Enhanced self-amplifying or trans-amplifying RNA
By inserting polynucleotides in the alphavirus genomic 5' UTR of saRNAs and taRNAs, the issues of cytotoxicity and expression kinetics are mitigated, achieving prolonged and effective protein expression with reduced immune response.
Patent Information
- Application Number
- PCT/EP2025/053640
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-02-12
- Filing Date
- 2025-02-12
- Publication Date
- 2025-08-21
AI Technical Summary
Existing self-amplifying RNAs (saRNAs) induce strong innate immune responses and cytotoxic effects, leading to reduced protein expression and flu-like side-effects, with existing mutations in the genomic 5' UTR of alphaviruses not fully addressing cytotoxicity and expression kinetics issues.
Incorporation of one or more polynucleotide inserts downstream of position -16 in the alphavirus genomic 5' UTR of saRNAs or taRNAs, resulting in slower amplification and reduced cellular toxicity while maintaining or enhancing protein expression, with a duration of up to 15 weeks in vivo.
The modified saRNAs and taRNAs exhibit less cellular toxicity, equivalent or higher cumulative protein production, and are less susceptible to reversion to a cytopathic phenotype, with applications across various alphavirus-derived saRNAs.
Smart Images

Figure IMGF000074_0001 
Figure IMGF000070_0001 
Figure IMGF000072_0001
Abstract
Description
[0001] ENHANCED SELF-AMPLIFYING OR TRANS-AMPLIFYING RNA
[0002] FIELD OF THE INVENTION
[0003] The invention is broadly in the field of medicine, more precisely in the field of RNA therapy. In particular, the invention concerns a self-amplifying ribonucleic acid (saRNA) or trans-amplifying RNA (taRNA) and its use in methods of treatment or protein production, such as recombinant protein production.
[0004] BACKGROUND OF THE INVENTION
[0005] Self-amplifying RNAs (saRNA) or trans-amplifying RNAs (taRNA) are promising as nucleic acid drugs that can express therapeutic proteins for up to 4 or 8 weeks in vivo. saRNAs or taRNAs are used for vaccination and protein replacement purposes but have other applications as well. However, it has been well- documented that saRNA can induce a strong innate immune response in patients. This response can result in reduced protein expression but can also cause flu-like side-effects in patients. One contributing factor to this response could be the speed of replication and expression kinetics of saRNA inside a patient's cells. Attempts have been made to reduce the cytopathic effect (i.e., cellular toxicity) of the ancestral viruses and their derived saRNA. First, saRNA can be designed based on different viruses. The most used are alphaviruses, of which Sindbis virus (SINV), Semliki Forest virus (SFV), Eastern Equine Encephalitis Virus (EEEV), and Venezuelan Equine Encephalitis virus (VEEV) are most common. Chimeric combinations of more than one virus are possible as well. Research has demonstrated that saRNAs which use the non- structural proteins of VEEV are less cytopathic than saRNA using non-structural proteins of other alphaviruses (Petrakova et al., 2005, J. Virol., 79, 12, 7597-7608).
[0006] In addition, serially passaging either saRNA or intact virus can produce less cytopathic mutants. For example, the attenuated VEEV vaccine strain TC-83 has 12 point mutations, including a single pointsubstitution (r.3g>a, colloquially known as G3>A) in the genomic 5' UTR. This mutation makes the full- length, infectious form of the virus less pathogenic (both in vivo and in vitro) but does not result in complete attenuation. However, the mutation has also been demonstrated to result in a 3-fold lower expression of the encoded protein. Finally, it has been demonstrated that the non-infectious saRNA lacking the structural viral genes is actually more cytopathic than the wild type, despite having dramatically reduced replication (Petrakova et al., supra).
[0007] Nonetheless, saRNA still causes cytotoxic effects with any of the above modifications. In addition, the mentioned mutations are single point substitutions which makes them susceptible to reversion to the original, cytopathic phenotype. Therefore, there remains a need in the art for further and / or improved saRNA-based technologies for use in the medical field which have reduced cytotoxicity and satisfactory expression kinetics of the encoded transgene.
[0008] SUMMARY OF THE INVENTION
[0009] The present inventors have found saRNAs or taRNAs suitable for example for use in a method of protein or RNA production, protein or RNA therapy or vaccination, thereby addressing one or more of the above- mentioned problems in the art.
