Integrin antibody design platform
A method to detect entropy redistribution in protein complexes and design antibodies with specific CDR sequences addresses the challenge of toxic global TGF-β inhibition by stabilizing entropy distributions, enabling targeted modulation of TGF-β isoforms for enhanced cancer treatment.
Patent Information
- Application Number
- PCT/US2025/012550
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-07-23
- Filing Date
- 2025-01-22
- Publication Date
- 2025-07-31
AI Technical Summary
Current methods for inhibiting the TGF-β pathway in cancers face challenges due to significant toxicity and lack of specificity, as they target all isoforms without distinguishing between TGF-β1, -β2, and -β3, which are expressed in a latent form and require activation for signaling.
Development of a method to detect entropy redistribution in protein complexes, specifically through binding and measuring entropy distributions in proteins to produce energetically stabilized modified proteins, and design of antibodies with specific CDR sequences (SEQ ID NOs: 33-38) to target TGF-β isoforms, thereby modulating their activity.
The method allows for targeted modulation of TGF-β isoforms, reducing toxicity and enhancing cancer treatment efficacy by stabilizing entropy distributions, thus inhibiting TGF-β signaling in a controlled manner.
Smart Images

Figure US2025012550_31072025_PF_FP_ABST
Abstract
Description
INTEGRIN ANTIBODY DESIGN PLATFORMCROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This International Application claims the benefit of priority under 35 U.S.C. § 119(e) of U.S. Provisional Application Nos. 63 / 623,794, filed on January 22, 2024, and 63 / 674,756, filed on July 23, 2024, each of which is hereby incorporated by reference in its entirety and for all purposes.REFERENCE TO A SEQUENCE LISTING
[0002] The material in the accompanying Sequence Listing is hereby incorporated by reference in its entirety. The accompanying file, named “048536-775001WO_SL_ST26.xml” was created on January 21, 2025 and is 184,217 bytes.BACKGROUND
[0003] Transforming growth factor-P (TGF-P) is a potent immunosuppressive cytokine and its overactivity in the tumor microenvironment is a major mechanism of tumor immune evasion and resistance to immunotherapy. Inhibiting the TGF-P pathway in cancers has been the focus of intense interest for immune-oncology. TGF-P in mammals has three isoforms, TGF-pi, -P2, and -P3, which are ubiquitously expressed in a latent form (L-TGF-P). Latency is conferred by the non-covalent association of a specific prodomain, the latency associated peptide (LAP), with a mature TGF-p. Activation is the key initial step that allows TGF-P to acquire the ability to bind transforming growth factor receptors- 1 and -2 (i.e. TGF- R1 and 2) and initiate TGF-P signaling. The structural details of the TGF-P1 activation mechanism are not well understood, with relatively little known of the activation mechanisms of TGF-P2 and TGF-P3.Understanding the structural basis of TGF-P activation will help develop more specific targeting strategies for each isoform, which is needed since global inhibition of the TGF-P pathway has shown significant toxicity. Provided herein, inter alia, are compositions and methods of use thereof to address these and other problems in the art.BRIEF SUMMARY
[0004] In an aspect is provided a method of detecting entropy redistribution in a protein complex, the method including: (i) binding a first protein to a second protein thereby forming a protein complex; (ii) measuring a first entropy distribution in the first protein bound to thesecond protein; (iii) measuring a second entropy distribution in the second protein bound to the first protein; and (iv) producing a modified protein including the first entropy distribution of the first protein in an energetically stabilized state.
[0005] In another aspect is provided a method of detecting entropy redistribution in a protein complex, the method including: (i) binding a first protein to a second protein thereby forming a protein complex; (ii) measuring a first entropy distribution in the first protein bound to the second protein; (iii) measuring a second entropy distribution in the second protein bound to the first protein; and (iv) producing a modified protein including the second entropy distribution of the second protein in an energetically stabilized state.
[0006] In another aspect is provided a method of detecting entropy redistribution in a protein complex, the method including: (i) measuring a first entropy distribution in a first protein that is unbound; (ii) measuring a second entropy distribution in a protein complex including the first protein bound to a second protein; and (iii) producing a modified protein including the second entropy distribution of the protein complex in an energetically stabilized state.
[0007] In another aspect is provided a method of detecting entropy redistribution in a protein complex, the method including: (i) measuring a first entropy distribution in a first protein that is unbound; (ii) binding the first protein to a second protein thereby forming a protein complex;(iii) measuring a second entropy distribution in the first protein bound to the second protein; and(iv) producing a modified protein including the second entropy distribution of the first protein in an energetically stabilized state.
[0008] In another aspect is provided a method of detecting entropy redistribution in a protein complex, the method including: (i) measuring a first entropy distribution in a first protein that is unbound; (ii) binding the first protein to a second protein thereby forming a protein complex;(iii) measuring a second entropy distribution in the second protein bound to the first protein; and(iv) producing a modified protein including the second entropy distribution of the second protein in an energetically stabilized state.
[0009] In another aspect is provided a method of detecting entropy redistribution in a protein, the method including: (i) measuring a first entropy distribution in a protein that is unbound; (ii) measuring a second entropy distribution in a protein complex including the protein bound to a ligand; and (iii) producing a modified protein including the first entropy distribution of the protein in an energetically stabilized state.
[0010] In another aspect is provided a method of identifying an entropy-redistributing antibody, the method including: (i) contacting a protein complex including a first protein bound to a second protein with an antibody; (ii) detecting in the complex a first entropy of the first protein and a second entropy of the second protein; and (iii) identifying the antibody as an entropy-redistributing antibody, wherein if the first entropy or the second entropy is different relative to the entropy of the first protein or the second protein prior to the contacting of the antibody.
[0011] In another aspect is provided an antibody including a light chain variable domain and a heavy chain variable domain, wherein the light chain variable domain includes: a CDR LI as set forth in SEQ ID NO:33, a CDR L2 as set forth in SEQ ID NO:34 and a CDR L3 as set forth in SEQ ID NO: 35; and wherein the heavy chain variable domain includes: a CDR Hl as set forth in SEQ ID NO:36, a CDR H2 as set forth in SEQ ID NO:37, and a CDR H3 as set forth in SEQ ID NO:38.
[0012] In another aspect is provided an isolated nucleic acid encoding an antibody provided herein including embodiments thereof.
[0013] In another aspect is provided a pharmaceutical composition including a therapeutically effective amount of an antibody provided herein including embodiments thereof and a pharmaceutically acceptable excipient.
[0014] In another aspect is provided a method of treating cancer in a subject in need thereof, the method including administering to a subject a therapeutically effective amount of an antibody provided herein including embodiments thereof, thereby treating cancer in the subject.BRIEF DESCRIPTION OF THE DRAWINGS
[0015] FIGS. 1A-1N show autocrine TGF-p I signaling without release prevents lethal tissue inflammation caused by global TGF-P 1 deficiency. FIG. 1A: Chromatograms of cDNA made from RNA isolated from tail clippings of wildtype (WT / WT), WT / KI and knock in K I / K I mice with a mutation (R278A) in the furin cleavage site of exon 5 of the tgfbl gene on chromosome 7 (M13177.1c. H84-5AG>GC(p.Arg278Ala) The numbering of the mutation is based on the mouse tgfbl mRNA sequence (GenBank: M13177.1). FIG. IB: A schematic on one TGF-fM protein monomer and the position of LAP, the furin cleavage site, the mutated R278A sequence and the WT sequences, and the mature TGF-pi peptide are shown. FIG. 1C: The body weightsof tgfbl - / - (KO / KO) mice are shown at post-natal day 18 compared to littermate WT / KO controls. Shown is the mean and standard error (SE). *p<0.05 Student’s t-test. FIG. ID: tgfbl R278A KI / KI. WT / KI and WT / WT mice survive to adulthood compared to tgfbl KO / KO mice which die by 24 days of multiorgan inflammation. **** p<0.0001 of all groups compared to KO / KO by Mantel-Cox. FIG. IE: The body weights over time of the KI / KI, WT / KI and WT / WT mice are shown. FIG. IF : The body weights over time of the KI / KI mice bom to KI / KI or WT / KI dams are shown. FIG. 1G: A histologic analysis of organs (e.g., heart, lung, liver) from WT / WT, WT / KI, and KI / KI mice was performed using hematoxylin and eosin staining. Scatter plots of disease scores from mice with filled circles, open circles, open squares, or filled triangles representing respectively, KO / KO (n=6), WT / WT (n=6), WT / KI (n=5), KI / KI (n=6) mice. Shown is SE. ANOVA followed by Tukey’s multiple comparison test, ****<0.0001. FIG. 1H: Immunoblot using an antibody against mature TGF-p 1 of equal volumes of plasma, or organ lysates (kidney, liver, lung, or spleen), under reducing conditions, from tgfbl WT / WT, KO / KO or KI / KI (R278A). + or - below indicate respective genotypes. The positions of the molecular weight markers (MWM) are shown on the left. The expected positions of the ~50 kDa and 12.5 kDa uncleaved and cleaved TGF-p I bands are shown on the right. Below is an immunoblot of each organ lysate using anti-actin as a protein loading control. FIG. II: CD4+ T-cells from WT / WT or KI / KI mice were cultured on BSA or immobilized a\-'P8 ectodomain, as indicated below the image. Mature TGF-pi was detected by immunoblotting as in FIG. IM. The upper panel represents a shorter exposure, while the middle panel represents the membrane cut and exposed longer to show mature TGF-P 1 in the WT CD4+ T-cells. The lower panel, represents the same membrane stripped and reprobed with anti-actin. Shown is a representative experiment (n=3) FIG. 1 J: To demonstrate that the non-cleaved TGF- iwas present on the surface of CD4+ T-cells, WT CD4+ T-cells were lysed before or after surface biotinylation. Lysate from non-biotinylated control cells were compared to the eluates from equal amounts of biotinylated and non-biotinylated lysates applied to streptavidin agarose (SA), as indicated and detected with anti-mature TGF- 1. Expected positions of cleaved and non-cleaved bands are indicated, as is a non-specific band that may represent degradation. A band the same size of cleaved mature TGF- P1 is seen in the eluate from the SA beads incubated with non-biotinylated lysate, making the direct comparison of cleaved to uncleaved forms of TGF-P 1 difficult. Below is the same membrane stripped and reprobed with anti-Na+ / K+ ATPase, as a cell membrane marker. MWM are shown on the left. Shown are representative experiments with similar results (n=3). FIG. IK:The same lysates from activated CD4+T-cells from N, demonstrate (upper panel) increased avp8-mediated TGF-[3 signaling detected by anti- phospho-SMAD2 / 3 (pSMAD2 / 3). Note that pSMAD2 migrates slightly slower than pSMAD3 ; (middle panel) total SMAD2 / 3 ; (lower) actin. Shown is a representative experiment (n=3). FIG. IL: Fluorescence-activated cell sorting (FACS) experiments were performed on CD4+ T-cells in activating conditions from KI / KI compared to controls, WT / WT (or WT / KI) mice plated on BSA (± recombinant TGF-p I as a positive control) or immobilized avp8 ectodomain. CD4+ T-cells were stained with anti-FoxP3 and anti-CD25 and representative quadrant scatterplots were generated. Scatter bar graphs (FIG. IL) show Treg as a percentage of activated CD4+ T-cells. Shown is SE. Ns = not significant. FIGS. 1M-1N: FACS experiments were performed with peripheral blood mononuclear cells (PBMC) from KI / KI, and age and littermate matched controls (WT / WT or WT / KI) using the same staining used in FIG. IL. Treg were enumerated from adult mouse PBMC (n=9 WT / WT and WT / KI; n=8 KI / KI) or spleen at post-natal day -18-21; n=6 WT / WT and WT / KI; n=3 KI / KI) (FIG. IM), to compare with Treg percentages from KO / KO mice (FIG. 9A) or spleen (FIG. IN). Shown in FIGS. IM and IN is SE. ns = not significant. *p<0.05. See also FIG. 9.
[0016] FIGS. 2A-2H show structures and conformational flexibility of L-TGF-P 1 / GARP alone and bound with av[38. FIG. 2A: Atomic model of L-TGF-P1 dimer with major domain nomenclatures in protomer A colored and marked. FIG. 2B: Schematic diagram of L-TGF- P 1 / GARP constructs with all domains annotated. Sequence number starts after the signal peptide. Two protomers are labeled as L-TGF-P1Aand L-TGF-P1B, in which integrin binding RGD motif in protomer A and its mutation RGE in protomer B are also labeled. Labeled cysteine residues are resolved in the cryo-EM structures. TGF-PR2 binding sites are labeled as black half-bars. The GARP construct is truncated at the transmembrane domain (grey). FIG. 2C: Cryo-EM density map reconstructed from sample of avP8 / L-TGF-P 1 / GARP complex is displayed with two density thresholds, low threshold in transparent grey and high threshold in solid color. This map is reconstructed from a mixture of particles including L-TGF-pi / GARP, o.vp8 and its complex, except particles of one L-TGF-P 1 / GARP bound with two avP8. FIGS. 2D-2E: Cryo- EM density maps of L-TGF-pi / GARP (FIG. 2D) and avp8 (FIG. 2E) determined from particles classified from the complex sample. FIG. 2F: Cryo-EM density maps of 13 sub-classes of trimeric complex. Classes are arranged in the order from best to the least resolved L-TGF- Pl / GARP. Class 1 and 13 have the highest resolution in avP8. Maps of class 3 - 12 aredisplayed at the same threshold. Maps of class 1 - 13 are displayed with two density thresholds, low threshold in transparent grey and high threshold in solid color. In FIGS. 2D-2F, the color scheme of L-TGF-P1 follows the schematic diagram in FIG. 2A. The percentage number below each density map represents the fraction of particles classified from the dataset used to reconstruct the density map in FIG. 2C. The bars are colored following the convention in FIG. 2A, with the exception that unresolved regions are shown in white. FIG. 2G: Five selected subclasses from FIG. 2F to Illustrate the motion of L-TGF-p I relative to avP8. The ribbon diagram of avP8 and L-TGF-pi docked within the maps, which are arbitrarily colored. FIG. 2H: Cross comparison between sub-classes shown in FIG. 2G illustrate the increased flexibility (class 3 vs. 7), the degree and the direction of motion (class 3 vs. 5, and 4 vs. 6). All structures are aligned to each other using the b-propeller domain in av subunit. Together, they show that L- TGF-p / GARP rocks on top of avP8. See also FIG. 10.
[0017] FIGS. 3A-3O show spatial entropy redistribution upon L-TGF-p l / GARP binding to avp8. FIG. 3A: Cryo-EM density map of L-TGF-P l / GARP (left) determined directly from the sample before mixing with av[38, and of avp8 / L-TGF-Pl / GARP (right, Class 1 from FIG. 2F), both with atomic model refined to the corresponding density. FIGS. 3B-3C: Ribbon diagram of L-TGF-pl / GARP (FIG. 3B), and avp8 / L-TGF-P l / GARP (FIG. 3C). Residues are colored by normalized B-factors with the range indicated by the scale bar. Residues with lower B-factor are relatively stable, while those with higher B-factor (red) are more flexible. Two enlarged views within dashed boxes show that the lasso loop (upper panel) and RGD containing arm domain (lower panel) are flexible. Dashed loop in lower panel of FIG. 3B indicates the unresolved RGD loop. FIG. 3D: Ribbon diagram of L-TGF-P 1 colored with the changes of normalized B-factor from before to after binding to avP8. Note that the arm domain that binds to integrin becomes more stable (lower dashed box with enlarged view), while the straitjacket (containing the lasso, upper dashed box with enlarged view) and GARP becomes more flexible. FIG. 3E: A mechanism model illustrates how local conformational entropy is redistributed from the arm domain towards distal domains, including the straitjacket domain, upon formation of avP8 / L- TGF-P l / GARP complex. Different regions where local conformational entropy changes upon complex formation are circled with colored dashed lines. AS<0 indicates a reduction of local entropy due to conformational stabilization, ASX) indicates an increase of local entropy due to enhanced flexibility, while AS-0 indicate no obvious change in local entropy because there is nomajor change in local resolution of 3D reconstruction. Blurring of the ribbon diagram indicates the domain flexibility observed in the structure. FIG. 3F : Predicted spatial entropy redistribution upon L-TGF-P1 / GARP / MHG8 binding to avP8. Labeling nomenclature is the same as in FIG. 3E. Inhibitory Fab MHG8 binds and stabilizes the interface between mature TGF-p I and GARP21. Such stabilization directs the conformational entropy from the arm domain towards integrin avp8. FIGS. 3G-3H: Two different views of the cryo-EM density map of avP8 / L-TGF- ©1 / GARP / MHG8 complex (FIG. 3G) and with the docked atomic model (FIG. 3H). While the L-TGF-P1 / GARP / MHG8 is almost entirely resolved, only a very small part of the integrin head domain is resolved. FIG. 31: Predicted spatial entropy redistribution upon L-TGF-P1 / GARP binding to avP8fl reconstituted into lipid nanodisc. FIG. 3J: Comparison of the local resolutions between reconstructions of avP8tr and avP8fl in nanodisc (avP8fl-nd) in complex with L-TGF- Pl / GARP. Local resolutions are color coded by the same scale. Both densities are displayed with two density thresholds, low threshold in transparent grey and high threshold in solid color. FIG. 3K: Ribbon diagram of avP8fl-nd / L-TGF-Pl / GARP. Residues are colored by normalized B- factors with the range indicated by the scale bar. Residues with lower B-factor are relatively stable, while those with higher B-factor are more flexible. Two enlarged views within dashed boxes show that the lasso loop (upper panel) and RGD containing arm domain (lower panel) are flexible. FIG. 3L: Ribbon diagram of avP8 / L-TGF-Pl / GARP colored with the changes of normalized B-factor between avP8fl-nd and avP8tr in complex with L-TGF-P1 / GARP, decreased and increased. FIG. 3M: Predicted spatial entropy redistribution upon binding of soluble ectodomain, nanodisc reconstituted full length and immobilized ectodomain of integrin avP8 to cell membrane bound L-TGF-P1 / GARP. Labeling nomenclature is the same as in FIG. 3E. Anchoring in cell membrane presumably increases stability of L-TGF-pi / GARP complex (panel 1). Upon binding to the ectodomain of avP8, conformational entropy is redistributed largely from the L-TGF-P1 arm domain towards integrin av'PS (panel 2). Stabilization of avβ38 integrin via clasped and nanodisc reconstitution of full-length integrin redistributes conformational entropy largely towards straitjacket domain for TGF-P activation (panel 3 and 4). Immobilizing the integrin ectodomain drives the entropy redistribution almost entirely towards the straitjacket domain, inducing sufficient flexibility for efficient TGF-P activation (panel 5 and 6). FIG. 3N: Schematics showing the design of TMLC reporter cell assays of TGF-P activation without avP8 (panel 1), assays of TGF-P activation by theectodomain of avP8 without constraint (panel 2), C-terminally clasped av[38 ectodomain (panel 3), av[38fl-nd (panel 4), immobilized ecto-domain of cxvp8 (panel 5), and the clasped avP8 ectodomain globally stabilized by immobilization (panel 6). FIG. 30: Activation of TGF-p by soluble and immobilized avP8tr (C-terminally clasped and unclasped), av^Sfl-nd and immobilized cxvp8tr using the assay configuration and numbering as in FIG. 3N. See also FIG. 11.
[0018] FIGS. 4A-4J show intrinsic flexibility of L-TGF-P3 / GARP leads to high basal activation ol' TGF-p3. FIG. 4A: Schematic diagram of L-TGF-p3 / GARP constructs, with all domains annotated and colored as in FIG. 2A. FIG. 4B: Left: cryo-EM density map of L-TGF- P3 / GARP with the domain colored as in FIG. 4A. The bars are colored following the convention in FIG. 4A, with the exception that unresolved regions are shown in white. Right: The same density map (transparent) with the ribbon diagram of L-TGF-p3 / GARP displayed within the map. FIG. 4C: Comparison of cryo-EM density maps of L-TGF-P1 / GARP (transparent grey) and L-TGF-P3 / GARP map (colored solid surface) shows that arm domain of L-TGF-P3 / GARP is more flexible than that of L-TGF-(31 / GARP. FIG. 4D: Ribbon diagram of L-TGF-P3 with residues colored by the normalized B-factors with scale bar. Residues with lower B-factor are relatively stable, while those with higher B-factor (red) are more flexible. Two enlarged views within dashed boxes show that the lasso loop (upper panel) and RGD containing arm domain (lower panel) are flexible. FIG. 4E: A consensus model of L-TGF-pi / GARP and L-TGF- 03 / GARP with each Ca represented by a ball and colored with the difference of normalized B- factors between L-TGF-PI / GARP and L-TGF-P3 / GARP. Note that B-factors of the entire L- TGF-p3, particularly in the straitjacket (upper dashed box) and arm domain (lower dashed box), are much higher (~50 A2) than that of L-TGF-p 1 / GARP, indicating that L-TGF-p3 is more flexible than L-TGF-P 1 when presented by GARP. FIG. 4F: The mass photometry histogram presents the data as a histogram and the peaks have been fit by Gaussian curves. The peaks correspond to L-TGF-P3 / GARP or ocvP8 alone at ~190kd, L-TGF-P3 / GARP with one avP8 integrin at ~390kd, and L-TGF-P3 / GARP with two ocvP8 integrins at ~590kd. FIG. 4G: Cryo- EM density map of L-TGF-P3 / GARP bound with one avP8. The map is displayed at two thresholds, with the solid colored one at a higher threshold and transparent one at a low threshold. The disappearance of major part of L-TGF-P3 / GARP indicates its extensive flexibility upon binding to avP8. FIG. 4H: Cryo-EM density map reconstructed from all particles of L-TGF- 3 bound with one cxvpS. The map is displayed at two thresholds, with the solid colored one at a higher threshold and transparent one at a low threshold. FIG. 41: Upper row: the 3D classification of all particles in FIG. 4H show flexibility of L-TGF-(33 bound with av[38. Bottom row: fitted atomic models of ocv[38 and L-TGF-(33 into the corresponding density maps shown in the upper row. FIG. 4J : Cartoon illustration of a mechanistic model of intrinsic (left) versus - cxvp8-induced flexibility of L-TGF-p3 / GARP (right). See also FIG. 12.
[0019] FIGS. 5A-5G show avP8 binding to L-TGF-P3 is sufficient to release mature TGF-P3. FIG. 5A: Cartoon of TGF-P activation assay, with TMLC cells transfected and sorted to express equivalent levels of L-TGF-p l / GARP or L-TGF-p3 / GARP on the cell surface, cultured on either BSA or av[38 coated wells. FIG. 5B: TMLC cells expressing either L-TGF-P l / GARP (squares) or L-TGF-p3 / GARP (inverted triangles) were cultured on the indicated substrates and after overnight culture luciferase activity detected and reported as luminescence in relative light units (RLU). TMLC expressing L-TGF-P3 / GARP had significantly increased luciferase activity even when coated on BSA coated wells indicating high basal activity of TGF-p. This high basal activity in L-TGF-f53 / GARP TMLC prevented accurate normalization to active TGF-P and so results are reported as luminescence. **p<0.01 by one-way ANOVA followed by Tukey’s posttest. FIG. 5C: Cartoon of TGF-P activation assay where supernatants from wells of the indicated cells in FIG. 5A (L-TGF-pi / GARP (squares) or L-TGF-P3 / GARP (inverted triangles)) were applied to wild-type (WT) TMLC cells to detect amount of released TGF-P determined by normalizing to a standard TGF-P activation curve. FIG. 5D: Following overnight culture in the format shown in FIG. 5C luciferase activity was detected. After normalization, the results are shown as active TGF-P (ng / ml). ***p<0.001 by one-way ANOVA followed by Tukey’s posttest. FIG. 5E: Upper panel: Ribbon models and filtered densities for L-TGF-P1 and L-TGF-P3 lasso-loops. Proline residues of the lasso loops, which are used as landmarks, are indicated.Middle panel: Sequence position and conservations across species (larger fonts indicating higher conservation) are indicated below the ribbon models. Lower panel: Overlay of L-TGF-P1 and L- TGF-P3 ribbon models are shown in two different views, illustrating that lasso3 does not cover the TGF-PR2 binding site in the mature TGF-P as effectively as lassol. FIG. 5F: Sequence alignment showing lasso region of L-TGF-P1, -P3, and chimeric L-TGF-P1 with swapped lasso of L-TGF-P3. FIG. 5G: The lasso3 domain destabilizes L-TGF-pi / GARP. Upper panel: Cartoon showing configuration of assay. Lower panel: TMLC stably expressing GARP were transfectedwith constructs encoding L-TGF-p I (square), L-TGF-P3 (inverted triangles), or L-TGF-P1 with swapped lasso3 (TGF-p I _lasso3 chimera, inverted triangles) and sorted for equivalent expression. WT TMLC (circles) or L-TGF-p / GARP expressing cell lines were cultured overnight and luciferase activity reported as luminescence (RLU). *p<0.05, ****p<0.0001 by one-way ANOVA followed by Sidak’s multiple comparison test for the indicated comparisons.
[0020] FIGS. 6A-6D show intrinsic and integrin-induced entropy of L-TGF-p determines signaling directionality. Applicant designed two TGF-P reporter systems, in which TMLC cells and MFB-F11 cells, are co-cultured. These reporter cells stably expressed reporter constructs with SMAD-binding elements (SBE) driving indicated reporter proteins, luciferase (TMLC cells) or secreted alkaline phosphatase (SEAP; MFB-F11 cells). FIG. 6A: MFB-F11 reporter cells derived from tgfbl - / - mouse embryonic fibroblasts57are stably transduced with an integrin p8 (ITGB8') expression construct. After selection, cells are sorted for high av[38 expression, using an anti-P8 antibody. The histogram demonstrates that expression of cxvp8 is only seen in the ITGB8 transfected (gray curve), but not the non-transfected (NT) cells (black curve). FIG. 6B: Mixing of ocv[38 expressing MFB-F1 1 cells with L-TGF-PI / GARP presenting TMLC cells is required and sufficient to activate the TGF-P signaling pathway on L-TGF-pi / GARP expressing cells but not in avP8 expressing cells. Filled squares refer to L-TGF-P1(RGD) / GARP TMLC, open triangles refer to L-TGF-P1(RGE) / GARP TMLC (as characterized in FIG. 10B).Luciferase represents the signal generated from L-TGF-P1(RGD) / GARP TMLC. SEAP represents signals from avP8 expressing MFB-F11 cells. The results (vertical axis) are normalized against a standard TGF-P activation curve. **p<0.01, ***p<0.001 by one-way ANOVA followed by Sidak’s multiple comparison test for the indicated comparisons. FIG. 6C: Transfection of a TMLC cell line that stably expresses GARP and co-transfected with either wild-type L-TGF-P1 or L-TGF-P3 plasmids, both containing IRES GFP. After multiple rounds of sorting, equivalent levels of surface expression of L-TGF-pi and L-TGF-P3 are achieved as determined by surface staining with anti-GARP and GFP fluorescence. Co-culture of wild type MFB-F11 (-), or avP8 transfected (+) MFB-F11 cells (indicated below graph) with wild type TMLC (black circles), or TMLC expressing L-TGF-pi / GARP (filled squares) or L-TGF- P3 / GARP (triangles) reveal that TMLC L-TGF-P3 / GARP cells have significant basal levels of active TGF-P3 even when cultured with wild type MFB-F11 cells, which is further increased by co-culture with MFB-F11 avP8 expressing cells. Furthermore, these data revealed that L-TGF-Pl / GARP only signal TMLC cells (autocrine), but L-TGF-P3 / GARP signals both cells (autocrine and paracrine). The left graph shows luciferase signal and the right graph shows SEAP signal. The graph on the left shows a sample pairing for L-TGF-p3 / GARP with and without L-TGF-P3 / GARP. The graph on right shows that significantly increased SEAP is only seen when TMLC L-TGF-P3 / GARP cells are cocultured with MFB-F11 avP8 expressing cells. The results (vertical axis) are not normalized against standard TGF-P activation curves since the high basal level of TGF-P3 activation prevents accurate normalization, rather results are shown as arbitrary light units (AU).**p<0.01, ***p<0.001 by one-way ANOVA followed by Sidak’s multiple comparison test for the indicated comparisons with the exception that for L-TGF- P3 / GARP cells on wild type MFB-F11 or MFB-F11 avP8 expressing cells, the results are shown as a paired t-test. FIG. 6D: TGF-PR2 binds well to avP8 bound L-TGF-P3 / GARP compared to L-TGF-pi / GARP. Upper panel: cartoon of assay showing sequentially immobilization of the avP8 ectodomain, binding of the L-TGF-P1 or -P3 / GARP complexes, TGF-PR2-Fc (mouse-Fc), anti-mouse-HRP. Lower panel: a representative experiment of three is shown with varying concentrations of TGF-PR2-Fc, with signal reported as OD450-
[0021] FIGS. 7A-7B show dynamic entropy-based allosteric model of TGF-P activation. FIG. 7A: Cartoon representation of intrinsic and integrin-induced TGF-P 1 activation. 1) L-TGF- Pl / GARP presented on a cell has a relatively low level of basal entropy in the straitjacket / lasso allowing low levels of mature TGF-P 1 exposure to TGF- PRs, insufficient to trigger significant signaling. 2) Binding to avP8 stabilizes the arm domain but redistributes sufficient entropy to allow exposure of mature TGF-pi to TGF-bRs to trigger signaling. FIG. 7B: Cartoon representation of intrinsic and integrin-induced TGF-P3 activation. 3) TGF-P3 / GARP presented by an immune cell has a relatively high level of basal entropy in the straitjacket / lasso sufficient to allow mature TGF-pi to be exposed to TGF-PRs to allow a basal level of constitutive signaling while still being associated with the latent complex. 4) Binding to avP8 stabilizes the arm domain and redistributes entropy to allow further exposure of mature TGF-P3 to TGF-PRs, as well as sufficient entropy redistribution to release mature TGF-P3 where it can bidirectionally signal to L-TGF-P3 presenting cells, as well as avP8 expressing cells.
[0022] FIG. 8 shows domain organization of L-TGF-P1 and -P3. Sequence alignment with secondary structure prediction of L-TGF-pi and L-TGF-P3. Domains are colored as in (FIG.2A) and secondary structure prediction marked. Sequence numbering does not include signal peptide and is consistent in all figures and text.
[0023] FIG. 9 shows immune characterization of tgfbl -I- mice, related to FIG. 1. FACS experiments were performed on Treg from PMBC isolated from post-natal day 18 tgfbl - / - (KO / KO) mice compared with day 18 littermate controls (WT / KO). The staining was the same as performed in FIG. 1. The scatter bar graph shows Treg as a percentage of CD4+ T-cells (n=3 KO / KO; n=3 WT / KO). Shown is SE. *** p<0.001.
[0024] FIGS. 10A-10H show single particle cryo-EM and image processing of L-TGF- Pl / GARP and cxvPS / L-TGF-P 1 / GARP complex, related to FIG. 2. FIG. 10A: Mass photometry analysis of L-TGF-P 1 / GARP mixed with ectodomain of avfiS. Three peaks correspond to L- TGF-P1 / GARP or av[38 alone at ~180kD, one L-TGF-P1 / GARP bound with one av[38 at ~380kD, and one L-TGF-p 1 / GARP bound with two cxvp8 integrins at ~560kD. FIG. 10B: Coculture of MFB-F11 av[38 expressing cells with TMLC L-TGF-P 1 / GARP presenting cells is sufficient to activate the TGF-P signaling pathway by TMLC. To test whether one RGD site is sufficient for ocvP8-mediated TGF-P activation, TMLC-L- TGF-pi / GARP cells were made using a 1: 1 transfection ratio of TGF- pi(RGD) and TGF- pl(RGE) (pink squares). TMLC: L- TGF- P1(RGE / RGE) / GARP cells are also included to demonstrate the requirement of RGD for avP8 / L-TGF- pi binding and activation. The results (vertical axis) are normalized against a standard TGF-P activation curve. **p<0.01 by one-way ANOVA followed by Sidak’s multiple comparison test for the indicated comparisons. FIG. 10C: Applicant perfomed cryo-electron microscopic imaging of frozen hydrated sample of mixing avP8 with L-TGF-pi / GARP in 1 :1 molar ratio. 2D class averages were calculated from particles selected for further processing. Motions captured in avP8 / L-TGF-P 1 / GARP complex along five eigenvectors from 3DVA are illustrated (FIG. 10C). FIG. 10D: 3DVA of particles in Class 1 in FIG. 2F. Images were processed from electron micrograph to the final reconstruction and FSC for final resolution estimation of L-TGF-P 1 / GARP.
[0025] FIGS. 11A-11B show purification of otvpSfTnd and binding affinity of L-TGF- p 1 / GARP to avp8 constructs. FIG. 11F: SDS-PAGE of avp8fl-nd. FIG. 11H: The binding affinity assay of L-TGF-P 1 / GARP with avP8tr, avP8tr-clasped and ocvpSfl-nd showing no difference.
[0026] FIGS. 12A-12B show single particle cryo-EM and image processing of L-TGF- P3 / GARP, avf38 / L-TGF-P3 / GARP complex and comparison of binding interface between GARP and L-TGF-P, related to FIG. 4. Applicant performed cryo-electron microscopic imaging of frozen hydrated sample of mixing av[38 with L-TGF-Pe / GARP. 2D class averages were calculated from particles selected for further processing. Images were processed from electron micrograph to the final reconstruction and FSC for final resolution estimation of L-TGF- P3 / GARP. FIG. 12A: Three regions of cryo-EM density map and docked atomic model selected from the interface between L-TGF-P 1 and GARP . FIG. 12B: Three regions of cryo-EM density map and docked atomic model selected from the interface between L-TGF-P3 and GARP. As an example of how the methodology can be extended to other molecular complexes, overlaying of the atomic models of L-TGF-P 1 / GARP and L-TGF-P3 / GARP, demonstrated that interaction between GARP and L-TGF-P1 or L-TGF-P3 are very similar in the same selected regions.
