Pharmaceutical composition for preventing or treating ophthalmic diseases comprising NR2f1 inhibitor
The use of NR2F1 inhibitors, delivered via expression vectors, addresses the lack of effective treatments for age-related macular degeneration by reversing retinal cell aging and improving visual function, providing a stable and immunologically favorable therapeutic approach.
Patent Information
- Application Number
- PCT/KR2024/018450
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-02-07
- Filing Date
- 2024-11-21
- Publication Date
- 2025-08-14
AI Technical Summary
Current treatments for age-related macular degeneration, particularly atrophic forms, lack effective fundamental therapies that can reverse retinal cell aging and improve visual function, with existing treatments showing limited efficacy and significant side effects.
Development of a pharmaceutical composition using NR2F1 inhibitors, specifically short hairpin RNA (shRNA) delivered via expression vectors like AAV and lentivirus, to inhibit NR2F1 expression, thereby reversing retinal cell aging and promoting visual function recovery.
The NR2F1 inhibitor composition effectively reduces cell aging and enhances visual function by stabilizing expression and activity of NR2F1, offering a long-term treatment option with reduced immunogenic risk and improved efficacy compared to existing therapies.
Smart Images

Figure KR2024018450_14082025_PF_FP_ABST
Abstract
Description
Pharmaceutical composition for preventing or treating ophthalmic diseases comprising an NR2F1 inhibitor
[0001] The present invention relates to a pharmaceutical composition for preventing and treating ophthalmic diseases, and more particularly, to a pharmaceutical composition for preventing or treating ophthalmic diseases comprising an inhibitor of the expression or activity of NR2F1.
[0002] Age-related macular degeneration (AMD) is the leading cause of blindness in people over 65 years of age in many developed countries. It is known that the most important cause of this disease is the functional decline and age-related atrophy of the retinal pigment epithelium (RPE), which plays a crucial role in maintaining the homeostasis and physiological function of the retina, which plays a key role in visual function in all species of animals. In addition, it is thought that abnormal changes due to age-related changes in Bruch's membrane, which acts as the basement membrane of the RPE, and degeneration of the choriocapillaris, which is located at the outermost layer of the RPE and the neural retina and supplies nutrients and oxygen to the photoreceptor cells where phototransduction occurs, may also play a role.
[0003] Depending on the phenotype exhibited by these changes, age-related macular degeneration is largely classified into two types: dry AMD, which is characterized by degeneration and functional decline of the RPE, Bruch's membrane, and choriocapillaris, and wet AMD, which has the characteristics of dry AMD but is accompanied by choroidal neovascularization (CNV). About 10% of dry macular degeneration progresses to wet macular degeneration, which causes neovascularization (due to an inflammatory reaction), edema, and hemorrhage, while the remaining patients do not develop neovascularization, but develop atrophy due to apoptosis of the RPE and photoreceptor cells, which induces atrophic macular degeneration.
[0004] Treatment for wet AMD has been available since around 2005, using intravitreal injections of anti-vascular endothelial growth factor (anti-VEGF) to inhibit neovascularization. Currently, new drugs with a long duration of effect and that can act on additional targets that can reduce neovascularization in addition to VEGF are being released, and the rate of blindness due to wet AMD is decreasing significantly.
[0005] However, atrophic macular degeneration has not yet had a clear treatment, and recommendations include antioxidant supplements, smoking cessation, exercise, and improved diet. Patients gradually lose their sight, but their lifespans are increasing, increasing the period of restricted daily activities and increasing the socioeconomic losses associated with the suffering of family members. Atrophic age-related macular degeneration, however, has no specific treatment beyond observation, even in the medical field. However, the number of patients is steadily increasing.
[0006] Atrophic macular degeneration was confirmed to be associated with mutations in complement, suggesting that excessive complement activity is the cause of the disease. In 2023, a drug that modulates C3 complement function (SYFOVRE™ [pegcetacoplan injection]) became the first FDA-approved drug for atrophic macular degeneration, and it was confirmed that the rate of atrophy due to the drug decreased by about 20% per year. However, there was no significant improvement in visual acuity, and instead, serious side effects such as choroidal neovascularization and ischemic optic neuropathy were observed. In addition, an antibody drug that modulates C5 complement function (IZERVAY™ [Avacincaptad pegol]) has the limitation of only inhibiting the progression of atrophy rather than improving visual function. Fundamental treatments or therapies such as inhibition or regeneration of retinal nerve degeneration have still not been developed. Therefore, the development of a fundamental treatment for atrophic macular degeneration different from the existing ones is urgently needed.
[0007] Meanwhile, NR2F1 (Nuclear Receptor Subfamily 2 Group F Member 1) is a transcriptional regulator belonging to the steroid / thyroid hormone receptor superfamily. It functions as a dimer upon binding to DNA and plays a crucial role in assembling two highly conserved domains: a zinc-finger DNA-binding domain (DBD) and a putative ligand-binding domain (LBD). NR2F1 is intricately involved in various brain developmental processes, including regulation of neuronal excitability in the developing neocortex, cortical patterning, and neurogenesis.
[0008] Haplodeficiency of NR2F1 is associated with a single-gene neurodevelopmental syndrome known as Bosch-Boonstra-Schaaf optic atrophy syndrome, which is a key factor in early retinal and optic nerve head development and visual system maturation (neurogenesis of the visual system). NR2F1 is expressed at varying levels in virtually all cells within the developing mouse retina and the inner nuclear layer (INL) of the mature mouse retina, and is particularly expressed in amacrine cells of the mature mouse retina. Furthermore, overexpression of NR2F1 promotes the differentiation of amacrine and cone photoreceptor cells, but leads to a loss of rod photoreceptors in mouse retinal explant cultures.
[0009] However, the role of NR2F1 in age-related ophthalmic diseases and the possibility of treating ophthalmic diseases by regulating NR2F1 expression are currently unknown, and no treatment for retinal diseases using domestic or foreign reverse aging technology has yet been developed.
[0010] Accordingly, the present inventors confirmed the role of NR2F1 in aging, and confirmed the therapeutic effect of retinal degenerative disease through regulation of NR2F1 expression by inhibiting the transcription factor NR2F1 and reversing retinal cell aging, and developed a treatment suitable for ophthalmic diseases, particularly dry macular degeneration, including an NR2F1 inhibitor.
[0011] The present invention provides a pharmaceutical composition for preventing or treating ophthalmic diseases comprising an NR2F1 inhibitor.
[0012] The present invention also provides a method for treating an ophthalmic disease, comprising administering an NR2F1 inhibitor.
[0013] In addition, the present invention provides a method for treating an ophthalmic disease, comprising administering an effective amount of an NR2F1 inhibitor to a subject in need thereof for preventing or treating an ophthalmic disease.
[0014] The present invention also provides the use of an NR2F1 inhibitor in the manufacture of a medicament for the prevention or treatment of ophthalmic diseases.
[0015] The present invention also provides an NR2F1 inhibitor for use in the prevention or treatment of ophthalmic diseases.
[0016] Also provided is an ophthalmic preparation comprising a pharmaceutical composition according to the present invention.
[0017] The present invention provides a pharmaceutical composition for preventing or treating ophthalmic diseases comprising an NR2F1 (Nuclear Receptor Subfamily 2 Group F Member 1) inhibitor.
[0018] The NR2F1 inhibitor according to the present invention may be an expression inhibitor of the NR2F1 gene or an activity inhibitor of the NR2F1 protein.
[0019] The inventors of the present invention confirmed that increased expression of NR2F1 is associated with cellular aging, and confirmed that visual function can be restored by inducing reverse aging by inhibiting the expression or activity of NR2F1 using an NR2F1 inhibitor.
[0020] In particular, unlike wet macular degeneration, which causes retinal edema, hemorrhage, and fibrotic scarring due to choroidal neovascularization, dry macular degeneration (Dry AMD) does not cause neovascularization, but causes macular atrophy due to apoptosis of RPE and photoreceptor cells. The etiology of this atrophic macular degeneration (a progressive form of dry macular degeneration) is diverse and has not yet been clearly identified, but the occurrence and deterioration due to cellular senescence of the RPE has recently emerged as one of the etiologies. Therefore, from a regenerative medicine perspective, an anti-aging treatment that can suppress neurodegeneration could be a fundamental treatment, but none has been developed worldwide yet. Therefore, the NR2F1 inhibitor according to the present invention can exhibit excellent therapeutic efficacy by exhibiting the effect of RPE anti-aging, thereby enabling more fundamental treatment in dry / atrophic macular degeneration.
[0021] The above “NR2F1 (Nuclear Receptor Subfamily 2 Group F Member 1)” is also known as COUP-TF1 (COUP Transcription Factor 1) and is a transcriptional regulator belonging to the steroid / thyroid hormone receptor superfamily. It is known that Bosch-Boonstra-Schaaf Optic Atrophy syndrome is caused by an abnormality in the NR2F1 gene, but there has been no research and development on a therapeutic agent that utilizes the relationship between aging and NR2F1.