[0010] Accordingly, a first aspect of the invention relates to a self-amplifying ribonucleic acid (saRNA) or transamplifying RNA (taRNA) comprising: an alphavirus genomic 5' untranslated region (5'UTR) or mutant thereof; a nucleic acid sequence encoding alphavirus nonstructural proteins nsPl-4 or mutant thereof; an alphavirus sub-genomic promoter or mutant thereof; and (i) an open reading frame sequence encoding a protein of interest or (ii) a non-coding RNA of interest, wherein the alphavirus genomic 5'UTR or mutant thereof comprises one or more polynucleotide inserts downstream of a nucleotide at position -16 , wherein the last nucleotide of the genomic 5' UTR is position -1, and wherein the combined length of the one or more polynucleotide inserts is at least 5 nucleotides.
[0011] As shown in the experimental section, the present inventors have found that the enhanced saRNAs illustrating the principles of the invention have a slower amplification speed and allow a gradual increase in expression of the protein of interest. Furthermore, the present saRNAs are associated with less cellular toxicity, while maintaining an equivalent or higher cumulative protein production. Moreover, the present saRNAs can demonstrate a duration of expression of at least 15 weeks in vivo.
[0012] Moreover, due to the type of modification, the present saRNAs are less susceptible to reversion to the cytopathic phenotype. In addition, while the prior art point mutations are typically species-specific and often do not work in saRNA derived from a different virus, the modifications as required in the saRNAs illustrating the invention are applicable to all saRNAs, such as to all alphavirus-derived saRNAs. The same advantages apply to taRNAs using the same principles of the invention.
[0013] Further aspects of the invention provide: a nucleic acid encoding for the saRNA or taRNA as defined herein; a vector comprising the saRNA or taRNA as defined herein or comprising a nucleic acid corresponding to the saRNA or taRNA as taught herein; a cell comprising the saRNA or taRNA as defined herein, or a cell comprising the vector as defined herein. As shown in the example section, the saRNA as taught herein is useful inter alia in methods of producing a protein of interest in a subject, showing a lower cytotoxicity, an equivalent or higher accumulated protein expression and / or an extended duration of protein expression.
[0014] Hence, a further aspect relates to a pharmaceutical composition comprising the saRNA or taRNA, the nucleic acid, the vector, and / or the cell, as defined herein, and further comprising a pharmaceutically acceptable carrier.
[0015] Further aspects relate to : the saRNA or taRNA as defined herein, the vector as defined herein, the cell as defined herein, or the pharmaceutical composition as defined herein, for use in a method of producing a protein or noncoding RNA in a subject; the saRNA or taRNA as defined herein, the vector as defined herein, the cell as defined herein, or the pharmaceutical composition as defined herein, for use as a medicament; a method for treating a subject in need of said treatment comprising administering an effective amount of the saRNA or taRNA as defined herein, the vector as defined herein, the cell as defined herein, or the pharmaceutical composition as defined herein to the subject; the saRNA or taRNA as defined herein, the vector as defined herein, the cell as defined herein, or the pharmaceutical composition as defined herein, for use in a (in vitro) method of recombinant protein production; the saRNA or taRNA as defined herein, the vector as defined herein, the cell as defined herein, or the pharmaceutical composition as defined herein, for use in a method of protein therapy, vaccination, stem cell reprogramming, induction of stem cells, induction of allergy tolerance, gene editing, gene modification, gene silencing, regulation of gene expression, immunotherapy, or cancer treatment in a subject; a method of protein therapy, vaccination, stem cell reprogramming, induction of stem cells, induction of allergy tolerance, gene editing, gene modification, gene silencing, regulation of gene expression, immunotherapy, or cancer treatment in a subject in need thereof comprising administering an effective amount of the saRNA or taRNA as defined herein, the vector as defined herein, the cell as defined herein, or the pharmaceutical composition as defined herein to the subject; the saRNA or taRNA as defined herein, the vector as defined herein, the cell as defined herein, or the pharmaceutical composition as defined herein, for use in an in vivo diagnostic method; an in vitro diagnostic method comprising the use of the saRNA or taRNA as defined herein, the vector as defined herein, the cell as defined herein, or the pharmaceutical composition as defined herein.
[0016] Further aspects provide:
[0017] Use of the saRNA or taRNA as defined herein, the nucleic acid as defined herein, the vector as defined herein, or the cell as defined herein, for recombinant production of a protein of interest.
[0018] Use of the saRNA or taRNA as defined herein, the nucleic acid as defined herein, the vector as defined herein, or the cell as defined herein, for in vitro or ex vivo modifying a host cell, such as to produce a protein or RNA of interest by the host cell, optionally wherein the host cell is configured for autologous or allogeneic administration to a subject.