[0027] FIGS. 13A-13F show raw immunoblots, related to FIG. 1. FIG. 13A: Raw immunoblot of plasma data depicted in FIG. IM. Plasma was subject to 3 sequential rounds of IgG pre-clearance using Sepharose G beads. Lanes 9 (WT / WT), 10 (KO / KO) and l l(KIZKI) are depicted in FIG. IM. Samples in Lanes 1,2 and 3, and 5,6 and 7 represent the samples after 1 or 2 rounds of pre-clearing respectively. FIG. 13B: Raw immunoblot of TGF-pi expression in murine organ homogenates (FIG. IM). Lanes 1,2 and 3 show TGF-P1 staining from WT / WT, KO / KO and KI / KI mice respectively in kidney, Lanes 4, 5 and 6 in liver, Lanes 7, 8 and 9 in lung, and 10, 11 and 12 in spleen. FIG. 13C: Raw immunoblot representing the P-actin expression depicted in FIG. IM as a loading control. FIG. 13D: Raw immunoblot data for FIG. IN demonstrating the expression of uncleaved TGF-pl (upper blot) after 0.9 seconds exposure, and cleaved TGF-pi (lower blot) after 14.9 seconds exposure. Included below the TGF-pi blots is a raw immunoblot stained with anti-P-actin to ensure equal protein loading. FIG. 13E: Raw immunoblot of anti-pSMAD2 / 3 (upper blot) and anti-SMAD2 / 3 (lower blot) presented in FIG. IP. Included below the SMAD2 / 3 blot is an immunoblot using anti-P-actin to ensure equal protein loading. FIG. 13F: Raw immunoblots for data depicted in FIG. 10. The upper blot displays anti-TGF-Pl staining. Lane 1 (non-biotinylated lysate), Lane 2 (non-biotinylated lysate after Sepharose pre-clearance), Lane 3 (eluate from pre-cleared lysate incubated with streptavidin beads), Lane 4 (blank), Lane 5 (biotinylated lysate) Lane 6 (biotinylated lysate after Sepharose pre-clearance), Lane 7 (eluate from pre-cleared biotinylated lysate incubated withstreptavidin beads). The lower image depicts the raw immunoblot data depicting anti-Na+ / K+ ATPase staining to demonstrate cell surface protein enrichment. FIG. 1 J depicts Lane 5, lane 7 and Lane 3 respectively.
[0028] FIG. 14 shows architecture and nomenclatures of avP8 (left) and L-TGF-P (right).
[0029] FIG. 15 shows paracrine release of TGF-P is not required for mouse survival. We created a knock-in (KI) mouse strain containing a tgfbl R249A mutation in the furin (RHRR to RHRA) recognition sequence that joins LAP with the mature TGF-P peptide. This mutation prevents cleavage and release of mature TGF-p. Homozygous mutant KI / KI mice are bom live, breed, display no phenotypical abnormalities and survive, as opposed to tgfbl - / - (KO / KO) mice which die of multiorgan inflammation. ****p<0.0001 KI / KI vs KO / KO.
[0030] FIG. 16 show a comparison of density maps of L-TGF-P1 / GARP in complex with ectodomain (left) or full length avP8 reconstituted in nanodisc (right).
[0031] FIG. 17 shows entropy redistribution model tested by stabilizing CC bond. Left panel: Cartoon representation of local flexibility in L-TGF-P1 / GARP structures, which is redistributed upon binding to avP8 in lipid nanodiscs. Inset: design of stabilizing Cys mutations in the P8 al- (G128C) and oc2- (V199C) helices. nsEM class average show the avP8 ectodomain maintains only the extended-closed conformation with the G128C / V199C mutation. Graph on right shows that avP8cc significantly increases TGF-P activation compared to wild-type and a ligand binding defective mutant (ASDL) of avP8. ****p<0.0001 by Student’s t-test.
[0032] FIG. 18 show Using the TMLC cell based functional assay, Applicant found that avP8 liposomes caused a higher activation of TGF- p. Inhibitory antibody Fl 2 blocked avP8 liposome activation to the same level as soluble ectodomain of avP8, which does not activate TGF- P in TMLC cells.
[0033] FIGS. 19A-19B show avP6 supports paracrine TGF-P signaling as well as autocrine signaling without release of mature TGF-P. FIG. 19A: Cryo-EM structure of avP6-fl-nd in complex with L-TGF-pi (LAP; mature TGF-P) and a fiducial marker Fab 8B8 (pink). FIG. 19B: Two TGF-P reporter cell assay (inset) with avP6 expressed on the MFB (SEAP) cells and L- TGF-pl / GARP or L- TGF(R249A)-pl on the TMLC (luciferase) cell. ***p<0.001, ****<p<0.0001, ANOVA, Tukey’s post-test.
[0034] FIGS. 20A-20E show a stabilizing CC mutation to test CERD in avP6-mediated TGF- P activation. FIG. 20A: Unlike WT cxvp6, cxvp6CC expressed on CHO cells does not activate TGF-P by TMLC reporter cells. FIG. 20B: Immobilized cxvp6-tr and czvp6CC-tr activate similar levels of TGF-P activation by TMLC reporter cells. FIG. 20C: avP6-mediated TGF-P activation is affected by constraints on avP6 and does not require actin-cytoskeletal force. FIG. 20D: Upper: EM density map of Fabl9C5 / avP6-fl-nd complex in extended-open conformation (-70% of particles). Lower: Biolayer interferometry (BLI) sensorgram show 19C5 does not block binding of L-TGF-P to czvp6, compared to 3G9 that blocks completely, and 8B8 that does not block binding. FIG. 20E: Using the dual reporter cell assay configuration (FIG. 6), 19C5 nearly completely inhibits paracrine av[36-mediated TGF-P activation by avP6 expressing (SEAP) reporter cells, but only blocks 50% of autocrine TGF-P signaling to L-TGF-P1 / GARP expressing (luciferase) reporter cells.
[0035] FIGS. 21A-21B show the allosteric antibody 19C5 inhibits lung fibrosis without inducing the inflammation associated with 3G9. To induce lung injury, C57B\6 mice were instilled with bleomycin (Img / kg) or saline via oropharyngeal delivery Ix / wk for 4 wks. Mabs (Isotype, 19C5 or BG00011 (aka 3G9)) were administered I.P (10 mg / kg) once weekly for 4 wks (n=6). FIG. 21A: To assess lung injury, trichrome staining of whole lung sections from each mouse was performed and assessed histomorphometrically (modified Ashcroft Score). *p<0.05, **p<0.01, ***p<0.001. FIG. 21B: Mouse alveolar macrophages isolated by bronchoalveolar lavage were cultured on immobilized avP6-tr with 19C5, 3G9 or isotype control at various concentrations. Total RNA was isolated and MMP12 expression determined by TaqMan assay. Results expressed relative to isotype treated control. *p<0.05, **p<0.01
[0036] FIG. 22 shows the ability of Fabl9C5 to block ccvP6-mediated autocrine and paracrine signaling is reduced relative to 19C5 IgGl Using the dual reporter cell assay configuration (Fig. 27), Fab 19C5 loses potency in inhibiting avPb-mediated TGF-P activation towards the czvp6 expressing (SEAP) reporter cells, and the L-TGF- 1 / GARP expressing (luciferase) reporter cells. Result expressed as percent activation relative to an isotype and are compared to 3G9 (BG00011).
[0037] FIG. 23 shows experimental results that indicate different CC mutations have different allosteric affects on function. Integrin ITGB8 constructs with the indicated Cys mutations were produced as human avb8 ectodomains in ExpiCHO cells and purified on an anti-av affinity resin.Integrins were coated on 96 well plates at 10 ug / ml and as negative controls a polyclonal nonblocking anti-LAP antibody or BSA were applied to wells without integrin. In one well, the TMLC GARP / TGF-b cells were plated on uncoated wells and treated with recombinant TGF-b (5 pg / ml) as a positive control. TMLC GARP / L-TGF-b cells were added to all other wells and after overnight incubation in DMEM with 10% FCS were assayed for luciferase activity and reported as arbitrary units.
[0038] FIG. 24 shows exemplary ITGB6 CC-mutants described herein.
[0039] FIG. 25 shows experimental results that indicate different CC mutations have different allosteric affects on function and that the same Cys-Cys Mutations in ITGB8 have different effects on ITGB6. CHO cells were either untransfected (filled circles), transfected with wild-type human ITGB6 expression construct (filled squares), or human ITGB6 expression construct expressing Cys mutations in 153 / 228 positions (CCM1, filled triangles) or Cys mutations in 156 / 227 positions (CCM2, open triangles). CHO cells expressing either ITGB6 WT or 156 / 227 Cys mutations were sorted for equivalent surface expression and then co-cultured with TMLC TGF-b reporter cells stably transfected with human full-length GARP (LRRC32) and L-TGF-bl. Results indicate that the integrin avb6 activates cell surface L-TGF-b more efficiently than secreted L-TGF-b and that the 156 / 227 cys-cys mutated integrin loses the ability to support TGF-b activation while CCM1 has no effect. One-one ANOVA and Tukey’s post-test were performed to show where the differences lay.
[0040] FIG. 26 shows ITGB6 stabilizing Cys-Cys mutant (156 / 227, CCM2) that inhibits TGF- b activation does not inhibit cell adhesion to L-TGF-b. CHO cells were either untransfected (filled circles), transfected with wild-type human ITGB6 expression construct (filled squares), or human ITGB6 expression construct expressing Cys mutations in 156 / 227 positions (CC2M, Open diamonds). CHO cells expressing either ITGB6 WT or 156 / 227 Cys mutations were sorted for equivalent surface expression and then equal numbers of cells were allowed to adhere for 1 hr at 37°C to human L-TGF-bl immobilized on 96-well plates (10 mg / ml coating concentration). Results are shown normalized to the WT CHO control cells (One-way ANOVA with Tukey’s post-test). Results indicate that the 156 / 227 cys-cys mutated integrin avb6 binds well to L-TGF- b. These results also show that the 156 / 227 Cys-cys mutation does not inhibit function by decreasing ligand binding. These data are consistent with entropic redistribution as primary mechanism of CCM2 mutation on TGF-b activation.
[0041] FIG. 27 shows the 156 / 227 Cys-Cys mutation induces a change in the conformational ensemble of av[36. Cryogenic electron microscopic (cryo-EM) analysis of the full-length av06 integrin or the full-length av|36 integrin with 156 / 227 Cys-Cys mutations (ccm2). Purified integrins were reconstituted in lipid nanodiscs in complex with a non-blocking Fab (8B8) as a fiducial marker and plunge frozen on grids and imaged (Titan Krios). Density maps are shown after particle reconstruction. Note that the CC2m mutation has changed the conformational ensemble away from predominately extended-closed to a conformationally heterogeneous open ensemble. Lower threshold (not shown) suggests that the CC2m ensemble is biased towards extended-open. Graph show the the avP6fl CC2M in nanodisc is not able to efficiently support TGF-b activation when incubated with L-TGF-bl / GARP TMLC reporter cells as opposed to wild-type avf>6fl in nanodisc which efficiently support TGF-b activation,
[0042] FIG. 28 shows The 156 / 227 cys-cys bond forms between the ITGB6 al and a2 helices in av|36. Cryogenic electron microscopic (cryo-EM) analysis of the the full-length avb6 integrin with 156 / 227 Cys-Cys mutations (cc2m). Purified integrin was reconstituted in lipid nanodiscs in complex with a non-blocking Fab (8B8) or with L-TGF-b as a fiducial marker and plunge frozen on grids and imaged (Titan Krios). Density maps are shown after particle reconstruction. Note that in the reconstructions the CC2m mutation has a density in the appropriate position in the model (see insets) demonstrating that the appropriate Cys-Cys mutations form. These results show that CCM2 cys-cys bond forms, allows Latent-TGF-beta binding and causes extended open conformation.
[0043] FIG. 29 shows examples of amino acid locations for Cys-Cys mutations in ITGB al and a2 helices and ITGB sequence alignment
[0044] FIG. 30 shows amino acid annotation at residues based on location of Cys mutations introduced into ITGB6.
[0045] FIG. 31 shows modeling of Cys mutations in ITGB subunits based on ITGB6 Cys mutations.
[0046] FIG. 32 shows schematics and experimental results demonstrating that 19C5 directionally inhibits TGF-P signaling without blocking ligand binding.
[0047] FIGS. 33A-33B show affinity of 19C5 to avP6. Protein G probe tip bound with 19C5.Binding to avb6 ectodomain or avb6CCM2 ectodomain was compared. 19C5 binding to avb6CCM2 was better compared to avb6tr.
[0048] FIG. 34 shows data that demonstrates 19C5 is a selective allosteric antibody to avP6. BLI using probe tip bound to L-TGF-bl. Ectodomain of avb6 allowed to bind to a non- function blocking anti-av Mab, 19C5 or anti-b6 (3G9.1, also referred to as STX-100). 19C5 and 8B8 have no effect on binding while 3G9 completely inhibits binding. A structure of a complex between avb6fl-nd, 19C5 Fab and 8B8 Fab, with L-TGF-bl was obtained using single particle cryoelectron microscopy. Shown is a density map with model for the b6 upper leg (hybrid and psi domain) and 19C5 Fab. 19C5 has favorable growth properties as a hybridoma, high antibody yields, and stability. In addition, 19C5 allows for binding to L-TGF-p.
[0049] FIG. 35 shows the CryoEM structure of 19C5 Fab bound to avb6fl-nd. Particle subclassification showing same complex in two different conformations. Left: extended-closed conformation with ribbon model (30% of particles); Right: extended-open conformationB (70% of particles). Below: merged density maps. Inset shows general nomenclature for integrin domains.
[0050] FIG. 36 shows a model of antibody footprint using PISA. Shown are contacting residues forming H bonds.
[0051] FIG. 37 shows 19C5 does not induce macrophage activation (e.g., induction of MMP12) compared to 3G9. Mouse alveolar macrophages isolated by bronchoalveolar lavage were cultured on immobilized avb6-tr with 19C5, 3G9 or isotype control at various concentrations. Total RNA was isolated and MMP12 expression determined by TaqMan assay. Results expressed relative to isotype treated control. *p<0.05, **p<0.01. Cartoon renderings of in vitro systems shown.
[0052] FIG. 38 shows the allosteric antibody 19C5 inhibits lung fibrosis without inducing the inflammation associated with 3G9. To induce lung injury, C57B\6 mice were instilled with bleomycin (1 mg / kg) or saline via oropharyngeal delivery Ix / wk for 4 wks. Mabs (Isotype, 19C5 or BG00011 (aka 3G9)) were administered I.P (10 mg / kg) once weekly for 4 wks (n=6). To assess lung injury, trichrome staining of whole lung sections from each mouse was performed and assessed histomorphometrically (modified Ashcroft Score). *p<0.05, **p<0.01, ***p<0.001.
[0053] FIGS. 39A-39E show exemplary allosteric signaling models described herein compared to existing allosteric models known in the art. FIG. 48A:Traditionally, allostery is thought to be transmitted across single domain proteins through a series of defined conformational states as depicted by black dots with white holes. Structural techniques capture and allow definition of some of these states. FIG. 48B: For proteins where the allosteric modulator induces changes in ligand affinity but no defined conformational states are noted, the term “dynamic allostery” is used to define entropic redistribution of flexibility across the small protein to change the ligand binding properties. FIG 48C: In the current state of the art, it is thought that flexible linkers between different protein domains prevent allosteric regulation through either conformational or dynamic allostery. FIG. 48D: The data provided herein show that dynamic allostery can underlie allosteric communication in multidomains proteins (e.g., integrins, TGF-beta and GARP) as well as between such multidomain proteins when they serve as receptor-ligand binding pairs. FIG. 48E: Dynamic allosteric communication leading to changes in directional cell signaling between any cell bound receptor- ligand pair can be determined based on the methods provided herein, and evidence of this is shown in examples of directional signaling induced by GARP / TGF-beta binding to integrin avb6, and subsequent examples of PD1-PD-L1, CD28 / CD80 (CD86), CTLA4 / CD80 (CD86), ICOS / ICOSL, Tigit / Nectin2. This methodology can also be extended to antibodies which are naturally flexible and can induce dynamic allosteric changes in flexible cell surface molecules as exemplified by the high affinity anti-b8 integrin derivative H4C8 changing the dynamic behavior of integrin avb8 compared to the lower affinity parental clone, and the antibody 3G9 binding to the avb6 integrin changing the distribution of flexibility of avb6 compared to its unbound state.
[0054] FIGS. 40A-40C show entropy redistribution PD-1 / PD-L1 and antibody effects. FIG. 40A: Structural representation of PD-1 binding to PD-L1, highlighting entropy redistribution and stabilization upon ligand binding. Apo PD-1 (left panel) shows the interface flexibility, while PD-L1 -bound PD-1 (right panel) demonstrates stabilizing interaction interface and redistribution of entropy redistribution. Gray gradient represents B-factors, illustrating regions of stability and flexibility. Upon PD-L1 binding (right panel), PD-1 undergoes entropy redistribution, facilitating intracellular signaling in T cells. FIG. 40B: Structural superimposition of PD-1 inhibitors and agonists bound to PD-1(PDB: 3RRQ). Nivolumab (PDB: 5WT9), NBOla (PDB: 6HIG) and other blockers (#1-3) and agonists (#6-8) are mapped on the PD-1 surface. Model of PD-1binding sites based on AlphaFold prediction for Peresolimab agonistic binding regions. FIG.40C Shows blocking and agonist activity of antibody.
[0055] FIGS. 41A-41D show structural alignments of immune receptors. Structural alignments of CD28, CTLA4, and ICOS with their respective ligands (in grey) using the PD-1 component of the PD-1 / PD-L1 complex (PDB ID: 3BIK; FIG. 41D) as a reference. The alignments include CD28 / CD80 (AlphaFold prediction; FIG. 41A), CTLA4 / CD80 (PDB ID: 1I8L; FIG. 41B), and ICOS / ICOSL (PDB ID: 6X4G; FIG. 41C), highlighting the similarity faces of these immune receptors.
[0056] FIG. 42 shows a comparative structural analysis of CD28, CTLA4, and ICOS with antibodies. The structural alignments of CD28, CTLA4, and ICOS immune receptors with their corresponding antibodies, visualized in transparent colors for clarity, and aligned using the PD-1 (PDB ID: 3BIK) as a reference structure. The CD28 antibodies include 5. 11 Al (PDB ID: 1YJD) and 1C6 (PDB ID: 4R0L). For ICOS, the antibody STIM003 (PDB ID: 7JOO) is shown. The CTLA4 antibodies featured are Ipilimumab (PDB ID: 6RP8), JS007 (PDB ID: 8HIT), HL32 (PDB ID: 6XY2), an unknown Fab (PDB ID: 7ELX), and Tremelimumab (PDB ID: 5GGV).
[0057] FIG. 43 shows entropy redistribution in CTLA4 and B7-1. CTLA4 and B7-1 interaction sites before and after binding. For CTLA4 (PDB ID: 4KKN), the original binding site depicted orange is more stable than its distal part shown in pink. Upon binding to B7-1 , the stability at the binding site increases significantly, while the distal part becomes less stable.Conversely, B7-1 (PDB ID: 1DR9) exhibits a flexible binding site prior to interaction; however, post-binding (PDB ID: 118L), this stability reverses, with the distal part becoming more flexible (red) and the original binding site more stable. This visualization emphasizes the dynamic changes in molecular stability in response to protein-protein interactions of CTLA4 and B7-1.
[0058] FIG. 44 shows humanization of the 19C5 VH and VL domains does not significantly affect binding to recombinant avb6. Shown is a does-response experiment where the human avb6 ectodomain is immobilized at the indicated doses and after blocking and washing 19C5 parental or humanized 19C5 are added and the IC50 calculated from binding curves by best fit to a 4- parameter sigmoidal binding model (n=2).DETAILED DESCRIPTIONDEFINITIONS
[0059] While various embodiments and aspects of the present invention are shown and described herein, it will be obvious to those skilled in the art that such embodiments and aspects are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention.
[0060] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in the application including, without limitation, patents, patent applications, articles, books, manuals, and treatises are hereby expressly incorporated by reference in their entirety for any purpose.
[0061] The abbreviations used herein have their conventional meaning within the chemical and biological arts. The chemical structures and formulae set forth herein are constructed according to the standard rules of chemical valency known in the chemical arts.
[0062] Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by a person of ordinary skill in the art. See, e.g., Singleton et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY 2nd ed„ J. Wiley & Sons (New York, NY 1994); Sambrook et al., MOLECULAR CLONING, A LABORATORY MANUAL, Cold Springs Harbor Press (Cold Springs Harbor, NY 1989). Any methods, devices and materials similar or equivalent to those described herein can be used in the practice of this invention. The following definitions are provided to facilitate understanding of certain terms used frequently herein and are not meant to limit the scope of the present disclosure.
[0063] Where substituent groups are specified by their conventional chemical formulae, written from left to right, they equally encompass the chemically identical substituents that would result from writing the structure from right to left, e.g., -CH2O- is equivalent to -OCH2-.
[0064] The term "alkyl," by itself or as part of another substituent, means, unless otherwise stated, a straight (i.e., unbranched) or branched non-cyclic carbon chain (or carbon), or combination thereof, which may be fully saturated, mono- or polyunsaturated and can include di- and multivalent radicals, having the number of carbon atoms designated (i.e., C1-C10 means one to ten carbons). Examples of saturated hydrocarbon radicals include, but are not limited to,groups such as methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, isobutyl, sec-butyl, (cyclohexyl)methyl, homologs and isomers of, for example, n-pentyl, n-hexyl, n-heptyl, n-octyl and the like. An unsaturated alkyl group is one having one or more double bonds or triple bonds. Examples of unsaturated alkyl groups include, but are not limited to, vinyl, 2-propenyl, crotyl, 2- isopentenyl, 2-(butadienyl), 2,4-pentadienyl, 3-(l,4-pentadienyl), ethynyl, 1- and 3-propynyl, 3- butynyl, and the higher homologs and isomers. An alkoxy is an alkyl attached to the remainder of the molecule via an oxygen linker (-O-). An alkyl moiety may be an alkenyl moiety. An alkyl moiety may be an alkynyl moiety. An alkyl moiety may be fully saturated.
[0065] The term "alkylene," by itself or as part of another substituent, means, unless otherwise stated, a divalent radical derived from an alkyl, as exemplified, but not limited by, -CH2CH2CH2CH2-. Typically, an alkyl (or alkylene) group will have from 1 to 24 carbon atoms, with those groups having 10 or fewer carbon atoms being preferred in the present invention. A "lower alkyl" or "lower alkylene" is a shorter chain alkyl or alkylene group, generally having eight or fewer carbon atoms. The term "alkenylene," by itself or as part of another substituent, means, unless otherwise stated, a divalent radical derived from an alkene.
[0066] The term "heteroalkyl," by itself or in combination with another term, means, unless otherwise stated, a stable non-cyclic straight or branched chain, or combinations thereof, including at least one carbon atom and at least one heteroatom (e.g. O, N, P, Si or S) and wherein the nitrogen and sulfur atoms may optionally be oxidized, and the nitrogen heteroatom may optionally be quaternized. The heteroatom(s) O, N, P, S, and Si may be placed at any interior position of the heteroalkyl group or at the position at which the alkyl group is attached to the remainder of the molecule. Examples include, but are not limited to: -CH2-CH2-O-CH3, -CH2-CH2-NH-CH3, -CH2-CH2-N(CH3)-CH3, -CH2-S-CH2-CH3,-CH2-CH2, -S(O)-CH3, -CH2-CH2-S(O)2-CH3, -CH=CH-O-CH3, -Si(CH3)3, -CH2-CH=N-OCH3, -CH=CH-N(CH3)-CH3, -0-CH3, -O-CH2-CH3, and -CN. Up to two or three heteroatoms may be consecutive, such as, for example, -CH2-NH-OCH3 and -CH2-O-Si(CH3)3- A heteroalkyl moiety may include one heteroatom (e.g., O, N, S, Si, or P). A heteroalkyl moiety may include two optionally different heteroatoms (e.g., O, N, S, Si, or P). A heteroalkyl moiety may include three optionally different heteroatoms (e.g., O, N, S, Si, or P). A heteroalkyl moiety may include four optionally different heteroatoms (e.g., O, N, S, Si, or P). A heteroalkyl moiety may include five optionally different heteroatoms (e.g., O, N, S, Si, or P). A heteroalkyl moiety may include up to8 optionally different heteroatoms (e.g., O, N, S, Si, or P).
[0067] Similarly, the term "heteroalkylene," by itself or as part of another substituent, means, unless otherwise stated, a divalent radical derived from heteroalkyl, as exemplified, but not limited by, -CH2-CH2-S-CH2-CH2- and -CH2-S-CH2-CH2-NH-CH2-. For heteroalkylene groups, heteroatoms can also occupy either or both of the chain termini (e.g., alkyleneoxy, alkylenedioxy, alkyleneamino, alkylenediamino, and the like). Still further, for alkylene and heteroalkylene linking groups, no orientation of the linking group is implied by the direction in which the formula of the linking group is written. For example, the formula -C(O)2R - represents both -C(O)2R'- and -R'C(O)2-. As described above, heteroalkyl groups, as used herein, include those groups that are attached to the remainder of the molecule through a heteroatom, such as -C(O)R', -C(O)NR', -NR'R”, -OR’, -SR’, and / or -SO2R'. Where “heteroalkyl” is recited, followed by recitations of specific heteroalkyl groups, such as -NR'R" or the like, it will be understood that the terms heteroalkyl and -NR'R" are not redundant or mutually exclusive. Rather, the specific heteroalkyl groups are recited to add clarity. Thus, the term "heteroalkyl" should not be interpreted herein as excluding specific heteroalkyl groups, such as -NR'R" or the like.
[0068] The terms "cycloalkyl" and "heterocycloalkyl," by themselves or in combination with other terms, mean, unless otherwise stated, non-aromatic cyclic versions of "alkyl" and "heteroalkyl," respectively, wherein the carbons making up the ring or rings do not necessarily need to be bonded to a hydrogen due to all carbon valencies participating in bonds with nonhydrogen atoms. Additionally, for heterocycloalkyl, a heteroatom can occupy the position at which the heterocycle is attached to the remainder of the molecule. Examples of cycloalkyl include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, 1 -cyclohexenyl, 3-cyclohexenyl, cycloheptyl, 3-hydroxy-cyclobut-3-enyl-l,2, dione, 1H-1,2,4-Iriazolyl-5(4H)- one, 4H-l,2,4-triazolyl, and the like. Examples of heterocycloalkyl include, but are not limited to, l -(l ,2,5,6-tetrahydropyridyl), 1 -piperidinyl, 2-piperidinyl, 3-piperidinyl, 4-morpholinyl, 3- morpholinyl, tetrahydrofuran-2-yl, tetrahydrofuran-3-yl, tetrahydrothien-2-yl, tetrahydrothien-3- yl, 1 -piperazinyl, 2-piperazinyl , and the like. A "cycloalkylene" and a "heterocycloalkylene," alone or as part of another substituent, means a divalent radical derived from a cycloalkyl and heterocycloalkyl, respectively. A heterocycloalkyl moiety may include one ring heteroatom (e.g., O, N, S, Si, or P). A heterocycloalkyl moiety may include two optionally different ring heteroatoms (e.g., O, N, S, Si, or P). A heterocycloalkyl moiety may include three optionally different ring heteroatoms (e.g., O, N, S, Si, or P). A heterocycloalkyl moiety may include fouroptionally different ring heteroatoms (e.g., O, N, S, Si, or P). A heterocycloalkyl moiety may include five optionally different ring heteroatoms (e.g., O, N, S, Si, or P). A heterocycloalkyl moiety may include up to 8 optionally different ring heteroatoms (e.g., O, N, S, Si, or P).
[0069] The terms "halo" or "halogen," by themselves or as part of another substituent, mean, unless otherwise stated, a fluorine, chlorine, bromine, or iodine atom. Additionally, terms such as "haloalkyl" are meant to include monohaloalkyl and polyhaloalkyl. For example, the term "halo(Ci-C4)alkyl" includes, but is not limited to, fluoromethyl, difluoromethyl, trifluoromethyl, 2,2,2-trifluoroethyl, 4-chlorobutyl, 3 -bromopropyl, and the like.
[0070] The term "acyl" means, unless otherwise stated, -C(O)R where R is a substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl.
[0071] The term "aryl" means, unless otherwise stated, a polyunsaturated, aromatic, hydrocarbon substituent, which can be a single ring or multiple rings (preferably from 1 to 3 rings) that are fused together (i.e., a fused ring aryl) or linked covalently. A fused ring aryl refers to multiple rings fused together wherein at least one of the fused rings is an aryl ring. The term "heteroaryl" refers to aryl groups (or rings) that contain at least one heteroatom such as N, O, or S, wherein the nitrogen and sulfur atoms are optionally oxidized, and the nitrogen atom(s) are optionally quaternized. Thus, the term "heteroaryl" includes fused ring heteroaryl groups (i.e., multiple rings fused together wherein at least one of the fused rings is a heteroaromatic ring). A5.6-fused ring heteroarylene refers to two rings fused together, wherein one ring has 5 members and the other ring has 6 members, and wherein at least one ring is a heteroaryl ring. Likewise, a6.6-fused ring heteroarylene refers to two rings fused together, wherein one ring has 6 members and the other ring has 6 members, and wherein at least one ring is a heteroaryl ring. And a 6,5- fused ring heteroarylene refers to two rings fused together, wherein one ring has 6 members and the other ring has 5 members, and wherein at least one ring is a heteroaryl ring. A heteroaryl group can be attached to the remainder of the molecule through a carbon or heteroatom. Nonlimiting examples of aryl and heteroaryl groups include phenyl, 1 -naphthyl, 2-naphthyl, 4- biphenyl, 1 -pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 3-pyrazolyl, 2-imidazolyl, 4-imidazolyl, pyrazinyl, 2-oxazolyl, 4-oxazolyl, 2-phenyl-4-oxazolyl, 5-oxazolyl, 3-isoxazolyl, 4-isoxazolyl, 5- isoxazolyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, 2-furyl, 3-furyl, 2-thienyl, 3-thienyl, 2-pyridyl, 3- pyridyl, 4-pyridyl, 2-pyrimidyl, 4-pyrimidyl, 5 -benzothiazolyl, purinyl, 2-benzimidazolyl, 5-indolyl, 1 -isoquinolyl, 5-isoquinolyl, 2-quinoxalinyl, 5-quinoxalinyl, 3-quinolyl, and 6-quinolyl. Substituents for each of the above noted aryl and heteroaryl ring systems are selected from the group of acceptable substituents described below. An "arylene" and a "heteroarylene," alone or as part of another substituent, mean a divalent radical derived from an aryl and heteroaryl, respectively. Non-limiting examples of aryl and heteroaryl groups include pyridinyl, pyrimidinyl, thiophenyl, thienyl, furanyl, indolyl, benzoxadiazolyl, benzodioxolyl, benzodioxanyl, thianaphthanyl, pyrrolopyridinyl, indazolyl, quinolinyl, quinoxalinyl, pyridopyrazinyl, quinazolinonyl, benzoisoxazolyl, imidazopyridinyl, benzofuranyl, benzothienyl, benzothiophenyl, phenyl, naphthyl, biphenyl, pyrrolyl, pyrazolyl, imidazolyl, pyrazinyl, oxazolyl, isoxazolyl, thiazolyl, furylthienyl, pyridyl, pyrimidyl, benzothiazolyl, purinyl, benzimidazolyl, isoquinolyl, thiadiazolyl, oxadiazolyl, pyrrolyl, diazolyl, triazolyl, tetrazolyl, benzothiadiazolyl, isothiazolyl, pyrazolopyrimidinyl, pyrrolopyrimidinyl, benzotriazolyl, benzoxazolyl, or quinolyl. The examples above may be substituted or unsubstituted and divalent radicals of each heteroaryl example above are non-limiting examples of heteroarylene. A heteroaryl moiety may include one ring heteroatom (e.g., O, N, or S). A heteroaryl moiety may include two optionally different ring heteroatoms (e.g., O, N, or S). A heteroaryl moiety may include three optionally different ring heteroatoms (e.g., O, N, or S). A heteroaryl moiety may include four optionally different ring heteroatoms (e.g., O, N, or S). A heteroaryl moiety may include five optionally different ring heteroatoms (e.g., O, N, or S). An aryl moiety may have a single ring. An aryl moiety may have two optionally different rings. An aryl moiety may have three optionally different rings. An aryl moiety may have four optionally different rings. A heteroaryl moiety may have one ring. A heteroaryl moiety may have two optionally different rings. A heteroaryl moiety may have three optionally different rings. A heteroaryl moiety may have four optionally different rings. A heteroaryl moiety may have five optionally different rings.
[0072] A fused ring heterocycloalkyl- aryl is an aryl fused to a heterocycloalkyl. A fused ring heterocycloalkyl-heteroaryl is a heteroaryl fused to a heterocycloalkyl. A fused ring heterocycloalkyl-cycloalkyl is a heterocycloalkyl fused to a cycloalkyl. A fused ring heterocycloalkyl-heterocycloalkyl is a heterocycloalkyl fused to another heterocycloalkyl. Fused ring heterocycloalkyl-aryl, fused ring heterocycloalkyl-heteroaryl, fused ring heterocycloalkyl- cycloalkyl, or fused ring heterocycloalkyl-heterocycloalkyl may each independently be unsubstituted or substituted with one or more of the substituents described herein.
[0073] The term "oxo," as used herein, means an oxygen that is double bonded to a carbon atom.
[0074] The term "alkylsulfonyl," as used herein, means a moiety having the formula -S(O2)-R', where R' is a substituted or unsubstituted alkyl group as defined above. R' may have a specified number of carbons (e.g., "C1-C4 alkylsulfonyl").
[0075] Each of the above terms (e.g., "alkyl," "heteroalkyl,", "cycloalkyl", "heterocycloalkyl", "aryl," and "heteroaryl") includes both substituted and unsubstituted forms of the indicated radical. Preferred substituents for each type of radical are provided below.