[0022] The NR2F1 inhibitor of the present invention may be at least one selected from the group consisting of siRNA (short interfering RNA), shRNA (short hairpin RNA), miRNA (micro RNA), ribozyme or antisense oligonucleotide that complementarily binds to NR2F1; or a compound, peptide, peptide mimetics, aptamer and antibody or antigen-binding fragment of an antibody that specifically binds to RNPS1.
[0023] Preferably, it may be a shRNA (short hairpin RNA) that suppresses the expression of the NR2F1 gene, and the shRNA may be delivered by an expression vector in order to deliver the therapeutic agent through an appropriate administration route due to the nature of the ophthalmic disease.
[0024] In the present invention, the term "short hairpin RNAs (shRNA)" refers to double-stranded RNAs (dsRNAs) that are artificially introduced into cells to induce RNA interference (RNAi), and are dsRNAs that are introduced into cells using a plasmid or vector-based system to provide short interfering RNAs (siRNAs) within the cells.
[0025] The term "shRNA targeting the NR2F1 gene" refers to shRNAs that induce RNAi activity against the NR2F1 gene. The NR2F1 gene is known from Gene Bank and other sources.
[0026] Accordingly, a desirable shRNA (short hairpin RNA) can be synthesized by considering a gene sequence known in Gene Bank, etc. Any sequence that induces RNAi phenomenon for the NR2F1 gene is included in the shRNA sequence of the present invention. Exemplary sequences thereof include sequences of SEQ ID NO: 4, SEQ ID NO: 11 to 21, etc. According to one embodiment of the present invention, the base sequence of SEQ ID NO: 4 was used.
[0027] The shRNA for the above NR2F1 inhibitor may preferably be included in an expression vector.
[0028] More specifically, the shRNA of sequence number 4 may have been applied to the expression vector.
[0029] In addition, the term "siRNA (small interfering RNA)" used in the present invention refers to a short double-stranded RNA that can induce RNA interference (RNAi) through the cleavage of a specific mRNA. It is composed of a sense RNA strand having a sequence homologous to the mRNA of a target gene and an antisense RNA strand having a sequence complementary thereto. Since siRNA can suppress the expression of a target gene, it is provided as an efficient gene knock-down method or as a method of gene therapy.
[0030] siRNA (small interfering RNA) can usually be synthesized by considering the known gene sequences in Gene Bank, etc. Exemplary sequences thereof are described as sequences of SEQ ID NOs: 22 to 31 (SEQ ID NOs: 22-23, 24-25, 26-27, 28-29, 30-31 matching). Retinal diseases such as macular degeneration require topical drug administration to the eye. However, commonly used anti-VEGF antibody drugs such as Lucentis and Eylea require dozens of repeated direct administrations to the eye in many patients, which patients usually feel great resistance to. In contrast, the shRNA included in the expression vector according to the present invention can improve the existing therapeutic methods in that it can exhibit long-term therapeutic efficacy even with a single administration.
[0031] In addition, the NR2F1 inhibitor according to the present invention as a treatment for retinal diseases has the advantage of being able to target and deliver therapeutic genes to retinal cells through subretinal or intraocular injection, allowing for long-term stable expression, and reducing the risk of mutations by preventing integration into the patient's genome, thereby reducing the potential risk of inserting new genetic material. In addition, it is a vector with generally low immunogenicity, and in particular, the retina and RPE are immune privileged tissues, reducing the possibility of immune-mediated rejection or destruction of the therapeutic vector, which can potentially further improve the efficacy and longevity of the treatment.
[0032] In particular, siRNA, shRNA, miRNA, ribozymes, and other RNAs that bind complementarily to common genes are difficult to apply directly to the eye. Therefore, the present invention utilizes shRNAs contained within expression vectors, thereby enhancing therapeutic efficacy and designing them in a form suitable for actual clinical applications.
[0033] The above expression vector may be a viral vector, a plasmid, or a non-viral vector.
[0034] The above viral vectors include adeno-associated virus (AAV) vectors, adenovirus vectors, lentivirus vectors, herpes simplex virus vectors, baculovirus vectors, Sendai virus vectors, retrovirus vectors, etc., and preferably, the expression vector may be a lentivirus or adeno-associated virus (AAV) vector.
[0035] In the present invention, the NR2F1 inhibitor may be a recombinant AAV (rAAV) vector or lentiviral vector into which an shRNA that suppresses the expression of the NR2F1 gene or the activity of the protein is inserted. More specifically, it may be a recombinant AAV (rAAV) vector or lentiviral vector into which an shRNA of SEQ ID NO: 4 is inserted.
[0036] "rAAV" refers to a viral particle comprised of an encapsidated polynucleotide rAAV vector comprising at least one AAV capsid protein and a heterologous polynucleotide (i.e., a polynucleotide other than the wild-type AAV genome, e.g., a transgene to be delivered into a mammalian cell). The rAAV particle may have any AAV serotype, including any modification, derivative, or pseudotype (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or AAV10 or derivatives / modifications / pseudotypes thereof). Such AAV serotypes and derivatives / modifications / pseudotypes and methods for producing such serotypes / derivatives / modifications / pseudotypes are known in the art (see, e.g., Asokan et al., Mol. Ther. 20(4):699-708 (2012)). In some embodiments, the rAAV particle comprises AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV.PHP.eB, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, It may be any one selected from AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15 and AAV.HSC16.
[0037] Additionally, rAAV particles include AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV.PHP.eB, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, A capsid protein from an AAV capsid serotype selected from AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15 and AAV.HSC16. In some embodiments, the rAAV particle comprises AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV.PHP.eB, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, A capsid protein that is a derivative, variant, or pseudotype of the AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, or AAV.HSC16 capsid protein.
[0038] The rAAV particles of the present disclosure can have any serotype or any combination of serotypes (e.g., a population of rAAV particles comprising two or more serotypes, e.g., two or more of rAAV2, rAAV8, and rAAV9 particles). In some embodiments, the rAAV particles are rAAV1, rAAV2, rAAV3, rAAV4, rAAV5, rAAV6, rAAV7, rAAV8, rAAV9, rAAV10, or other rAAV particles, or a combination of two or more thereof. In some embodiments, the rAAV particles are rAAV8 or rAAV9 particles. In some embodiments, the rAAV particle comprises AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV.PHP.eB, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, and AAV.HSC16. In some embodiments, the rAAV particle comprises capsid proteins from two or more serotypes selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.A capsid protein that is a derivative, variant or pseudotype of two or more serotypes selected from Anc80L65, AAV.7m8, AAV.PHP.B, AAV.PHP.eB, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15 and AAV.HSC16 capsid proteins.
[0039] In some embodiments, the rAAV particle has an AAV capsid protein of a serotype selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16, or a derivative, variant, or pseudotype thereof. In some embodiments, the rAAV particle has an AAV capsid protein of the serotype AAV8, AAV9, or a derivative, variant, or pseudotype thereof. In some embodiments, the rAAV particle has an AAV capsid protein of a serotype selected from the group consisting of AAV7, AAV8, AAV9, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.PHP.B, AAV.PHP.eB, and AAV.7m8.
[0040] According to one embodiment of the present invention, AAV 2 (phospholipase) / 8 (capsid domain) was used.
[0041] A “lentiviral vector” is a type of retrovirus. The vector is also referred to interchangeably as a lentiviral transfer vector. The lentiviral vector is inserted into the genomic DNA of a cell to be infected and stably expresses a gene. In addition, the vector can transfer a gene to dividing cells and non-dividing cells. Since the vector does not induce an immune response in the human body, expression is continuous. In addition, compared to the adenovirus vector, which is a conventionally used viral vector, it has the advantage of being able to transfer genes of a large size.
[0042] Lentiviruses include members of the bovine lentivirus family, the equine lentivirus family, the feline lentivirus family, the ovine lentivirus family, the caprine lentivirus family, and the primate lentivirus family. The development of lentiviral vectors for gene therapy is reviewed in the literature [Klimatcheva et al. (1999) Frontiers in Bioscience 4:481-496]. The design and use of lentiviral vectors suitable for gene therapy are described, for example, in U.S. Patent No. 6,207,455 and U.S. Patent No. 6,615,782. Examples of lentiviruses include, but are not limited to, HIV-1, HIV-2, HIV-1 / HIV-2 pseudotypes, HIV-1 / SIV, FIV, caprine arthritis encephalitis virus (CAEV), equine infectious anemia virus, and bovine immunodeficiency virus.
[0043] A recombinant lentivirus can be obtained through a step of transforming a host cell with the lentiviral vector, packaging plasmid, and envelope plasmid of the present invention; and a step of isolating the lentivirus from the transformed host cell.
[0044] The terms "packaging plasmid" and "envelope plasmid" as used herein refer to plasmids loaded with genes encoding proteins. In addition to lentiviral vectors, these plasmids may provide helper constructs (e.g., plasmids or isolated nucleic acids) necessary for lentivirus production. These constructs contain elements useful for producing and packaging lentiviral vectors in host cells. These elements may include structural proteins, such as GAG precursors; processing proteins, such as pol precursors; proteases, coat proteins, and expression and regulatory signals necessary for producing proteins and producing lentiviral particles in host cells.
