA molecule of the virus.

3. The composition of claim 1, wherein the negative-strand RNA molecule comprises a conserved region and the first oligonucleotide binds to or hybridizes with the conserved region of the negative-strand RNA molecule.

4. The composition of claim 1, wherein the first oligonucleotide is a primer comprising a nucleic acid sequence of SEQ ID NO: 1 (TGAACCCACCAAAGATGTGTATG).

5. The composition of claim 1, further comprising a second oligonucleotide that binds to or hybridizes with a positive-strand RNA molecule produced by the virus.

6. The composition of claim 2, further comprising a second oligonucleotide that binds to or hybridizes with a positive-strand RNA molecule produced by the virus and the second oligonucleotide does not binds to or hybridize with the negative-strand RNA molecule of the virus.

7. The composition of claim 4, further comprising a second oligonucleotide that is a primer comprising a nucleic acid sequence of SEQ ID NO: 2 (ACCCTGATGTGAGCTCTTCCCAG).

8. The composition of claim 1, wherein the virus is murine coronavirus MHV.

9. The composition of claim 1, wherein the virus is SARS-CoV, MERS-CoV, or SARS- CoV-2.

10. The composition of claim 1, wherein the virus is SARS-CoV-2.

11. A composition comprising a second oligonucleotide that binds to or hybridizes with a positive-strand RNA molecule produced by a virus that is from family Coronaviridae.

12. The composition of claim 11, wherein the second oligonucleotide does not bind to or hybridize with a negative-strand RNA molecule of the virus.

13. The composition of claim 11, wherein the positive-strand RNA molecule comprises a conserved region and the second oligonucleotide binds to or hybridizes with the conserved region of the positive-strand RNA molecule.

14. The composition of claim 11, wherein the second oligonucleotide is a primer comprising a nucleic acid sequence of SEQ ID NO: 2 (ACCCTGATGTGAGCTCTTCCCAG).

15. The composition of claim 11, wherein the virus is murine coronavirus MHV.

16. The composition of claim 11, wherein the virus is SARS-CoV, MERS-CoV, or SARS- CoV-2.

17. The composition of claim 11, wherein the virus is SARS-CoV-2.

18. A method for detecting a coronavirus in a sample, the method comprising:isolating RNA from a sample; contacting the isolated RNA with a first primer in the presence of a reverse transcriptase and dNTP under a condition permissive for cDNA synthesis, thereby generating cDNA; contacting the cDNA with forward and reverse primers in the presence of a DNA polymerase and dNTP under a condition permissive for cDNA amplification, thereby generating an amplified product, and identifying the amplified product, thereby detecting the presence or absence of the virus.

19. The method of claim 18, wherein the first primer binds to or hybridizes with a negative-strand RNA molecule produced by the virus.

20. The method of claim 19, wherein the first primer does not bind to or hybridize with a positive-strand RNA molecules produced by the virus.

21. The method of claim 19, wherein the negative-strand RNA molecule comprises a conserved region and the first primer binds to or hybridizes with the conserved region of the negative-strand RNA molecule.

22. The method of claim 18, wherein the first primer comprises a nucleic acid sequence of SEQ ID NO: 1 (TGAACCCACCAAAGATGTGTATG).

23. The method of claim 18, wherein the first primer binds to or hybridizes with a positive-strand RNA molecule produced by the virus.

24. The method of claim 23, wherein the first primer does not bind to or hybridizes with a negative-strand RNA molecules produced by the virus.

25. The method of claim 23, wherein the positive-strand RNA molecule comprises a conserved region and the first primer binds to or hybridizes with the conserved region of the positive-strand RNA molecule.

26. The method of claim 18, wherein the first primer comprises a nucleic acid sequence of SEQ ID NO: 2 (ACCCTGATGTGAGCTCTTCCCAG).

27. The method of claim 18, wherein the forward primer comprises a nucleic acid sequence of SEQ ID NO: 1 (TGAACCCACCAAAGATGTGTATG) and the reverse primer comprises a nucleic acid sequence of SEQ ID NO. 2 (ACCCTGATGTGAGCTCTTCCCAG).

28. The method of claim 18, wherein the coronavirus is murine coronavirus MHV.

29. The method of claim 18, wherein the coronavirus is SARS-CoV, MERS-CoV, or SARS-CoV-2.

30. The method of claim 18, wherein the coronavirus is SARS-CoV-2.

31. The method of claim 18, wherein the primer is conjugated to a heterologous molecule.

32. The method of claim 31, wherein the heterologous molecule is a detectable label.

33. The method of claim 18, wherein the method distinguishes a replicating virus infection from a non-replicative virus infection.

34. The method of claim 18, wherein the method detects a stage of coronavirus infection.

35. The method of claim 18, wherein the method detects an infectivity of coronavirus infection.

36. The method of claim 18, wherein the method further comprises a step of identifying a subject who is infected with the virus and but fails to show symptoms of virus infection.

37. A kit comprising i) a first primer comprising a nucleic acid sequence of SEQ ID NO: 1 (TGAACCCACCAAAGATGTGTATG), ii) a second primer comprising a nucleic acid sequence of SEQ ID NO. 2 (ACCCTGATGTGAGCTCTTCCCAG) and iii) instructions for using for using the first and second primers for detecting the coronavirus.

Citation Information

Patent Citations

  • Compositions and methods for treating and detecting coronavirus infection

    US20230183703A1