[0076] Substituents for the alkyl and heteroalkyl radicals (including those groups often referred to as alkylene, alkenyl, heteroalkylene, heteroalkenyl, alkynyl, cycloalkyl, heterocycloalkyl, cycloalkenyl, and heterocycloalkenyl) can be one or more of a variety of groups selected from, but not limited to, -OR', =0, =NR', =N-OR’, -NR’R", -SR', -halogen, -SiR'R"R", -OC(O)R', -C(O)R', -CO2R', -CONR'R", -OC(O)NR'R", -NR"C(O)R', -NR'-C(0)NR"R'", -NR"C(O)2R', -NR-C(NR'R")=NR’", -S(O)R’, -S(O)2R', -S(0)2N(R)(’R"-NRS02R’), -CN, and -NO2in a number ranging from zero to (2m'+l), where m' is the total number of carbon atoms in such radical. R’, R”, R'", and R"” each preferably independently refer to hydrogen, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl (e.g., aryl substituted with 1-3 halogens), substituted or unsubstituted alkyl, alkoxy, or thioalkoxy groups, or arylalkyl groups. When a compound of the invention includes more than one R group, for example, each of the R groups is independently selected as are each R', R", R'", and R"" group when more than one of these groups is present. When R' and R" are attached to the same nitrogen atom, they can be combined with the nitrogen atom to form a 4-, 5- , 6-, or 7-membered ring. For example, -NR’R" includes, but is not limited to, 1-pyrrolidinyl and 4-morpholinyl. From the above discussion of substituents, one of skill in the art will understand that the term “alkyl” is meant to include groups including carbon atoms bound to groups other than hydrogen groups, such as haloalkyl (e.g., -CF3 and -CH2CF3) and acyl (e.g., -C(O)CH3, -C(O)CF3, -C(O)CH2OCH3, and the like).
[0077] Similar to the substituents described for the alkyl radical, substituents for the aryl and heteroaryl groups are varied and are selected from, for example: -OR’, -NR’R", -SR', -halogen, -SiR'R' R'", -OC(O)R', -C(O)R', -CO2R', -CONR'R", -0C(0)NR'R",-NR"C(O)R', -NR'-C(O)NR”R’", NR"C(O)2R’, NRC(NR'R")=NR'", S(O)R’, -S(O)2R’, -S(O)2N(R’)(R”, -NRSO2R’), -CN, -N02, -R’, -N3, -CH(Ph)2, fluoro(Ci-C4)alkoxy, and fluoro(Ci- C4)alky 1, in a number ranging from zero to the total number of open valences on the aromatic ring system; and where R', R", R'", and R"" are preferably independently selected from hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl. When a compound of the invention includes more than one R group, for example, each of the R groups is independently selected as are each R', R”, R'", and R”" groups when more than one of these groups is present.
[0078] Where a moiety is substituted with an R substituent, the group may be referred to as "R-substituted. " Where a moiety is R-substituted, the moiety is substituted with at least one R substituent and each R substituent is optionally different. For example, where a moiety herein is R1A-substituted or unsubstituted alkyl, a plurality of R1Asubstituents may be attached to the alkyl moiety wherein each R1Asubstituent is optionally different. Where an R-substituted moiety is substituted with a plurality of R substituents, each of the R-substituents may be differentiated herein using a prime symbol (') such as R', R", etc. For example, where a moiety is R3A-substituted or unsubstituted alkyl, and the moiety is substituted with a plurality of R3Asubstituents, the plurality of R3Asubstituents may be differentiated as R3A', R3A", R3A’", etc. In some embodiments, the plurality of R substituents is 3.
[0079] Two or more substituents may optionally be joined to form aryl, heteroaryl, cycloalkyl, or heterocycloalkyl groups. Such so-called ring-forming substituents are typically, though not necessarily, found attached to a cyclic base structure. In one embodiment, the ring-forming substituents are attached to adjacent members of the base structure. For example, two ringforming substituents attached to adjacent members of a cyclic base structure create a fused ring structure. In another embodiment, the ring-forming substituents are attached to a single member of the base structure. For example, two ring-forming substituents attached to a single member of a cyclic base structure create a spirocyclic structure. In yet another embodiment, the ringforming substituents are attached to non-adjacent members of the base structure.
[0080] Two of the substituents on adjacent atoms of the aryl or heteroaryl ring may optionally form a ring of the formula -T-C(O)-(CRR')q-U-, wherein T and U are independently -NR-, -O-, -CRR'-, or a single bond, and q is an integer of from 0 to 3. Alternatively, two of the substituents on adjacent atoms of the aryl or heteroaryl ring mayoptionally be replaced with a substituent of the formula -A-(CH2)r-B-, wherein A and B are independently -CRR'-, -O-, -NR-, -S-, -S(O) -S(O)2-, -S(O)2NR'-, or a single bond, and r is an integer of from 1 to 4. One of the single bonds of the new ring so formed may optionally be replaced with a double bond. Alternatively, two of the substituents on adjacent atoms of the aryl or heteroaryl ring may optionally be replaced with a substituent of the formula -(CRR’)s-X'- (C”R"R"')d-, where variables s and d are independently integers of from 0 to 3, and X’ is -O-, -NR'-, -S-, -S(O)-, -S(O)2-, or -S(O)2NR’-. The substituents R, R', R", and R'" are preferably independently selected from hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl.
[0081] As used herein, the terms "heteroatom" or "ring heteroatom" are meant to include, oxygen (O), nitrogen (N), sulfur (S), phosphorus (P), and silicon (Si).
[0082] A "substituent group," as used herein, means a group selected from the following moieties:(A) oxo, halogen, -CF3, -CN, -OH, -NH2, -C00H, -C0NH2, -NO2, -SH, -SO2C1, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC=(0)NHNH2, -NHC=(0) NH2, -NHSO2H, -NI KA (O)H, -NHC(0)-0H, -NHOH, -OCF3, -OCHF2, unsubstituted alkyl, unsubstituted heteroalkyl, unsubstituted cycloalkyl, unsubstituted heterocycloalkyl, unsubstituted aryl, unsubstituted heteroaryl, and(B) alkyl, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, substituted with at least one substituent selected from:(i) oxo, halogen, -CF3, -CN, -OH, -NH2, -C00H, -CONH2, -NO2, -SH, -SO2CI, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC=(0)NHNH2, -NHC=(0) NH2, -NHSO2H, -NHC= (O)H, -NHC(O)-OH, -NHOH, -OCF3, -OCHF2, unsubstituted alkyl, unsubstituted heteroalkyl, unsubstituted cycloalkyl, unsubstituted heterocycloalkyl, unsubstituted aryl, unsubstituted heteroaryl, and(ii) alkyl, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, substituted with at least one substituent selected from:(a) oxo, halogen, -CF3, -CN, -OH, -NH2, -C00H, -C0NH2, -NO2, -SH, -SO2CI, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC=(0)NHNH2, -NHC=(0) NH2, - NHSO2H, -NHC= (O)H, -NHC(0)-0H, -NHOH, -OCF3, -OCHF2, unsubstitutedalkyl, unsubstituted heteroalkyl, unsubstituted cycloalkyl, unsubstituted heterocycloalkyl, unsubstituted aryl, unsubstituted heteroaryl, and(b) alkyl, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, substituted with at least one substituent selected from: oxo, halogen, -CF3, -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO2CI, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC=(O)NHNH2, -NHC=(O) NH2, -NHSO2H, -NHC= (O)H, -NHC(O)-OH, -NHOH, -OCF3, -OCHF2, unsubstituted alkyl, unsubstituted heteroalkyl, unsubstituted cycloalkyl, unsubstituted heterocycloalkyl, unsubstituted aryl, unsubstituted heteroaryl.
[0083] A “chemical linker,” as provided herein, is a covalent linker, a non-covalent linker, a peptide linker (a linker including a peptide moiety), a cleavable peptide linker, a substituted or unsubstituted alkylene, substituted or unsubstituted heteroalkylene, substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene, substituted or unsubstituted arylene or substituted or unsubstituted heteroarylene or any combination thereof. Thus, a chemical linker as provided herein may include a plurality of chemical moieties, wherein each of the plurality of chemical moieties is chemically different. Alternatively, the chemical linker may be a non-covalent linker. Examples of non-covalent linkers include without limitation, ionic bonds, hydrogen bonds, halogen bonds, van der Waals interactions (e.g. dipole-dipole, dipole- induced dipole, London dispersion), ring stacking (pi effects), and hydrophobic interactions. In embodiments, a chemical linker is formed using conjugate chemistry including, but not limited to nucleophilic substitutions (e.g., reactions of amines and alcohols with acyl halides, active esters), electrophilic substitutions (e.g., enamine reactions) and additions to carbon-carbon and carbon-heteroatom multiple bonds (e.g., Michael reaction, Diels-Alder addition).
[0084] A "size-limited substituent" or "size-limited substituent group," as used herein, means a group selected from all of the substituents described above for a "substituent group," wherein each substituted or unsubstituted alkyl is a substituted or unsubstituted C1-C20 alkyl, each substituted or unsubstituted heteroalkyl is a substituted or unsubstituted 2 to 20 membered heteroalkyl, each substituted or unsubstituted cycloalkyl is a substituted or unsubstituted C3-C8 cycloalkyl, each substituted or unsubstituted heterocycloalkyl is a substituted or unsubstituted 3 to 8 membered heterocycloalkyl, each substituted or unsubstituted aryl is a substituted or unsubstituted Ce-Cio aryl, and each substituted or unsubstituted heteroaryl is a substituted or unsubstituted 5 to 10 membered heteroaryl.
[0085] A "lower substituent" or "lower substituent group," as used herein, means a group selected from all of the substituents described above for a “substituent group,” wherein each substituted or unsubstituted alkyl is a substituted or unsubstituted Ci-Cs alkyl, each substituted or unsubstituted heteroalkyl is a substituted or unsubstituted 2 to 8 membered heteroalkyl, each substituted or unsubstituted cycloalkyl is a substituted or unsubstituted C3-C7 cycloalkyl, each substituted or unsubstituted heterocycloalkyl is a substituted or unsubstituted 3 to 7 membered heterocycloalkyl, each substituted or unsubstituted aryl is a substituted or unsubstituted Ce-Cio aryl, and each substituted or unsubstituted heteroaryl is a substituted or unsubstituted 5 to 9 membered heteroaryl.
[0086] In some embodiments, each substituted group described in the compounds herein is substituted with at least one substituent group. More specifically, in some embodiments, each substituted alkyl, substituted heteroalkyl, substituted cycloalkyl, substituted heterocycloalkyl, substituted aryl, substituted heteroaryl, substituted alkylene, substituted heteroalkylene, substituted cycloalkylene, substituted heterocycloalkylene, substituted arylene, and / or substituted heteroarylene described in the compounds herein are substituted with at least one substituent group. In other embodiments, at least one or all of these groups are substituted with at least one size-limited substituent group. In other embodiments, at least one or all of these groups are substituted with at least one lower substituent group.
[0087] In other embodiments of the compounds herein, each substituted or unsubstituted alkyl may be a substituted or unsubstituted C1-C20 alkyl, each substituted or unsubstituted heteroalkyl is a substituted or unsubstituted 2 to 20 membered heteroalkyl, each substituted or unsubstituted cycloalkyl is a substituted or unsubstituted C3-C8 cycloalkyl, each substituted or unsubstituted heterocycloalkyl is a substituted or unsubstituted 3 to 8 membered heterocycloalkyl, each substituted or unsubstituted aryl is a substituted or unsubstituted Ce-Cio aryl, and / or each substituted or unsubstituted heteroaryl is a substituted or unsubstituted 5 to 10 membered heteroaryl. In some embodiments of the compounds herein, each substituted or unsubstituted alkylene is a substituted or unsubstituted C1-C20 alkylene, each substituted or unsubstituted heteroalkylene is a substituted or unsubstituted 2 to 20 membered heteroalkylene, each substituted or unsubstituted cycloalkylene is a substituted or unsubstituted C3-C8 cycloalkylene, each substituted or unsubstituted heterocycloalkylene is a substituted or unsubstituted 3 to 8 membered heterocycloalkylene , each substituted or unsubstituted arylene is a substituted orunsubstituted Ce-Cio arylene, and / or each substituted or unsubstituted heteroarylene is a substituted or unsubstituted 5 to 10 membered heteroarylene.
[0088] In some embodiments, each substituted or unsubstituted alkyl is a substituted or unsubstituted Ci-Cs alkyl, each substituted or unsubstituted heteroalkyl is a substituted or unsubstituted 2 to 8 membered heteroalkyl, each substituted or unsubstituted cycloalkyl is a substituted or unsubstituted C3-C7 cycloalkyl, each substituted or unsubstituted heterocycloalkyl is a substituted or unsubstituted 3 to 7 membered heterocycloalkyl, each substituted or unsubstituted aryl is a substituted or unsubstituted Ce-Cio aryl, and / or each substituted or unsubstituted heteroaryl is a substituted or unsubstituted 5 to 9 membered heteroaryl. In some embodiments, each substituted or unsubstituted alkylene is a substituted or unsubstituted Ci-Cs alkylene, each substituted or unsubstituted heteroalkylene is a substituted or unsubstituted 2 to 8 membered heteroalkylene, each substituted or unsubstituted cycloalkylene is a substituted or unsubstituted C3-C7 cycloalkylene, each substituted or unsubstituted heterocycloalkylene is a substituted or unsubstituted 3 to 7 membered heterocycloalkylene, each substituted or unsubstituted arylene is a substituted or unsubstituted Ce-Cio arylene, and / or each substituted or unsubstituted heteroarylene is a substituted or unsubstituted 5 to 9 membered heteroarylene. In some embodiments, the compound is a chemical species set forth in the Examples section, figures, or tables below.
[0089] As used herein, the term "conjugate" refers to the association between atoms or molecules. The association can be direct or indirect. For example, a conjugate between a nucleic acid and a protein can be direct, e.g., by covalent bond, or indirect, e.g., by non-covalent bond (e.g. electrostatic interactions (e.g. ionic bond, hydrogen bond, halogen bond), van der Waals interactions (e.g. dipole-dipole, dipole-induced dipole, London dispersion), ring stacking (pi effects), hydrophobic interactions and the like). In embodiments, conjugates are formed using conjugate chemistry including, but are not limited to nucleophilic substitutions (e.g., reactions of amines and alcohols with acyl halides, active esters), electrophilic substitutions (e.g., enamine reactions) and additions to carbon-carbon and carbon-heteroatom multiple bonds (e.g., Michael reaction, Diels-Alder addition). These and other useful reactions are discussed in, for example, March, ADVANCED ORGANIC CHEMISTRY, 3rd Ed., John Wiley & Sons, New York, 1985; Hermanson, BIOCONJUGATE TECHNIQUES, Academic Press, San Diego, 1996; and Feeney et al., MODIFICATION OF PROTEINS; Advances in Chemistry Series, Vol. 198, American Chemical Society, Washington, D.C., 1982.
[0090] Useful reactive moieties or functional groups used for conjugate chemistries (including "click chemistries" as known in the art) herein include, for example:(a) carboxyl groups and various derivatives thereof including, but not limited to, N- hydroxysuccinimide esters, N-hydroxybenztriazole esters, acid halides, acyl imidazoles, thioesters, p-nitrophenyl esters, alkyl, alkenyl, alkynyl and aromatic esters;(b) hydroxyl groups which can be converted to esters, ethers, aldehydes, etc.(c) haloalkyl groups wherein the halide can be later displaced with a nucleophilic group such as, for example, an amine, a carboxylate anion, thiol anion, carbanion, or an alkoxide ion, thereby resulting in the covalent attachment of a new group at the site of the halogen atom;(d) dienophile groups which are capable of participating in Diels-Alder reactions such as, for example, maleimido groups;(e) aldehyde or ketone groups such that subsequent derivatization is possible via formation of carbonyl derivatives such as, for example, imines, hydrazones, semicarbazones or oximes, or via such mechanisms as Grignard addition or alkyllithium addition;(f) sulfonyl halide groups for subsequent reaction with amines, for example, to form sulfonamides;(g) thiol groups, which can be converted to disulfides, reacted with acyl halides, or bonded to metals such as gold;(h) amine or sulfhydryl groups, which can be, for example, acylated, alkylated or oxidized;(i) alkenes, which can undergo, for example, cycloadditions, acylation, Michael addition, etc.;(j) epoxides, which can react with, for example, amines and hydroxyl compounds;(k) phosphoramidites and other standard functional groups useful in nucleic acid synthesis;(l) metal silicon oxide bonding;(m) metal bonding to reactive phosphorus groups (e.g. phosphines) to form, for example, phosphate diester bonds; and(n) sulfones, for example, vinyl sulfone.
[0091] Chemical synthesis of compositions by joining small modular units using conjugate (“click”) chemistry is well known in the art and described, for example, in H. C. Kolb, M. G. Finn and K. B. Sharpless ((2001). "Click Chemistry: Diverse Chemical Function from a FewGood Reactions". Angewandte Chemie International Edition 40 (11): 2004-2021); R. A. Evans ((2007). "The Rise of Azide-Alkyne 1 ,3-Dipolar 'Click' Cycloaddition and its Application to Polymer Science and Surface Modification". Australian Journal of Chemistry 60 (6): 384-395; W.C. Guida et al. Med. Res. Rev. p 3 1996; Spiteri, Christian and Moses, John E. ((2010). "Copper-Catalyzed Azide-Alkyne Cycloaddition: Regioselective Synthesis of 1,4,5- Trisubstituted 1,2,3-Triazoles". Angewandte Chemie International Edition 49 (I): 31-33); Hoyle, Charles E. and Bowman, Christopher N. ((2010). "Thiol-Ene Click Chemistry". Angewandte Chemie International Edition 49 (9): 1540-1573); Blackman, Melissa L. and Royzen, Maksim and Fox, Joseph M. ((2008). "Tetrazine Ligation: Fast Bioconjugation Based on Inverse- Electron-Demand Diels- Alder Reactivity". Journal of the American Chemical Society 130 (41): 13518-13519); Devaraj, Neal K. and Weissleder, Ralph and Hilderbrand, Scott A. ((2008). "Tetrazine Based Cycloadditions: Application to Pretargeted Live Cell Labeling". Bioconjugate Chemistry 19 (12): 2297-2299); Stockmann, Henning; Neves, Andre; Stairs, Shaun; Brindle, Kevin; Leeper, Finian ((2011). "Exploring isonitrile-based click chemistry for ligation with biomolecules". Organic & Biomolecular Chemistry), all of which are hereby incorporated by reference in their entirety and for all purposes.
[0092] The reactive functional groups can be chosen such that they do not participate in, or interfere with, the chemical stability of the proteins or nucleic acids described herein. By way of example, the nucleic acids can include a vinyl sulfone or other reactive moiety (e.g., maleimide). Optionally, the nucleic acids can include a reactive moiety having the formula -S-S-R. R can be, for example, a protecting group. Optionally, R is hexanol. As used herein, the term hexanol includes compounds with the formula CeHnOH and includes, 1-hexanol, 2-hexanol, 3-hexanol, 2-methyl-l -pentanol, 3-methyl-l -pentanol, 4-methyl- 1 -pentanol, 2-methyl-2-pentanol, 3-methyl- 2-pentanol, 4-methyl-2-pentanol, 2-methyl-3 -pentanol, 3-methyl-3-pentanol, 2,2-dimethyl-l- butanol, 2,3-dimethyLl -butanol, 3, 3 -dimethyl -1 -butanol, 2,3-dimethyl-2-butanol, 3,3-dimethyL 2-butanol, and 2-ethyLl -butanol. Optionally, R is 1-hexanol.
[0093] As used herein, the term "about" means a range of values including the specified value, which a person of ordinary skill in the art would consider reasonably similar to the specified value. In embodiments, the term "about" means within a standard deviation using measurements generally acceptable in the art. In embodiments, about means a range extending to + / - 10% of the specified value. In embodiments, about means the specified value.
[0094] Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by a person of ordinary skill in the art. See, e.g., Singleton et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY 2nd ed„ J. Wiley & Sons (New York, NY 1994); Sambrook et al., MOLECULAR CLONING, A LABORATORY MANUAL, Cold Springs Harbor Press (Cold Springs Harbor, NY 1989). Any methods, devices and materials similar or equivalent to those described herein can be used in the practice of this invention. The following definitions are provided to facilitate understanding of certain terms used frequently herein and are not meant to limit the scope of the present disclosure.
[0095] " Nucleic acid" refers to nucleotides (e.g., deoxyribonucleotides or ribonucleotides) and polymers thereof in either single-, double- or multiple- stranded form, or complements thereof; or nucleosides (e.g., deoxyribonucleosides or ribonucleosides). In embodiments, “nucleic acid” does not include nucleosides. The terms “polynucleotide,” “oligonucleotide,” “oligo” or the like refer, in the usual and customary sense, to a linear sequence of nucleotides. The term “nucleoside” refers, in the usual and customary sense, to a glycosylamine including a nucleobase and a five-carbon sugar (ribose or deoxyribose). Non limiting examples, of nucleosides include cytidine, uridine, adenosine, guanosine, thymidine and inosine. The term “nucleotide” refers, in the usual and customary sense, to a single unit of a polynucleotide, i.e., a monomer. Nucleotides can be ribonucleotides, deoxyribonucleotides, or modified versions thereof. Examples of polynucleotides contemplated herein include single and double stranded DNA, single and double stranded RNA, and hybrid molecules having mixtures of single and double stranded DNA and RNA. Examples of nucleic acid, e.g. polynucleotides contemplated herein include any types of RNA, e.g. mRNA, siRNA, miRNA, and guide RNA and any types of DNA, genomic DNA, plasmid DNA, and minicircle DNA, and any fragments thereof. The term “duplex” in the context of polynucleotides refers, in the usual and customary sense, to double strandedness. Nucleic acids can be linear or branched. For example, nucleic acids can be a linear chain of nucleotides or the nucleic acids can be branched, e.g., such that the nucleic acids comprise one or more arms or branches of nucleotides. Optionally, the branched nucleic acids are repetitively branched to form higher ordered structures such as dendrimers and the like.
[0096] Nucleic acids, including e.g., nucleic acids with a phosphothioate backbone, can include one or more reactive moieties. As used herein, the term reactive moiety includes any group capable of reacting with another molecule, e.g., a nucleic acid or polypeptide through covalent, non-covalent or other interactions. By way of example, the nucleic acid can include anamino acid reactive moiety that reacts with an amino acid on a protein or polypeptide through a covalent, non-covalent or other interaction.
[0097] The terms also encompass nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non- naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides. Examples of such analogs include, without limitation, phosphodiester derivatives including, e.g., phosphoramidate, phosphorodiamidate, phosphorothioate (also known as phosphothioate having double bonded sulfur replacing oxygen in the phosphate), phosphorodithioate, phosphonocarboxylic acids, phosphonocarboxylates, phosphonoacetic acid, phosphonoformic acid, methyl phosphonate, boron phosphonate, or O-methylphosphoroamidite linkages (see Eckstein, OLIGONUCLEOTIDES AND ANALOGUES: A PRACTICAL APPROACH, Oxford University Press) as well as modifications to the nucleotide bases such as in 5 -methyl cytidine or pseudouridine.; and peptide nucleic acid backbones and linkages. Other analog nucleic acids include those with positive backbones; non-ionic backbones, modified sugars, and non-ribose backbones (e.g. phosphorodiamidate morpholino oligos or locked nucleic acids (LNA) as known in the art), including those described in U.S. Patent Nos. 5,235,033 and 5,034,506, and Chapters 6 and 7, ASC Symposium Series 580, CARBOHYDRATE MODIFICATIONS IN ANTISENSE RESEARCH, Sanghui & Cook, eds. Nucleic acids containing one or more carbocyclic sugars are also included within one definition of nucleic acids. Modifications of the ribose-phosphate backbone may be done for a variety of reasons, e.g., to increase the stability and half-life of such molecules in physiological environments or as probes on a biochip. Mixtures of naturally occurring nucleic acids and analogs can be made; alternatively, mixtures of different nucleic acid analogs, and mixtures of naturally occurring nucleic acids and analogs may be made. In embodiments, the intemucleotide linkages in DNA are phosphodiester, phosphodiester derivatives, or a combination of both.
[0098] Nucleic acids can include nonspecific sequences. As used herein, the term "nonspecific sequence" refers to a nucleic acid sequence that contains a series of residues that are not designed to be complementary to or are only partially complementary to any other nucleic acid sequence. By way of example, a nonspecific nucleic acid sequence is a sequence of nucleic acid residues that does not function as an inhibitory nucleic acid when contacted with a cell or organism.
[0099] A polynucleotide is typically composed of a specific sequence of four nucleotide bases: adenine (A); cytosine (C); guanine (G); and thymine (T) (uracil (U) for thymine (T) when the polynucleotide is RNA). Thus, the term “polynucleotide sequence” is the alphabetical representation of a polynucleotide molecule; alternatively, the term may be applied to the polynucleotide molecule itself. This alphabetical representation can be input into databases in a computer having a central processing unit and used for bioinformatics applications such as functional genomics and homology searching. Polynucleotides may optionally include one or more non-standard nucleotide(s), nucleotide analog(s) and / or modified nucleotides.
[0100] The term “complement,” as used herein, refers to a nucleotide (e.g., RNA or DNA) or a sequence of nucleotides capable of base pairing with a complementary nucleotide or sequence of nucleotides. As described herein and commonly known in the art the complementary (matching) nucleotide of adenosine is thymidine and the complementary (matching) nucleotide of guanosine is cytosine. Thus, a complement may include a sequence of nucleotides that base pair with corresponding complementary nucleotides of a second nucleic acid sequence. The nucleotides of a complement may partially or completely match the nucleotides of the second nucleic acid sequence. Where the nucleotides of the complement completely match each nucleotide of the second nucleic acid sequence, the complement forms base pairs with each nucleotide of the second nucleic acid sequence. Where the nucleotides of the complement partially match the nucleotides of the second nucleic acid sequence only some of the nucleotides of the complement form base pairs with nucleotides of the second nucleic acid sequence. Examples of complementary sequences include coding and a non-coding sequences, wherein the non-coding sequence contains complementary nucleotides to the coding sequence and thus forms the complement of the coding sequence. A further example of complementary sequences are sense and antisense sequences, wherein the sense sequence contains complementary nucleotides to the antisense sequence and thus forms the complement of the antisense sequence.
[0101] As described herein the complementarity of sequences may be partial, in which only some of the nucleic acids match according to base pairing, or complete, where all the nucleic acids match according to base pairing. Thus, two sequences that are complementary to each other, may have a specified percentage of nucleotides that are the same (i.e., about 60% identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region).
[0102] The term "amino acid" refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, y-carboxy glutamate, and O-phosphoserine. Amino acid analogs refers to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., an a carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid. Amino acid mimetics refers to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid. The terms “non-naturally occurring amino acid” and “unnatural amino acid” refer to amino acid analogs, synthetic amino acids, and amino acid mimetics which are not found in nature.
[0103] Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes.
[0104] The terms "polypeptide," "peptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues, wherein the polymer may In embodiments be conjugated to a moiety that does not consist of amino acids. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymers. A "fusion protein" refers to a chimeric protein encoding two or more separate protein sequences that are recombinantly expressed as a single moiety.
[0105] An amino acid or nucleotide base "position" is denoted by a number that sequentially identifies each amino acid (or nucleotide base) in the reference sequence based on its position relative to the N-terminus (or 5'-end). Due to deletions, insertions, truncations, fusions, and the like that must be considered when determining an optimal alignment, in general the amino acid residue number in a test sequence determined by simply counting from the N-terminus will not necessarily be the same as the number of its corresponding position in the reference sequence.For example, in a case where a variant has a deletion relative to an aligned reference sequence, there will be no amino acid in the variant that corresponds to a position in the reference sequence at the site of deletion. Where there is an insertion in an aligned reference sequence, that insertion will not correspond to a numbered amino acid position in the reference sequence. In the case of truncations or fusions there can be stretches of amino acids in either the reference or aligned sequence that do not correspond to any amino acid in the corresponding sequence.
[0106] The terms "numbered with reference to" or "corresponding to," when used in the context of the numbering of a given amino acid or polynucleotide sequence, refers to the numbering of the residues of a specified reference sequence when the given amino acid or polynucleotide sequence is compared to the reference sequence. An amino acid residue in a protein "corresponds" to a given residue when it occupies the same essential structural position within the protein as the given residue. One skilled in the art will immediately recognize the identity and location of residues corresponding to a specific position in a protein (e.g., TGF-beta) in other proteins with different numbering systems. For example, by performing a simple sequence alignment with a protein (e.g., TGF-beta) the identity and location of residues corresponding to specific positions of the protein are identified in other protein sequences aligning to the protein. For example, a selected residue in a selected protein corresponds to glutamic acid at position 138 when the selected residue occupies the same essential spatial or other structural relationship as a glutamic acid at position 138. In some embodiments, where a selected protein is aligned for maximum homology with a protein, the position in the aligned selected protein aligning with glutamic acid 138 is the position to correspond to glutamic acid 138. Instead of a primary sequence alignment, a three dimensional structural alignment can also be used, e.g., where the structure of the selected protein is aligned for maximum correspondence with the glutamic acid at position 138, and the overall structures compared. In this case, an amino acid that occupies the same essential position as glutamic acid 138 in the structural model is said to correspond to the glutamic acid 138 residue.
[0107] "Conservatively modified variants" applies to both amino acid and nucleic acid sequences. With respect to particular nucleic acid sequences, "conservatively modified variants" refers to those nucleic acids that encode identical or essentially identical amino acid sequences. Because of the degeneracy of the genetic code, a number of nucleic acid sequences will encode any given protein. For instance, the codons GCA, GCC, GCG and GCU all encode the amino acid alanine. Thus, at every position where an alanine is specified by a codon, the codon can bealtered to any of the corresponding codons described without altering the encoded polypeptide. Such nucleic acid variations are "silent variations," which are one species of conservatively modified variations. Every nucleic acid sequence herein which encodes a polypeptide also describes every possible silent variation of the nucleic acid. One of skill will recognize that each codon in a nucleic acid (except AUG, which is ordinarily the only codon for methionine, and TGG, which is ordinarily the only codon for tryptophan) can be modified to yield a functionally identical molecule. Accordingly, each silent variation of a nucleic acid which encodes a polypeptide is implicit in each described sequence.
[0108] As to amino acid sequences, one of skill will recognize that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide, or protein sequence which alters, adds or deletes a single amino acid or a small percentage of amino acids in the encoded sequence is a "conservatively modified variant" where the alteration results in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. Such conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles of the disclosure.
[0109] The following eight groups each contain amino acids that are conservative substitutions for one another:1) Alanine (A), Glycine (G);2) Aspartic acid (D), Glutamic acid (E);3) Asparagine (N), Glutamine (Q);4) Arginine (R), Lysine (K);5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V);6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W);7) Serine (S), Threonine (T); and8) Cysteine (C), Methionine (M)(see, e.g., Creighton, Proteins (1984)).
[0110] The terms "identical" or percent "identity," in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., about 60% identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region, when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection (see, e.g., NCBI web site http: / / www.ncbi.nlm.nih.gov / BLAST / or the like). Such sequences are then said to be "substantially identical." This definition also refers to, or may be applied to, the compliment of a test sequence. The definition also includes sequences that have deletions and / or additions, as well as those that have substitutions. As described below, the preferred algorithms can account for gaps and the like. Preferably, identity exists over a region that is at least about 25 amino acids or nucleotides in length, or more preferably over a region that is 50-100 amino acids or nucleotides in length.
[0111] "Percentage of sequence identity" is determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide or polypeptide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity.
[0112] A "comparison window", as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of, e.g., a full length sequence or from 20 to 600, about 50 to about 200, or about 100 to about 150 amino acids or nucleotides in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith and Waterman (1970) Adv. Appl. Math. 2:482c, by the homology alignment algorithm of Needleman andWunsch (1970) J. Mol. Biol. 48:443, by the search for similarity method of Pearson and Lipman (1988) Proc. Nat’l. Acad. Sci. USA 85:2444, by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by manual alignment and visual inspection (see, e.g., Ausubel et al., Current Protocols in Molecular Biology (1995 supplement)).
[0113] An example of an algorithm that is suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al. (1977) Nuc. Acids Res. 25:3389-3402, and Altschul et al. (1990) J. Mol. Biol. 215:403-410, respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http: / / www.ncbi.nlm.nih.gov / ). This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive- valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al., supra). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always > 0) and N (penalty score for mismatching residues; always < 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a word length (W) of 11 , an expectation (E) or 10, M=5, N=-4 and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a word length of 3, and expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff and Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915) alignments (B) of 50, expectation (E) of 10, M=5, N=-4, and a comparison of both strands.
[0114] The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5787). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, more preferably less than about 0.01, and most preferably less than about 0.001.
[0115] An indication that two nucleic acid sequences or polypeptides are substantially identical is that the polypeptide encoded by the first nucleic acid is immunologically cross reactive with the antibodies raised against the polypeptide encoded by the second nucleic acid, as described below. Thus, a polypeptide is typically substantially identical to a second polypeptide, for example, where the two peptides differ only by conservative substitutions. Another indication that two nucleic acid sequences are substantially identical is that the two molecules or their complements hybridize to each other under stringent conditions, as described below. Yet another indication that two nucleic acid sequences are substantially identical is that the same primers can be used to amplify the sequence.
[0116] The phrase "specifically (or selectively) binds" to an antibody or "specifically (or selectively) immunoreactive with," when referring to a protein or peptide, refers to a binding reaction that is determinative of the presence of the protein, often in a heterogeneous population of proteins and other biologies. Thus, under designated immunoassay conditions, the specified antibodies bind to a particular protein at least two times the background and more typically more than 10 to 100 times background. Specific binding to an antibody under such conditions requires an antibody that is selected for its specificity for a particular protein. For example, polyclonal antibodies can be selected to obtain only a subset of antibodies that are specifically immunoreactive with the selected antigen and not with other proteins. This selection may be achieved by subtracting out antibodies that cross-react with other molecules. A variety of immunoassay formats may be used to select antibodies specifically immunoreactive with a particular protein. For example, solid-phase ELISA immunoassays are routinely used to select antibodies specifically immunoreactive with a protein (see, e.g., Harlow & Lane, Using Antibodies, A Laboratory Manual (1998) for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity).
[0117] A "ligand" refers to an agent, e.g., a polypeptide or other molecule, capable of binding to a receptor or antibody, antibody variant, antibody region or fragment thereof.
[0118] Techniques for conjugating therapeutic agents to antibodies are well known (see, e.g., Amon et al., "Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy", in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.), pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al., “Antibodies For Drug Delivery”in Controlled Drug Delivery (2ndEd.), Robinson et al. (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); Thorpe, "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review" in Monoclonal Antibodies ‘84: Biological And Clinical Applications, Pinchera et al. (eds.), pp. 475-506 (1985); and Thorpe et al., "The Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates", Immunol. Rev., 62:119- 58 (1982)). As used herein, the term “antibody-drug conjugate” or “ADC” refers to a therapeutic agent conjugated or otherwise covalently bound to to an antibody.