[0045] For the production of recombinant lentiviruses, the Lenti-X Lentiviral Expression System from Clonetech Laboratories, packaging plasmids (e.g., pRSV-Rev, psPAX, pCl-VSVG, pNHP, etc.) or envelope plasmids (e.g., pMD2.G, pLTR-G, pHEF-VSVG, etc.) provided by Addgene can be used.
[0046] The above-mentioned expression vector can achieve expression of the desired shRNA through an operably linked sequence.
[0047] As used herein, the term "operably linked" refers to a functional linkage between a nucleotide expression control sequence (e.g., a promoter, signal sequence, or array of transcription factor binding sites) and another nucleotide, wherein the control sequence is capable of controlling the transcription and / or translation of the other nucleic acid sequence.
[0048] In the present invention, the promoter sequence may include a promoter sequence generally used in vector expression, a promoter sequence known to be specific to RPE cells, or a promoter sequence for overexpression. For example, general promoter sequences that may be used include a CMV (cytomegalovirus) promoter, an adenovirus late promoter, a vaccinia virus 7.5K promoter, an SV40 promoter, a tk promoter of HSV, an RSV U6 promoter, a promoter, an EF1 alpha promoter, a metallothionine promoter, a beta-actin promoter, a promoter of a human IL-2 gene, a promoter of a human IFN gene, a promoter of a human IL-4 gene, a promoter of a human lymphotoxin gene, a promoter of a human GM-CSF gene, and the like.
[0049] Promoters that can be used specifically for RPE cells include, for example, the BEST1 (VMD2) promoter, the RPE65 promoter, and the RDH5 promoter.
[0050] In addition, the vector according to the present invention may contain one or more suitable transcription initiation, termination, enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation (polyA) signals that stabilize mRNA in the cytoplasm, e.g., Kozak sequences; sequences that enhance translation efficiency or WPRE; sequences that enhance mRNA stability; Central polypyrimidine tract / central termination sequence (cPPT / CTS); Rev-responsive element (RRE) and, if desired, sequences that enhance secretion of the encoded product.
[0051] For example, the genetic construct according to the present invention may also comprise an enhancer. Such enhancers are viral enhancers, including but not limited to a CMV enhancer, a WPRE enhancer, an HPRE enhancer, a CTE enhancer, or derivatives or hybrids thereof.
[0052] Additionally, the genetic construct according to the present invention may comprise a Kozak sequence.
[0053] The packaging signal may be a 5' inverted terminal repeat (ITR) and a 3' ITR. For example, the genetic construct comprises AAV ITR sequences for use in an AAV vector. In one embodiment, the ITR is derived from a different AAV than the one supplying the capsid. In a preferred embodiment, the ITR sequence is derived from AAV2, or a deleted version thereof (ITR), which may be used for convenience and to accelerate regulatory approval. However, ITRs from other AAV sources may also be selected. When the source of the ITR is AAV2 and the AAV capsid is derived from another AAV source, the resulting vector may be designated a pseudotype. Typically, an AAV vector genome comprises an AAV 5' ITR, any coding sequence according to the invention, any regulatory sequence, and an AAV 3' ITR. However, other arrangements of the elements may also be suitable. A shortened version of the 5' ITR, termed ITR, has been described, which has a deletion of the D-sequence and terminal resolution site (trs). In another embodiment, full-length AAV 5' and 3' ITRs are used.
[0054] In some embodiments, the regulatory sequence comprises a polyadenylation (polyA) signal. In some embodiments, the polyA signal is a bovine growth hormone polyadenylation (bGH polyA) signal, a small polyA (SPA) signal, a human growth hormone polyadenylation (hGH polyA) signal, an SV40 polyA signal, an SV40 late polyA signal, or a derivative or hybrid thereof.
[0055] The genetic constructs according to the present invention can be modified as long as the identity of the construct is maintained. That is, the term "identical" or percent "identity", in the context of two or more nucleic acid or polypeptide sequences, refers to two or more sequences or partial sequences that have a specified percentage (i.e., preferably 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity) of the same or identical amino acid residues or nucleotides over a specified region (e.g., any of the modified ORFs provided herein when compared and aligned for maximum match over a comparison window or a designated region) as measured using the BLAST or BLAST 2.0 sequence comparison algorithm with the default parameters described below, or by manual alignment and visual inspection (see, e.g., the NCBI website).
[0056] The NR2F1 inhibitor of the present invention and a composition comprising the same can suppress the expression of any one or more genes selected from the group consisting of p16, p21, and p53. p16, p21, and p53 are aging markers, and when NR2F1 is overexpressed or aging progresses, the protein expression level of at least one of p16, p21, and p53 increases. Accordingly, the NR2F1 inhibitor of the present invention suppresses the protein expression level of any one or more of p16, p21, and p53.
[0057] The NR2F1 inhibitor of the present invention and the composition comprising the same can inhibit the expression of any one or more genes selected from the group consisting of CXCL10, IL-1β, IL-6, IL-18, and MMP9, which are senescence-associated secretory phenotypes (SASPs).
[0058] The pharmaceutical composition according to the present invention may be an ophthalmic composition for topical administration to the eye.
[0059] In the present invention, the ophthalmic disease is age-related macular degeneration (AMD), diabetic retinopathy, macular edema, cystoid macular edema, retinitis pigmentosa (RP), Leber's congenital amaurosis (LCA), Stargardt's disease, Usher's syndrome, choroidal plexus atrophy, rod-cone or cone-rod dystrophy, ciliopathies, mitochondrial disorders, progressive retinal atrophy, degenerative retinal diseases, familial or acquired maculopathy, sickle cell retinopathy, retinal pigment epithelium-system diseases, uveitis, retinal detachment, traumatic retinal damage, iatrogenic retinal damage, macular hole, macular telangiectasia, ganglion cell disease, optic nerve disease, glaucoma, optic neuropathy, ischemic retinal disease, retinopathy of prematurity, retinal vascular occlusion, polypoid choroidal vasculopathy, retinal hypoxia, familial macroneuropathy, retinal vascular disease, ocular vascular disease, retinal neuron degeneration due to glaucoma, It may be ischemic optic neuropathy, and preferably age-related macular degeneration (AMD). The age-related macular degeneration may be wet macular degeneration or dry macular degeneration, and more preferably dry macular degeneration. Furthermore, this macular degeneration may exhibit characteristics of atrophic macular degeneration.
[0060] The term “prevention” used in the present invention means any act of preemptively suppressing or delaying the onset of an ophthalmic disease by administering a pharmaceutical composition according to the present invention before the onset of the ophthalmic disease.
[0061] The term “treatment” used in the present invention means any action by which the symptoms of an ophthalmic disease are improved or beneficially changed by administering a pharmaceutical composition according to the present invention after the onset of the ophthalmic disease.
[0062] The present invention provides a method for treating an ophthalmic disease comprising administering an inhibitor of expression of the NR2F1 gene or an inhibitor of activity of the protein.
[0063] In addition, the present invention provides a method for treating an ophthalmic disease, comprising administering an effective amount of an expression inhibitor of the NR2F1 gene or an activity inhibitor of the protein to a subject in need thereof for the prevention or treatment of an ophthalmic disease.
[0064] It will be appreciated that NR2F1 inhibitors can be used in pharmaceutical formulations, and can be used as a single therapy for treating, alleviating, or preventing ocular diseases, or for inhibiting the aging process. Alternatively, NR2F1 inhibitors according to the present invention can be used in addition to or in combination with known treatments for treating, alleviating, or preventing ocular diseases, or for inhibiting the aging process.
[0065] The present invention also provides an NR2F1 inhibitor for use in the treatment of ophthalmic diseases.
[0066] The present invention also provides the use of an NR2F1 inhibitor in the manufacture of a medicament for use as a treatment for an ophthalmic disease.
[0067] The NR2F1 inhibitor according to the present invention can be combined in compositions having various different forms, particularly depending on the manner in which the composition is to be used. Thus, for example, the composition may be in the form of a powder, tablet, capsule, liquid, ointment, cream, gel, hydrogel, aerosol, spray, micelle solution, transdermal patch, liposomal suspension, or any other suitable form that can be administered to a human or animal in need of treatment. It will be appreciated that the carrier for the agent according to the present invention must be well tolerated by the subject to which it is administered.
[0068] In a preferred embodiment, the agent according to the present invention may be administered to a subject by injection into the bloodstream, nerves, or directly into the site requiring treatment. For example, this may be intraocular (subretinal injection and intravitreal injection), intravenous (bolus or infusion), subcutaneous (bolus or infusion), or intradermal (bolus or infusion).
[0069] It will be understood that the amount of NR2F1 inhibitor required will be determined by its biological activity and bioavailability, which in turn will depend on the route of administration, the physicochemical properties of the NR2F1 inhibitor, and whether it is used as a monotherapy or in combination therapy. The frequency of administration will also be influenced by the half-life of the circulating polypeptide within the subject being treated. The optimal dosage to be administered can be determined by those skilled in the art and will vary with the particular NR2F1 inhibitor being used, the strength of the pharmaceutical composition, the route of administration, and the progression or stage of the disorder. Depending on the particular subject being treated, additional factors including subject age, weight, sex, diet, and timing of administration will necessitate dosage adjustment.
[0070] In general, depending on the NR2F1 inhibitor used, the NR2F1 inhibitor according to the present invention can be used to treat, alleviate, or prevent ophthalmic diseases by intravitreal injection at a daily dose of 0.05 to 0.1 mL, or subretinal injection at a dose of up to 0.3 mL, but the dosage is not limited thereto.
[0071] The NR2F1 inhibitor may be administered before, during, or after the onset of the disease and / or disorder.
[0072] Known procedures, such as those commonly employed in the pharmaceutical industry (e.g., in vivo experiments, clinical trials, etc.), can be used to formulate specific formulations of the NR2F1 inhibitors according to the present invention and precise treatment regimens (e.g., daily dose and frequency of administration of the formulation).
[0073] In the present invention, the "subject" may be a vertebrate, mammal, or domestic animal. Therefore, the compositions and agents of the present invention may be used to treat any mammal, such as livestock (e.g., horses), pets, or in other veterinary applications. However, most preferably, the subject is a human.
[0074] A “therapeutically effective amount” of an NR2F1 inhibitor or pharmaceutical composition is any amount, as defined above, necessary to treat an ophthalmic disorder or to produce a desired effect, such as promoting nerve regeneration and / or survival, when administered to a subject.
[0075] A "pharmaceutically acceptable carrier" as referred to herein is any known compound or combination of known compounds known to those skilled in the art to be useful in formulating pharmaceutical compositions.
[0076] The pharmaceutical carrier may be liquid, and the pharmaceutical composition is in the form of a solution. Liquid carriers are used to prepare solutions, suspensions, emulsions, syrups, elixirs, and pressurized compositions. The genetic constructs or recombinant expression vectors according to the present invention may be dissolved or suspended in a pharmaceutically acceptable liquid carrier, such as water, an organic solvent, a mixture of both, or a pharmaceutically acceptable oil or fat. The liquid carrier may contain other suitable pharmaceutical additives, such as solubilizers, emulsifiers, buffers, preservatives, sweeteners, flavoring agents, suspending agents, thickeners, colors, viscosity modifiers, stabilizers, or tonicity modifiers. Suitable examples of liquid carriers for oral and parenteral administration include water (partially containing additives such as those described above, e.g., cellulose derivatives, preferably sodium carboxymethyl cellulose solution), alcohols (including monohydric and polyhydric alcohols, such as glycols) and their derivatives, and oils (e.g., fractionated coconut oil and arachis oil). For parenteral administration, the carrier may also be an oily ester, such as ethyl oleate and isopropyl myristate. Sterile liquid carriers are useful in sterile liquid form compositions for parenteral administration. Liquid carriers for pressurized compositions may be halogenated hydrocarbons or other pharmaceutically acceptable propellants.
[0077] Liquid pharmaceutical compositions, which are sterile solutions or suspensions, can be used, for example, by intraocular (subretinal and intravitreal injections), brainstem, intramuscular, intrathecal, epidural, intrathecal, intraperitoneal, intravenous, and subcutaneous injection. The genetic constructs or recombinant expression vectors can be prepared as sterile solid compositions that can be dissolved or suspended in sterile water, saline, or other suitable sterile injectable media for administration.
[0078] The NR2F1 inhibitors and pharmaceutical compositions of the present invention may be administered orally in the form of sterile solutions or suspensions containing other solutes or suspending agents (e.g., saline or glucose sufficient to render the solution isotonic), bile salts, acacia, gelatin, sorbitan monooleate, polysorbate 80 (the oleate ester of sorbitol and its anhydride copolymerized with ethylene oxide), and the like. The NR2F1 inhibitors or pharmaceutical compositions according to the present invention may also be administered orally in the form of liquid or solid compositions. Compositions suitable for oral administration include solid forms such as pills, capsules, granules, tablets, and powders, and liquid forms such as solutions, syrups, elixirs, and suspensions. Forms useful for parenteral administration include sterile solutions, emulsions, and suspensions.
[0079] The present invention provides an ophthalmic preparation comprising a pharmaceutical composition according to the present invention.
[0080] The above ophthalmic preparation may be in the form of, for example, eye drops, eye ointments, intraocular injections, ointments, etc., and is preferably, but not limited to, eye drops or skin delivery preparations. Such preparations may be manufactured according to methods commonly used in the art. As an ophthalmic topical administration form, the preparation may be in the form of drops, sprays, or gels, and another method is to administer the preparation to the eye using liposomes. In addition, the preparation may be injected into the tear film through a pump-catheter system. As an additional embodiment, the preparation may be incorporated into, carried by, or attached to a contact lens placed on the eye. In another embodiment, the preparation may be contained in a sponge or cotton swab that can be applied to the ocular surface, and a liquid spray that can be applied to the ocular surface may also be used.
[0081] Any feature described in this application (including all attached claims, abstract and drawings) and / or any step of any method or process so disclosed may be combined with any of the above embodiments in any combination, except combinations where at least some of such features and / or steps are mutually exclusive.
[0082] The NR2F1 inhibitor of the present invention has the effect of reducing cell aging of retinal pigment epithelial cells and restoring visual function by inhibiting the expression of the NR2F1 gene or the activity of the protein, thereby causing retinal cell aging.
[0083] For a better understanding of the present invention and to show how embodiments thereof may be carried out in practice, reference will now be made by way of example to the accompanying drawings, in which:
[0084] Figure 1 is a conceptual diagram illustrating the reverse aging of retinal pigment epithelial cells and improvement of visual function by the NR2F1 inhibitor of the present invention.
[0085] Figure 2 is a diagram showing an example of an AAV vector with Scramble inserted.
[0086] Figure 3 is a diagram showing an example of an AAV vector into which shNr2f1, an NR2F1 inhibitor of the present invention, is inserted.
[0087] Figure 4 is a diagram showing an example of a LV (lentivirus) vector with Scramble inserted.
[0088] Figure 5 is a diagram showing an example of an LV (lentivirus) vector into which shNr2f1, an NR2F1 inhibitor of the present invention, is inserted.
[0089] Figure 6 is a diagram showing the expression level of NR2F1 protein in retinal pigment epithelial cells of mice of different ages (3 weeks old, 3 months old, 6 months old, 12 months old, and 24 months old) confirmed by Western blotting.
[0090] Figure 7 is a diagram showing the results of confirming the expression patterns of aging-related genes and the NR2F1 gene in a human retinal pigment epithelial cell line (ARPE-19) induced to age with doxorubicin.
[0091] Figure 8 is a diagram showing changes in mRNA and protein expression of aging-related phenotypes confirmed by quantitative real-time PCR and Western blotting when NR2F1 was overexpressed in a human retinal pigment epithelial cell line (ARPE-19).
[0092] Figure 9 is a diagram showing changes in mRNA and protein expression of aging-related phenotypes confirmed by quantitative real-time PCR and Western blotting when NR2F1 was suppressed in a human retinal pigment epithelial cell line (ARPE-19) induced to age with doxorubicin.
[0093] Figure 10 is a diagram showing the change in the proportion of senescent cells in the retina and the mRNA expression of the senescence-associated secretory (SASP) phenotype when AAV-NR2F1 was injected subretinacularly in a young mouse model, as confirmed by β-galactosidase (SA-β-gal) staining and quantitative real-time PCR.
[0094] Figure 11 shows the changes in mRNA and protein expression of age-related phenotypes confirmed by quantitative real-time PCR, Western blotting analysis, and immunofluorescence staining of flat-mount RPE when AAV-shNR2F1 was subretinally injected in a mouse model of dry macular degeneration induced by NaIO3.
[0095] Figure 12 is a diagram showing the results of analyzing the effect of improving visual function in a mouse model in which dry macular degeneration was induced by NaIO3 when AAV-shNR2F1 was injected subretinally (Figure 12A: representative waveforms of a- and b-waves [top], representative waveforms of c-waves [bottom]; 12B: graphs of a-, b-, and c-waves).
[0096] Figure 13 is a diagram showing the change in the proportion of senescent cells in the retina when AAV-shNR2F1 was injected subretinally in an aged mouse model, confirmed by β-galactosidase (SA-β-gal) staining.
[0097] Figure 14 is a diagram showing the results of analyzing the effect of subretinal injection of AAV-shNR2F1 on improving visual function in an aged mouse model (Figure 14A: representative waveforms of a- and b-waves [top], representative waveforms of c-waves [bottom]; 14B: graphs of a-, b-, and c-waves).
[0098] The present invention will be described in more detail below through examples. However, these examples are intended to exemplify the present invention and the scope of the present invention is not limited to these examples.
[0099] The mice used in the following experimental examples or examples are C57BL / 6 mice, bred in a facility approved by the Institutional Animal Care and Use Committee (IACUC) of the Konkuk University Animal Research Institute, and managed and used in accordance with the protocol approved by the IACUC.