[0119] The term “immune checkpoint receptor protein” is used herein according to its plain ordinary meaning and refers to a protein expressed on the cell-surface of an immune cell (e.g., T lymphocyte). In embodiments, the immune checkpoint receptor protein recognizes complimentary ligands on antigen presenting cells. In embodiments, the immune checkpoint receptor protein is a stimulatory receptor or an inhibitor receptor. In embodiments, the immune checkpoint receptor protein can regulate the type, intensity, and duration of an immune response (e.g. activity of an immune cell).
[0120] For specific proteins described herein, the named protein includes any of the protein’ s naturally occurring forms, variants or homologs that maintain the protein transcription factor activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to the native protein). In some embodiments, variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring form. In other embodiments, the protein is the protein as identified by its NCBI sequence reference. In other embodiments, the protein is the protein as identified by its NCBI sequence reference, homolog or functional fragment thereof.
[0121] The term “PD1” or “programmed cell death protein 1” as used herein refers to any of the recombinant or naturally-occurring forms of programmed cell death protein 1 (PD-1), also known as cluster of differentiation 279 (CD279), or variants or homologs thereof that maintainPD1 activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to PD1). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence e.g., a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring PD1 protein. In embodiments, the PD1 protein is substantially identical to the protein identified by UniProt No. Q15116 or a variant or homolog having substantial identity thereto.
[0122] The term "CTLA-4" as referred to herein includes any of the recombinant or naturally- occurring forms of the cytotoxic T-lymphocyte-associated protein 4 protein, also known as CD152 (cluster of differentiation 152), or variants or homologs thereof that maintain CTLA-4 activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to CTLA-4). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring CTLA-4 protein. In embodiments, the CTLA-4 protein is substantially identical to the protein identified by the UniProt reference number Pl 6410 or a variant or homolog having substantial identity thereto.
[0123] The term "CD28" as referred to herein includes any of the recombinant or naturally- occurring forms of the Cluster of Differentiation 28 protein, or variants or homologs thereof that maintain CD28 activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to CD28). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring CD28 protein. In embodiments, the CD28 protein is substantially identical to the protein identified by the UniProt reference number P 10747 or a variant or homolog having substantial identity thereto.
[0124] The term "ITGB6" as referred to herein includes any of the recombinant or naturally- occurring forms of the integrin subunit beta 6, or variants or homologs thereof that maintain ITGB6 activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to ITGB6). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring ITGB6 protein. In embodiments, the ITGB6 protein is substantiallyidentical to the protein identified by the UniProt reference number Pl 8564 or a variant or homolog having substantial identity thereto.
[0125] The term “T cell receptor protein” or “TCR protein” is used herein according to its plain ordinary meaning and refers to a protein expressed on the surface of a T cell that is responsible for antigen recognition. In embodiments, the TCR protein binds an antigen peptide bound to a major histocompatibility complex. In embodiments, the TCR protein is an alpha (a) chain, a beta (P) chain, a gamma (y) chain, or a delta (5) chain. In embodiments, the TCR protein is an alpha (a) chain. In embodiments, the TCR protein is a beta (P) chain. In embodiments, the TCR protein is a gamma (y) chain. In embodiments, the TCR protein is a delta (5) chain. In embodiments, the binding of an antigen peptide to the TCR protein results in the activation of the T cell.
[0126] The term “LAG3” or “lymphocyte-activation gene 3” as used herein refers to any of the recombinant or naturally-occurring forms of the lymphocyte-activation gene 3 protein, also known as lymphocyte activating 3 or LAG-3, or variants or homologs thereof that maintain LAG3 activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to LAG3). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring LAG3 protein. In embodiments, the LAG3 protein is substantially identical to the protein identified by UniProt No. Pl 8627 or a variant or homolog having substantial identity thereto.
[0127] The term “CD226” or “cluster of differentiation 226” as used herein refers to any of the recombinant or naturally-occurring forms of the cluster of differentiation 226 protein, also known as DNAX accessory molecule- 1 (DNAM-1), or variants or homologs thereof that maintain CD226 activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to CD226). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring CD226 protein. In embodiments, the CD226 protein is substantially identical to the protein identified by UniProt No. QI 5762 or a variant or homolog having substantial identity thereto.
[0128] The term “TIGIT" or “T cell immunoreceptor with Ig and ITIM domains” as used herein refers to any of the recombinant or naturally-occurring forms of the TIGIT protein, also known as WUCAM or Vstm3, or variants or homologs thereof that maintain TIGIT activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to TIGIT). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring TIGIT protein. In embodiments, the TIGIT protein is substantially identical to the protein identified by UniProt No. Q495A1 or a variant or homolog having substantial identity thereto.
[0129] The term “CD96” or “cluster of differentiation 96” as used herein refers to any of the recombinant or naturally-occurring forms of the cluster of differentiation 96 protein, also known as T cell activation, increased late expression (Tactile) protein, or variants or homologs thereof that maintain CD96 activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to CD96). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring CD96 protein. In embodiments, the CD96 protein is substantially identical to the protein identified by UniProt No. P40200 or a variant or homolog having substantial identity thereto. In embodiments, the CD96 protein is substantially identical to the protein identified by UniProt No. Q8WUE2 or a variant or homolog having substantial identity thereto.
[0130] The term “BTLA” or “B- and T-lymphocyte attenuator” as used herein refers to any of the recombinant or naturally-occurring forms of the B- and T-lymphocyte attenuator protein, also known as cluster of differentiation 272 (CD272), or variants or homologs thereof that maintain BTLA activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to BTLA). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring BTLA protein. In embodiments, the BTLA protein is substantially identical to the protein identified by UniProt No. Q7Z6A9 or a variant or homolog having substantial identity thereto.
[0131] The term “B7-H3” or “B7 Homolog 3” as used herein refers to any of the recombinant or naturally-occurring forms of the B7 Homolog 3 protein, also known as cluster of differentiation 276 (CD276), or variants or homologs thereof that maintain B7-H3 activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to B7- H3). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring B7-H3 protein. In embodiments, the B7-H3 protein is substantially identical to the protein identified by UniProt No. Q5ZPR3 or a variant or homolog having substantial identity thereto.
[0132] The term “VISTA” or “V-domain Ig suppressor of T cell activation” as used herein refers to any of the recombinant or naturally-occurring forms of the V-domain Ig suppressor of T cell activation protein, or variants or homologs thereof that maintain VISTA activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to VISTA). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence e.g., a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring VISTA protein. In embodiments, the VISTA protein is substantially identical to the protein identified by UniProt No. Q9H7M9 or a variant or homolog having substantial identity thereto.
[0133] The term “TIM-3” or “T-cell immunoglobulin and mucin-domain containing-3” as used herein refers to any of the recombinant or naturally-occurring forms of the T-cell immunoglobulin and mucin-domain containing-3 protein, also known as hepatitis A virus cellular receptor 2 (HAVCR2), or variants or homologs thereof that maintain TIM-3 activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to TIM-3). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring TIM-3 protein. In embodiments, the TIM-3 protein is substantially identical to the protein identified by UniProt No. Q8TDQ0 or a variant or homolog having substantial identity thereto.
[0134] The term “ICOS” or “inducible T-cell costimulator” as used herein refers to any of the recombinant or naturally-occurring forms of the inducible T-cell costimulatory protein, also known as cluster of differentiation 278 (CD278), or variants or homologs thereof that maintainICOS activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to ICOS). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, or 150 continuous amino acid portion) compared to a naturally occurring ICOS protein. In embodiments, the ICOS protein is substantially identical to the protein identified by UniProt No. Q9Y6W8 or a variant or homolog having substantial identity thereto.
[0135] The term “GARP” or “golgi associated retrograde protein” as used herein refers to any of the recombinant or naturally-occurring forms of the golgi associated retrograde protein complex, or variants or homologs thereof that maintain GARP activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to GARP). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150, or 200 continuous amino acid portion) compared to a naturally occurring GARP complex. In embodiments, the GARP complex is a heteromeric protein complex. In embodiments, the GARP complex is a heteromeric protein complex including vacuolar protein sorting-assocatied proteins (Vps). In embodiments, the vacuolar protein sorting-assocatied proteins (Vps) include a VPS51 protein, a VPS52 protein, a VPS53 protein, and a VPS54 protein.
[0136] The term “VPS51” or “vacuolar protein sorting-assocatied protein 51” as used herein refers to any of the recombinant or naturally-occurring forms of the vacuolar protein sorting- assocatied protein 51 homolog, or variants or homologs thereof that maintain VPS51 activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to VPS51). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150, or 200 continuous amino acid portion) compared to a naturally occurring VPS51 protein. In embodiments, the VPS51 protein is substantially identical to the protein identified by UniProt No. Q9UID3 or a variant or homolog having substantial identity thereto.
[0137] The term “VPS52” or “vacuolar protein sorting-assocatied protein 52” as used herein refers to any of the recombinant or naturally-occurring forms of the vacuolar protein sorting- assocatied protein 52 homolog, or variants or homologs thereof that maintain VPS52 activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared toVPS52). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence {e.g., a 50, 100, 150, or 200 continuous amino acid portion) compared to a naturally occurring VPS52 protein. In embodiments, the VPS52 protein is substantially identical to the protein identified by UniProt No. Q8N1B4 or a variant or homolog having substantial identity thereto.
[0138] The term “VPS53” or “vacuolar protein sorting-assocatied protein 53” as used herein refers to any of the recombinant or naturally-occurring forms of the vacuolar protein sorting- assocatied protein 53 homolog, or variants or homologs thereof that maintain VPS53 activity {e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to VPS53). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence e.g., a 50, 100, 150, or 200 continuous amino acid portion) compared to a naturally occurring VPS53 protein. In embodiments, the VPS53 protein is substantially identical to the protein identified by UniProt No. Q5VIR6 or a variant or homolog having substantial identity thereto.
[0139] The term “VPS54” or “vacuolar protein sorting-assocatied protein 54” as used herein refers to any of the recombinant or naturally-occurring forms of the vacuolar protein sorting- assocatied protein 54, or variants or homologs thereof that maintain VPS54 activity {e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to VPS54). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence {e.g., a 50, 100, 150, or 200 continuous amino acid portion) compared to a naturally occurring VPS54 protein. In embodiments, the VPS 54 protein is substantially identical to the protein identified by UniProt No. Q9P1Q00 or a variant or homolog having substantial identity thereto.
[0140] The term “NRROS” or “negative regulator of reactive oxygen species” as used herein refers to any of the recombinant or naturally-occurring forms of the negative regulator of reactive oxygen species, also known as leucine-rich repeat-containing protein 33 (LRC33), or variants or homologs thereof that maintain NRROS activity {e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to NRROS). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence {e.g., a 50, 100, 150, or 200 continuousamino acid portion) compared to a naturally occurring NRROS protein. In embodiments, the NRROS protein is substantially identical to the protein identified by UniProt No. Q9P1Q0 or a variant or homolog having substantial identity thereto.
[0141] The term “0X40” as used herein refers to any of the recombinant or naturally-occurring forms of the 0X40 protein, also known as cluster of differentiation 134 (CD134) or tumor necrosis factor receptor superfamily, member 4 (TNFRSF4), or variants or homologs thereof that maintain 0X40 activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to 0X40). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence e.g., a 50, 100, 150, or 200 continuous amino acid portion) compared to a naturally occurring 0X40 protein. In embodiments, the 0X40 protein is substantially identical to the protein identified by UniProt No. P43489 or a variant or homolog having substantial identity thereto.
[0142] The term “ICAM” or “ICAM-1” as used herein refers to any of the recombinant or naturally -occurring forms of the intercellular adhesion molecule 1 (ICAM-1) protein, also known as cluster of differentiation 54 (CD54), or variants or homologs thereof that maintain ICAM activity e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to ICAM). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150, or 200 continuous amino acid portion) compared to a naturally occurring ICAM protein. In embodiments, the ICAM protein is substantially identical to the protein identified by UniProt No. P05362 or a variant or homolog having substantial identity thereto.
[0143] The term “PDL-1” or “PD-L1” as used herein refers to any of the recombinant or naturally-occurring forms of the programmed death-ligand 1 protein, also known as cluster of differentiation 274 (CD274) or B7 homolog 1 (B7-H1), or variants or homologs thereof that maintain PDL-1 activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to PDL-1). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150, or 200 continuous amino acid portion) compared to a naturally occurring PDL-1 protein. In embodiments, the PDL-1 protein is substantiallyidentical to the protein identified by UniProt No. Q9NZQ7 or a variant or homolog having substantial identity thereto.
[0144] The term “CD80” or “cluster of differentiation 80” as used herein refers to any of the recombinant or naturally-occurring forms of the cluster of differentiation 80 protein, also known as B7, type I (B7-1) membrane protein, or variants or homologs thereof that maintain CD80 activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to CD80). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence e.g., a 50, 100, 150, or 200 continuous amino acid portion) compared to a naturally occurring CD80 protein. In embodiments, the CD80 protein is substantially identical to the protein identified by UniProt No. P33681 or a variant or homolog having substantial identity thereto.
[0145] The term “CD86” or “cluster of differentiation 86” as used herein refers to any of the recombinant or naturally-occurring forms of the cluster of differentiation 86 protein, also known as B7-2, or variants or homologs thereof that maintain CD86 activity e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to CD86). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150, or 200 continuous amino acid portion) compared to a naturally occurring CD86 protein. In embodiments, the CD86 protein is substantially identical to the protein identified by UniProt No. P42081 or a variant or homolog having substantial identity thereto.
[0146] The term “MHC-II protein” or “major histocompatibility complex class II protein” is used herein according to its plain ordinary meaning and refers to a protein expressed on the surface of an antigen-presenting cell (APC). In embodiments, the MHC-II protein is loaded with a peptide fragment of an antigen. In embodiments, the MHC-II protein is encoded by a human leukocyte antigen gene complex (HLA). In embodiments, the MHC-II protein is an HLA-DP protein, an HLA-DM protein, a HLA-DOA protein, a HLA-DOB protein, a HLA-DQ protein, or a HLA-DR protein. In embodiments, the MHC-II protein is an HLA-DP protein. In embodiments, the MHC-II protein is an HLA-DM protein. In embodiments, the MHC-II protein is an HLA-DOA protein. In embodiments, the MHC-II protein is an HLA-DOB protein. In embodiments, the MHC-II protein is an HLA-DQ protein. In embodiments, the MHC-II protein is an HLA-DR protein.
[0147] The term “Galectin-3” or “Gal-3’" as used herein refers to any of the recombinant or naturally-occurring forms of the Galectin-3 protein, or variants or homologs thereof that maintain Gal-3 activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to Gal-3). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150, or 200 continuous amino acid portion) compared to a naturally occurring Gal-3 protein. In embodiments, the Gal-3 protein is substantially identical to the protein identified by UniProt No. P17931 or a variant or homolog having substantial identity thereto.
[0148] The term “FGL1” or “FGL-1” as used herein refers to any of the recombinant or naturally-occurring forms of the fibrinogen- like protein 1 protein, or variants or homologs thereof that maintain FGL1 activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to FGL1). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150, or 200 continuous amino acid portion) compared to a naturally occurring FGL1 protein. In embodiments, the FGL1 protein is substantially identical to the protein identified by UniProt No. Q08830 or a variant or homolog having substantial identity thereto.
[0149] The term “CD112” or “cluster of differentiation 112” as used herein refers to any of the recombinant or naturally-occurring forms of the cluster of differentiation 112 protein, also known as poliovirus receptor-related 2 (PVRL2) or nectin cell adhesion molecule 2 (NECTIN 2), or variants or homologs thereof that maintain CD112 activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to CD112). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150, or 200 continuous amino acid portion) compared to a naturally occurring CD112 protein. In embodiments, the CD112 protein is substantially identical to the protein identified by UniProt No. Q92692 or a variant or homolog having substantial identity thereto.
[0150] The term “CD155” or “cluster of differentiation 155” as used herein refers to any of the recombinant or naturally-occurring forms of the cluster of differentiation 155 protein, also known as poliovirus receptor (PVR), or variants or homologs thereof that maintain CD155 activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activitycompared to CD155). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150, or 200 continuous amino acid portion) compared to a naturally occurring CD155 protein. In embodiments, the CD155 protein is substantially identical to the protein identified by UniProt No. P15151 or a variant or homolog having substantial identity thereto.
[0151] The terms "HVEM protein" and "HVEM" as used herein include any of the recombinant or naturally-occurring forms of the herpesvirus entry mediator, also known as tumor necrosis factor receptor superfamily member 14 (TNFRSF14), or variants or homologs thereof that maintain HVEM activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to HVEM). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring HVEM protein. In embodiments, the HVEM protein is substantially identical to the protein identified by the UniProt reference number Q92956 or a variant or homolog having substantial identity thereto.
[0152] The term “NECTIN 4” as used herein refers to any of the recombinant or naturally- occurring forms of the nectin cell adhesion molecule 2 protein, also known as poliovirus receptor -related 4 (PVRL4), or variants or homologs thereof that maintain NECTIN 4 activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to NECTIN 4). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150, or 200 continuous amino acid portion) compared to a naturally occurring NECTIN 4 protein. In embodiments, the NECTIN 4 protein is substantially identical to the protein identified by UniProt No. Q96NY8 or a variant or homolog having substantial identity thereto.
[0153] The term “Ceacam 1” as used herein refers to any of the recombinant or naturally- occurring forms of the carcinoembryonic antigen-related cell adhesion molecule Iprotein, also known as cluster of differentiation 66a (CD66a), or variants or homologs thereof that maintain Ceacam 1 activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to Ceacam 1). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence ora portion of the sequence (e.g., a 50, 100, 150, or 200 continuous amino acid portion) compared to a naturally occurring Ceacam 1 protein. In embodiments, the Ceacam 1 protein is substantially identical to the protein identified by UniProt No. Q3KRG8 or a variant or homolog having substantial identity thereto.
[0154] The term "gene" means the segment of DNA involved in producing a protein; it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons). The leader, the trailer as well as the introns include regulatory elements that are necessary during the transcription and the translation of a gene. Further, a "protein gene product" is a protein expressed from a particular gene.
[0155] The terms "plasmid", "vector" or "expression vector" refer to a nucleic acid molecule that encodes for genes and / or regulatory elements necessary for the expression of genes. Expression of a gene from a plasmid can occur in cis or in trans. If a gene is expressed in cis, the gene and the regulatory elements are encoded by the same plasmid. Expression in trans refers to the instance where the gene and the regulatory elements are encoded by separate plasmids.
[0156] The terms "transfection", "transduction", "transfecting" or "transducing" can be used interchangeably and are defined as a process of introducing a nucleic acid molecule or a protein to a cell. Nucleic acids are introduced to a cell using non- viral or viral-based methods. The nucleic acid molecules may be gene sequences encoding complete proteins or functional portions thereof. Non- viral methods of transfection include any appropriate transfection method that does not use viral DNA or viral particles as a delivery system to introduce the nucleic acid molecule into the cell. Exemplary non- viral transfection methods include calcium phosphate transfection, liposomal transfection, nucleofection, sonoporation, transfection through heat shock, magnetifection and electroporation. In some embodiments, the nucleic acid molecules are introduced into a cell using electroporation following standard procedures well known in the art. For viral-based methods of transfection any useful viral vector may be used in the methods described herein. Examples for viral vectors include, but are not limited to retroviral, adenoviral, lentiviral and adeno-associated viral vectors. In some embodiments, the nucleic acid molecules are introduced into a cell using a retroviral vector following standard procedures well known in the art. The terms "transfection" or "transduction" also refer to introducing proteins into a cell from the external environment. Typically, transduction or transfection of a protein relies on attachment of a peptide or protein capable of crossing the cell membrane to the protein ofinterest. See, e.g., Ford et al. (2001) Gene Therapy 8: 1-4 and Prochiantz (2007) Nat. Methods 4:119-20.
[0157] A "label" or a "detectable moiety" is a composition detectable by spectroscopic, photochemical, biochemical, immunochemical, chemical, or other physical means. For example, useful labels include 32P, fluorescent dyes, electron-dense reagents, enzymes (e.g., as commonly used in an ELISA), biotin, digoxigenin, or haptens and proteins or other entities which can be made detectable, e.g., by incorporating a radiolabel into a peptide or antibody specifically reactive with a target peptide. Any appropriate method known in the art for conjugating an antibody to the label may be employed, e.g., using methods described in Hermanson, Bioconjugate Techniques 1996, Academic Press, Inc., San Diego.
[0158] When the label or detectable moiety is a radioactive metal or paramagnetic ion, the agent may be reacted with another long-tailed reagent having a long tail with one or more chelating groups attached to the long tail for binding to these ions. The long tail may be a polymer such as a polylysine, polysaccharide, or other derivatized or derivatizable chain having pendant groups to which the metals or ions may be added for binding. Examples of chelating groups that may be used according to the disclosure include, but are not limited to, ethylenediaminetetraacetic acid (EDTA), diethylenetriaminepentaacetic acid (DTPA), DOTA, NOTA, NETA, TETA, porphyrins, polyamines, crown ethers, bis-thiosemicarbazones, polyoximes, and like groups. The chelate is normally linked to the PSMA antibody or functional antibody fragment by a group, which enables the formation of a bond to the molecule with minimal loss of immunoreactivity and minimal aggregation and / or internal cross-linking. The same chelates, when complexed with non-radioactive metals, such as manganese, iron and gadolinium are useful for MRI, when used along with the antibodies and carriers described herein. Macrocyclic chelates such as NOTA, DOTA, and TETA are of use with a variety of metals and radiometals including, but not limited to, radionuclides of gallium, yttrium and copper, respectively. Other ring-type chelates such as macrocyclic polyethers, which are of interest for stably binding nuclides, such as223Ra for RAIT may be used. In certain embodiments, chelating moieties may be used to attach a PET imaging agent, such as an A1-18F complex, to a targeting molecule for use in PET analysis.
[0159] Antibodies are large, complex molecules (molecular weight of -150,000 or about 1320 amino acids) with intricate internal structure. A natural antibody molecule contains two identical pairs of polypeptide chains, each pair having one light chain and one heavy chain. Each lightchain and heavy chain in turn consists of two regions: a variable (“V”) region, involved in binding the target antigen, and a constant (“C”) region that interacts with other components of the immune system. The light and heavy chain variable regions (also referred to herein as light chain variable (VL) domain and heavy chain variable (VH) domain, respectively) come together in 3-dimensional space to form a variable region that binds the antigen (for example, a receptor on the surface of a cell). Within each light or heavy chain variable region, there are three short segments (averaging 10 amino acids in length) called the complementarity determining regions (“CDRs”). The six CDRs in an antibody variable domain (three from the light chain and three from the heavy chain) fold up together in 3 -dimensional space to form the actual antibody binding site which docks onto the target antigen. The position and length of the CDRs have been precisely defined by Kabat, E. et al., Sequences of Proteins of Immunological Interest, U.S. Department of Health and Human Services, 1983, 1987. The part of a variable region not contained in the CDRs is called the framework ("FR"), which forms the environment for the CDRs.
[0160] An “antibody variant’’ as provided herein refers to a polypeptide capable of binding to an antigen and including one or more structural domains (e.g., light chain variable domain, heavy chain variable domain) of an antibody or fragment thereof. Non-limiting examples of antibody variants include single-domain antibodies or nanobodies, monospecific Fab2, bispecific Fab2, trispecific Faba, monovalent IgGs, scFv, bispecific antibodies, bispecific diabodies, trispecific triabodies, scFv-Fc, minibodies, IgNAR, V-NAR, hcIgG, VhH, or peptibodies. A “peptibody” as provided herein refers to a peptide moiety attached (through a covalent or non- covalent linker) to the Fc (crystallisable fragment) domain of an antibody. Further non-limiting examples of antibody variants known in the art include antibodies produced by cartilaginous fish or camelids. A general description of antibodies from camelids and the variable regions thereof and methods for their production, isolation, and use may be found in references WO97 / 49805 and WO 97 / 49805 which are incorporated by reference herein in their entirety and for all purposes. Likewise, antibodies from cartilaginous fish and the variable regions thereof and methods for their production, isolation, and use may be found in W02005 / 118629, which is incorporated by reference herein in its entirety and for all purposes.
[0161] The terms "CDR LI", "CDR L2" and "CDR L3" as provided herein refer to the complementarity determining regions (CDR) 1 , 2, and 3 of the variable light (L) chain of an antibody. In embodiments, the variable light chain provided herein includes in N-terminal to C-terminal direction a CDR LI, a CDR L2 and a CDR L3. Likewise, the terms "CDR Hl", "CDR H2" and "CDR H3" as provided herein refer to the complementarity determining regions (CDR) 1, 2, and 3 of the variable heavy (H) chain of an antibody. In embodiments, the variable heavy chain provided herein includes in N-terminal to C-terminal direction a CDR Hl, a CDR H2 and a CDR H3.
[0162] The terms "FR LI ", "FR L2", "FR L3" and "FR L4" as provided herein are used according to their common meaning in the art and refer to the framework regions (FR) 1, 2, 3 and 4 of the variable light (L) chain of an antibody. In embodiments, the variable light chain provided herein includes in N-terminal to C-terminal direction a FR LI, a FR L2, a FR L3 and a FR L4. Likewise, the terms "FR Hl", "FR H2", "FR H3" and "FR H4" as provided herein are used according to their common meaning in the art and refer to the framework regions (FR) 1, 2, 3 and 4 of the variable heavy (H) chain of an antibody. In embodiments, the variable heavy chain provided herein includes in N-terminal to C-terminal direction a FR Hl, a FR H2, a FR H3 and a FR H4.
[0163] An exemplary immunoglobulin (antibody) structural unit comprises a tetramer. Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one “light” (about 25 kD) and one “heavy” chain (about 50-70 kD). The N-terminus of each chain defines a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition. The terms variable light chain (VL), variable light chain (VL) domain or light chain variable region and variable heavy chain (VH), variable heavy chain (VH) domain or heavy chain variable region refer to these light and heavy chain regions, respectively. The terms variable light chain (VL), variable light chain (VL) domain and light chain variable region as referred to herein may be used interchangeably. The terms variable heavy chain (VH), variable heavy chain (VH) domain and heavy chain variable region as referred to herein may be used interchangeably. The Fc (i.e. fragment crystallizable region) is the "base" or "tail" of an immunoglobulin and is typically composed of two heavy chains that contribute two or three constant domains depending on the class of the antibody. By binding to specific proteins, the Fc region ensures that each antibody generates an appropriate immune response for a given antigen. The Fc region also binds to various cell receptors, such as Fc receptors, and other immune molecules, such as complement proteins.
[0164] The terms “KD”, “Kd”, “KD” or “Kd” are used according to its commonly known meaning in the art. A dissociation constant is a specific type of equilibrium constant thatmeasures the propensity of a larger object to separate (dissociate) reversibly into smaller components, as when a complex falls apart into its component molecules, or when a salt splits up into its component ions. The dissociation constant is the inverse of the association constant. KD is the equilibrium dissociation constant, a ratio of koff / kon, between the antibody and its antigen. KD and affinity are inversely related. The KD value relates to the concentration of antibody (the amount of antibody needed for a particular experiment) and so the lower the KD value (lower concentration) and thus the higher the affinity of the antibody.
[0165] The term "antibody" is used according to its commonly known meaning in the art. Antibodies exist, e.g., as intact immunoglobulins or as a number of well- characterized fragments produced by digestion with various peptidases. Thus, for example, pepsin digests an antibody below the disulfide linkages in the hinge region to produce F(ab)'2, a dimer of Fab which itself is a light chain joined to VH-CHI by a disulfide bond. The F(ab)'2 may be reduced under mild conditions to break the disulfide linkage in the hinge region, thereby converting the F(ab)'2 dimer into an Fab’ monomer. The Fab' monomer is essentially Fab with part of the hinge region (see Fundamental Immunology (Paul ed., 3d ed. 1993). While various antibody fragments are defined in terms of the digestion of an intact antibody, one of skill will appreciate that such fragments may be synthesized de novo either chemically or by using recombinant DNA methodology. Thus, the term antibody, as used herein, also includes antibody fragments either produced by the modification of whole antibodies, or those synthesized de novo using recombinant DNA methodologies (e.g., single chain Fv) or those identified using phage display libraries (see, e.g., McCafferty et al., Nature 348:552-554 (1990)). The term “antibody” as referred to herein further includes antibody variants such as single domain antibodies. Thus, in embodiments an antibody includes a single monomeric variable antibody domain. Thus, in embodiments, the antibody, includes a variable light chain (VL) domain or a variable heavy chain (VH) domain. In embodiments, the antibody is a variable light chain (VL) domain or a variable heavy chain (VH) domain. The recognized immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon, and mu constant region genes, as well as the myriad immunoglobulin variable region genes. Light chains are classified as either kappa or lambda. Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, which in turn define the immunoglobulin classes, IgG, IgM, IgA, IgD and IgE, respectively.
[0166] For preparation of monoclonal or polyclonal antibodies, any technique known in the art can be used (see, e.g., Kohler & Milstein, Nature 256:495-497 (1975); Kozbor et al. ,Immunology Today 4:72 (1983); Cole et al., pp. 77-96 in Monoclonal Antibodies and Cancer Therapy (1985)). "Monoclonal" antibodies (mAb) refer to antibodies derived from a single clone. Techniques for the production of single chain antibodies (U.S. Pat. No. 4,946,778) can be adapted to produce antibodies to polypeptides of this invention. Also, transgenic mice, or other organisms such as other mammals, may be used to express humanized antibodies. Alternatively, phage display technology can be used to identify antibodies and heteromeric Fab fragments that specifically bind to selected antigens (see, e.g., McCafferty et al., Nature 348:552-554 (1990); Marks et al., Biotechnology 10:779-783 (1992)).
[0167] The epitope of a mAh is the region of its antigen to which the mAb binds. Two antibodies bind to the same or overlapping epitope if each competitively inhibits (blocks) binding of the other to the antigen. That is, a lx, 5x, lOx, 20x or lOOx excess of one antibody inhibits binding of the other by at least 30% but preferably 50%, 75%, 90% or even 99% as measured in a competitive binding assay (see, e.g., Junghans et cd., Cancer Res. 50:1495, 1990). Alternatively, two antibodies have the same epitope if essentially all amino acid mutations in the antigen that reduce or eliminate binding of one antibody reduce or eliminate binding of the other. Two antibodies have overlapping epitopes if some amino acid mutations that reduce or eliminate binding of one antibody reduce or eliminate binding of the other.
[0168] A single-chain variable fragment (scFv) is typically a fusion protein of the variable regions of the heavy (VH) and light chains (VL) of immunoglobulins, connected with a short linker peptide of 10 to about 25 amino acids. The linker may usually be rich in glycine for flexibility, as well as serine or threonine for solubility. The linker can either connect the N- terminus of the VH with the C-terminus of the VL, or vice versa.
[0169] For preparation of suitable antibodies of the invention and for use according to the invention, e.g., recombinant, monoclonal, or polyclonal antibodies, many techniques known in the art can be used (see, e.g., Kohler & Milstein, Nature 256:495-497 (1975); Kozbor et al., Immunology Today 4: 72 (1983); Cole et al., pp. 77-96 in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc. (1985); Coligan, Current Protocols in Immunology (1991); Harlow & Lane, Antibodies, A Laboratory Manual (1988); and Coding, Monoclonal Antibodies: Principles and Practice (2d ed. 1986)). The genes encoding the heavy and light chains of an antibody of interest can be cloned from a cell, e.g., the genes encoding a monoclonal antibody can be cloned from a hybridoma and used to produce a recombinant monoclonal antibody. Gene libraries encoding heavy and light chains of monoclonal antibodies can also be made fromhybridoma or plasma cells. Random combinations of the heavy and light chain gene products generate a large pool of antibodies with different antigenic specificity (see, e.g., Kuby, Immunology (3rd ed. 1997)). Techniques for the production of single chain antibodies or recombinant antibodies (U.S. Patent 4,946,778, U.S. Patent No. 4,816,567) can be adapted to produce antibodies to polypeptides of this invention. Also, transgenic mice, or other organisms such as other mammals, may be used to express humanized or human antibodies (see, e.g., U.S. Patent Nos. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016, Marks et al., Bio / Technology 10:779-783 (1992); Lonberg et al., Nature 368:856-859 (1994); Morrison, Nature 368:812-13 (1994); Fishwild et al., Nature Biotechnology 14:845-51 (1996); Neuberger, Nature Biotechnology 14:826 (1996); and Lonberg & Huszar, Intern. Rev. Immunol. 13:65-93 (1995)). Alternatively, phage display technology can be used to identify antibodies and heteromeric Fab fragments that specifically bind to selected antigens (see, e.g., McCafferty et al., Nature 348:552-554 (1990); Marks et al., Biotechnology 10:779-783 (1992)). Antibodies can also be made bispecific, i.e., able to recognize two different antigens (see, e.g., WO 93 / 08829, Traunecker et al., EMBO J. 10:3655-3659 (1991); and Suresh et al., Methods in Enzymology 121 :210 (1986)). Antibodies can also be heteroconjugates, e.g., two covalently joined antibodies, or immunotoxins (see, e.g., U.S. Patent No. 4,676,980 , WO 91 / 00360; WO 92 / 200373; and EP 03089).