[0100] The adeno-associated virus (AAV) vector plasmid used in the examples below was purchased from VectorBuilder (USA).
[0101] [Example]
[0102] Example 1. Preparation of AAV vector containing shRNA Nr2f1
[0103] A pAAV[Exp]-U6>Scramble[shRNA#1]-mPGK>mCherry:WPRE AAV vector consisting of the base sequence represented by sequence number 1 and a pAAV[Exp]-U6>mNr2f1[shRNA#1]-mPGK>mCherry:WPRE AAV vector consisting of the base sequence represented by sequence number 2 were prepared.
[0104] AAV 2 (phospholipase) / 8 (capsid domain) was used as the AAV serotype, and the full-length sequences of the vectors are shown in sequence numbers 1 and 2 below, respectively.
[0105] - pAAV[Exp]-U6>Scramble[shRNA#1]-mPGK>mCherry:WPRE (SEQ ID NO: 1)
[0106] - pAAV[Exp]-U6>mNr2f1[shRNA#1]-mPGK>mCherry:WPRE (SEQ ID NO: 2)
[0107] The Scramble shRNA sequence and mNr2f1 shRNA sequence used here are shown in SEQ ID NOs. 3 and 4, respectively (the underlined sequences in SEQ ID NOs. 3 and 4 indicate sequences that function by complementary binding to the actual target mRNA).
[0108] Sequence number 3 (Scramble shRNA):CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG
[0109] Sequence number 4 (mNr2f1 shRNA): GCTACCTGTCTGGCTACATTTCTCGAGAAATGTAGCCAGACAGGTAGC
[0110] Example 2. Experimental preparation and experimental method
[0111] 2-1. Cell culture
[0112] The human adult RPE cell line APRE19 obtained from ATCC was used. Cells were cultured and maintained in Dulbecco's modified Eagle's medium:nutrient mixture F12 (DMEM / F12, 1:1, Invitrogen, Carlsbad, CA, USA) containing 10% fetal bovine serum (FBS) (12483-020, Thermo Fisher Scientific, Waltham, MA, US) and 1% penicillin / streptomycin (LS202-02, Thermo Fisher Scientific, Carlsbad, CA, USA) at 37°C in a humidified 5% CO2 atmosphere.
[0113] - Lentivirus production
[0114] Lentiviral plasmids were purchased from VectorBuilder (Chicago, IL, USA).
[0115] 1) Human empty vector control (pLV[Exp]-Puro-CMV>ORF_Stuffer) (SEQ ID NO: 5);
[0116] 2) Human NR2F1 OE vector (pLV[Exp]-Puro-CMV>hNR2F1[NM_005654.6] (SEQ ID NO: 6);
[0117] 3) shScramble: pLV[shRNA]-Puro-U6>Scramble_shRNA#1 (SEQ ID NO: 7);
[0118] 4) shNR2F1: pLV[shRNA]-Puro-U6>shNR2F1[ shRNA#1] (SEQ ID NO: 8)
[0119] The sequence numbers of each of these are shown in SEQ ID NOs: 5 to 8.
[0120] The hNR2F1 insertion sequence for overexpression is shown in SEQ ID NO: 9. In addition, the shScramble sequence and shNR2F1 sequence used are shown in SEQ ID NO: 10 or SEQ ID NO: 11, respectively.
[0121] Sequence number 9 (hNR2F1 insertion sequence):
[0122]
[0123] SEQ ID NO: 10 (shScramble): CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG
[0124] SEQ ID NO: 11 (shNR2F1): GTCCGCAGGAACTTAACTTACCTCGAGGTAAGTTAAGTTCCTGCGGAC
[0125] For lentivirus production, HEK293T cells (2.5x10 6 ) were pre-seeded overnight on 100-mm plates coated with poly-D-lysine (PDL). The medium was replaced with Opti-MEM 3 h before transfection. Lentiviral vectors were co-transfected into cell suspensions with the pMD2.G-VSV-G envelope plasmid and the psPAX2 packaging vector using Lipofectamin 3,000 (L3000001, Thermo Fisher Scientific, Waltham, MA, US) and incubated for 6 h before replacing with fresh DMDM. Viral supernatants were collected from HEK293T cells 36 h after medium replacement and passed through a 0.45-μm syringe filter (Merck Millipore, Burligton, MA, US) to remove cells.
[0126] - Lentiviral transduction
[0127] Overexpression of NR2F1
[0128] On day 0, ARPE-19 cells were seeded at 4.5 × 10 in 60 mm cell culture dishes. 5The cells were plated at a density of 100 μg / ml. The next day, cells were transduced with lentiviral vectors containing Stuffer or NR2F1 together with hexadimethrine bromide (8 μg / ml; polybrene) (TR-1003-G, Sigma-Aldrich). After 16 h of incubation, the cell culture medium was replaced with fresh DMEM / F12 containing 10% FBS and 1% p / s medium, and cells were harvested and analyzed two days later.
[0129] Knockdown of NR2F1
[0130] On day 0, 4.5 × 10 ARPE-19 cells were seeded in 60 mm cell culture dishes. 5 The cells were seeded at a density of 10 μg / mL. The following day, lentiviral transduction was performed using shScramble or shNR2F1. After 16 h of culture, the cell culture medium was replaced with fresh medium containing 5 μg / mL puromycin (ant-pr-1, InvivoGen, San Diego, CA). From day 3, the cells were exposed to puromycin and doxorubicin (250 nM) for 3 days, and this treatment was continued for the next 2 days. On day 7, the culture medium was replaced with fresh medium and maintained for 2 days. Two days later, the cells were harvested and analyzed.
[0131] 2-2. Animal testing
[0132] Eight-week-old male C57BL / 6 mice were used as experimental animals. Mice were raised in a facility certified by the Konkuk University Laboratory Animal Research Center, and the care and use of experimental animals were performed in accordance with a protocol approved by the Institutional Animal Care and Use Committee (IACUC, Approval No. KU23096) of Konkuk University, Seoul, Republic of Korea.
[0133] AAV vector plasmids were purchased from VectorBuilder (Chicago, IL, USA) and prepared as described in Example 1 above:
[0134] 1) AAV-shScramble: pAAV[Exp]-U6>Scramble[shRNA#1]-mPGK>mCherry:WPRE;
[0135] 2) AAV-mCherry-shNr2f1: pAAV[Exp]-U6>mNr2f1[shRNA#1]-mPGK>mCherry:WPRE.
[0136] Intraperitoneal injection (IP) was performed by injecting 25 mg / kg NaIO3 or an equivalent volume of PBS. Subretinal injection was performed by injecting adeno-associated virus (AAV) (AAV-shScramble = 1.0 x 10) using a blunt 35-gauge Hamilton microsyringe (Hamilton Company, NV, USA) under a light microscope (Olympus SZ51, Tokyo, Japan). 8 particles / mouse, AAV-mCherry-shNr2f1 = 1.0 x 10 8 particles / mouse).
[0137] Meanwhile, for the production of an overexpression model
[0138] 1) AAV-mCherry: pAAV[Exp]-CMV>mCherry:WPRE;
[0139] 2) AAV-mCherry-Nr2f1: pAAV[Exp]-CMV>mCherry / mNr2f1[NM_010151.3]:WPRE; was prepared as an AAV vector and injected subretinally in the same manner as mentioned above.
[0140] 2-3. RNA isolation and quantitative real-time PCR
[0141] Total RNA was isolated from harvested cells and mouse RPE using TRIzol reagent (15596018, Invitrogen, Carlsbad, CA, USA). RNA was reverse transcribed into complementary DNA using the iScript gDNA Clear cDNA Synthesis Kit (Bio-Rad, #1725035) according to the manufacturer's instructions. Quantitative real-time PCR (qRT-PCR) was performed using SYBR Green Supermix (Bio-Rad, #1725271) to quantify gene expression levels. Gene expression levels were normalized to the housekeeping gene (GAPDH), and the fold change in mRNA was calculated using relative quantification (2-ΔΔCt).
[0142] 2-4. Western blot analysis
[0143] Cells were washed with phosphate-buffered saline and proteins were extracted with cold RIPA lysis buffer (89901, Thermo Fisher Scientific, Waltham, MA, US). Protein concentration was measured using the BCA protein assay kit (A53225, Thermo Fisher Scientific, Waltham, MA, US). Equal amounts of protein were separated by electrophoresis on a 10–15% SDS-PAGE gel and transferred to a polyvinylidene difluoride (PVDF) membrane (ISEQ00010, Merck Millipore, Burligton, MA, US) in Tris-glycine-methanol buffer. The membrane was blocked with 5% skim milk (232100, BD Life Sciences, Franklin Lakes, NJ, US) in TBST buffer for 1 hour and incubated overnight at 4°C with the appropriate primary antibody. After washing with TBS-T for 20 minutes, the membrane was incubated with specific HRP-conjugated secondary antibody (1:5,000, A90-116P, Bethyl Laboratories, Montgomery, TX, USA) for 2 hours at room temperature. Bands were visualized with ECL chemiluminescent substrate (34580, Thermo Fisher Scientific, Waltham, MA, US) using Chemi Doc System (iBright CL1500 imaging system, Thermo Fisher Scientific, Waltham, MA, US). The signal intensity of primary antibody binding was quantified and normalized to that of the loading control (GAPDH), and the images were processed in ImageJ. The antibodies used in Western blot analysis are listed in Table 1.