[0170] Methods for humanizing or primatizing non-human antibodies are well known in the art e.g., U.S. Patent Nos. 4,816,567; 5,530,101 ; 5,859,205; 5,585,089; 5,693,761 ; 5,693,762; 5,777,085; 6,180,370; 6,210,671 ; and 6,329,511; WO 87 / 02671 ; EP Patent Application 0173494; Jones et al. (1986) Nature 321:522; and Verhoyen et al. (1988) Science 239: 1534). Humanized antibodies are further described in, e.g., Winter and Milstein (1991) Nature 349:293. Generally, a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. These non-human amino acid residues are often referred to as import residues, which are typically taken from an import variable domain. Humanization can be essentially performed following the method of Winter and co-workers (see, e.g., Morrison et al., PNAS USA, 81 :6851-6855 (1984), Jones et al., Nature 321:522-525 (1986); Riechmann et al., Nature 332:323-327 (1988); Morrison and Oi, Adv. Immunol., 44:65-92 (1988), Verhoeyen et al., Science 239:1534-1536 (1988) and Presta, Curr. Op. Struct. Biol. 2:593-596 (1992), Padlan, Molec. Immun., 28:489-498 (1991); Padlan, Molec. Immun., 31 (3): 169-217 (1994)), by substituting rodent CDRs or CDR sequences for the corresponding sequences of a humanantibody. Accordingly, such humanized antibodies are chimeric antibodies (U.S. Patent No. 4,816,567), wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies. For example, polynucleotides comprising a first sequence coding for humanized immunoglobulin framework regions and a second sequence set coding for the desired immunoglobulin complementarity determining regions can be produced synthetically or by combining appropriate cDNA and genomic DNA segments. Human constant region DNA sequences can be isolated in accordance with well known procedures from a variety of human cells.
[0171] A "chimeric antibody" is an antibody molecule in which (a) the constant region, or a portion thereof, is altered, replaced or exchanged so that the antigen binding site (variable region) is linked to a constant region of a different or altered class, effector function and / or species, or an entirely different molecule which confers new properties to the chimeric antibody, e.g., an enzyme, toxin, hormone, growth factor, drug, etc.; or (b) the variable region, or a portion thereof, is altered, replaced or exchanged with a variable region having a different or altered antigen specificity. The preferred antibodies of, and for use according to the invention include humanized and / or chimeric monoclonal antibodies.
[0172] "Contacting" is used in accordance with its plain ordinary meaning and refers to the process of allowing at least two distinct species (e.g. antibodies and antigens) to become sufficiently proximal to react, interact, or physically touch. It should be appreciated, however, that the resulting reaction product can be produced directly from a reaction between the added reagents or from an intermediate from one or more of the added reagents which can be produced in the reaction mixture.
[0173] The term "contacting" may include allowing two species to react, interact, or physically touch, wherein the two species may be, for example, a pharmaceutical composition as provided herein and a cell. In embodiments contacting includes, for example, allowing a pharmaceutical composition as described herein to interact with a cell.
[0174] A "cell" as used herein, refers to a cell carrying out metabolic or other function sufficient to preserve or replicate its genomic DNA. A cell can be identified by well-known methods in the art including, for example, presence of an intact membrane, staining by aparticular dye, ability to produce progeny or, in the case of a gamete, ability to combine with a second gamete to produce a viable offspring. Cells may include prokaryotic and eukaryotic cells. Prokaryotic cells include but are not limited to bacteria. Eukaryotic cells include, but are not limited to, yeast cells and cells derived from plants and animals, for example mammalian, insect (e.g., spodoptera) and human cells.
[0175] The term "recombinant" when used with reference, e.g., to a cell, nucleic acid, protein, or vector, indicates that the cell, nucleic acid, protein or vector, has been modified by the introduction of a heterologous nucleic acid or protein or the alteration of a native nucleic acid or protein, or that the cell is derived from a cell so modified. Thus, for example, recombinant cells express genes that are not found within the native (non-recombinant) form of the cell or express native genes that are otherwise abnormally expressed, under expressed or not expressed at all. Transgenic cells and plants are those that express a heterologous gene or coding sequence, typically as a result of recombinant methods.
[0176] The term "isolated", when applied to a nucleic acid or protein, denotes that the nucleic acid or protein is essentially free of other cellular components with which it is associated in the natural state. It can be, for example, in a homogeneous state and may be in either a dry or aqueous solution. Purity and homogeneity are typically determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis or high performance liquid chromatography. A protein that is the predominant species present in a preparation is substantially purified.
[0177] The term "heterologous" when used with reference to portions of a nucleic acid indicates that the nucleic acid comprises two or more subsequences that are not found in the same relationship to each other in nature. For instance, the nucleic acid is typically recombinantly produced, having two or more sequences from unrelated genes arranged to make a new functional nucleic acid, e.g., a promoter from one source and a coding region from another source. Similarly, a heterologous protein indicates that the protein comprises two or more subsequences that are not found in the same relationship to each other in nature (e.g., a fusion protein).
[0178] The term "exogenous" refers to a molecule or substance (e.g., a compound, nucleic acid or protein) that originates from outside a given cell or organism. For example, an "exogenous promoter" as referred to herein is a promoter that does not originate from the cell or organism itis expressed by. Conversely, the term "endogenous" or "endogenous promoter" refers to a molecule or substance that is native to, or originates within, a given cell or organism.
[0179] As defined herein, the term "inhibition", "inhibit", "inhibiting" and the like in reference to cell proliferation (e.g., cancer cell proliferation) means negatively affecting (e.g., decreasing proliferation) or killing the cell. In some embodiments, inhibition refers to reduction of a disease or symptoms of disease (e.g., cancer, cancer cell proliferation). Thus, inhibition includes, at least in part, partially or totally blocking stimulation, decreasing, preventing, or delaying activation, or inactivating, desensitizing, or down-regulating signal transduction or enzymatic activity or the amount of a protein (e.g. a cancer-associated protein). Similarly an "inhibitor" is a compound or protein that inhibits a receptor or another protein, e.g.,, by binding, partially or totally blocking, decreasing, preventing, delaying, inactivating, desensitizing, or down-regulating activity (e.g., a receptor activity or a protein activity).
[0180] The term "expression" includes any step involved in the production of the polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post- translational modification, and secretion. Expression can be detected using conventional techniques for detecting protein (e.g., ELISA, Western blotting, flow cytometry, immunofluorescence, immunohistochemistry, etc.).
[0181] “Biological sample” or “sample” refer to materials obtained from or derived from a subject or patient. A biological sample includes sections of tissues such as biopsy and autopsy samples, and frozen sections taken for histological purposes. Such samples include bodily fluids such as blood and blood fractions or products (e.g., serum, plasma, platelets, red blood cells, and the like), sputum, tissue, cultured cells (e.g., primary cultures, explants, and transformed cells) stool, urine, synovial fluid, joint tissue, synovial tissue, synoviocytes, fibroblast-like synoviocytes, macrophage-like synoviocytes, immune cells, hematopoietic cells, fibroblasts, macrophages, T cells, etc. A biological sample is typically obtained from a eukaryotic organism, such as a mammal such as a primate e.g., chimpanzee or human; cow; dog; cat; a rodent, e.g., guinea pig, rat, mouse; rabbit; or a bird; reptile; or fish.
[0182] A “control” or “standard control” refers to a sample, measurement, or value that serves as a reference, usually a known reference, for comparison to a test sample, measurement, or value. For example, a test sample can be taken from a patient suspected of having a given disease (e.g. cancer) and compared to a known normal (non-diseased) individual (e.g. a standard controlsubject). A standard control can also represent an average measurement or value gathered from a population of similar individuals (e.g. standard control subjects) that do not have a given disease (i.e. standard control population), e.g., healthy individuals with a similar medical background, same age, weight, etc. A standard control value can also be obtained from the same individual, e.g. from an earlier-obtained sample from the patient prior to disease onset. For example, a control can be devised to compare therapeutic benefit based on pharmacological data (e.g., halflife) or therapeutic measures (e.g., comparison of side effects). Controls are also valuable for determining the significance of data. For example, if values for a given parameter are widely variant in controls, variation in test samples will not be considered as significant. One of skill will recognize that standard controls can be designed for assessment of any number of parameters (e.g. RNA levels, protein levels, specific cell types, specific bodily fluids, specific tissues, etc).
[0183] One of skill in the art will understand which standard controls are most appropriate in a given situation and be able to analyze data based on comparisons to standard control values. Standard controls are also valuable for determining the significance (e.g. statistical significance) of data. For example, if values for a given parameter are widely variant in standard controls, variation in test samples will not be considered as significant.
[0184] As used herein, the term "cancer" refers to all types of cancer, neoplasm or malignant tumors found in mammals (e.g., humans), including leukemia, lymphoma, carcinomas and sarcomas. Exemplary cancers that may be treated with a compound or method provided herein include cancer of the thyroid, endocrine system, brain, breast, cervix, colon, head and neck, liver, kidney, lung, non-small cell lung, melanoma, mesothelioma, ovary, sarcoma, stomach, uterus medulloblastoma, colorectal cancer, or pancreatic cancer. Additional examples include Hodgkin’s Disease, Non-Hodgkin’s Lymphoma, multiple myeloma, neuroblastoma, glioma, glioblastoma multiforme, ovarian cancer, rhabdomyosarcoma, primary thrombocytosis, primary macroglobulinemia, primary brain tumors, malignant pancreatic insulanoma, malignant carcinoid, urinary bladder cancer, premalignant skin lesions, testicular cancer, lymphomas, thyroid cancer, esophageal cancer, genitourinary tract cancer, malignant hypercalcemia, endometrial cancer, adrenal cortical cancer, neoplasms of the endocrine or exocrine pancreas, medullary thyroid cancer, medullary thyroid carcinoma, melanoma, colorectal cancer, papillary thyroid cancer, hepatocellular carcinoma, or prostate cancer.
[0185] As used herein, the term “lymphoma’- refers to a group of cancers affecting hematopoietic and lymphoid tissues. It begins in lymphocytes, the blood cells that are found primarily in lymph nodes, spleen, thymus, and bone marrow. Two main types of lymphoma are non-Hodgkin lymphoma and Hodgkin’s disease. Hodgkin’s disease represents approximately 15% of all diagnosed lymphomas. This is a cancer associated with Reed-Sternberg malignant B lymphocytes. Non-Hodgkin’ s lymphomas (NHL) can be classified based on the rate at which cancer grows and the type of cells involved. There are aggressive (high grade) and indolent (low grade) types of NHL. Based on the type of cells involved, there are B-cell and T-cell NHLs. Exemplary B-cell lymphomas that may be treated with a compound or method provided herein include, but are not limited to, small lymphocytic lymphoma, Mantle cell lymphoma, follicular lymphoma, marginal zone lymphoma, extranodal (MALT) lymphoma, nodal (monocytoid B- cell) lymphoma, splenic lymphoma, diffuse large cell B-lymphoma, Burkitt’s lymphoma, lymphoblastic lymphoma, immunoblastic large cell lymphoma, or precursor B -lymphoblastic lymphoma. Exemplary T-cell lymphomas that may be treated with a compound or method provided herein include, but are not limited to, cutaneous T-cell lymphoma, peripheral T-cell lymphoma, anaplastic large cell lymphoma, mycosis fungoides, and precursor T-lymphoblastic lymphoma.
[0186] The term "sarcoma" generally refers to a tumor which is made up of a substance like the embryonic connective tissue and is generally composed of closely packed cells embedded in a fibrillar or homogeneous substance. Sarcomas that may be treated with a compound or method provided herein include a chondrosarcoma, fibrosarcoma, lymphosarcoma, melanosarcoma, myxosarcoma, osteosarcoma, Abernethy's sarcoma, adipose sarcoma, liposarcoma, alveolar soft part sarcoma, ameloblastic sarcoma, botryoid sarcoma, chloroma sarcoma, chorio carcinoma, embryonal sarcoma, Wilms' tumor sarcoma, endometrial sarcoma, stromal sarcoma, Ewing's sarcoma, fascial sarcoma, fibroblastic sarcoma, giant cell sarcoma, granulocytic sarcoma, Hodgkin's sarcoma, idiopathic multiple pigmented hemorrhagic sarcoma, immunoblastic sarcoma of B cells, lymphoma, immunoblastic sarcoma of T-cells, Jensen's sarcoma, Kaposi’s sarcoma, Kupffer cell sarcoma, angiosarcoma, leukosarcoma, malignant mesenchymoma sarcoma, parosteal sarcoma, reticulocytic sarcoma, Rous sarcoma, serocystic sarcoma, synovial sarcoma, or telangiectaltic sarcoma.
[0187] The term "melanoma" is taken to mean a tumor arising from the melanocytic system of the skin and other organs. Melanomas that may be treated with a compound or method providedherein include, for example, acral-lentiginous melanoma, amelanotic melanoma, benign juvenile melanoma, Cloudman's melanoma, S91 melanoma, Harding-Passey melanoma juvenile melanoma, lentigo maligna melanoma, malignant melanoma, nodular melanoma, subungal melanoma, or superficial spreading melanoma.
[0188] As used herein, the term “autoimmune disease” refers to a disease or condition in which a subject’s immune system has an aberrant immune response against a substance that does not normally elicit an immune response in a healthy subject. Examples of autoimmune diseases that may be treated with a compound, pharmaceutical composition, or method described herein include Acute Disseminated Encephalomyelitis (ADEM), Acute necrotizing hemorrhagic leukoencephalitis, Addison’s disease, Agammaglobulinemia, Alopecia areata, Amyloidosis, Ankylosing spondylitis, Anti-GBM / Anti-TBM nephritis, Antiphospholipid syndrome (APS), Autoimmune angioedema, Autoimmune aplastic anemia, Autoimmune dysautonomia, Autoimmune hepatitis, Autoimmune hyperlipidemia, Autoimmune immunodeficiency, Autoimmune inner ear disease (AIED), Autoimmune myocarditis, Autoimmune oophoritis, Autoimmune pancreatitis, Autoimmune retinopathy, Autoimmune thrombocytopenic purpura (ATP), Autoimmune thyroid disease, Autoimmune urticaria, Axonal or neuronal neuropathies, Balo disease, Behcet’s disease, Bullous pemphigoid, Cardiomyopathy, Castleman disease, Celiac disease, Chagas disease, Chronic fatigue syndrome, Chronic inflammatory demyelinating polyneuropathy (CIDP), Chronic recurrent multifocal ostomyelitis (CRMO), Churg-Strauss syndrome, Cicatricial pemphigoid / benign mucosal pemphigoid, Crohn’s disease, Cogans syndrome, Cold agglutinin disease, Congenital heart block, Coxsackie myocarditis, CREST disease, Essential mixed cryoglobulinemia, Demyelinating neuropathies, Dermatitis herpetiformis, Dermatomyositis, Devic’s disease (neuromyelitis optica), Discoid lupus, Dressier’s syndrome, Endometriosis, Eosinophilic esophagitis, Eosinophilic fasciitis, Erythema nodosum, Experimental allergic encephalomyelitis, Evans syndrome, Fibromyalgia , Fibrosing alveolitis, Giant cell arteritis (temporal arteritis), Giant cell myocarditis, Glomerulonephritis, Goodpasture’s syndrome, Granulomatosis with Polyangiitis (GPA) (formerly called Wegener’s Granulomatosis), Graves’ disease, Guillain-Barre syndrome, Hashimoto’s encephalitis, Hashimoto’s thyroiditis, Hemolytic anemia, Henoch-Schonlein purpura, Herpes gestationis, Hypogammaglobulinemia, Idiopathic thrombocytopenic purpura (ITP), IgA nephropathy, IgG4- related sclerosing disease, Immunoregulatory lipoproteins, Inclusion body myositis, Interstitial cystitis, Juvenile arthritis, Juvenile diabetes (Type 1 diabetes), Juvenile myositis, Kawasakisyndrome, Lambert-Eaton syndrome, Leukocytoclastic vasculitis, Lichen planus, Lichen sclerosus, Ligneous conjunctivitis, Linear IgA disease (LAD), Lupus (SLE), Lyme disease, chronic, Meniere’s disease, Microscopic polyangiitis, Mixed connective tissue disease (MCTD), Mooren’s ulcer, Mucha-Habermann disease, Multiple sclerosis, Myasthenia gravis, Myositis, Narcolepsy, Neuromyelitis optica (Devic’s), Neutropenia, Ocular cicatricial pemphigoid, Optic neuritis, Palindromic rheumatism, PANDAS (Pediatric Autoimmune Neuropsychiatric Disorders Associated with Streptococcus), Paraneoplastic cerebellar degeneration, Paroxysmal nocturnal hemoglobinuria (PNH), Parry Romberg syndrome, Parsonnage-Tumer syndrome, Pars planitis (peripheral uveitis), Pemphigus, Peripheral neuropathy, Perivenous encephalomyelitis, Pernicious anemia, POEMS syndrome, Polyarteritis nodosa, Type I, II, & III autoimmune polyglandular syndromes, Polymyalgia rheumatica, Polymyositis, Postmyocardial infarction syndrome, Postpericardiotomy syndrome, Progesterone dermatitis, Primary biliary cirrhosis, Primary sclerosing cholangitis, Psoriasis, Psoriatic arthritis, Idiopathic pulmonary fibrosis, Pyoderma gangrenosum, Pure red cell aplasia, Raynauds phenomenon, Reactive Arthritis, Reflex sympathetic dystrophy, Reiter’s syndrome, Relapsing polychondritis, Restless legs syndrome, Retroperitoneal fibrosis, Rheumatic fever, Rheumatoid arthritis, Sarcoidosis, Schmidt syndrome, Scleritis, Scleroderma, Sjogren’s syndrome, Sperm & testicular autoimmunity, Stiff person syndrome, Subacute bacterial endocarditis (SBE), Susac’s syndrome, Sympathetic ophthalmia, Takayasu’s arteritis, Temporal arteritis / Giant cell arteritis, Thrombocytopenic purpura (TTP), Tolosa-Hunt syndrome, Transverse myelitis, Type 1 diabetes, Ulcerative colitis, Undifferentiated connective tissue disease (UCTD), Uveitis, Vasculitis, Vesiculobullous dermatosis, Vitiligo, or Wegener’s granulomatosis (i.e., Granulomatosis with Polyangiitis (GPA).
[0189] As used herein, the term “inflammatory disease” refers to a disease or condition characterized by aberrant inflammation (e.g. an increased level of inflammation compared to a control such as a healthy person not suffering from a disease). Examples of inflammatory diseases include traumatic brain injury, arthritis, rheumatoid arthritis, psoriatic arthritis, juvenile idiopathic arthritis, multiple sclerosis, systemic lupus erythematosus (SLE), myasthenia gravis, juvenile onset diabetes, diabetes mellitus type 1, Guillain-Barre syndrome, Hashimoto’s encephalitis, Hashimoto’s thyroiditis, ankylosing spondylitis, psoriasis, Sjogren’s syndrome, vasculitis, glomerulonephritis, auto-immune thyroiditis, Behcet’s disease, Crohn’s disease, ulcerative colitis, bullous pemphigoid, sarcoidosis, ichthyosis, Graves ophthalmopathy, inflammatory bowel disease, Addison’s disease, Vitiligo, asthma, asthma, allergic asthma, acnevulgaris, celiac disease, chronic prostatitis, inflammatory bowel disease, pelvic inflammatory disease, reperfusion injury, sarcoidosis, transplant rejection, interstitial cystitis, atherosclerosis, and atopic dermatitis.
[0190] The terms “treating”, or “treatment” refers to any indicia of success in the therapy or amelioration of an injury, disease, pathology or condition, including any objective or subjective parameter such as abatement; remission; diminishing of symptoms or making the injury, pathology or condition more tolerable to the patient; slowing in the rate of degeneration or decline; making the final point of degeneration less debilitating; improving a patient’s physical or mental well-being. The treatment or amelioration of symptoms can be based on objective or subjective parameters; including the results of a physical examination, neuropsychiatric exams, and / or a psychiatric evaluation. The term "treating" and conjugations thereof, may include prevention of an injury, pathology, condition, or disease. In embodiments, treating is preventing. In embodiments, treating does not include preventing.
[0191] “Treating” or “treatment” as used herein (and as well-understood in the art) also broadly includes any approach for obtaining beneficial or desired results in a subject’s condition, including clinical results. Beneficial or desired clinical results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, diminishment of the extent of a disease, stabilizing (i.e., not worsening) the state of disease, prevention of a disease’s transmission or spread, delay or slowing of disease progression, amelioration or palliation of the disease state, diminishment of the reoccurrence of disease, and remission, whether partial or total and whether detectable or undetectable. In other words, "treatment" as used herein includes any cure, amelioration, or prevention of a disease. Treatment may prevent the disease from occurring; inhibit the disease’s spread; relieve the disease’s symptoms, fully or partially remove the disease’s underlying cause, shorten a disease’s duration, or do a combination of these things.
[0192] "Treating" and "treatment" as used herein include prophylactic treatment. Treatment methods include administering to a subject a therapeutically effective amount of an active agent. The administering step may consist of a single administration or may include a series of administrations. The length of the treatment period depends on a variety of factors, such as the severity of the condition, the age of the patient, the concentration of active agent, the activity of the compositions used in the treatment, or a combination thereof. It will also be appreciated that the effective dosage of an agent used for the treatment or prophylaxis may increase or decrease over the course of a particular treatment or prophylaxis regime. Changes in dosage may resultand become apparent by standard diagnostic assays known in the art. In some instances, chronic administration may be required. For example, the compositions are administered to the subject in an amount and for a duration sufficient to treat the patient. In embodiments, the treating or treatment is no prophylactic treatment.
[0193] “Patient”, “patient in need thereof’, “subject”, or “subject in need thereof’ refers to a living organism suffering from or prone to a disease or condition that can be treated by administration of a pharmaceutical composition as provided herein. Non-limiting examples include humans, other mammals, bovines, rats, mice, dogs, monkeys, goat, sheep, cows, deer, and other non- mammalian animals. In embodiments, a patient is human. In embodiments, a patient in need thereof is human. In embodiments, a subject is human. In embodiments, a subject in need thereof is human.
[0194] An “effective amount” is an amount sufficient for a compound to accomplish a stated purpose relative to the absence of the compound (e.g. achieve the effect for which it is administered, treat a disease, reduce enzyme activity, increase enzyme activity, reduce a signaling pathway, or reduce one or more symptoms of a disease or condition). An example of an “effective amount” is an amount sufficient to contribute to the treatment, prevention, or reduction of a symptom or symptoms of a disease, which could also be referred to as a “therapeutically effective amount.” A “reduction” of a symptom or symptoms (and grammatical equivalents of this phrase) means decreasing of the severity or frequency of the symptom(s), or elimination of the symptom(s). A “prophylactically effective amount” of a drug is an amount of a drug that, when administered to a subject, will have the intended prophylactic effect, e.g., preventing or delaying the onset (or reoccurrence) of an injury, disease, pathology or condition, or reducing the likelihood of the onset (or reoccurrence) of an injury, disease, pathology, or condition, or their symptoms. The full prophylactic effect does not necessarily occur by administration of one dose, and may occur only after administration of a series of doses. Thus, a prophylactically effective amount may be administered in one or more administrations. An “activity decreasing amount,” as used herein, refers to an amount of antagonist required to decrease the activity of an enzyme relative to the absence of the antagonist. A “function disrupting amount,” as used herein, refers to the amount of antagonist required to disrupt the function of an enzyme or protein relative to the absence of the antagonist. The exact amounts will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques see, e.g., Lieberman, Pharmaceutical Dosage Forms (vols. 1-3, 1992);Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (1999); Pickar, Dosage Calculations (1999); and Remington: The Science and Practice of Pharmacy, 20th Edition, 2003, Gennaro, Ed., Lippincott, Williams & Wilkins).
[0195] For any compound described herein, the therapeutically effective amount can be initially determined from cell culture assays. Target concentrations will be those concentrations of active compound(s) that are capable of achieving the methods described herein, as measured using the methods described herein or known in the art.
[0196] As is well known in the art, therapeutically effective amounts for use in humans can also be determined from animal models. For example, a dose for humans can be formulated to achieve a concentration that has been found to be effective in animals. The dosage in humans can be adjusted by monitoring compounds effectiveness and adjusting the dosage upwards or downwards, as described above. Adjusting the dose to achieve maximal efficacy in humans based on the methods described above and other methods is well within the capabilities of the ordinarily skilled artisan.
[0197] The term “therapeutically effective amount,” as used herein, refers to that amount of the therapeutic agent sufficient to ameliorate the disorder, as described above. For example, for the given parameter, a therapeutically effective amount will show an increase or decrease of at least 5%, 10%, 15%, 20%, 25%, 40%, 50%, 60%, 75%, 80%, 90%, or at least 100%. Therapeutic efficacy can also be expressed as “-fold” increase or decrease. For example, a therapeutically effective amount can have at least a 1.2-fold, 1.5-fold, 2-fold, 5-fold, or more effect over a control.
[0198] Dosages may be varied depending upon the requirements of the patient and the compound being employed. The dose administered to a patient, in the context of the present disclosure, should be sufficient to effect a beneficial therapeutic response in the patient over time. The size of the dose also will be determined by the existence, nature, and extent of any adverse side-effects. Determination of the proper dosage for a particular situation is within the skill of the practitioner. Generally, treatment is initiated with smaller dosages which are less than the optimum dose of the compound. Thereafter, the dosage is increased by small increments until the optimum effect under circumstances is reached. Dosage amounts and intervals can be adjusted individually to provide levels of the administered compound effective for the particularclinical indication being treated. This will provide a therapeutic regimen that is commensurate with the severity of the individual's disease state.
[0199] As used herein, the term "administering" is used in accordance with its plain and ordinary meaning and includes oral administration, administration as a suppository, topical contact, intravenous, parenteral, intraperitoneal, intramuscular, intralesional, intrathecal, intranasal or subcutaneous administration, or the implantation of a slow-release device, e.g., a mini-osmotic pump, to a subject. Administration is by any route, including parenteral and transmucosal (e.g., buccal, sublingual, palatal, gingival, nasal, vaginal, rectal, or transdermal). Parenteral administration includes, e.g., intravenous, intramuscular, intra-arteriole, intradermal, subcutaneous, intraperitoneal, intraventricular, and intracranial. Other modes of delivery include, but are not limited to, the use of liposomal formulations, intravenous infusion, transdermal patches, etc. In embodiments, the administering does not include administration of any active agent other than the recited active agent.
[0200] It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.METHODS
[0201] Provided herein are, inter alia, methods for detecting a protein dynamic -based allosteric mechanism. For example, upon binding to av08, the reduction of local conformational entropy of the L-TGF-P RGD binding region is redistributed to the distal regions of L-TGF- P / GARP, leading to increased flexibility and exposure of mature TGF-p to TGF-[3Rs. Thus, in an aspect is provided a method detecting entropy redistribution in a protein complex, the method including: (i) binding a first protein to a second protein thereby forming a protein complex; (ii) measuring a first entropy distribution in the first protein bound to the second protein; (iii) measuring a second entropy distribution in the second protein bound to the first protein; and (iv) producing a modified protein include the first entropy distribution of the first protein in an energetically stabilized state. As provided herein the term “energetically stabilized state” refers to a state in which a molecule (e.g., protein) has an energetically favorable conformation which may be characterized as a state of lower entropy. In embodiments, the energetically favorableconformation has lower entropy. In embodiments, the energetically stabilized state is a result of entropy redistribution within the molecule.
[0202] In another aspect is provided a method of detecting entropy redistribution in a protein complex, the method including: (i) binding a first protein to a second protein thereby forming a protein complex; (ii) measuring a first entropy distribution in the first protein bound to the second protein; (iii) measuring a second entropy distribution in the second protein bound to the first protein; and (iv) producing a modified protein including the second entropy distribution of the second protein in an energetically stabilized state.
[0203] In another aspect is provided a method of detecting entropy redistribution in a protein complex, the method including: (i) measuring a first entropy distribution in a first protein that is unbound; (ii) measuring a second entropy distribution in a protein complex including the first protein bound to a second protein; and (iii) producing a modified protein including the second entropy distribution of the protein complex in an energetically stabilized state.
[0204] The term “entropy” as provided herein refers to its customary meaning in the chemical arts. Entropy as provided herein is a level of conformational flexibility within a protein (e.g., a portion of protein, a protein domain) or protein complex (including at least two proteins bound to each other through a non-covalent linker). Likewise, the terms “entropy distribution” and “entropy redistribution” refer to the distribution or redistribution of areas of flexibility within a protein or protein complex. A protein that includes an “entropy distribution” in an “energetically stabilized state” is a protein or peptide that has been modified (e.g., by including amino acid substitutions or amino acid modifications) to include a specific conformation wherein that conformation does not change energetically over time. Thus, the entropy distribution of a modified protein as provided herein corresponds to one of several conformational states the protein may include or may be able to assume relative to the absence of the modification.
[0205] As provided herein the term “conformational entropy” refers to local dynamics or flexibility within a protein. The conformational entropy or entropy as provided herein may be determined or detected using methods commonly known in the chemical arts to analyze and detect the structure of a protein, peptide or protein complex. For example, methods to detect protein structures useful for the invention provided herein include without limitation, X-ray crystallography, NMR spectroscopy, or single particle cryo-EM. Where entropy of large protein complexes is detected, single particle cryo-EM may be used. By using single particle cryo-EMconformational flexibility from local resolution may be accessed or from the temperature factor assigned to each residue during refinement of atomic model into the cryo-EM density map. Thus, in embodiments, the entropy, entropy distribution or entropy redistribution is detected / measured by single particle cryo-EM. In embodiments, measurement or detection of the entropy, entropy distribution or entropy redistribution includes hydrogen deuterium exchange. In embodiments, measurement or detection of the entropy, entropy distribution or entropy redistribution includes hydrogen deuterium exchange coupled with mass spectrometry. In embodiments, measurement or detection of the entropy, entropy distribution or entropy redistribution includes molecular dynamics simulations. By studying how local resolution changes before and after complex formation provides information of redistribution of conformation entropy across the protein complex.
[0206] In embodiments, the second entropy distribution is the entropy of the first protein. In embodiments, the second entropy distribution is the entropy of the second protein.
[0207] In another aspect is provided a method of detecting entropy redistribution in a protein complex, the method including: (i) measuring a first entropy distribution in a first protein that is unbound; (ii) binding the first protein to a second protein thereby forming a protein complex;(iii) measuring a second entropy distribution in the first protein bound to the second protein; and(iv) producing a modified protein including the second entropy distribution of the first protein in an energetically stabilized state.
[0208] In another aspect is provided a method of detecting entropy redistribution in a protein complex, the method including: (i) measuring a first entropy distribution in a first protein that is unbound; (ii) binding the first protein to a second protein thereby forming a protein complex;(iii) measuring a second entropy distribution in the second protein bound to the first protein; and(iv) producing a modified protein including the second entropy distribution of the second protein in an energetically stabilized state.
[0209] In an aspect is provided a method of detecting entropy redistribution in a protein, the method including: (i) measuring a first entropy distribution in a protein that is unbound; (ii) measuring a second entropy distribution in a protein complex including the protein bound to a ligand; (iii) producing a modified protein including the first entropy distribution of the protein in an energetically stabilized state.
[0210] In embodiments, the first entropy distribution and the second entropy distribution are independently detected by cryo-electron microscopy. In embodiments, the first entropy distribution and the second entropy distribution are detected by cryo-electron microscopy. In embodiments, the first entropy distribution is detected by cryo-electron microscopy. In embodiments, the second entropy distribution is detected by cryo-electron microscopy.
[0211] In embodiments, the first entropy distribution and the second entropy distribution are independently detected in silico. In embodiments, the first entropy distribution and the second entropy distribution are detected in silico. In embodiments, the first entropy distribution is detected in silico. In embodiments, the second entropy distribution is detected in silico.
[0212] In embodiments, the first entropy distribution and the second entropy distribution are independently detected by protein resolution or density mapping. In embodiments, the first entropy distribution and the second entropy distribution are independently detected by protein resolution. In embodiments, the first entropy distribution and the second entropy distribution are independently detected by density mapping.
[0213] In embodiments, the first entropy distribution and the second entropy distribution are detected by protein resolution or density mapping. In embodiments, the first entropy distribution and the second entropy distribution are detected by protein resolution. In embodiments, the first entropy distribution and the second entropy distribution are detected by density mapping.
[0214] In embodiments, the first entropy distribution is detected by protein resolution or density mapping. In embodiments, the first entropy distribution is detected by protein resolution. In embodiments, the first entropy distribution is detected by density mapping.
[0215] In embodiments, the second entropy distribution is detected by protein resolution or density mapping. In embodiments, the second entropy distribution is detected by protein resolution. In embodiments, the second entropy distribution is detected by density mapping.
[0216] In embodiments, the detecting in silico includes a computer implemented detection mode.
[0217] In embodiments, the first protein is an immune checkpoint receptor protein.
[0218] In embodiments, the first protein is expressed by a T cell.
[0219] In embodiments, the first protein is a TGF-beta protein, a PD-1 protein, a CTLA-4 protein, an a CD28 protein, a TCR protein, a LAG-3 protein, a CD226 protein, a TIGIT protein, a CD96 protein, a BTLA protein, a B7-H3 protein, a VISTA protein, a TIM-3 protein, an ICOS protein, a GARP protein, a NRROS protein, an 0X40 (CD134) protein, or an ICAM protein. In embodiments, the first protein is an ICOS protein. In embodiments, the first protein is a GARP protein. In embodiments, the first protein is a NRROS protein. In embodiments, the first protein is an 0X40 (CD 134) protein. In embodiments, the first protein is an ICAM protein. In embodiments, the first protein is a TGF-beta protein. In embodiments, the first protein is a BMP9 protein. In embodiments, the first protein is a BMP10 protein. In embodiments, the first protein is an Activin A protein. In embodiments, the first protein is a PD-1 protein. In embodiments, the first protein is a CTLA-4 protein. In embodiments, the first protein is a CD28 protein. In embodiments, the first protein is a TCR protein. In embodiments, the first protein is a LAG-3 protein. In embodiments, the first protein is a CD226 protein. In embodiments, the first protein is a TIGIT protein. In embodiments, the first protein is a CD96 protein. In embodiments, the first protein is a BTLA protein. In embodiments, the first protein is a B7-H3 protein. In embodiments, the first protein is a VISTA protein. In embodiments, the first protein is a TIM-3 protein. Any of the ligands and receptors described in Dostert et al. (24 OCT 2018https: / / doi.org / 10.1152 / physrev.00045.2017), which is hereby incorporated by reference in its entirety and for all purposes, may be used as first and second protein provided herein, including embodiments thereof.
[0220] In embodiments, the first protein is a TGF-beta protein, a BMP9 protein, a BMP10 protein, an Activin A protein, a PD-1 protein, a CTLA-4 protein, a CD28 protein, a TCR protein, a LAG-3 protein, a CD226 protein, a TIGIT protein, a CD96 protein, a BTLA protein, a B7-H3 protein, a VISTA protein or a TIM-3 protein.
[0221] In embodiments, the second protein is an immune checkpoint receptor ligand.
[0222] In embodiments, the second protein is expressed by an antigen presenting cell or a tumor cell.
[0223] In embodiments, the second protein is an integrin protein, a PDL-1 protein, a CD80 protein, a CD86 protein, an MHC-II protein, a Galectin-3 protein, a FGL1 protein, a CD112 protein, a CD155 protein, a HVEM protein, a NECTIN 2 protein, a NECTIN 4 protein or a Ceacam 1 protein. In embodiments, the second protein is an integrin protein. In embodiments,the second protein is a PDL-1 protein. In embodiments, the second protein is a CD80 protein. In embodiments, the second protein is a CD86 protein. In embodiments, the second protein is an MHC-II protein. In embodiments, the second protein is a Galectin-3 protein. In embodiments, the second protein is a FGL1 protein. In embodiments, the second protein is a CD112 protein. In embodiments, the second protein is a CD 155 protein. In embodiments, the second protein is a HVEM protein. In embodiments, the second protein is a Ceacam 1 protein. In embodiments, the second protein is a NECTIN 4 protein. In embodiments, the second protein is a NECTIN 2 protein.
[0224] Any of the ligands and receptors described in Dostert et al. (24 OCT 2018https: / / doi.org / 10.1152 / physrev.00045.2017), which is hereby incorporated by reference in its entirety and for all purposes, may be used as first and second protein provided herein, including embodiments thereof, respectively.
[0225] In embodiments, the modified protein includes a cysteine-cysteine stabilizing mutation. In embodiments, the cysteine-cysteine stabilizing mutation is included in the amino acid sequence of SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61 or SEQ ID NO:62. The term “cysteine-cysteine stabilizing mutation” is used herein according to its plain ordinary meaning and refers to an amino acid substitution in a protein to a cysteine residue that allows for a disulfide bond to form between the protein and a second protein.
[0226] In embodiments, the cysteine-cysteine stabilizing mutation is at a position corresponding to any one of the amino acid positions depicted in FIG. 30. In embodiments, the cysteine-cysteine stabilizing mutation is at a position corresponding to amino acid position 236, 221, 233, 220, 234, 227, 246, or 241. In one further embodiment, the modified protein is ITGB6.
[0227] In embodiments, the modified protein forms part of a lipid bilayer composition. In embodiments, the lipid bilayer composition is a lipid nanodisc. A lipid nanodisc as provided herein refers to a lipid bilayer commonly known in the art and as described in Gao et al. (Nature volume 534, pages 347-351 (2016)), which is hereby incorporated by reference in its entirety and for all purposes.
[0228] In embodiments, the modified protein includes the amino acid sequence of any of the ITGB CC-mutants depicted in Figure 29, 30 or 31. In embodiments, the modified protein includes the amino acid sequence of SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61 or SEQ ID NO:62.
[0229] In embodiments, the modified protein includes the cysteine-cysteine stabilizing mutation at a position corresponding to amino acid position 166 of ITGB1. In embodiments, the modified protein includes the cysteine-cysteine stabilizing mutation at a position corresponding to amino acid position 236 of ITGB1.
[0230] In embodiments, the modified protein includes the cysteine-cysteine stabilizing mutation at a position corresponding to amino acid position 150 of ITGB2. In embodiments, the modified protein includes the cysteine-cysteine stabilizing mutation at a position corresponding to amino acid position 221 of ITGB2.
[0231] In embodiments, the modified protein includes the cysteine-cysteine stabilizing mutation at a position corresponding to amino acid position 161 of ITGB3. In embodiments, the modified protein includes the cysteine-cysteine stabilizing mutation at a position corresponding to amino acid position 233 of ITGB3.
[0232] In embodiments, the modified protein includes the cysteine-cysteine stabilizing mutation at a position corresponding to amino acid position 153 of ITGB4. In embodiments, the modified protein includes the cysteine-cysteine stabilizing mutation at a position corresponding to amino acid position 220 of ITGB4.
[0233] In embodiments, the modified protein includes the cysteine-cysteine stabilizing mutation at a position corresponding to amino acid position 161 of ITGB5. In embodiments, the modified protein includes the cysteine-cysteine stabilizing mutation at a position corresponding to amino acid position 234 of ITGB5.
[0234] In embodiments, the modified protein includes the cysteine-cysteine stabilizing mutation at a position corresponding to amino acid position 156 of ITGB6. In embodiments, the modified protein includes the cysteine-cysteine stabilizing mutation at a position corresponding to amino acid position 227 of ITGB6.
[0235] In embodiments, the modified protein includes the cysteine-cysteine stabilizing mutation at a position corresponding to amino acid position 175 of ITGB7. In embodiments, the modified protein includes the cysteine-cysteine stabilizing mutation at a position corresponding to amino acid position 246 of ITGB7.
[0236] In embodiments, the modified protein includes the cysteine-cysteine stabilizing mutation at a position corresponding to amino acid position 170 of ITGB8. In embodiments, themodified protein includes the cysteine-cysteine stabilizing mutation at a position corresponding to amino acid position 241 of ITGB8.
[0237] In embodiments, the method further includes producing an antibody that specifically binds to the modified protein.
[0238] In embodiments, the method further includes immunizing a mammal with the modified protein thereby producing an entropy- specific antibody. An “entropy-specific antibody” as provided herein refers to an antibody that specifically binds to one conformation state of a protein, protein domain or protein complex.
[0239] In embodiments, the entropy-specific antibody is an IgG.
[0240] In embodiments, the entropy-specific antibody includes a flexible linker. A flexible linker as provided herein may be any chemical linker useful for the methods and compositions provided herein.
[0241] A “chemical linker,” as provided herein, is a covalent linker, a non-covalent linker, a peptide or peptidyl linker (a linker including a peptide moiety), a cleavable peptide linker, a substituted or unsubstituted alkylene, substituted or unsubstituted heteroalkylene, substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene, substituted or unsubstituted arylene or substituted or unsubstituted heteroarylene or any combination thereof.
[0242] The chemical linker as provided herein may be a bond, -O-, -S-, -C(O)-, -C(O)O-,-C(O)NH-, -S(O)2NH-, -NH-, -NHC(O)NH-, substituted (e.g., substituted with a substituent group, a size-limited substituent or a lower substituent group) or unsubstituted alkylene, substituted (e.g., substituted with a substituent group, a size-limited substituent or a lower substituent group) or unsubstituted heteroalkylene, substituted (e.g., substituted with a substituent group, a size-limited substituent or a lower substituent group) or unsubstituted cycloalkylene, substituted (e.g., substituted with a substituent group, a size-limited substituent or a lower substituent group) or unsubstituted heterocycloalkylene, substituted (e.g., substituted with a substituent group, a size-limited substituent or a lower substituent group) or unsubstituted arylene or substituted (e.g., substituted with a substituent group, a size- limited substituent or a lower substituent group) or unsubstituted heteroarylene.
[0243] The chemical linker as provided herein may be a bond, -O-, -S-, -C(O)-, -C(O)O-,C(O)NH-, -S(0)2NH-, -NH-, -NHC(O)NH-, substituted or unsubstituted (e.g., C1-C20, C1-C10,C1-C5) alkylene, substituted or unsubstituted (e.g., 2 to 20 membered, 2 to 10 membered, 2 to 5 membered) heteroalkylene, substituted or unsubstituted (e.g., C3-C8, C3-C6, C3-C5) cycloalkylene, substituted or unsubstituted (e.g., 3 to 8 membered, 3 to 6 membered, 3 to 5 membered) heterocycloalkylene, substituted or unsubstituted (e.g., C6-C10, C6-C8, C6-C5) arylene or substituted or unsubstituted (e.g., 5 to 10 membered, 5 to 8 membered, 5 to 6 membered,) heteroarylene.
[0244] In embodiments, the chemical linker is a covalent linker. In embodiments, the chemical linker is a hydrocarbon linker. In embodiments, the chemical linker is a cleavable peptide linker.
[0245] Thus, a chemical linker as provided herein may include a plurality of chemical moieties, wherein each of the plurality of chemical moieties is chemically different.Alternatively, the chemical linker may be a non-covalent linker. Examples of non-covalent linkers include without limitation, ionic bonds, hydrogen bonds, halogen bonds, van der Waals interactions (e.g. dipole-dipole, dipole-induced dipole, London dispersion), ring stacking (pi effects), and hydrophobic interactions. In embodiments, a chemical linker is formed using conjugate chemistry including, but not limited to nucleophilic substitutions (e.g., reactions of amines and alcohols with acyl halides, active esters), electrophilic substitutions (e.g., enamine reactions) and additions to carbon-carbon and carbon-heteroatom multiple bonds (e.g., Michael reaction, Diels-Alder addition).
[0246] In embodiments, the chemical linker is a non-covalent linker. In embodiments, the chemical linker is a covalent linker. In embodiments, the chemical linker is a peptide linker. In embodiments, the peptide linker includes one or more (e.g., 1 , 2, 3, 4, 5, 6, 7) glycine amino acid residues. In embodiments, the peptide linker has a length of less than 20 (e.g., 19, 18, 17, 16, etc.) amino acid residues.
[0247] In embodiments, the peptide linker has a length from about 1 to about 15 amino acid residues. In embodiments, the peptide linker has a length from about 2 to about 15 amino acid residues. In embodiments, the peptide linker has a length from about 3 to about 15 amino acid residues. In embodiments, the peptide linker has a length from about 4 to about 15 amino acid residues. In embodiments, the peptide linker has a length from about 5 to about 15 amino acid residues. In embodiments, the peptide linker has a length from about 6 to about 15 amino acid residues. In embodiments, the peptide linker has a length from about 7 to about 15 amino acidresidues. In embodiments, the peptide linker has a length from about 8 to about 15 amino acid residues. In embodiments, the peptide linker has a length from about 9 to about 15 amino acid residues. In embodiments, the peptide linker has a length from about 10 to about 15 amino acid residues. In embodiments, the peptide linker has a length from about 11 to about 15 amino acid residues. In embodiments, the peptide linker has a length from about 12 to about 15 amino acid residues. In embodiments, the peptide linker has a length from about 13 to about 15 amino acid residues. In embodiments, the peptide linker has a length from about 14 to about 15 amino acid residues.
[0248] In embodiments, the peptide linker has a length from about 1 to about 14 amino acid residues. In embodiments, the peptide linker has a length from about 1 to about 13 amino acid residues. In embodiments, the peptide linker has a length from about 1 to about 12 amino acid residues. In embodiments, the peptide linker has a length from about 1 to about 11 amino acid residues. In embodiments, the peptide linker has a length from about 1 to about 10 amino acid residues. In embodiments, the peptide linker has a length from about 1 to about 9 amino acid residues. In embodiments, the peptide linker has a length from about 1 to about 8 amino acid residues. In embodiments, the peptide linker has a length from about 1 to about 7 amino acid residues. In embodiments, the peptide linker has a length from about 1 to about 6 amino acid residues. In embodiments, the peptide linker has a length from about 1 to about 5 amino acid residues. In embodiments, the peptide linker has a length from about 1 to about 4 amino acid residues. In embodiments, the peptide linker has a length from about 1 to about 3 amino acid residues. In embodiments, the peptide linker has a length from about 1 to about 2 amino acid residues.
[0249] In embodiments, the peptide linker has a length from 1 to 15 amino acid residues. In embodiments, the peptide linker has a length from 2 to 15 amino acid residues. In embodiments, the peptide linker has a length from 3 to 15 amino acid residues. In embodiments, the peptide linker has a length from 4 to 15 amino acid residues. In embodiments, the peptide linker has a length from 5 to 15 amino acid residues. In embodiments, the peptide linker has a length from 6 to 15 amino acid residues. In embodiments, the peptide linker has a length from 7 to 15 amino acid residues. In embodiments, the peptide linker has a length from 8 to 15 amino acid residues. In embodiments, the peptide linker has a length from 9 to 15 amino acid residues. In embodiments, the peptide linker has a length from 10 to 15 amino acid residues. In embodiments, the peptide linker has a length from 11 to 15 amino acid residues. Inembodiments, the peptide linker has a length from 12 to 15 amino acid residues. In embodiments, the peptide linker has a length from 13 to 15 amino acid residues. In embodiments, the peptide linker has a length from 14 to 15 amino acid residues.
[0250] In embodiments, the peptide linker has a length from 1 to 14 amino acid residues. In embodiments, the peptide linker has a length from 1 to 13 amino acid residues. In embodiments, the peptide linker has a length from 1 to 12 amino acid residues. In embodiments, the peptide linker has a length from 1 to 11 amino acid residues. In embodiments, the peptide linker has a length from 1 to 10 amino acid residues. In embodiments, the peptide linker has a length from 1 to 9 amino acid residues. In embodiments, the peptide linker has a length from 1 to 8 amino acid residues. In embodiments, the peptide linker has a length from 1 to 7 amino acid residues. In embodiments, the peptide linker has a length from 1 to 6 amino acid residues. In embodiments, the peptide linker has a length from 1 to 5 amino acid residues. In embodiments, the peptide linker has a length from 1 to 4 amino acid residues. In embodiments, the peptide linker has a length from 1 to 3 amino acid residues. In embodiments, the peptide linker has a length from 1 to 2 amino acid residues.
[0251] In embodiments, the peptide linker has a length of 3, 5, 7, 9, or 18 amino acid residues. In embodiments, the peptide linker has a length of 3 amino acid residues. In embodiments, the peptide linker has a length of 5 amino acid residues. In embodiments, the peptide linker has a length of 7 amino acid residues. In embodiments, the peptide linker has a length of 9 amino acid residues. In embodiments, the peptide linker has a length of 18 amino acid residues.
[0252] In embodiments, the peptide linker has a length of about 3, 5, 7, 9, or 18 amino acid residues. In embodiments, the peptide linker has a length of about 3 amino acid residues. In embodiments, the peptide linker has a length of about 5 amino acid residues. In embodiments, the peptide linker has a length of about 7 amino acid residues. In embodiments, the peptide linker has a length of about 9 amino acid residues. In embodiments, the peptide linker has a length of about 18 amino acid residues.
[0253] In embodiments, the entropy-specific antibody is administered to a subject in need thereof for the treatment of a disease. In embodiments, the disease is cancer, an inflammatory disease or an autoimmune disease. In embodiments, the disease is cancer. In embodiments, the cancer is alveolar soft part sarcoma, basal cell skin cancer, B-cell lymphoma, bile duct cancer, bladder cancer, cervical cancer, classical Hodgkin lymphoma, colorectal cancer, cutaneoussquamous cell cancer, endometrial cancer, esophageal cancer, head and neck squamous cell cancers, kidney cancer, liver cancer, lung cancer, melanoma, merkel cell cancer, mesothelioma, stomach cancer, or triple-negative breast cancer.
[0254] In embodiments, the disease is an inflammatory disease. In embodiments, the disease is an autoimmune disease. In embodiments, the disease is fibrosis. In embodiments, the disease lung fibrosis, kidney fibrosis, or liver fibrosis. In embodiments, the disease is inflammatory bowel disease, multiple sclerosis, chronic viral infection (e.g., hepatitis B) or lupus.
[0255] In another aspect is provided a method of identifying an entropy-redistributing antibody, the method including: (i) contacting a protein complex including a first protein bound to a second protein with an antibody; (ii) detecting a first entropy of the first protein and a second entropy of the second protein; and (iii) identifying the antibody as an entropyredistributing antibody, wherein if the first entropy or the second entropy is different relative to the entropy of the first protein or the second protein prior to the contacting of the antibody. An “entropy-redistributing antibody” as provided herein refers to an antibody that induces entropy redistribution in a molecule (e.g., protein, protein domain or protein complex) upon binding to the molecule.ANTIBODY COMPOSITIONS
[0256] The methods provided herein can, inter alia, be used to formulate, identify, or manufacture antibody compositions that are capable of binding integrin peptides. Thus, in another aspect is provided an antibody specifically binding to a modified integrin peptide, wherein the modified integrin peptide has a lower entropy relative to its unmodified form.
[0257] In another aspect is provided an antibody including a light chain variable domain and a heavy chain variable domain, wherein the light chain variable domain includes: a CDR LI as set forth in SEQ ID NO:33, a CDR L2 as set forth in SEQ ID NO:34 and a CDR L3 as set forth in SEQ ID NO:35; and wherein the heavy chain variable domain includes: a CDR Hl as set forth in SEQ ID NO:36, a CDR H2 as set forth in SEQ ID NO:37, and a CDR H3 as set forth in SEQ ID NO:38.
[0258] In embodiments, the antibody is a humanized antibody. In embodiments, the antibody is a chimeric antibody. In embodiments, the antibody is an IgG.
[0259] In embodiments, the light chain variable domain includes the sequence of SEQ ID NO:43, SEQ ID NO:94, or SEQ ID NO: 141. In embodiments, the light chain variable domain includes the sequence of SEQ ID NO:43. In embodiments, the light chain variable domain includes the sequence of SEQ ID NO:94. In embodiments, the light chain variable domain includes the sequence of SEQ ID NO: 141. In embodiments, the light chain variable domain is the sequence of SEQ ID NO: 43, SEQ ID NO:94, or SEQ ID NO: 141. In embodiments, the light chain variable domain is the sequence of SEQ ID NO:43. In embodiments, the light chain variable domain is the sequence of SEQ ID NO:94. In embodiments, the light chain variable domain is the sequence of SEQ ID NO: 141.
[0260] In embodiments, the heavy chain variable domain includes the sequence of SEQ ID NO:48, SEQ ID NO: 102, or SEQ ID NO: 142. In embodiments, the heavy chain variable domain includes the sequence of SEQ ID NO:48. In embodiments, the heavy chain variable domain includes the sequence of SEQ ID NO: 102. In embodiments, the heavy chain variable domain includes the sequence of SEQ ID NO: 142. In embodiments, the heavy chain variable domain is the sequence of SEQ ID NO:48, SEQ ID NO: 102, or SEQ ID NO: 142. In embodiments, the heavy chain variable domain is the sequence of SEQ ID NO:48. In embodiments, the heavy chain variable domain is the sequence of SEQ ID NO: 102. In embodiments, the heavy chain variable domain is the sequence of SEQ ID NO: 142.
[0261] In embodiments, the light chain variable domain includes the sequence of SEQ ID NO:43 and the heavy chain variable domain includes the sequence of SEQ ID NO:48. In embodiments, the light chain variable domain is the sequence of SEQ ID NO:43 and the heavy chain variable domain is the sequence of SEQ ID NO:48. In embodiments, the antibody is referred to herein as clone 19C5.
[0262] In embodiments, the light chain variable domain includes the sequence of SEQ ID NO:94 and the heavy chain variable domain includes the sequence of SEQ ID NO: 102. In embodiments, the light chain variable domain is the sequence of SEQ ID NO:94 and the heavy chain variable domain is the sequence of SEQ ID NO: 102. In embodiments, the antibody is referred to herein as clone Huml9C5(57.2).
[0263] In embodiments, the light chain variable domain includes the sequence of SEQ ID NO: 141 and the heavy chain variable domain includes the sequence of SEQ ID NO: 142. In embodiments, the light chain variable domain is the sequence of SEQ ID NO: 141 and the heavychain variable domain is the sequence of SEQ ID NO: 142. In embodiments, the antibody is referred to herein as clone 19C5. In embodiments, the antibody is referred to herein as clone Mutl l9c5(57.7).
[0264] In embodiments, the method is specific for an entropic state of TGF-beta 1. In embodiments, the method is specific for an entropic state of TGF-beta 3.NUCLEIC ACID COMPOSITIONS
[0265] The compositions provided herein include, inter alia, nucleic acid molecules encoding the antibodies provided herein including embodiments thereof. Thus, in another aspect is provided an isolated nucleic acid encoding an antibody provided herein including embodiments thereof.PHARMACEUTICAL COMPOSITIONS
[0266] The compositions provided herein include, inter alia, pharmaceutical compositions including the antibody provided herein including embodiments thereof. Thus, in another aspect is provided a pharmaceutical composition including a therapeutically effective amount of an antibody provided herein including embodiments thereof and a pharmaceutically acceptable excipient.METHODS OF TREATMENT
[0267] The compositions (e.g., antibodies) provided herein including embodiments thereof, are contemplated as providing effective treatments for diseases such as cancer. Thus, in another aspect is provided a method of treating cancer in a subject in need thereof, the method including administering to a subject a therapeutically effective amount of an antibody provided herein including embodiments thereof, thereby treating cancer in the subject.
[0268] In embodiments, the cancer is melanoma, lymphoma, carcinoma, myeloma, leukemia, glioma, breast cancer, prostate cancer, bladder cancer, uterine cancer, gastric cancer, colorectal cancer, lung cancer, esophageal cancer, brain cancer, head and neck cancer, renal cancer, hepatic cancer, or thyroid cancer. In embodiments, the cancer is melanoma. In embodiments, the cancer is lymphoma. In embodiments, the cancer is carcinoma. In embodiments, the cancer is myeloma. In embodiments, the cancer is leukemia. In embodiments, the cancer is glioma. In embodiments, the cancer is breast cancer. In embodiments, the cancer is prostate cancer. In embodiments, the cancer is bladder cancer. In embodiments, the cancer is uterine cancer. In embodiments, the cancer is gastric cancer. In embodiments, the cancer is colorectal cancer. In embodiments, thecancer is lung cancer. In embodiments, the cancer is esophageal cancer. In embodiments, the cancer is brain cancer. In embodiments, the cancer is head and neck cancer. In embodiments, the cancer is renal cancer. In embodiments, the cancer is hepatic cancer. In embodiments, the cancer is thyroid cancer.EXAMPLESExample 1: Summary
[0269] TGF-P signaling is essential to maintain the immunosuppressive component of the immune system. TGF-P is expressed as a latent complex (L-TGF-P). Such latency is conferred by association of mature TGF-p with its prodomain, which is presented on the surface of immunosuppressive cells by covalent association with GARP. Here, we have demonstrated the physiological relevance of such autocrine signaling by engineering mice that only express a form of mature TGF-P 1 that cannot be released from L-TGF-P 1 and thus cannot support paracrine signaling. These mice survived into adulthood and are rescued from the early lethal tissue inflammation of global TGF-pi deficiency, confirming sufficient autocrine function to support survival in vivo. To understand the structural mechanism of TGF-P activation without release, we combined cryogenic electron microscopy and cell-based assays to reveal a dynamic-based allosteric mechanism of autocrine signaling, where avP8 binding transduced the intrinsic flexibility of L-TGF-P1 from the integrin binding site to expose TGF-P1 to its receptors for signaling. Similarly, with greater intrinsic flexibility, L-TGF-P3 allowed constitutive autocrine activation without release. This flexibility was further enhanced by binding to ocvP8 culminating in paracrine release of mature TGF-P3. These findings demonstrated distinctive biodistributions and functions of active and latent TGF-P isoforms.Example 2: Introduction
[0270] Transforming growth factor-Pl (TGF-P 1) is a potent multifunctional cytokine essential for normal development and immune homeostasis1. In pathology, it is a major fibrogenic and immunosuppressive cytokine and plays major roles in organ fibrosis, tumor immune evasion and resistance to immunotherapy2,3. TGF-P 1 is widely expressed in both normal and pathologic tissues across organs and cell types. Because it is always expressed in an inactive (latent) form (L-TGF-P)4, expression itself is not a major point of regulation. Instead, the key mechanisms of regulating its bioactivity include latency maintenance, activation to a form that is capable of binding to its receptors (TGF-PR1 and TGF-PR2), and diffusion, whether it signals locally (i.e.autocrine5) or at a distance (i.e. paracrine6, endocrine7). Yet, these mechanisms that operate during development and immune homeostasis, and in various pathologies are not well understood. Such lack of understanding has led to non-specific therapeutic TGF-P targeting strategies focusing on global inhibition of mature TGF-P or its receptors. The success of such therapeutic approaches have been limited by toxicities3.
[0271] Latency of TGF-pl is determined by its association with its N-terminal prodomain8. During biosynthesis, the prodomain forms a ring-shaped disulfide linked homodimer (the latency-associated peptide, LAP) that encircles the C-terminal disulfide mature TGF-P homodimer to form L-TGF-pl complex8. Furin cleavage during biosynthesis results in non- covalent association of mature TGF-P with its LAP though a proprotein convertase cleavage sequence located at the junction of the prodomain and TGF-P9. The LAP of L-TGF-PI serves four essential functions: 1) conferring latency through shielding mature TGF- 1 from its receptors8; 2) sequestering L-TGF- i to the matrix or to the cell-surface through binding to TGF- 1 milieu molecules1; 3) facilitating proper folding and efficient secretion10; 4) binding to activating proteins1.
[0272] A deeper understanding of latency and activation affords an opportunity to improve understanding of the context- specific functions of TGF- , and how to more precisely target them. TGF-P has three distinct gene products (TGF-PL -PL and -P3), all of which are thought to expressed in a latent form4. All mature TGF-P homodimers are highly conserved and bind to TGF-PR1 and TGF-PR2, with TGF-P1 and -P3 showing similar binding affinities11 12. Furin cleavage sites are conserved in all TGF-P isoforms allowing TGF-P to be released from each LAP after activation to support paracrine or endocrine signaling mechanisms. In addition, the LAPs of TGF-pi and TGF-P3 contain the integrin binding motif RGDLXXL / I and bind with high affinity to specific integrins (ocvP6 and avP8), which culminate in activation, by mechanisms that thus far remain speculative13 16. These similarities between L-TGF-pi and L- TGF-P3 would be expected to confer functional redundancy. Surprisingly, mice deficient in TGF-P1 and TGF-P3 have distinct phenotypes17-20, which might be explained in part by the low homology of their LAPs (FIG. 8). Thus, their distinct functions might be governed by individual mechanisms of latency and / or activation. Structures of L-TGF-PI reveal a domain organization that provide atomic-level details of latency8,21. Homodimerization of LAP is stabilized by disulfide linkages to form a complete straitjacket, which encircles the mature TGF-Phomodimer8. Flexible loops known as “lasso” domains attach the straitjacket to the arm domains to shield the residues of mature TGF-p from interacting with TGF-pR2, the first receptor-ligand interaction required for formation of the TGF-P receptor complex22. Sequence alignments reveal significant variation in these regions in L-TGF-P 1 and L-TGF-P3 (FIG. 8). However, structures of L-TGF-p3 are required for a broader structural understanding of TGF-p latency mechanisms, and currently such structures do not exist.
[0273] Structural efforts to understand TGF-p activation have historically focused on TGF-P 1 due to the potential of TGF-p I as a therapeutic target. Mice deficient in TGF-p 1 die shortly after birth of massive tissue inflammation, thus inhibiting TGF- 1 may stimulate anti-tumor immunity18,23. TGF-P1 mediates its immunosuppressive role largely through its expression on T- cells in particular, regulatory T-cells (Treg)5,24-26. Treg differentiation and function rely on the surface expression of L-TGF-P mediated by the covalent association of its LAP with the transmembrane cell surface milieu molecule Glycoprotein A Repetitions Predominant (GARP), which is likely required for the in vivo functions of both TGF-P1 and TGF-P317,19,27’29. Crystal structures of L-TGF-P1 / GARP reveals a stable architecture of the complex and suggest how L- TGF-pi is presented at the immune cell surface21. A model of L-TGF-P 1 activation suggested by this structure is that mature TGF-P1 must be released from the constraint of LAP and GARP for TGF-pi activation, but the mechanism of this remains obscure21.
[0274] TGF-P activation in vivo is mainly mediated by two integrins, avP6 and avP8, which bind to LAP of TGF-P1 and -P3 with high affinity13,15,16,30,31. Structural differences and sequence divergence between these two integrins suggest distinct modes of activation that likely contribute to some of the context- specific functions of TGF-pi15,32,33. In the case of avP6, global integrin conformational changes transduce force from the actin-cytoskeleton to L-TGF-P to disrupt LAP and allow release of mature TGF- for paracrine signaling14. This mechanism requires the highly conserved p6-subunit cytoplasmic domain, which binds the actin cytoskeleton16. However, avP8 mediated activation does not result in release of mature TGF-PL indicating that avP8 does not support paracrine TGF-pi signaling. avP8 mediated TGF-pi activation does not require actin- cytoskeleton force generation, since it does not undergo global conformational changes34,35, the divergent P8 cytoplasmic domain is not required for activation, and even when present, it does not bind to actin15. Our previous work revealed that avP8 binding induces flexibility in the L-TGF-pl ring, which led us to hypothesize that mature TGF-01 can be activated without being released from the latent complex, which we demonstrated in cell-based assays13. Together, these previous findings led to a hypothesis of autocrine signaling whereby the flexibility generated by binding of L-TGF- 1 to avp8 is sufficient to expose mature TGF-pl to TGF- Rs without being released13. Yet, it remains unclear how without mechanical force, avP8 binding mechanistically induces L-TGF- flexibility when L-TGF-P is stabilized by binding to GARP, and whether such a mechanism is physiologically relevant, as it is widely assumed that release and paracrine signaling of TGF- is required for its function1.
[0275] In this study, we first validate that autocrine signaling without release of TGF-P1 from its latent complex is physiological relevant. We engineer knock-in mice which globally express only a form of TGF-P 1 with a mutation in the furin cleavage site. These mice survive and breed and are spared from the lethal early tissue inflammation seen in TGF- 1 deficient mice23. These results define a new mechanism of L-TGF- activation where mature TGF-P still bound to its latent complex can be activated, bind to its receptors and propagate sufficient signals to rescue the lethality associated with TGF-P1 deficiency. We next pursue the mechanism allowing TGF- P1 to bind to TGF-PRs without release. We describe a dynamic allosteric model whereby, upon binding to avP8, the reduction of local conformational entropy around the L-TGF-P RGD binding region is accompanied with an increase in conformational entropy around the distal regions of L-TGF-P / GARP, exposing mature TGF-P to TGF-PRs without release. The direction of entropy redistribution can be manipulated by stabilization of different domains. In support of this model, we obtain the first structure of L-TGF-P3 to show that the degree of basal conformational entropy of L-TGF-P 1 and -P3 not only determines the basal level of integrin independent TGF-P activation, but also the entropy available to drive integrin-dependent TGF-P activation. Higher levels of integrin-mediated entropic change in L-TGF-P3 than in -Pl result in paracrine release of mature TGF-P3 but not -Pl , leading to isoform-specific mechanisms of autocrine and paracrine TGF-P signaling. Overall, our structural and cell-based approaches reveal a protein dynamic -based allosteric mechanism of redistributing conformational entropy at large distances across protein complexes that is actin cytoskeletal force-independent and determines autocrine and paracrine TGF-P functions. Together these results advance mechanistic understanding of latency and activation of TGF-P family members, and at the same time providea roadmap for structural studies to understand protein dynamic-mediated signal propagation through flexible cell surface proteins.Example 3: Results
[0276] Autocrine TGF-fJl signaling without release prevents lethal tissue inflammation caused by global TGF-pi deficiency
[0277] TGF-p signals through both autocrine and paracrine mechanisms. TGF-01 deficient mice lack both autocrine and paracrine TGF-P 1 signaling from all cells and die around 3 weeks of age of widespread tissue inflammation23. This is attributed to TGF-P signaling in T-cells, since this same phenotype is seen when TGF-P receptors are deleted from T-cells2536. Whether T-cells receive TGF-pi signals primarily through autocrine or paracrine mechanisms is not well understood. Our recent structural and cell-based studies demonstrated that release of TGF-P 1 was not required for autocrine TGF-PI signaling. We sought to test the physiological significance of this finding. We created mice with a mutation in the canonical furin recognition sequence (deave mature TGF-P 1 from LAP and are thus only capable of autocrine signaling without release of TGF-PI from its latent complex, but incapable of providing paracrine TGF-P 1 (FIGS. 1A-1B, 9). We hypothesize that if non-released mature TGF-PI can still productively bind to TGF-PRs and induce autocrine signaling, these mutant mice will be rescued from the universal early lethal tissue inflammation seen in TGF-P 1 deficient mice23. Tgfbl mice begin to show signs of wasting by 10-14 days and die within 24 days (FIGS. 1C-1D). TgfbiR278A7R278AITHCe arephenotypically indistinguishable from tgfblR278A / WTand WT littermates up to 200 days (at the time of this manuscript submission) and show similar post-natal survival, weight gain, and breeding capacity (FIGS. ID- IF). Genetic approaches to determine the in vivo role of TGF-P 1 are confounded by contributions of maternal endocrine TGF-P 1 supplied through the placenta during development and after birth through the breast milk. Maternal derived TGF-P 1 from tgfbl- / - dams can partially compensate for fetal TGF-P 1 deficiency allowing tgfbl7mice to be born live and survive until weaning before succumbing to autoimmunity23,37. When maternal TGF-P1 is absent, tgfbl- / - mice die immediately after birth7. We demonstrate that endocrine release of cleaved mature TGF-P from maternal sources is dispensable since tgfb 1R278A / R278Amice can be derived from homozygous tgffriR278A7R278Adams and these mice show similar post-natal survival, gain weight, and are phenotypically indistinguishable from tgfbiR278A7R278Amice bom fromtgfblR278A7WTdams (FIGS. IF, 8). The organs of tgfl)iR278A7R278Amicearehistologically indistinguishable from WT and tgfblR278A7WImice, in contrast with tgfbl mice, which display massive immune infiltration of heart, liver and lungs (FIG. 1G). Therefore, autocrine TGF-pi signaling without release can rescue the early lethal tissue inflammation of TGF-P 1 deficiency, and endocrine or paracrine release of TGF-PI is not involved or required for this rescue.
[0278] We verify that tg / b7A27S / VR27SAmice show no biochemical evidence of mature TGF-p I cleavage. We performed immunoblot analysis of plasma, and organ lysates using an antibody that recognizes an epitope on the mature TGF-01 monomer. Mature TGF-PI can be detected as non-cleaved from LAP (~50 kDa) or as a ~ 12.5 kDa monomer when cleaved. In plasma, we find only non-cleaved TGF-pi in tfiJbli<278A''R278A. absence of mature TGF-pi in tgfbl'7', and only cleaved in WT mice (FIG. 1H). In organs, only non-cleaved TGF-PI is seen in tgfblR278A / R278Amice, both non-cleaved L-TGF-P1 and mature TGF-PI in WT, and neither form in tgfbl'7' mice (FIG. 1H). In addition, in kidney, liver, lung, spleen and plasma from tgfoiR278A7R2 / 8Amice the amount of non-cleaved L-TGF-P1 is not reduced relative to total cleaved and uncleaved TGF-PI in WT mice (FIG. 1H). These data demonstrate that non-cleaved L-TGF-P I is synthesized and secreted, not degraded, or proteolytically cleaved by a non-furin protease, and exhibits appropriate organ biodistribution. The non-cleaved L-TGF-P 1 in organs of WT mice is consistent with previous reports suggesting that in vivo, some mature TGF-P1 is secreted in the non-cleaved form38.