[0144] AntibodyVendorCatalog No.Working Dilutionγ-H2AXabcamAb28931:1,000NR2F1abcamab968461:1,000NR2F1novusNBP1-312591:2,000p16BD Pharmingen5511531:2,000p21Santa cruzsc-62461:500P53Santa cruzSc-1261:500GAPDHCell Signaling14C1011:4,000VinculinSanta cruzsc-736141:500
[0145] 2.5. Immunofluorescence analysis
[0146] For cells, cells were washed three times with PBS and fixed with 4% paraformaldehyde for 15 minutes at room temperature. Cells were washed three times with PBS and permeabilized in PBS-0.1% Triton X-100 for 10 minutes. After washing with PBS (three times), cells were blocked in 3% bovine serum albumin (BSA)-PBS-0.1% Triton X-100 for 1 hour at room temperature. For antigen staining, cells were incubated overnight at 4°C with the appropriate concentration of primary antibodies (Table 2). The following day, cells were washed three times with PBS and incubated with secondary antibodies (1:300 Alexa Fluor #A-21247 (Rat647), #A-11029 (mouse488), #A-21424 (mouse555), #A-11034 (rabbit488), #A-21429 (rabbit555)) for 1 h at room temperature. Cells were then incubated with Hoechst (1:2,000) for 10 min, stored in PBS at 4°C, and samples were mounted with Aqua-Poly / Mount (Polysciences, #18606-20). Images were captured using a confocal microscope (Carl Zeiss, #LSM 900).
[0147] For tissues, RPE isolated from the indicated mice were fixed with 4% paraformaldehyde at 4°C for 1 hour and 30 minutes, washed with PBS, and permeabilized with 0.2% Triton X-100 for 5 minutes. The tissues were washed with 0.05% Triton X-100 for 5 minutes, blocked with 2% NGS in 3% BSA and 0.05% Triton X-100 for 2 hours at 4°C, and then stained with primary antibodies (Table 2) overnight at 4°C. The following day, the RPE were washed with 0.05% Triton X-100 and incubated with fluorescently labeled secondary antibodies (1:1500) for 24 hours, finally washed twice with PBS, and flat-mounted using Aquamount.
[0148] 2.6. SA-β-gal analysis
[0149] Senescence-associated β-galactosidase (SA-β-gal) assay was performed using a senescence detection kit (#ab65351, abcam, Cambridge, UK).
[0150] For cells, cells were washed twice with phosphate-buffered saline (PBS), fixed with fixative for 15 minutes at room temperature, and then washed twice with PBS. Cells were then incubated in a SA-β-Gal staining solution mixture (staining solution, staining aid, 20 mg / ml X-gal in DMF) at 37°C for 4–6 hours. Cells were then washed twice with PBS and observed under a light microscope. Positive cells were manually counted to determine the percentage of stained cells.
[0151] For tissue samples, the eyes were immediately enucleated after anesthetizing the mice and washed with cold PBS. The fat tissue around the enucleated eyes was removed, and the retina and RPE / choroid / sclera complex tissue were isolated. The RPE / choroid / sclera complex tissue was fixed in a fixative for 30 minutes at room temperature. After washing twice with PBS, the tissue was stained with a dye mixture (BioVision, #K320, CA, USA) according to the manufacturer's protocol at 37°C for 15 hours. For destaining, the RPE / choroid / sclera complex tissue was immersed in 30% H2O2 and incubated in a 55°C heat block for approximately 50 minutes. After washing with PBS, the tissue was flat-mounted on a slide glass using Aqua-Poly / Mount.
[0152] 2.7. Cell proliferation analysis
[0153] Cell proliferation was assessed using crystal violet assay, CCK-8 and EdU staining according to the following protocol.
[0154] (1) Crystal violet analysis
[0155] The medium was aspirated, and the cells were washed three times with phosphate-buffered saline (PBS) and then incubated with a 0.5% crystal violet solution for 10 minutes. Crystal violet dye (C0775-25G, Sigma-Aldrich) was dissolved in 25% methanol. The cells were then washed at least four times with PBS to remove excess crystal violet solution. Absorbance was read at 595 nm, and images were captured using a microscope (ZEISS).
[0156] (2) CCK-8 analysis
[0157] Cell proliferation was quantified using the CCK-8 assay according to the manufacturer's protocol (Dojindo).
[0158] (3) EdU staining
[0159] For 5-ethynyl-2′-deoxyuridine (EdU) labeling, the Click-IT EdU reaction was performed according to the manufacturer's instructions (Molecular Probes). Additionally, co-staining with antibodies, including DAPI staining, was performed using the antibody staining protocol for the ARPE-19 cell line.
[0160] 2.8. Statistical Analysis
[0161] The results of the analysis are expressed as the mean ± SEM. Each experimental data was analyzed using a two-tailed Student's t-test. All figures were plotted using GraphPad Prism 5. In the drawings of the present invention, statistically significant P values are indicated as follows: ***p < 0.001, **p < 0.01, *p < 0.05.
[0162] Example 3. Comparison of Nr2f1 protein expression in retinal pigment epithelial cells (RPE) of mice at different ages.
[0163] To determine the relationship between mouse growth and aging and Nr2f1 protein expression, RPE cells were collected from mice of different ages (3 weeks, 3 months, 6 months, 12 months, and 24 months) and the Nr2f1 protein expression levels were compared by Western blotting, and the results are shown in Fig. 6.
[0164] In the above experiment, the expression level of Nr2f1 increased as the mice aged, and the highest expression was observed at 12 and 24 months of age.
[0165] Through this, it was confirmed that the expression level of Nr2f1 protein in RPE cells of mice is related to the aging of mice.
[0166] Example 4. Confirmation of the expression patterns of senescence-related genes and the NR2F1 gene in ARPE-19 cells induced by doxorubicin.
[0167] Changes in the expression of aging-related genes and NR2F1 were identified in ARPE-19 cells induced by doxorubicin.
[0168] Senescence was induced in a human retinal pigment epithelial cell line using 250 nM doxorubicin (DOX), a chemical that induces DNA damage-induced senescence. Specifically, ARPE-19 cells were treated with 250 nM DOX for 3 days, and cells were harvested and analyzed on the indicated days (Fig. 7A).
[0169] The analysis results showed that cell senescence progressed when DOX was treated, and the mRNA and protein levels of senescence-related gene markers p16, p21, and p53 were significantly increased (Figures 7B and 7C).
[0170] Additionally, quantitative real-time PCR revealed that transcriptional regulation of various cytokine and chemokine genes, including IL-1β, IL-8, IL-18, and MMP2, was upregulated at the mRNA level in senescence-induced ARPE-19 cells (Fig. 7D).
[0171] Additionally, NR2F1 expression was found to be significantly increased in senescence-induced ARPE-19 cells (Fig. 7E, F).
[0172] Therefore, we confirmed that the expression of NR2F1, a key indicator of cellular senescence, increased in Dox-induced senescent ARPE-19 cells.
[0173] Example 5. Functional confirmation of NR2F1 in human retinal pigment epithelial cell lines.
[0174] Example 5-1. Cell senescence effect due to NR2F1 overexpression in human retinal pigment epithelial cell lines
[0175] To investigate the function of NR2F1 in human retinal pigment epithelial cell line (ARPE-19), we observed changes in the expression of aging-related phenotypes induced by overexpression of NR2F1 in ARPE-19.
[0176] First, ARPE-19 cells were seeded in 60 mm cell culture dishes at 4.5 x 10 5 After culturing at a density of 10, the cells were transduced with lentiviral vectors containing Stuffer or NR2F1 together with hexadimethrine bromide (8 μg / ml; polybrene) (TR-1003-G, Sigma-Aldrich) the next day. Then, after 16 h of culture, the cell culture medium was replaced with fresh DMEM / F12 containing 10% FBS and 1% p / s medium, and two days later, the cells were collected and divided into the control group and the NR2F1 overexpression group (NR2F1-OE), respectively. The relative levels of aging-related genes and proteins in each group were analyzed by quantitative real-time PCR and Western blotting, and the results are shown in Fig. 8A and Fig. 8B.
[0177] In the above experiment, the mRNA and protein levels of aging-related markers, such as p16, p21, and p53, were significantly increased in the NR2F1 overexpression group (NR2F1-OE) compared to the control group. In addition, the mRNA levels of SASP (senescence-associated secretory phenotype) components, such as IL-1β, IL-8, CXCL1, CXCL10, CCL20, MMP3, and MMP9, were significantly increased in the NR2F1 overexpression group (NR2F1-OE) compared to the control group.
[0178] Through this, we confirmed that overexpression of NR2F1 in RPE cells has the effect of inducing cell senescence.
[0179] Example 5-2. Effect of NR2F1 inhibition on cell senescence in senescent human retinal pigment epithelial cell lines.
[0180] To investigate the function of NR2F1 in human retinal pigment epithelial cell line (ARPE-19), we observed changes in the expression of aging-related phenotypes induced by inhibition of NR2F1 in ARPE-19 cells induced by doxorubicin.
[0181] First, ARPE-19 cells were seeded in 60 mm cell culture dishes at 4.5 x 10 5 After culturing at a density of 10, cells were transduced with lentiviral vectors containing shScramble or shNR2F1 the following day. Then, after 16 hours of culture, the cell culture medium was replaced with fresh medium containing 5 μg / ml puromycin (ant-pr-1, InvivoGen, San Diego, CA), and from the third day, the cells were exposed to puromycin and doxorubicin (250 nM) for 3 days. Thereafter, the medium was replaced with regular medium without drugs, and two days later, the cells were collected and divided into the control group (Vehicle + shScramble), doxorubicin treatment group (Dox + shScramble), and doxorubicin treatment followed by NR2F1 inhibition group (Dox + shNR2F1). The relative levels of senescence-related genes and proteins in each group were analyzed through quantitative real-time PCR and Western blotting, and the results are shown in Figures 9A, 9B, and 9C.
[0182] In the above experiment, it was confirmed that the mRNA and protein levels of senescence-related markers such as p21 and p53 were significantly increased in the doxorubicin-treated group (Dox+shScramble) compared to the control group. On the other hand, it was confirmed that the mRNA and protein levels of senescence-related markers such as p21 and p53 were significantly decreased in the NR2F1 inhibition group (Dox+shNR2F1) after doxorubicin treatment compared to the doxorubicin-treated group (Dox+shScramble). In addition, the mRNA levels of IL-1β, IL-8, IL-18, CXCL20, and MMP9, which are components of the senescence-associated secretory phenotype (SASP), were significantly decreased in the NR2F1 inhibition group (Dox+shNR2F1) after doxorubicin treatment compared to the doxorubicin-treated group (Dox+shScramble).
[0183] This suggests that inhibition of NR2F1 in RPE cells has the effect of alleviating doxorubicin-induced aging.
[0184] Example 6. Functional confirmation of NR2F1 in a mouse model
[0185] Example 6-1. Effect of AAV-NR2F1 subretinal injection on cell senescence induction in an adult mouse model
[0186] To investigate the function of NR2F1 in vivo, AAV-NR2F1 was injected into the subretinal space of normal adult mice to overexpress NR2F1, and then retinal aging was observed.
[0187] First, adeno-associated viruses (AAV) containing mCherry or NR2F1 were injected into the subretinal space of an 8-week-old male C57BL / 6J mouse model (1.0 × 10 9 particles / mouse). Mice under each condition were divided into a control group (Control) and an NR2F1 overexpression group (NR2F1-OE), and retinas were collected after 3 weeks. The proportion of senescent cells in the retina and the relative levels of senescence-related genes in each group were analyzed using β-galactosidase (SA-β-gal) staining and quantitative real-time PCR using a senescence detection kit (#ab65351, abcam, Cambridge, UK). The results are shown in Figures 10A and 10B.
[0188] In the above experiment, the proportion of senescent cells stained blue with β-galactosidase (SA-β-gal) in the retina significantly increased in the NR2F1-overexpressing mouse model (NR2F1-OE) compared to the control group. In addition, the mRNA levels of SASP (senescence-associated secretory phenotype) components, such as CXCL10, IL-1β, IL-6, IL-18, and MMP9, significantly increased in the NR2F1-overexpressing mouse model (NR2F1-OE) compared to the control group.
[0189] Through this, we confirmed that overexpression of NR2F1 has the effect of inducing retinal aging in a young mouse model.
[0190] Example 7. Confirmation of the effect of NR2F1 inhibition in a mouse model of dry macular degeneration.
[0191] Example 7-1. Effect of AAV-shNR2F1 subretinal injection on cell senescence reduction in a mouse model of dry macular degeneration.
[0192] To investigate the function of NR2F1 in vivo in mice, AAV-shNR2F1 was injected into the subretinal space of a mouse model in which dry macular degeneration was induced by intraperitoneal injection of NaIO3, and NR2F1 was suppressed, after which alleviation of retinal aging was observed.
[0193] First, adeno-associated viruses (AAV) containing shScramble or NR2F1 were injected into the subretinal space of an 8-week-old male C57BL / 6J mouse model (1.0 × 10 8 particles / mouse). Four weeks after subretinal injection (SRI), 25 mg / kg of phosphate-buffered saline (PBS) or NaIO3 was administered intraperitoneally (IP). Mice under each condition were divided into a control group (Vehicle+shScramble), a NaIO3-treated group (NaIO3+shScramble), and a NaIO3-treated NR2F1-inhibited group (NaIO3+shNR2F1). Retinas were collected after 2 weeks. The relative levels of aging-related genes and proteins in each group were analyzed by quantitative real-time PCR, Western blotting analysis, and immunofluorescence staining of flat-mount RPE, and the results are shown in Figures 11A to 11C.
[0194] The analysis results showed that the mRNA and protein levels of aging-related markers, such as p16 and p53, significantly increased in the NaIO3-treated group (NaIO3+shScramble) compared to the control group. On the other hand, the mRNA and protein levels of aging-related markers, such as p16 and p53, significantly decreased in the NR2F1-inhibited group (NaIO3+shNR2F1) after NaIO3 treatment compared to the NaIO3-treated group (NaIO3+shScramble).
[0195] This suggests that inhibition of NR2F1 has the effect of alleviating retinal aging in a mouse model of dry macular degeneration.
[0196] Example 7-2. Effect of subretinal injection of AAV-shNR2F1 on visual function improvement in a mouse model of dry macular degeneration.
[0197] To investigate the function of NR2F1 in vivo in mice, AAV-shNR2F1 was injected into the subretinal space of a mouse model of dry macular degeneration induced by intraperitoneal injection of NaIO3 to suppress NR2F1, and changes in visual function in the mice were measured using electroretinography (ERG) (Celeris mouse ERG system (Diagnosys, LLC, MA, USA).
[0198] Before the experiment, mice were conditioned in a dark place for at least 16 h. Mice were anesthetized by intraperitoneal injection of a mixture of Zoletil (Virbac, France) and xylazine (Rompun, Bayer HealthCare, Leverkusen, Germany) diluted with NaCl (4:1 ratio). After administration of general anesthesia, the pupils of the mice were dilated with Tropherine (Hanmi, Korea) and anesthetized with a local anesthetic, alkyne. The eyes were protected with 2% hypromellose (Samil, Korea) before injection. The mice were placed on a warming plate to maintain body temperature with the electrodes of the Celeris mouse ERG system attached to each eye, and retinal function was measured under red light. For ERG, the electrodes were aligned with the center of the eye and in contact with the cornea, and the reference electrode was placed in the opposite eye. The amplitudes for the a- and b-waves ranged from 0.001 to 10 cd*s / m2. 2 150 cd*s / m for single flash stimulus and c-wave in the range 2 Flash-induced responses were recorded. At least three responses were recorded for each flash intensity and averaged. The amplitudes of the a-wave and b-wave were measured from the maximum negative and positive peaks of the recording relative to the pre-stimulus baseline, and the c-wave amplitude was measured as the distance from the maximum negative c-wave to the maximum peak amplitude of the c-wave (a measure of retinal pigment epithelium function). The measurement results are shown in Figure 12.
[0199] As can be confirmed in Fig. 12, in the AAV-shNR2F1 injection group, a significant improvement in the measured a-wave and b-wave amplitudes was confirmed compared to the control group, confirming that the visual function of the mouse was restored. In addition, the c-wave amplitude, which can confirm the function of the RPE, was decreased in the mouse model group induced with dry macular degeneration, and significantly increased in the group injected subretinacularly with AAV-shNR2F1 (Fig. 12A: representative waveforms of a- and b-waves [top], representative waveforms of c-waves [bottom]; 12B: graphs of a-, b-, and c-waves). This shows that the inhibition of NR2F1 has the effect of improving the visual function of the mouse in the mouse model induced with dry macular degeneration.
[0200] Example 8: Confirmation of NR2F1 function in an aged mouse model
[0201] Example 8-1: Effect of AAV-shNR2F1 subretinal injection on alleviation of cell senescence in an aged mouse model
[0202] To investigate the function of NR2F1 in vivo in aged mice, AAV-shNR2F1 was injected into the subretinal space of an aged mouse model to suppress NR2F1, and then the alleviation of retinal aging was observed.
[0203] First, adeno-associated viruses (AAV) containing shScramble or shNR2F1 were injected into the subretinal space of 3-month-old and 24-month-old C57BL / 6J mouse models (1.0 x 10 9particles / mouse). Mice under each condition were divided into a 3-month-old control group (3-month-old_shControl), a 24-month-old control group (24-month-old_shControl), and a 24-month-old shNR2F1 inhibition group (24-month-oldsh_NR2F1), and retinas were collected after 3 weeks. The proportion of senescent cells in the retina of each group was analyzed through β-galactosidase (SA-β-gal) staining using a senescence detection kit (#ab65351, abcam, Cambridge, UK), and the results are shown in Figures 13A and 13B.