[0279] To understand why tgJblR278A / ,'278Amice do not have massive tissue inflammation, we next asked whether non-cleaved TGF-PI was normally present on the surface of CD4+ T-cells and therefore, might be capable of supporting TGF-PI activation in WT mice. Indeed, we found that non-cleaved L-TGF-P 1 was easily detected in whole cell lysates or on the surface of WT CD4+T-cells (FIGS. 1I-1J). These data together with the long-term survival of tgfblR278A / R278Amice led us to hypothesize that non-cleaved TGF-P1 is functionally capable of signaling on CD4+ T-cells.
[0280] To test this hypothesis, we first determined the ability of non-cleaved TGF-pi to induce avP8-mediated TGF-pl signaling on CD4+ T-cells. CD4+ T-cells from [gfbiR278A7R278AorWT mice were plated onto immobilized avP8 to induce TGF-P activation and signaling. TGF-P signaling was increased similarly in both CD4+ T-cells from tgfl>]R27SA7R278AOr WT mice sincedetection of the phosphorylated form of the canonical TGF-p signaling mediator, SMAD2 / 3, was increased similarly in both (FIG. IK). These data demonstrate that release of TGF-P1 is not required for avP8-mediated autocrine TGF-pi signaling on CD4+ T-cells.
[0281] We next addressed the functional significance of av'PS-mediated autocrine TGF-P signaling on differentiation of CD4+ T-cells. TGF-P is required for the conversion of CD4+ T- cells to Treg, and for Treg function in non-thymic (i.e. peripheral) tissues25 2636. We have previously developed an assay to detect avP8-mediated conversion of activated CD4+ T-cells to induced Treg (iTreg), the in vitro equivalent of peripherally derived Treg (pTreg)39. Efficient avp8-dependent conversion to iTreg was observed from CD4+ T-cells from both WT and tgfl)lR278A / R27SAmiCe which correlated with the increased avP 8 -dependent pSMAD2 / 3 signaling in CD4+ T-cells (FIGS. 1K-L). Thus, avP8 can induce sufficient autocrine signaling from cellsurface non-cleaved TGF-P to lead to differentiation of iTreg.
[0282] We next addressed whether release of TGF-pi was required for pTreg differentiation in vivo. We determined that global deletion of TGF-P1 causes reduction in the pTreg population (FIG. 9), consistent with previous reports24. Next, we enumerated Treg in the peripheral blood and spleen of tgj]yiR278A7R278AmiCe and found no evidence of a reduction in pTreg frequencies in tgfblR278A7R278Acompared with WT mice, rather there was a slight increase in overall Treg frequences in KI / KI compared to WT / WT mice (FIGS. 1M-N). Thus, release of TGF-P1 is not required for pTreg generation or maintenance.
[0283] Taken together, our findings support the physiological relevance of autocrine TGF-P 1 signaling without release of mature TGF-P, which produces sufficient immunosuppressive T-cell differentiation to prevent the early lethal tissue inflammation of global tgfbl deficiency.
[0284] Structures of the L-TGF-pl / GARP and avp8 / L-TGF-pi / GARP complexes
[0285] To address the structural mechanism allowing TGF-P 1 to bind to TGF-PRs without release, we use single particle cryogenic electron microscopy (cryo-EM) to study complexes of L-TGF-P1 / GARP and avP8 / L-TGF-Pl / GARP in solution. By co-expression of the recombinant GARP ectodomain, L-TGF-pi with a wild type integrin binding motif RGD (L-TGF(RGD)-pi) and a mutant form of integrin binding motif RGE (L-TGF(RGE)-Pl) that cannot bind to integrin, we obtained a L-TGF-pi / GARP complex. The resulting L-TGF-pi / GARP contains about 50%L-TGF-p(RGE / RGD)-pi, which can only bind one avp8 integrin, 25% L-TGF(RGD / RGD)-pl, which can bind two, and 25% L-TGF(RGE / RGE)-P1, which cannot bind to avP8. This design allows us to maximize the population of L-TGF-P / GARP bound with one avP8, reducing heterogeneity of the sample and facilitates particle alignment13. Furthermore, in this complex, two cystine residues of GARP each forms a disulfide bond with a cystine residue in an L-TGF- P1 monomer (FIG. 2B). By mixing these L-TGF- i / GARP complexes with the recombinant ectodomain of avP8 in a 1 : 1 molar ratio, we obtained approximately the anticipated proportion of 1: 1 and 2:1 avP8 / L-TGF-Pl / GARP complexes as revealed by mass photometry (FIG. 10A) and single particle cryo-EM (FIGS. 2C-2G, 10). Using a cell-based TGF-pi activation assay, we demonstrated that two avP8 binding to L-TGF-PI / GARP is not necessary but one avP8 binding is sufficient to fully active TGF-pi for signaling (FIG. 10B). Thus, in our structural studies, we focused on L-TGF-pi / GARP bound with one avP8. From this sample, we determined a structure of L-TGF-PI / GARP with a single avP8 bound at 2.5A resolution (FIGS. 2C). By further intensive particle classification, we isolate a small percentage of unbound L-TGF-pi / GARP (4.6% particles, at 3.4A, FIG. 2D) and ocvP8 (1.5% of particles, at 4.5A, FIG. 2E), with the remaining particles the trimeric complex in many different conformations (93.9% of particles in total, with resolution range from 2.5 A to 8.3A, FIGS. 2F-2H). Although we also determined a structure of L-TGF-pi / GARP bound with two avP8 integrins to an overall resolution of 3.0A, in which only one avP8 is well resolved, we did not pursue this further. In addition, we determined a 3.0A resolution structure of L-TGF-pi / GARP from the purified L-TGF-pl / GARP alone.
[0286] Overall, the cryo-EM solution structure of L-TGF-pi / GARP, either determined alone or isolated as unbound particles from the 1: 1 mixture of L-TGF-PI / GARP and avP8, is largely consistent with the crystal structure of the same complex (PDB: 6GFF), except that we connect the straitjacket domain to the contralateral arm domain on the opposite side of L-TGF-pi, instead of ipsilateral arm domain on the same side8. The resolution in the majority of the L-TGF- Pl / GARP complex is sufficient to resolve sidechains for reliable atomic model building (FIG. 3A, left panel). The local resolution of the cryo-EM density map and the B-factor (or commonly referred to as B-factor) of individual residues obtained from real space refinement are consistent (FIG. 3B). We further subject L-TGF-PI / GARP complex to 1 ps long all-atom molecular dynamics simulations that reveal a clear correlation between the per-residue root-mean-square- fluctuation (RMSF) and the B-factor. RMSF is a measure of the local structural flexibility anddynamics40. Thus, local resolution or B-factor provide a quantitative measurement of the relative flexibility of specific local regions within the molecule (FIG. 3B), which clearly show that half of the straitjacket domain (including the lasso) that does not interact with GARP is more flexible (FIG. 3B, enlarged view in the upper panel) than the analogous portion of the other straitjacket domain within the same L-TGF-01 (FIG. 3B enlarged view in lower panel). Our results suggest that, in solution, extensive interaction stabilizes the portion of the straitjacket domain in contact with GARP (FIG. 3B enlarged view in the upper panel), and exposure of mature TGF-01 may require disruption of this extensive interaction.
[0287] Structural dynamics and induced flexibility of av08 / L-TGF-01 / GARP
[0288] Based on the structures of L -TGF-01 / GARP alone and in complex with czv08 (FIGS. 3A-3C), we hypothesized that integrin binding to the L-TGF-p 1 / GARP further induces flexibility of GARP, L-TGF-01 or both, leading to the destabilization of L-TGF-01 / GARP interface, and the lasso loops. Indeed, via extensive particle classification, we captured snapshots of avp8 / L-TGF-p 1 / GARP complex that reflect the range of motion and flexibility of GARP / L- TGF-[3 l relative to czv08 (FIGS. 2F-2H). In all snapshots, the domain close to the RGD binding loop is always resolved but the density of the remaining part of L-TGF-01 / GARP is progressively weaker (FIG. 2F). Despite only being resolved in two snapshots (FIGS. 2F class 1 and 2), GARP is present in all L-TGF-01 particles, since they are covalently linked. Extensively focused particle classification and alignment, together with 3D variability analysis (3DVA), reveal rocking motions of L-TGF-01 / GARP relative to av08 (FIGS. 2G-2H, 10C-10D, and 9). Beyond such rocking motions, we observe progressive loss of density from GARP to the straitjacket domain as the range of motion increases (FIGS. 2G and 2H, 11B). Visualizing both rocking motion and progressive change of local resolutions in GARP and straitjacket rules out the possibility that the loss of density is caused by particle misalignment rather than increased flexibility. Thus, we conclude that the disappearance of GARP in the reconstructions is caused by the increased flexibility of the straitjacket domain.
[0289] In one snapshot (class 1 in FIGS. 2F and 3A, right panel) where GARP is well resolved, which contains only 6.3% of classified particles, the lasso loop of the straitjacket domain that interacts with GARP becomes more flexible after binding to czv08, as measured from both local resolution and change of normalized B-factor based on a common reference, while the local resolutions of the remaining portions of L-TGF-01 / GARP are comparable in thestructures of avP8 / L-TGF-Pl / GARP and L-TGF-[31 / GARP (FIGS. 3B, 3C, 10). As revealed in this best resolved structure of the trimeric complex, the arm domain of L-TGF-p becomes more stable upon binding to avP8, indicated by a reduction of ~15 A* in normalized B -factor from L- TGF-P / GARP alone, but the straitjacket domain, including lasso loop and the interface of GARP with mature TGF-P, becomes more flexible, with a -15 A increase in B-factor (FIG. 3D). Consequentially, destabilization of the TGF-p / GARP interface leads to progressive disappearance of L-TGF-P / GARP in the reconstructions, which is also reflected as the progressive increasing of B-factors (FIG. 2F, class 3 to 8). Thus, binding to cc P8 not only stabilizes the RGD loop and part of the arm domain that binds to the integrin, but also allosterically induces more flexibility in the distal regions of the L-TGF-P1 ring, particularly in the region of lasso loop and straitjacket domain. These findings suggest that such induced flexibility activates TGF-P 1 (FIGS. 3D-3E).
[0290] Spatial conformational entropy redistribution drives av 8 mediated L-TGF-P activation
[0291] Next, we asked the question what drives the allosteric activation of TGF-P 1. The changes between L-TGF-pi / GARP and ocvP8 / L-TGF-pi / GARP are not consistent with a “classic allostery” model conceptualized as a “domino effect” of conformational changes between stable structural endpoints41. In the best resolved structures (FIG. 3A, class 1), we observed minimal changes of L-TGF-P 1 in its overall conformation after binding to integrin (GARP: RMSD 1.3 A, 3950 atom pairs; L-TGF-P1 non-integrin binding subunit A: RMSD 1.9 A, 2496 atom pairs; L-TGF-P1 integrin binding subunit B: RMSD 2.0 A, 2398 atom pairs). Rather, there are obvious changes in the local resolution of the reconstructed cryo-EM density maps, and the per residue B-factor in the refined structures (FIGS. 3A-3D). Indeed, conformational flexibility instead of a series of discrete conformational changes is thought to drive dynamic allostery42'434445. Thus, our observations suggest that, by binding of cxvp8 to L- TGF-pi / GARP, protein dynamics drive the allosteric destabilization of the L-TGF-P 1 / GARP interface and consequentially lead to exposure of mature TGF-P 1 to its receptors.
[0292] Examining allostery through a thermodynamic lens allows the connection between ‘classic’ and ‘dynamic’ allostery, where any change to the protein impacts free energy through both entropy and enthalpy. It is hypothesized that dynamic allostery influences the free energy,predominantly via entropic contributions42,46. Based on the Boltzmann equation, S=kBln(W), where S is entropy, kB is Boltzmann’s constant and W represents the number of microstates47, higher conformational dynamics equal higher conformational entropy. It has also been observed that, upon binding small molecules, peptides or DNA, proteins tend to redistribute their conformational entropy, i.e. reduce conformational entropy around the binding site and consequentially increase conformational entropy in a distal region44,45,48,49. As proposed previously50,51, spatial redistribution of conformational entropy explains dynamic allostery. Applying this concept to explain dynamic allosteric activation of L-TGF-p I , our results lead to a hypothesis whereby, upon binding to av08, conformational entropy in L-TGF-P / GARP is redistributed from the tzv'PS binding site to the L-TGF-p straitjacket domain (FIG. 3E), allosterically exposing mature TGF-P to TGF-PR, leading to signaling.
[0293] We designed additional experiments to test the validity of this dynamic allostery hypothesis. First, we tested whether stabilizing the L-TGF-p / GARP interface in the avp8 / L- TGF-p / GARP system would change the direction of spatial conformational entropy redistribution towards avP8. Using the inhibitory Fab MHG8, which binds to and stabilizes the L-TGF-P1 / GARP interface21, we determine the structure of the avP8 / L-TGF-Pl / GARP / MHG8 complex. Indeed, we find in our structure of ocvP8 / L-TGF-pi / GARP / MHG8 the L-TGF-pi straitjacket, including the LAP ring and integrin binding site, is well-resolved but most of avP8, including the head domain, is unresolved confirming redistribution of conformational entropy towards the integrin (FIGS. 3F-3H).
[0294] Following this experiment, we further tested a hypothesis that the direction of spatial conformational entropy redistribution can be altered by stabilizing conformational flexible regions. We determined a cryo-EM reconstruction of L-TGF-P1 / GARP in complex with a full length avP8 (ex vP8 Fl ) reconstituted into lipid nanodisc (avP8fl-nd) which constrains its otherwise flexible lower legs (FIGS. 31, 11A). Compared with the class 1 of truncated avP8 (txvpStr) in complex with L-TGF-P1 / GARP, this reconstruction has better resolved leg portions of avP8, but the local resolution of L-TGF-pi / GARP portion is worse, so the B-factor is higher (FIGS. 3J-3L). Together, our results suggest that the conformational flexible regions in the avP8 / L-TGF-Pl / GARP complex serve as entropic reservoirs that can be regulated or manipulated to alter the direction of entropy redistribution.
[0295] To further test this directionality of conformational entropy redistribution hypothesis, we next constrained L-TGF-p l / GARP into a physiologically relevant membrane environment and allowed it to bind av[38 with various amounts of constraint, ranging from none to global stabilization (FIG. 3M). In this system, L-TGF-p 1 / GARP is expressed in the cell membrane of a transformed mink lung epithelial TGF-P responsive reporter cell (TMLC)52(FIG. 3N), and allowed to bind with empty nanodisc as a control (FIG. 3N, panel 1), the txvp8 ectodomain without constraint (FIG. 3N, panel 2), C-terminally clasped avP8 ectodomain (FIG. 3N, panel 3), Otvp81'1 reconstituted into lipid nanodisc (FIG. 3N, panel 4), the unclasped czv'PS ectodomain globally stabilized by immobilization (FIG. 3N, panel 5), or the clasped avP8 ectodomain globally stabilized by immobilization (FIG. 3N, panel 6). For ocvP8 ectodomain, we predict that the membrane constraint imposed on L-TGF-p l / GARP directs entropy towards av[38 leading to inefficient TGF-P 1 activation (FIG. 3M). The direction of entropic redistribution imposed by the membrane constraint on L-TGF-P1 / GARP would be overcome by increasing amounts of constraint imposed on cx\'P8, leading to increasing the efficiency of TGF-pi activation (FIG.3M).
[0296] Indeed, with the different forms of avP8 showing the similar affinity to L-TGF- Pl / GARP (FIG. 11B), the cxv^S ectodomain without constraint does not efficiently induce TGF- P signaling (FIG. 30). In comparison, C-terminally clasped ocvpstr, or avP8fl in lipid nanodisc more efficiently activates TGF-P signaling (FIG. 30). Global immobilized C-terminally clasped or unclasped cxvp8tr has the highest activation efficiency (FIG. 30). In this assay configuration there is no mechanical force applied to avP8 from the actin cytoskeleton and thus, the mechanism of avP8-dependent TGF-P activation will favor dynamic allostery. These experiments support the hypothesis that the conformational entropy redistribution is not only sufficient but is the primary mechanism driving avP8 mediated L-TGF-P activation.
[0297] Intrinsic and induced flexibility of L-TGF-p3 and L-TGF-p3 / GARP
[0298] It has been shown that L-TGF-P3 presented by GARP is essential during development and may also play a role in immunosuppressive immunity in post-natal life29,53,54. Therefore, we next studied the structure and activation of L-TGF-P3 alone and presented by GARP and induced by avP8 binding, which has not been studied structurally or functionally.
[0299] Using a similar strategy as for L-TGF-P1, we expressed and purified recombinant L- TGF-p3 and the L-TGF-p3 / GARP complex (FIG. 4A). Single particle cryo-EM studies provided structures of L-TGF-[33 / GARP (2.9A, FIG. 4B), comparable with that of L-TGF-pi / GARP (3.0A), with the GARP domain and the part of the straitjacket that is in contact with GARP almost identical in both structures (FIGS. 4C, 12A-12B). However, L-TGF-P3 is significantly more flexible in all other regions by B-factor comparison to L-TGF-pi, particularly the arm, which contains the integrin binding site, and the portion of the straitjacket domain, including the lasso loop, that cradles the tip of mature TGF-P containing the receptor binding domain (FIGS. 4D and 4E). Such increased intrinsic flexibility suggests that L-TGF-P3 is less constrained and contains higher basal entropy than L-TGF-P1. We hypothesize that this increased basal entropy could facilitate exposure of mature TGF-P3 to TGF-PRs even without binding to cxvp8. After integrin binding, further entropic perturbation would lead to release of mature TGF-P3 from its latent complex.
[0300] To test this hypothesis, we next determined the structures of avP8 / L-TGF-P3 (2.7 A) and avP8 / L-TGF-P3 / GARP (~ 4.9-7.2A) using L-TGF-P3 constructs where the furin cleavage site (R277A) was mutated to ensure that mature TGF-p3 remained associated with the latent complex. For image processing, we used the same procedure as applied to av'PS / L-TGF- Pl / GARP complex to avoid any potential bias in data interpretation. Although the cx\'P8 / L-TGF- P3 / GARP complex is stably formed (FIG. 4F) and the avP8 density well resolved, only a small portion of L-TGF-P3 but no density of GARP is resolved (FIG. 4G). To simplify structural analysis, we then focused on the structure of avP8 / L-TGF-P3 without GARP (FIG. 4H). Further particle classification of this dataset reveals that L-TGF-P3 rocks over the top of avf38 (FIG. 41) in a much larger range than that of L-TGF-pi bound to avP813. Indeed, in all these conformational snapshots, the straitjacket domains of L-TGF-P3, including the mature TGF-P3 peptides, are not resolved (FIGS. 4H and 41). Overall, our structural studies of avP8 / L-TGF-P3 and avP8 / L-TGF-P3 / GARP reveal similar but more dramatic redistribution of conformational entropy as seen in the avP8 / L-TGF-Pl / GARP complex (FIGS. 2F class 1), since we could not isolate any subclass with either GARP or complete L-TGF-P3. Thus, we conclude that intrinsic flexibility of L-TGF-P3 is further enhanced upon avP8 binding by a similar conformational entropy redistribution mechanism as seen with L-TGF-PI / GARP (FIG. 4J).
[0301] This presents a hypothesis that there is a threshold for flexibility of the straitjacket / lasso to allow mature TGF-P to be exposed to its receptors without being released. If so, the increased intrinsic flexibility of L-TGF-p3 presented by GARP could allow mature TGF-P3 to be exposed to its receptors, allowing basal activation even without integrin binding. To test this, we expressed L-TGF-p3 / GARP and measured TGF-P activation using TMLC reporter cells. Indeed, TMLC reporter cell expressing cell surface L-TGF-[33 / GARP had significantly higher detectable basal TGF-P activity than that of L-TGF-P1 / GARP, which has no basal activity (FIGS. 5A-5B, 13). If there is similarly a threshold for flexibility of the straitjacket / lasso to allow mature TGF-P to be released, the higher induced flexibility of L-TGF-p3 found in the av[38 / L-TGF-P3 complex could be sufficient to cause release of mature TGF-P3 from L-TGF-P3 / GARP (FIG. 5C). Indeed, analysis of supernatant from L-TGF-P3 / GARP TMLC cells cultured on immobilized avP8 contained significant amounts of released TGF-P as opposed to supernatant from L-TGF-P1 / GARP TMLC cells which did not contain released TGF-P (FIGS. 5C-5D).
[0302] Why mature TGF-P3 as opposed to TGF-P 1 can be efficiently released from its latent complex could be explained by the relative differences in intrinsic flexibility of the lasso loop, a critical determinant of latency in all TGF-P superfamily members8,55. A detailed comparison of sequence and structure reveals that the lasso loop of L-TGF-P3 (lasso3) is not only shorter than that of L-TGF-pi (lasso 1) but also less well conserved in the key residues that interact with mature TGF-P56(FIG. 5E). We thus hypothesize that the lasso3 has evolved to be more flexible providing less coverage to mature TGF-P3 from exposure to its receptor and allowing a higher basal activity of L-TGF-P3. To test this hypothesis, we swapped the TGF-P3 lasso into TGF-P 1 (L-TGF-Pl_lasso3) (FIG. 5F) and found that this lasso swap indeed significantly increased basal activation of TGF-pi although not to the level of wild type L-TGF-P3 (FIG. 5G). Taken together, we conclude that the level of conformational entropy of the arm, straitjacket and lasso domains, as well as the structure of the lasso loop, are key to maintaining latency, exposure, or release of mature TGF-P.
[0303] Functional consequences of TGF-p release from av 8 mediated L-TGF-p activation.
[0304] Under the physiological conditions where avP8-mediated TGF-P activation occurs in the tumor microenvironment, avP8 is presented by one cell, but L-TGF-P is presented on the cellsurface of a contacting cell39. In this scenario, av[38 mediated TGF-P activation could result in bidirectional signaling to both cells if TGF-P was released (paracrine), or only in unidirectional signaling on the immune cell presenting TGF-P cell if not released (autocrine). To test whether such avP8-mediated directional TGF-P activation occurs, we devised an in vitro co-culture model system where the integrin av[38 is expressed by TGF-p I null embryonic fibroblasts (MFB-F11) that stably express a TGF-P responsive secreted alkaline phosphatase (SEAP) reporter construct57, and TGF-P is expressed on the surface of TMLC cells (FIGS. 6A-C). The MFB-F11 reporter cells are highly sensitive to exogenous TGF-P, indicating possession of the full complement of TGF-P receptors and downstream signaling apparatuses57. When co-cultured with the L-TGF-P1 / GARP expressing TMLC TGF-P reporter cells, SEAP in the cell supernatant reports TGF-P signaling from the avP8 expressing cells while luciferase measured from the cell lysate reports TGF-P signaling from the L-TGF-P1 / GARP expressing cells (FIGS. 6B-6C). Since MFB-F11 cells are TGF-P deficient, the only cellular source of TGF-P1 in the co-culture system will be from the L-TGF-pi / GARP expressing TMLC TGF-P reporter cells.
[0305] Co-culture of ocvP8 expressing MFB-F11 reporter cells with L-TGF-P 1 / GARP expressing TMLC reporter cells results in autocrine signaling since only luciferase from the L- TGF-pi / GARP expressing TMLC cells is detected (FIGS. 6B-6C). Such exclusivity of autocrine signaling can be attributed to the insufficient flexibility of the straitjacket and lasso loop of L-TGF-P1 to allow mature TGF-P 1 to be released but sufficient to be exposed within the latent ring to bind to TGF-PR2 after avP8 binding. The next question is whether the directionality of L-TGF-P3 activation by avp8 is different than L-TGF-P1, since mature TGF-P3 is released upon avP8 binding (FIGS. 5C-5D). Indeed, under the same experimental condition where TGF-pi signaling is exclusive autocrine, both autocrine and paracrine TGF-P3 signaling are observed since both luciferase from L-TGF-P3 / GARP expressing TMLC cells and SEAP from the avP8 expressing MFB-F11 cells are detected (FIG. 6C). We hypothesize that within the L-TGF-P complex, mature TGF-P3 compared to TGF-pi would be more accessible to TGF- PR2, the first receptor to bind the mature TGF-P to initiate the signaling pathway22.
[0306] To test whether TGF-PR2 binds mature TGF-P when exposed within L-TGF-P complexes, we performed TGF-PR2 binding assays to immobilized ocvP8 bound L-TGF-P3 or L- TGF-P1 / GARP complexes. In these systems, the furin cleavage site between the mature TGF-Pand the LAP are mutated at the analogous position as in the tgfblll27!J"VR277''' mice, and thus mature L-TGF-P cannot be released. Consistent with our structural analysis and TGF-p activation assays, we observed more robust complex formation between TGF-pR2 and L-TGF- P3 / GARP than to L-TGF-P 1 / GARP when bound to immobilized avP8 (FIG. 6D).Example 4: Discussion
[0307] Physiological role of TGF-pi activation without release
[0308] TGF-pi plays major roles in mammalian biology from embryo implantation through the entire lifespan. For all of these roles, the requirement for release of TGF-P for its function has long been assumed58. Historically, biochemical and structural experiments reinforced this dogmatic view. Early biochemical experiments revealed that purified TGF-P 1 was part of a larger latent complex, and release of mature TGF-pl from this complex was required in order to detect any measurable TGF-P 1 activity59. Crystal structures of L-TGF-P and mature TGF-P with its receptors showed that within the latent complex, mature TGF-P is shielded by its LAP and not sufficiently exposed to bind to its receptors, TGF-PR2 and TGF-PRl8,22,56,60. Together, these data form the basis of the dogmatic view that mature TGF-P has to be released for both autocrine and paracrine function.
[0309] Our previous structural study of the avP8 / L-TGF-Pl complex challenged this dogma. We predicted mature TGF-P1 could be sufficiently exposed to bind to its receptors within the L- TGF-pi complex since we found that binding to avP8 dramatically increased the flexibility of L-TGF-P113. Here, we provide definitive evidence that mature TGF-P without release can still support autocrine signaling. We show in mice mature TGF-pi covalently bound to LAP can induce sufficient signaling to support immune function, since mice have so far survived 6 months without the early immune lethality associated with global TGF-PI deficiency21,2861,62. Our ability to generate live births from homozygous tglb]R27R / '7R'272'' intercrosses in the complete absence of wild type maternal TGF-P 1 from conception to adulthood, provides definitive evidence that paracrine release of mature TGF-P 1 is not required either for development or for early immune function.
[0310] Our results differ from previous reports where mice with furin conditionally deleted in T-cells develop delayed organ inflammation similar to mice with conditional deletion of TGF-pi in T-cells5. Differences between [gfoiR278A7R27SAmice and these T-cell-specific deletion modelsexplain why tgp)iR278A7R278Amice are spared from lethal tissue inflammation. Furin potentially cleaves hundreds of substrates other that TGF-P1 expressed by T-cells63, and likely has effects that are independent of TGF-pi that affect T-cell immunosuppressive function. Mice with tgfbl conditionally deleted in T-cells lack autocrine TGF-p l signaling by T-cells, whereas autocrine TGF-p I signaling is preserved in tgfl>iR278A / R278Amice. Taken together, these data are consistent with our findings that autocrine TGF-p I signaling without release is sufficient to prevent autoimmunity. Furthermore, such findings not only validate our structure-based approach to study the L-TGF-P activation mechanism but demonstrate the power of cryo-EM to reveal structural mechanisms of flexible proteins that would otherwise have been unanticipated.
[0311] L-TGF-p activation driven by conformational entropy redistribution
[0312] The concept of conformational entropy redistribution, where conformational entropy reduces around the ligand binding site and increases at distant sites in the protein is derived from conformational ensembles quantitatively characterized from structures obtained by X-ray crystallography or NMR spectroscopy of relatively small proteins4951. With single particle cryo- EM, protein conformational dynamics are correlated with local resolutions of the reconstructed density maps, allowing exploration of conformational entropy redistribution in much larger and complex systems. The redistribution of conformational entropy can also explain dynamic allosteric communication from the ligand binding site to distant sites across the protein without involving propagation of discrete stable conformational changes43 51.
[0313] Here, we used cryo-EM to examine conformational entropy redistribution in the large and multi-component protein complex, ccvP8 / L-TGF-P / GARP, where all components have been shown to be highly flexible in our previous13 34and current studies. By characterizing the changes of conformational flexibility of different regions of L-TGF- / GARP induced by integrin avP8 binding, we show that conformational entropy redistribution is the underlying dynamic allostery mechanism of avP8 mediated L-TGF-P activation.
[0314] Specifically, we demonstrate that intrinsic flexibility, the basal conformational entropy of L-TGF-P complexes, controls TGF-P latency. In the case of the fully latent L-TGF-P1, the straitjacket and lasso loop are relatively stable (FIG. 7 A, panel 1), as opposed to the partial latent L-TGF-P3, where the same domains are flexible (FIG. 7B, panel 3). Binding to czv'PS stabilizes the flexible RGD loop on the arm domain of both L-TGF-P 1 and -P3 and reduces localconformational entropy. Spatial redistribution of this entropy towards the straitjacket enhances the flexibility of the respective lasso loops. For L-TGF-p I , lower basal conformational entropy results in less conformational entropy redistribution towards the lasso domain, insufficient to release mature TGF-P but sufficient to expose it to its receptor (FIG. 7A, panel 2). Without being released, TGF-P is restricted to autocrine signaling. In contrast, because L-TGF-P3 has higher basal conformational entropy, av[38 binding results in more conformational entropy redistribution towards the lasso domain resulting in L-TGF-P3 passing a flexibility threshold sufficient for release mature TGF-p3 (FIG. 7B, panel 4). Released TGF-p3 is capable for both autocrine and paracrine signaling to either av[38 or L-TGF-p3 / GARP presenting cells.
[0315] Physiological relevance of dynamic allostery in the activation of the TGF- P3 / GARP complex
[0316] TGF-p3 is essential since TGF-P3 deficient mice die at birth of cleft palate and defective pulmonary development19. This phenotype is not seen with TGF-pi or TGF-p2 deficiency64, even though the mature TGF-P3 homodimer and TGF-P 1 homodimer are highly homologous, both bind to TGF-pRs similarly and utilize the same TGF-P signaling pathway12. Furthermore, expression of L-TGF-p I cannot completely rescue the cleft palate of L-TGF-P3 deficiency (i.e. tgfbl knocked into the tgfb3 locus)65,66, leading us to focus our attention on differences in latency / activation mechanisms between TGF-pi and -p3. Indeed, we find that the lasso loop of the straitjacket is a critical determinant of latency / activation.
[0317] The prodomain of L-TGF-P3, like L-TGF-P 1, efficiently forms a disulfide linked complex with GARP21,54. The L-TGF-P3 / GARP complex is essential since TGF-P3 and GARP colocalize at the medial edge of the palatal ridge during the critical developmental phase for palate fusion54and mice or humans deficient in GARP29,54or L-TGF-P319,67display cleft palate. In this study, we show that the interactions between the prodomain of L-TGF-P3 and -Pl with GARP are nearly identical. Thus, the relative increases in intrinsic and integrin-induced flexibility of the L-TGF-P3 prodomain straitjacket and arms, and release of mature TGF-P3, are the key features distinguishing L-TGF-P3 from L-TGF-P1 and likely contribute to the unique function of TGF-P3 amongst TGF-P isoforms in palatogenesis.
[0318] Furthermore, three independent lines of evidence support the physiological relevance of integrin ocv[38-mediated TGF-P3 release from the L-TGF-03 / GARP complex for palatogenesis.1) Cleft palate is associated with human TGFB3 mutations in the furin cleavage site, demonstrating that release of mature TGF-(33 is required for its function10. 2) Cleft palate is associated with human TGFB3 mutations in the RGD site, which demonstrates that integrin binding is essential for L-TGF-P3 activation17,68. 3) Cleft palate develops in mice deficient in the av (itgav) or itgb8 subunits, but not itgbb, suggesting that cxvP8 is the key integrin involved in release of TGF-P3 from the TGF-p3 / GARP complex during palatogenesis69,70. Interestingly, the cleft palate phenotype in itgb8 null mice is only seen in a subset of live births69. We speculate that in a subset of mice the intrinsic flexibility of L-TGF-p3 and exposure of mature TGF-p3 even without integrin otv [38 binding provides sufficient basal TGF-p signaling for palatogenesis.
[0319] Outside of palatogenesis, recent work suggests the physiological relevance of release of TGF-p3 in immunosuppressive immunity. A subset of regulatory T-cells (Treg) exclusively releases mature TGF-P3, not TGF-P I or TGF-P271. Immune activation caused by a neutralizing antibody to mature TGF-P3 suggests that TGF-p3 released from these Treg have immunosuppressive function in vivo71. It is possible that this release is integrin-mediated since (Xv[38 may be expressed by Tregs72-74. In the human lung, TGF-p3 is increased in expression independently of TGF-P 1. If lgfb3 is conditionally deleted in mice, or mice are treated with TGF-P3 specific antibodies, they are protected from experimental lung fibrosis75. In this study, TGF-P2 was similarly implicated in lung fibrosis and like TGF-P3 was shown to have increased basal activation even without integrin binding75. Recently it was shown that the integrin txvP6 binds to an alternative integrin recognition motif in L-TGF-P2 and supports activation76. We speculate that the general activation / latency mechanisms of L-TGF-P2 and L-TGF-P3 are similar.
[0320] Broader implication of dynamic allostery mechanism in macromolecular complexes
[0321] Our data using this multicomponent model system provide evidence that redistribution of conformational entropy is a mode of allosteric regulation in a highly dynamic system. Protein dynamics are quantified as conformational entropy via the Boltzmann equation47. It has been demonstrated that protein dynamics can tune protein function without involving discrete conformational changes43. However, only until very recently, examples of such dynamics were limited to the level of side chain rotamer ensembles by X-ray crystallography or methyl or aminegroup dynamics of small proteins by NMR spectroscopy49. The av[38 / L-TGF-P / GARP complex provides a case study of a tunable functional endpoint (i.e., activation) that can be correlated with protein dynamics in a relatively large complex, providing an example of the utility of single particle cryo-EM in determining the biologic function of dynamic allostery in such complexes. It is very likely that dynamic allostery is a widespread mechanism to tightly regulate protein function, yet underappreciated, since methodology to decipher this new dimension in macromolecular protein function is only beginning to be applied. Single particle cryo-EM is one valuable tool to directly visualize conformational dynamics in larger protein complexes. Combining it with other technologies, such as hydrogen-deuterium exchange mass spectrometry and / or molecular dynamic simulations, etc., it is reasonable to anticipate that dynamic allostery driven by conformational entropy redistribution will be found to play an important mechanistic role in many biological systems.
[0322] Intrinsic conformational entropy in latency of the TGF-P superfamily
[0323] Of the 33 TGF-P superfamily members, most are non-latent, despite sharing common structural features with TGF-P: a prodomain separated by a furin cleavage site from C-terminal growth factor domains resulting in secretion of a prodomain noncovalently paired with a dimeric mature growth factor55. Current dogma is that latency of TGF-P superfamily members is determined by the ability of receptors to competitively displace the straitjacket of the prodomains to allow sufficient binding to the mature growth factor to initiate downstream signaling55. It follows that non-latent TGF-P superfamily members have unstable straitjackets, which has been attributed to fewer conserved basic and hydrophobic residues in C-terminal region of the al- helix of the straitjacket compared to L-TGF-P155. Only the three TGF-P isoforms are thought to be completely latent, along with a few others in the larger superfamily (i.e. GDF8, and GDF1 I)8’5577'78.
[0324] The high basal activity of L-TGF-P3 that we found was thus unexpected, which we attribute to the increased intrinsic entropy of straitjacket and lasso loops compared to TGF-P 1. We propose that the relative intrinsic entropy of the straitjacket and lasso is a general evolutionary strategy that controls the degree of latency of TGF-P superfamily members. Thus, as with L-TGF-P3, latency is clearly not absolute, but rather determined by the degree of intrinsic conformational entropy. Extending this concept to non-latent TGF-P superfamily members with available structures, all have highly flexible straitjacket and lasso loops, such asBMP9, BMP 10 and ActivinA suggesting that they have very high levels of intrinsic entropy which allows their growth factors to be freely exposed to receptors without requiring release. Overall, our data supports an alternative hypothesis where the extent of latency is a continuum controlled by the level of intrinsic entropy of the straitjacket, which when sufficiently high allows receptors to bind to exposed receptor binding domains of mature growth factors while still within the prodomain complex. Amongst the TGF-P superfamily, L-TGF- l , with its relatively low entropy appears to be an exception, rather than the rule.
[0325] Therapeutic implications
[0326] The general concept of latency of TGF-P activation is binary, it is either latent or active. In this concept, mature TGF-P when associated with LAP is absolutely latent and only when released is active. However, our data reveal a continuum of TGF-P activation determined by the basal level of entropy in the integrin free / apo state allowing mature TGF-P to interact with TGF- Rs within L-TGF-P, as well by entropy redistribution in the integrin bound state allowing further increase of exposure or release of mature TGF- .
[0327] The binary dogmatic view has led to therapeutic approaches targeting only released paracrine mature TGF-P using TGF-P receptor traps and antibodies or targeting only latent TGF- P using antibodies that stabilize L-TGF-P or L-TGF-P / GARP. The architecture and flexibility of the avP8 / L-TGF-p / GARP complex suggests highly flexible and unstable L-TGF-P / GARP antibody binding epitopes as well as multiple steric clashes that limit access of TGF-PR traps, or antibody inhibitors to TGF-P or TGF-PRs within the complex. Indeed, we have observed poor inhibitory activity of antibody inhibitors to TGF-P, TGF-PRs, L-TGF-pi / GARP or TGF-PR traps for avP8-mediated activation of TGF-P39. Thus, it is not surprising that, up to now, immuno-oncology clinical trials using approaches that target paracrine released TGF-P have been disappointing due to lack of efficacy79. Our results predict that antibodies that stabilize L- TGF-P might also face similar efficacy challenges in clinical trials if the activation mechanism is avP8-dependent21'80'81.
[0328] The new mechanistic insights revealed from our study also suggest why TGF-P function can be highly context dependent, given that dynamic allostery determines where and when TGF-P is activated, whether it signals as an autocrine factor while remaining associated with the latent complex or is released, and ultimately whether it can mediate a paracrine mode ofsignaling. Such an activation mechanism will determine if TGF-P is primarily directed to TGF-P presenting cell or to integrin-expressing cells, and to cells in close proximity or at a distance. Thus, targeting TGF-P activation is highly complex, but such complexity offers opportunities for targeting context-dependent directional TGF-P activation, which can be achieved at multiple levels either through targeting basal entropy, entropic redistribution, or release. Importantly, entropy redistribution can be manipulated to occur in different directions, as demonstrated by our findings (FIGS. 3F-3O). It remains to be determined how targeting each of these entropically- driven mechanisms will affect different pathologic scenarios. But overall, our results provide a structural framework for developing therapeutic approaches to inhibit the context-specific function of the three different TGF-Ps and argue against one-size-fits-all targeting strategies.Example 5: Materials and Methods
[0329] EXPERIMENTAL MODEL AND EXPERIMENTAL DETAILS
[0330] Mice
[0331] 129SX1V / J x C57BL / 6 Tgfbl fl / - mice (J ax) with loxP3 sites flanking tgfbl exon 3 were crossed to 129X1 SV / I x C57BL / 6 Rosa 26-cre mice (Ozgene) to create tgfbl+7~ mice which were intercrossed to produce tgfbl mice37 82. Tgfbl mice with a mutation in the furin cleavage site M13177.1c.l l84-5AG>GC (p.Arg278Ala) were created at Ozgene (Perth, WA, Australia) using a conditional knock-in strategy on a C57B1 / 6 background. The targeting vector consisting of 5’ homology arm containing tgfbl exon 3 followed a murine tgfbl cDNA minigene spanning exon 4-7, followed by a neomycin resistance cassette flanked by flippase recognition target sites (Frt), and the entire minigene and neo cassette flanked by loxP3 sites, which was inserted into intron 3, which was followed by exon 4, intron 4 and exon 5 with a mutation (AC to GC) in R278 to change the furin cleavage motif275RHRR278to275RHRA278(R278A) followed by a 3’ homology arm. Successful targeting and germline transmission was followed by excision of the Frt flanked neo cassette to create a conditional KI (cKI) allele. Upon cre-mediated recombination, the loxP3 wild-type tgfbl exon 4-7 cDNA minigene can be excised and replaced with the tgfbl R278A mutant allele. C57BL / 6 heterozygous tgfbl cKI / +) or homozygous (tgfbl cKl / cKl) mice were crossed to C57BL / 6 Rosa 26-cre mice (Ozgene). The resulting C57BL / 6 KI / WT mice were mated to WT 129X1SV / J mice to generate 129X1SV / J x C57BL / 6 tgfblR278A / +mice. Alternatively, 129X1SV / J x C57BL / 6 tgfbl CKIR:77A / + mice were crossed to 129X1 SV / J x C57BL / 6Rosa 26-ae / WTmice (Ozgene) to create knock-in tgfblR27SA / +mice. Initialgenotyping was performed using tail genomic DNA isolated and genotyped by PCR (Kapa) using primers TGFbl IF, and TGFB1 KI / cKI 4R which produce a 654 bp band for the KI and 620 bp band for the WT allele. Subsequent genotyping was performed using WT or KI specific primers (TGFb F WT only or TGFb F KI only, paired with TGFb WT / KI rev) TgfblR278A7+mice breeding pairs from either strategy were intercrossed to produce tgfblR278A / tgfblR278Amice. Mice were screened for flippase (Flp) rosa 26-cre using a primer mixture (ROSAWT F, ROSAFlp F, ROSAcre F, ROSA R) and flp + mice removed from the colony. WT, tgfblR278A / tgfblR278Aox tgfblR278A / tgfblWTmice heterozygous or null for Rosa 26-cre and null for Flp were intercrossed and used for survival experiments. Live litters containing KI / KI mice were produced from intercrossing tgfblR278A / tgfblR278Aor tgfblli278A / tgfblWTmice, or crossing tgfblR278A / tgfblR278Ato tgfblR278A / tgfblm.To confirm mutant mRNA production from the KI and knock-out alleles, RNA was extracted from tail clippings, cDNA synthesized and amplified using the respective primer pairs tgfbl Ex3 / 4 cDNA F and tgfbl ex 6 / 7 cDNA R, and tgfbl Exl / 2 cDNA F and tgfbl Ex4 / 5 cDNA R and the products sequenced. To confirm the absence of mature TGF- l protein in the KO and absence of released mature TGF-p I in the KI mice, immunoblots were performed using an antibody to mouse mature TGF-pi (Abeam, abl79695). Serum was precleared 3 times with Protein G Sepharose beads to deplete IgG prior to immunoblotting. Spectral flow cytometry was performed on peripheral blood, or spleen from tgfbl'7', KI / KI (tg b / A27SA / tgfblR278A) or appropriate age and littermate matched controls (WT / WT. WT / KO or WT / KI). Histologic analysis of various organs were scored on an inflammation scale of 0-3 (0 = no inflammation; 1 = scattered lymphocytes infiltrating into tissues; 2 = distinct aggregates of lymphocytes infiltrating into tissues; 3 = diffuse inflammation infiltrating tissue in dense sheets of lymphocytes). Total inflammation score represents the sum of all individual organ inflammation scores.
[0332] Cell lines
[0333] Transformed mink lung TGF-P reporter cells (TMLC)52were a gift from J. Munger (New York University Medical Center, New York, NY, USA) and were stably transfected with L-TGF-pi (RGD / RGD), L-TGF-pi (RGD / RGE), L-TGF-pi (RGE / RGE), L-TGF-P3 (RGD / RGD), L-TGF-P3_lasso3 with or without GARP, as previously described13. TMLC cells were grown in DMEM + 10% FBS + penicillin- streptomycin + amphotericin B, cultured at 37°"C in a humidified incubator, 5% CO2.
[0334] MFB-F11 cells were a gift from Tony Wyss-Coray (Stanford University, School of Medicine). MFB are a mouse fibroblast line from tgfbl-l- mice which were stably transfected with an SBE-SEAP reporter cassette with a hygromycin resistance cassette and clone Fl 1 isolated by limiting dilution57. MFB-F11 cells were stably transduced with human ITGB8 construct using retroviral particles from the Phoenix amphotropic viral packaging cell line (Phoenix-AMPHO, ATCC). MFB-F11 cells were maintained in DMEM + 10% FBS + penicillin-streptomycin + amphotericin B, cultured at 37 °C in a humidified incubator, 5% CO2. [38 expression was maintained by supplementing basal media with 5 pg / mL puromycin. Phoenix cells were maintained in DMEM + 10% FBS + penicillin-streptomycin + amphotericin B, cultured at 37 °C in a humidified incubator, 5% CO2.
[0335] DNA constructs
[0336] The following cDNA constructs were used: [38 cDNA pBABE puro, avfl pcDM8, avtr pcDM8, (38tr pcDNAlneo, p8fl pcDNAlneo13-34; pLX307 hTGF-(31 IRES2 EGFP (h preceding protein name indicates human from here forward) was constructed from TGF- l_pLX307 (Plasmid #98377, AddGene) to remove a c-terminal V5 tag by cloning a PCR fragment created with primers (5’- caggtgtcgtgaggctagcatcg-3’ (SEQ ID NOG), and 5’ -gcgccactagtctcgagttatcag- 3’ (SEQ ID NO:4)) which was used as a backbone to generate pLX307 hTGF- l RGE_IRES2 EGFP puro, pLX307 hTGF-pl RGD_R249A_IRES2 EGFP puro, pLX307 hTGF-pl RGE_R249A_IRES2 EGFP puro, as described13, L-TGF-pl_RGD_Lasso3 (where the A31-L44 in lassol loop was swapped with T31-V42 from the L-TGF- 3 lasso3 loop) was made by splice overlap extension PCR using the primers (5’-ccatttcaggtgtcgtgaggc-3’ (SEQ ID NOG), 5’- ccctgagccaacggtgatgacccacgtccccgaggccgtgctcgc-3’ (SEQ ID NO:6), 5’- gtcatcaccgttggctcaggggggctggtgagccgcagcttggacag-3’ (SEQ ID NO:7), 5’-tggcgtagtagtcggcctc- 3’ SEQ ID NO:8)). HA-GARP pcDNA380was a gift from Sophie Lucas (Institut de Duve, Belgium), HIS SBP human GARP (hGARP) pcDNA6 was made using an N-terminal rat albumin signal peptide-His Tag-Strepravidin binding protein-HRV 3C protease tag (HIS SBP) from HIS SBP tagged porcine L-TGF- i pcDNA613as a template using primers (5’- ctctgatatcccaagctggctagccacc-3’ (SEQ ID NO:9), 5’-cagggcactttgtcttggtgaggaccctgaaacagcacctc- 3’ (SEQ ID NO: 10)) and joined by splice-overlap extension to a fragment amplified from HA GARP pcDNA683using primers (5’-ttagaggtgctgtttcagggtcctcaccaagacaaagtgccctg-3’ (SEQ ID NO:11), and 5 ’ -ccgctgtacaggctgttccc-3 ’ (SEQ ID NO: 12)), HIS SBP hGARP tr pcDNA6 wasmade by ligation of a PCR amplified fragment (HIS SBP hGARP fl pcDNA6 as a template with the primers 5’-agggccgtgtggacgtgg (SEQ ID NO:13), and 5’- tctcctcgagttatcagttgatgttcttcagtccccccttc-3’ (SEQ ID NO: 14)), HIS SBP hGARP tr pcDNA6 SpyCatcher was generated from HIS SBP-GARP tr pcDNA6 by gapping into the Xhol / Xbal cut plasmid a PCR fragment amplified from addgene-plasmid- 133447 (SpyCatcher) using primers (5’- ggggactgaagaacatcaacatgtcgtactaccatcaccatc-3’(SEQ ID NO: 15); 5’- ggcttaccttcgaagggcccttagctaccactggatccagta-3’(SEQ ID NO: 16)) using the Gibson Assembly Cloning Kit (NEB #E5510S). The entire human open reading frame and IRES RED cassette was transferred using Pmel / Spel from pLVE-hTGFB3-IRES-RED (Plasmid #52580, addgene) to replace the TGF-[31 reading frame and IRES GFP (Clal / Klenow, Spel) into TGF-Pl_pLX307 to create hTGF-[33 IRES RED, hTGF-p3 R277A IRES RED was made using splice overlap extension using PCR products (5’-ccatgtcacacctttcagccc-3’ (SEQ ID NO:17), 5’- gtccaaagccgccttcttcctctg-3 ’ (SEQ ID NO: 18); 5’-cagaggaagaaggcggctttggac-3’ (SEQ ID NO: 19), gtgttgtacagtcccagcacc (SEQ ID NO:20)), hTGF-(33 RGE_R277A_IRES RED was made using splice overlap extension using PCR products (5’- ggcgccccagttctccacgg-3’ (SEQ ID NO:21), 5’- ggcgccccagttctccacgg-3’ (SEQ ID NO:21); 5’-ggagaactggggcgcctcaag-3’ (SEQ ID NO:22), 5’- gtccaaagccgccttcttcctctg-3 ’ (SEQ ID NO: 18); 5’-cagaggaagaaggcggctttggac-3’ (SEQ ID NO: 19), 5’ -gtgttgtacagtcccagcacc-3’ (SEQ ID NO:26)), hTGF-P3 RGE_IRES RED was made using splice overlap extension using PCR products (5’- ggcgccccagttctccacgg-3’ (SEQ ID NO:21), 5’- gtccaaagccgccttcttcctctg-3 ’ (SEQ ID NO: 18); 5’- ggagaactggggcgcctcaag-3’ (SEQ ID NO:22), 5’-gtgttgtacagtcccagcacc-3’ (SEQ ID NQ:20)), hTGF-03 IRES GFP, hTGF-[33 RGE J RES GFP, hTGF-p3 R277A_IRES GFP and hTGF-£3 RGE_R277A_IRES GFP were made by cloning in the PCR fragment generated using TGF-pi_pLX307 as a template (5’- ctctacgcgtactagtggcgcgccgg-3’ (SEQ ID NO:25), 5’-ttacttgtacagctcgtccatgcc-3’ (SEQ ID NO:26)) and cloning into hTGF-p3 IRES RED, hTGF-p3 R277A_IRES RED, hTGF-p3 RGE_IRES RED and hTGF-p3 RGE_R277A_IRES RED, SBP HIS L-TGF-p3, SBP HIS L- TGF-p3 RGE, SBP HIS L-TGF-p3 R277A, SBP HIS L-TGF-p3 R277A_RGE, SBP HIS L- TGF-p3 C4S, SBP HIS L-TGF-03 C4S RGE, SBP HIS L-TGF-03 C4S R277A, and SBP HIS L- TGF-P3 C4S R277A_RGE all in pcDNA6 were made using splice overlap extension PCR to amplify the rat albumin signal peptide-HIS SBP-HRV 3C protease tag from HIS SBP L-TGF-p I pcDNA6 using primers specific for HIS SBP L-TGF-p3 C4WT (5’- gactcactatagggagacccaagctgg-3’ (SEQ ID NO:27), 5’- gtccaaggtggtgcaagtggacagggaccctgaaac-3’(SEQ ID NO:28); 5’ -ctgtccacttgcaccaccttggac-3’ (SEQ ID NO:29), 5’- ggtgagcctaagcttgctcaagatctg-3 ’ (SEQ ID NO:30)) or HIS SBP L-TGF-p3 C4S: 5’- gactcactatagggagacccaagctgg-3’ (SEQ ID NO:27), 5’- gtccaaggtggtgctagtggacagggaccctgaaac-3’ (SEQ ID NO:31); 5’- ctgtccactagcaccaccttggac-3 ’ (SEQ ID NO:32), 5’- ggtgagcctaagcttgctcaagatctg-3 ’ (SEQ ID NO:30)), and ligating the corresponding spliced products into hTGF-(33 IRES GFP, hTGF-p3 RGE_IRES GFP, hTGF-p3 R277A_IRES GFP and hTGF-[33 RGE_R277A_IRES GFP. All cDNA constructs were verified by sequencing. TGF-[3R2-Fc was previously described39.
[0337] Antibody isolation, characterization, and production
[0338] The following antibodies were used: and anti-P8 clone F12, which is high-affinity derivative of the parental clone C6D484created by combining rational structure based directed evolution to create a mutagenic Vh and VI domain library focused on amino acids to optimize the binding interface, displayed on the surface of yeast, and after multiple rounds of sorting, isolation and subcloning into murine IgG2a format, as described84, produced in ExpiCHO cells.
[0339] Expression and purification of proteins for functional assays and single particle cryo-EM
[0340] Secreted ectodomain of ocv|38 integrin was produced by transfecting ExpiCHO cells with integrin constructs13using the manufacturer’s protocol. Specifically, after 5 days growth, cell culture was centrifuged to collect supernatant, which was filtered through a PES (polyether sulfone) membrane, 0.2 pm pore size (Millipore). Protein purification is carried out by affinity chromatography using a column packed with Protein G crosslinked by antibody 8B8 which binds to civ integrin85. Bound av[38 is eluded from beads by washing the column with 100 mM glycine at pH 2.5. Flow through is immediately buffer adjusted by 2 M Tris-HCl pH 8, followed by size exclusion chromatography (Superose 6 Increase 10 / 300 GL, GE Healthcare) in 20 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM CaCh and 1 mM MgCl2.
[0341] Full length of av[38 integrin was produced by transfecting ExpiCHO cells with integrin constructs using the manufacturer’s protocol. Cells were harvested after 3 days growth. Cells were solubilized by rotation in 4 °C using solubilize buffer for 3 hrs (20 mM HEPES, pH 8.0, 150 mM NaCl, 1 mM CaC12, 1 mM MgC12, 10 mM DDM, 2 mM CHS and 2% OG, lx Protease Inhibitor Cocktail, EDTA-Free). Supernatant containing proteins were collected by centrifugedat 4,000 g followed by ultra-speed centrifuge at 45 ,000 rpm. Protein purification is carried out by affinity chromatography using a column packed with Protein G crosslinked by antibody C6D4F12 which binds to cxvp8 integrin. Bound full length avP8 is eluded from beads by washing the column with elution buffer (100 mM glycine at pH 2.5, 0.03% DDM). Flow through is immediately buffer adjusted by 2 M Tris-HCl pH 8.0, followed by size exclusion chromatography (Superose 6 Increase 10 / 300 GL, GE Healthcare) in 20 mM Tris-HCl pH 7.4, 150 mM NaCl, 0.03% DDM, 1 mM CaCh and 1 mM MgCh. av[38 in nanodisc was made by adding at a ratio of cxvp8fl: MSP-2N2: lipid equals to 1 : 4: 200 in 4 °C for 3 hrs, biobeads were added to remove the residue lipids over night by gentle rotation. czvpS in nanodisc was collected and further purified by size exclusion chromatography (Superose 6 Increase 10 / 300 GL, GE Healthcare) in 20 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM CaCh and 1 mM MgCh, the pooled and concentrated protein was subjected to SDS-PAGE, each protein size was identified to be corrected (FIG. 11 A).
[0342] Similarly, secreted L-TGF-P1 / GARP was produced by transient transfecting Expi293 cells with three different constructs, L-TGF-pi with R249A mutation, L-TGF-pi with R249A and RGE mutation, and ectodomain of GARP with N -terminal Strep-His tag. This strategy favors formation of L-TGF-P1 / GARP with a single intact RGD integrin binding motif. Cell culture was centrifuged to collect supernatant, which was filtered through a PES (polyether sulfone) membrane, 0.2 pm pore size (Millipore). Protein purification is carried out by using Ni- NTA agarose (QIAGEN), washed with three column volumes of 0.6 M NaCl, 0.01 M Tris (pH 8.0) and eluted with 0.25 M imidazole in Tris-buffered saline (TBS). The elution was then applied to Strep-tactin agarose (IBA) and washed with TBS (pH 7.4). To cleave the tag, 3.5 pl of commercial HRV-3C protease (Novagen, 1.8-3.0 U / pl) in TBS (pH 7.4) with 20% glycerol, was applied to the column, and incubated at 4°C overnight. The flow-through was washed with two column volumes of TBS (pH 7.4), then concentrated using centrifugal concentrators (Millipore) to about 1 mg / ml in 10 mM Tris (pH 7.4), 150 mM NaCl.
[0343] L-TGF-p3 was produced by transiently transfecting 293T cells with equal amounts of human L-TGF-p3 C4S_R277A_RGD and C4S_R277A_RGE plasmids.
[0344] C6D4F12 was produced by co-transfecting F12 VH pcDNA3.1 and F12 VL pcDNA3.1 into ExpiCHO cells and antibody purified using protein G agarose, as described13.
[0345] The homogeneity and purity of all protein preparations were verified by SDS-PAGE stained with Coomassie blue and protein concentrations were measured by nanodrop.
[0346] Mass photometry
[0347] Mass photometry experiments were performed with a Refeyn OneMP (Refeyn Ltd.). Each sample in TBS buffer with 1 mM CaCh, 1 mM MgCh of 16 pl was pipetted into the reaction chambers. Calibration was carried out by BSA, apoferritin and ADH. L-TGF-P1 / GARP, L-TGF-P3 / GARP, cxvp8, czvp8 / L-TGF-p l / GARP. and avp8 / L-TGF-p3 / GARP sample were diluted to 0.1 mg / ml, 1 pl of each sample was added to a 15 pl TBS with 1 mM CaCh and 1 mM MgCh buffer already pipetted into the reaction chamber. Image analysis was performed and analyzed by the software provided by Refeyn Ltd., with the default settings provided by the manufacturer.
[0348] Cryo-EM sample preparation
[0349] L-TGF-P 1 / GARP mixed with cxvp8 in I : I molar ration and incubated at room temperature for 30 min, the final protein complex concentration is 0.5 mg / ml. For cryo-EM grid preparation, 3 pl of the complex was deposited onto QU ANTIFOIL® R 1.2 / 1.3 on Au 300 mesh grids and UltrAuFoil® R 1.2 / 1.3 on Au 300 mesh grids. Grids were pre-glow-discharged for 30 s at 15 mA prior to sample application and freezing. The complexes were frozen using a FEI Vitrobot Mark IV using a 1 s blot time with blot force 1. All grids were frozen with 100% humidity at 22 °C and plunge-frozen in liquid ethane cooled by liquid nitrogen.
[0350] L-TGF-Pl / GARP-SpyCatcher was mixed with cxvp8 in 1:1 molar ratio and incubated at room temperature for 30 mins, the final protein complex concentration is 0.15 mg / ml. For cryo- EM grid preparation, 3 pl of the complex was deposited onto UltrAuFoil® R 1.2 / 1.3 on Au 300 mesh grids, covered with graphene oxide functionalized by Spy-tag86, washed by 10 pl TBS buffer 3 times, finally 3 pl TBS buffer was added. The complexes were frozen using a FEI Vitrobot Mark IV using a 3 s blot time, with 100% humidity at 22 °C and plunge- frozen in liquid ethane cooled by liquid nitrogen.
[0351] L-TGF-P 1 / GARP mixed with av 8fl-nd in 1 : 1 molar ration and incubated at room temperature for 30 min, the final protein complex concentration is 0.5 mg / ml. For cryo-EM grid preparation, 3 pl of the complex was deposited onto QU ANTIFOIL® R 1.2 / 1. on Au 300 mesh grids. Grids were glow-discharged for 30 s at 15 mA prior to sample application and freezing.The complexes were frozen using a FEI Vitrobot Mark IV using a 1 s blot time. All grids were frozen with 100% humidity at 22 °C and plunge-frozen in liquid ethane cooled by liquid nitrogen.
[0352] To prepare the complex of L-TGF-[33 / GARP with cxvp8, the molar ratio was 1 : 1, and incubated at room temperature for 30 min, the final protein complex concentration is 0.5 mg / ml. For cryo-EM grid preparation, 3 pl of the complex was deposited onto QU ANTIFOIL® R 1.2 / 1.3 on Au 300 mesh grids, grids were glow-discharged for 30 s at 15 mA prior to sample application and freezing. The complexes were frozen using a FEI Vitrobot Mark IV using a 1 s blot time. All grids were frozen with 100% humidity at 22 °C and plunge-frozen in liquid ethane cooled by liquid nitrogen.
[0353] To prepare the complex of L-TGF-P1 / GARP and L-TGF-p3 / GARP, the concentration is 0.3 mg / ml. For cryo-EM grid preparation, 3 pl of the complex was deposited ...
Claims
WHAT IS CLAIMED IS:
1. A method of detecting entropy redistribution in a protein complex, said method comprising:(i) binding a first protein to a second protein thereby forming a protein complex;(ii) measuring a first entropy distribution in said first protein bound to said second protein;(iii) measuring a second entropy distribution in said second protein bound to said first protein; and(iv) producing a modified protein comprising said first entropy distribution of said first protein in an energetically stabilized state.
2. A method of detecting entropy redistribution in a protein complex, said method comprising:(i) binding a first protein to a second protein thereby forming a protein complex;(ii) measuring a first entropy distribution in said first protein bound to said second protein;(iii) measuring a second entropy distribution in said second protein bound to said first protein; and(iv) producing a modified protein comprising said second entropy distribution of said second protein in an energetically stabilized state.
3. A method of detecting entropy redistribution in a protein complex, said method comprising:(i) measuring a first entropy distribution in a first protein that is unbound;(ii) measuring a second entropy distribution in a protein complex comprising said first protein bound to a second protein; and(iii) producing a modified protein comprising said second entropy distribution of said protein complex in an energetically stabilized state.
4. The method of any one of claims 1-3, wherein said second entropy distribution is the entropy of said first protein.
5. The method of any one of claims 1-3, wherein said second entropy distribution is the entropy of said second protein.
6. A method of detecting entropy redistribution in a protein complex, said method comprising:(i) measuring a first entropy distribution in a first protein that is unbound;(ii) binding said first protein to a second protein thereby forming a protein complex;(iii) measuring a second entropy distribution in said first protein bound to said second protein; and(iv) producing a modified protein comprising said second entropy distribution of said first protein in an energetically stabilized state.
7. A method of detecting entropy redistribution in a protein complex, said method comprising:(i) measuring a first entropy distribution in a first protein that is unbound;(ii) binding said first protein to a second protein thereby forming a protein complex;(iii) measuring a second entropy distribution in said second protein bound to said first protein; and(iv) producing a modified protein comprising said second entropy distribution of said second protein in an energetically stabilized state.
8. A method of detecting entropy redistribution in a protein, said method comprising:(i) measuring a first entropy distribution in a protein that is unbound;(ii) measuring a second entropy distribution in a protein complex comprising said protein bound to a ligand; and(iii) producing a modified protein comprising said first entropy distribution of said protein in an energetically stabilized state.
9. The method of any one of claims 1-8, wherein said first entropy distribution and said second entropy distribution are independently detected by cryo-electron microscopy.
10. The method of any one of claims 1-8, wherein said first entropy distribution and said second entropy distribution are independently detected in silico.
11. The method of claim 10, wherein said first entropy distribution and said second entropy distribution are independently detected by protein resolution or density mapping.
12. The method of claim 10, wherein said detecting in silico comprises a computer implemented detection mode.
13. The method of any one of claims 1-12, wherein said first protein is an immune checkpoint receptor protein.
14. The method of any one of claims 1-13, wherein said first protein is expressed by a T cell.
15. The method of any one of claims 1-14, wherein said first protein is a TGF-beta protein, a PD-1 protein, a CTLA-4 protein, an a CD28 protein, a TCR protein, a LAG-3 protein, a CD226 protein, a TIGIT protein, a CD96 protein, a BTLA protein, a B7-H3 protein, a VISTA protein, a TIM-3 protein, an ICOS protein, a GARP protein, a NRROS protein, an 0X40 (CD134) protein, or an ICAM protein.
16. The method of any one of claims 1-15, wherein said second protein is an immune checkpoint receptor ligand.
17. The method of any one of claims 1-16, wherein said second protein is expressed by an antigen presenting cell or a tumor cell.
18. The method of any one of claims 1-17, wherein said second protein is an integrin protein, a PDL-1 protein, a CD80 protein, a CD86 protein, an MHC-II protein, a Galectin-3 protein, a FGL1 protein, a CD112 protein, a CD155 protein, a HVEM protein, a NECTIN 4 protein or a Ceacam 1 protein.
19. The method of any one of claims 1-18, wherein the modified protein includes a cysteine-cysteine stabilizing mutation.
20. The method of any one of claims 1-19, wherein said modified protein forms part of a lipid bilayer composition.
21. The method of claim 20, wherein said lipid bilayer composition is a lipid nanodisc.
22. The method of any one of claims 1-21, wherein said modified protein comprises the amino acid sequence of SEQ ID NO: 179, SEQ ID NO: 180, SEQ ID NO:181, SEQ ID NO: 182 or SEQ ID NO: 183.
23. The method of any one of claims 1-22, further comprising producing an antibody that specifically binds to said modified protein.
24. The method of any one of claims 1 -22, further comprising immunizing a mammal with said modified protein thereby producing an entropy-specific antibody.
25. The method of claim 24, wherein said entropy- specific antibody is an IgG.
26. The method of claim 24 or 25, wherein said entropy-specific antibody comprises a flexible linker.
27. The method of any one of claims 24-26, wherein said entropy- specific antibody is administered to a subject in need thereof for the treatment of a disease.
28. The method of claim 27, wherein said disease is cancer, an inflammatory disease or an autoimmune disease.
29. A method of identifying an entropy-redistributing antibody, said method comprising:(i) contacting a protein complex comprising a first protein bound to a second protein with an antibody;(ii) detecting a first entropy of said first protein and a second entropy of said second protein; and(iii) identifying said antibody as an entropy-redistributing antibody, wherein if said first entropy or said second entropy is different relative to the entropy of said first protein or said second protein prior to said contacting of said antibody.
30. An antibody comprising a light chain variable domain and a heavy chain variable domain, wherein said light chain variable domain comprises: a CDR LI as set forth in SEQ ID NO:33, a CDR L2 as set forth in SEQ ID NO:34 and a CDR L3 as set forth in SEQ ID NO:35; and wherein said heavy chain variable domain comprises: a CDR Hl as set forth in SEQ ID NO:36, a CDR H2 as set forth in SEQ ID NO:37, and a CDR H3 as set forth in SEQ ID NO:3831. The method of claim 30, wherein said antibody is a humanized antibody.
32. The method of claim 30, wherein said antibody is a chimeric antibody.
33. The method of claim 30, wherein said antibody is an IgG.
34. The method of claim 30, wherein said light chain variable domain comprises the sequence of SEQ ID NO: 43, SEQ ID NO:94, or SEQ ID NO: 141.
35. The method of claim 30, wherein said heavy chain variable domain comprises the sequence of SEQ ID NO: 48, SEQ ID NO: 102, or SEQ ID NO: 142.
36. The method of claim 30, is specific for an entropic state of TGF-beta 1.
37. The method of claim 30, is specific for an entropic state of TGF-beta 3.
38. An isolated nucleic acid encoding an antibody of any one of claims 30- 36.
39. A pharmaceutical composition comprising a therapeutically effective amount of an antibody of any one of claims 30-36 and a pharmaceutically acceptable excipient.
40. A method of treating cancer in a subject in need thereof, said method comprising administering to a subject a therapeutically effective amount of an antibody of any one of claims 30-36, thereby treating cancer in said subject.
41. The method of treating cancer of claim 40, wherein the cancer is alveolar soft part sarcoma, basal cell skin cancer, B-cell lymphoma, bile duct cancer, bladder cancer, cervical cancer, classical Hodgkin lymphoma, colorectal cancer, cutaneous squamous cell cancer, endometrial cancer, esophageal cancer, head and neck squamous cell cancers, kidney cancer, liver cancer, lung cancer, melanoma, merkel cell cancer, mesothelioma, stomach cancer, or triple-negative breast cancer.
Citation Information
Patent Citations
Conformational entropy in molecular recognition
US20100285608A1