[0204] As a result of the analysis, it was confirmed that the proportion of senescent cells stained blue with β-galactosidase (SA-β-gal) in the retina in the 24-month-old control group (24-month-old_shControl) significantly increased compared to the 3-month-old control group (3-month-old_shControl). On the other hand, it was confirmed that the proportion of senescent cells in the 24-month-old NR2F1 inhibition group (24-month-oldsh_NR2F1) significantly decreased compared to the 24-month-old control group (24-month-old_shControl).
[0205] This suggests that inhibition of NR2F1 has the effect of alleviating retinal aging in an aged mouse model.
[0206] Example 8-2: Improvement of visual function by subretinal injection of AAV-shNR2F1 in an aged mouse model
[0207] To investigate the function of NR2F1 in vivo in aged mice, AAV-shNR2F1 was injected into the subretinal space of an aged mouse model to suppress NR2F1, and changes in visual function of the mice were measured using electroretinography (ERG) (Celeris mouse ERG system (Diagnosys, LLC, MA, USA).
[0208] Before the experiment, mice were conditioned in a dark place for at least 16 h. Mice were anesthetized by intraperitoneal injection of a mixture of Zoletil (Virbac, France) and xylazine (Rompun, Bayer HealthCare, Leverkusen, Germany) diluted with NaCl (4:1 ratio). After administration of general anesthesia, the pupils of the mice were dilated with Tropherine (Hanmi, Korea) and anesthetized with a local anesthetic, alkyne. The eyes were protected with 2% hypromellose (Samil, Korea) before injection. The mice were placed on a warming plate to maintain body temperature with the electrodes of the Celeris mouse ERG system attached to each eye, and retinal function was measured under red light. For ERG, the electrodes were aligned with the center of the eye and in contact with the cornea, and the reference electrode was placed in the opposite eye. The amplitudes for the a- and b-waves ranged from 0.001 to 10 cd*s / m2. 2 A single flash stimulus was used to elicit a range of responses. At least three responses were recorded for each flash intensity and averaged. The amplitudes of the a-wave and b-wave were measured from the maximum negative and positive peaks of the recording relative to the pre-stimulus baseline, and the c-wave amplitude was measured as the distance from the maximum negative c-wave to the maximum peak amplitude of the c-wave (a measure of retinal pigment epithelium function). The measurement results are shown in Figure 14.
[0209] As shown in Fig. 14, knockdown of Nr2f1 in aged mice improved aging and restored retinal function. The a- and b-wave amplitudes were decreased in the aged mouse group and significantly improved in the AAV-shNR2F1 subretinal injection group, confirming that the visual function of the mice was restored. In addition, the c-wave amplitude, which can determine the function of the RPE, was decreased in the aged mouse group and significantly increased in the AAV-shNR2F1 subretinal injection group (Fig. 14A: representative waveforms of a- and b-waves [top], representative waveforms of c-waves [bottom]; 14B: a-, b-, c-wave graphs). Therefore, it can be seen that inhibition of NR2F1 in an aged mouse model has the effect of improving the visual function of the mice.
[0210] From the above description, those skilled in the art will understand that the present invention can be implemented in other specific forms without altering the technical spirit or essential characteristics of the present invention. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention should be interpreted as encompassing all changes or modifications derived from the meaning and scope of the following claims and their equivalent concepts, rather than the detailed description above.
Claims
1. A pharmaceutical composition for preventing or treating ophthalmic diseases, comprising an NR2F1 (Nuclear Receptor Subfamily 2 Group F Member 1) inhibitor.
2. A pharmaceutical composition according to claim 1, wherein the NR2F1 inhibitor is one selected from the group consisting of siRNA (short interfering RNA), shRNA (short hairpin RNA), miRNA (micro RNA), ribozyme or antisense oligonucleotide that complementarily binds to NR2F1; or a compound, peptide, peptide mimetics, aptamer and antibody or antigen-binding fragment of an antibody that specifically binds to RNPS1.
3. A pharmaceutical composition according to claim 2, wherein the NR2F1 inhibitor is shRNA (short hairpin RNA).
4. A pharmaceutical composition according to claim 3, wherein the shRNA is delivered by an expression vector.
5. A pharmaceutical composition according to claim 3, wherein the NR2F1 inhibitor is any one shRNA selected from the group consisting of SEQ ID NO: 4 and 11 to 21.
6. A pharmaceutical composition according to claim 5, wherein the NR2F1 inhibitor is an shRNA of sequence number 4.
7. A pharmaceutical composition according to claim 4, wherein the expression vector comprises at least one selected from the group consisting of a viral vector, a plasmid, and a non-viral vector.
8. A pharmaceutical composition according to claim 7, wherein the viral vector comprises any one selected from the group consisting of an adeno-associated virus (AAV) vector, an adenovirus vector, a lentivirus vector, a herpes simplex virus vector, a baculovirus vector, a Sendai virus vector, and a retrovirus vector.
9. A pharmaceutical composition according to claim 4, wherein the expression vector is an adeno-associated virus (AAV) vector or a lentivirus.
10. A pharmaceutical composition according to claim 1, wherein the composition inhibits the expression of at least one protein selected from the group consisting of p16, p21, and p53.
11. A pharmaceutical composition according to claim 1, wherein the composition inhibits the expression of at least one gene selected from the group consisting of CXCL10, IL-1β, IL-6, IL-18, and MMP9.
12. A pharmaceutical composition according to claim 1, wherein the pharmaceutical composition is an ophthalmic composition for topical administration to the eye.
13. In paragraph 1, the ophthalmic disease is age-related macular degeneration (AMD), diabetic retinopathy, macular edema, cystoid macular edema, retinitis pigmentosa (RP), Leber's congenital amaurosis (LCA), Stargardt's disease, Usher's syndrome, choroidal plexus atrophy, rod-cone or cone-rod dystrophy, ciliopathies, mitochondrial disorders, progressive retinal atrophy, degenerative retinal diseases, familial or acquired maculopathy, sickle cell retinopathy, retinal pigment epithelium-system diseases, uveitis, retinal detachment, traumatic retinal damage, iatrogenic retinal damage, macular hole, macular telangiectasia, ganglion cell disease, optic nerve disease, glaucoma, optic neuropathy, ischemic retinal disease, retinopathy of prematurity, retinal vascular occlusion, polypoid choroidal vasculopathy, retinal hypoxia, familial macroneuropathy, retinal vascular disease, ocular vascular disease, glaucoma-induced A pharmaceutical composition comprising at least one selected from the group consisting of retinal neuron degeneration and ischemic optic neuropathy.
14. A pharmaceutical composition according to claim 1, wherein the ophthalmic disease is age-related macular degeneration (AMD).
15. A pharmaceutical composition according to claim 14, wherein the age-related macular degeneration includes wet macular degeneration or dry macular degeneration.
16. An ophthalmic preparation comprising a pharmaceutical composition according to any one of claims 1 to 15.
17. Use of an NR2F1 inhibitor in the manufacture of a medicament for the treatment of ophthalmic diseases.
18. A method for treating an ophthalmic disease, comprising administering an effective amount of an expression inhibitor of the NR2F1 gene or an activity inhibitor of the protein to a subject in need thereof for the prevention or treatment of an ophthalmic disease.
19. NR2F1 inhibitor for use in the treatment of ophthalmic diseases.
20. In the use of Article 17, the method of Article 18, or the inhibitor of Article 19, The above ophthalmic diseases include age-related macular degeneration (AMD), diabetic retinopathy, macular edema, cystoid macular edema, retinitis pigmentosa (RP), Leber's congenital amaurosis (LCA), Stargardt's disease, Usher's syndrome, choroidal plexus atrophy, rod-cone or cone-rod dystrophy, ciliopathies, mitochondrial disorders, progressive retinal atrophy, degenerative retinal diseases, familial or acquired maculopathy, sickle cell retinopathy, retinal pigment epithelium-system diseases, uveitis, retinal detachment, traumatic retinal injury, iatrogenic retinal injury, macular hole, macular telangiectasia, ganglion cell disease, optic nerve disease, glaucoma, optic neuropathy, ischemic retinal disease, retinopathy of prematurity, retinal vascular occlusion, polypoid choroidal vasculopathy, retinal hypoxia, familial macroneuropathy, retinal vascular disease, ocular vascular disease, retinal neuron degeneration due to glaucoma and ischemic A use, method or inhibitor selected from the group consisting of optic neuropathy.
Citation Information
Patent Citations
Gene therapy for autosomal dominant diseases
EP3289080B1
Composition for preventing or treating neuroinflammation diseases comprising bee venom extract
KR1020200116054A
Cited By
Biomarker for detecting anti-VEGF treatment typing of RVO-ME and application of biomarker
CN121253831A