[0019] An in vitro method for identifying a saRNA or taRNA as an agent useful for producing a protein or a non-coding RNA of interest, wherein the saRNA or taRNA comprises: an alphavirus genomic 5' untranslated region (5'UTR) or mutant thereof; a nucleic acid sequence encoding alphavirus nonstructural proteins nsPl-4 or mutant thereof; an alphavirus sub-genomic promoter or mutant thereof; and (i) an open reading frame sequence encoding a protein of interest or (ii) a non-coding RNA of interest, wherein the alphavirus genomic 5'UTR or mutant thereof comprises one or more polynucleotide inserts, the method comprising: administering the saRNA or taRNA to cells, thereby producing the protein or non-coding RNA in the cells; measuring viability of the cells; measuring a metric for rate of expression of the protein or non-coding RNA in the cells; identifying the saRNA or taRNA as an agent useful for producing a protein or a non-coding RNA of interest when (i) the viability of the cells is higher than the viability of the cells being administered the same saRNA or taRNA but without polynucleotide inserts in the alphavirus genomic 5'UTR or mutant thereof, and (ii) the metric for the rate of expression of the protein or non-coding RNA indicates an equal or lower rate of expression than the same metric in cells being administered the same saRNA or taRNA but without polynucleotide inserts in the alphavirus genomic 5'UTR or mutant thereof.
[0020] The above and further aspects and preferred embodiments of the invention are described in the following sections and in the appended claims. The subject-matter of appended claims is hereby specifically incorporated in this specification. DESCRIPTION OF THE DRAWINGS
[0021] FIG. 1 Schematic illustration of the saRN A genomic 5'UTR, wherein the first nucleotide of the open reading frame of nsPl is position 1, wherein the last nucleotide of the genomic 5' UTR is position -1 and the nucleotides upstream of position -1 are defined as nucleotides at positions "-n", wherein n is an integer ranging from 2 to m with m being the total number of nucleotides of the genomic 5' UTR. Enhanced saRNA contains one or more polynucleotide insert(s) (SEQ) with length p upstream of nucleotide +1, -1 or -n. Legend: circle = 5' Cap, dashed line = 5'UTR, AUG = start codon of the open reading frame of nsPl.
[0022] FIG. 2 Luminescence kinetics for 150 ng (FIG. 2A), 300 ng (FIG. 2B), and 600 ng (FIG. 2C) conventional saRNA (circles), E-15S1 (triangles), or E-4S1 (squares) in HeLa cells. The luminescence for all saRNA types is inversely related to the transfection dose. Data are presented as mean (N=2).
[0023] FIG. 3 Cumulative protein production of 150 ng (black bars), 300 ng (striped bars), and 600 ng (white bars) conventional saRNA (C-saRNA), E-15S1, or E-4S1 in HeLa cells, calculated as area under the curve (AUC) for either the first 24 hours (FIG. 3A) or the first 48 hours (FIG. 3B) after transfection. The cumulative luminescence for all saRNA types is inversely related to the transfection dose. The AUC for E-4S1 is lower than both other products before 24 hours but achieves equal levels during the second day after transfection at all transfection doses. Data are presented as mean with SEM (N=2).
[0024] FIG. 4 Detailed luminescence kinetics for 150 ng conventional saRNA (FIG. 4A), E-15S1 (FIG. 4B), or E-4S1 (FIG. 4C) in HeLa cells. Luminescence kinetics are presented as solid lines (left y-axis), and the first derivative (slope) of the luminescence kinetics as dashed lines (right y-axis). Data are presented as mean (N=2).
[0025] FIG. 5 Luminescence kinetics for 50 ng (FIG. 5A), 100 ng (FIG. 5B), and 150 ng (FIG. 5C) conventional saRNA (circles), E-15S1 (triangles), or E-4S1 (squares) in HeLa cells. The luminescence for enhanced saRNA is proportional to the transfection dose, while the luminescence for conventional saRNA does not increase from the 100 ng to 150 ng dose. Data are presented as mean (N=2).
[0026] FIG. 6 Cumulative protein production of 50 ng, 100 ng, and 150 ng conventional saRNA (FIG. 6A), E-15S1 (FIG. 6B), or E-4S1 (FIG. 6C) in HeLa cells, calculated as area under the curve (AUC). The cumulative luminescence for all saRNA types is proportional to the transfection dose. However, the AUC of conventional saRNA and E-15S1 reaches a plateau above 100 ng, while E-4S1 demonstrates a higher AUC at 150 ng relative to 100 ng. Data are presented as mean (N=2).
[0027] FIG. 7 Detailed luminescence kinetics for 150 ng conventional saRNA (FIG. 7A), E-15S1 (FIG. 7B), or E-4S1 (FIG. 7C) in HeLa cells. Luminescence kinetics are presented as solid lines (left y-axis), and the first derivative (slope) of the luminescence kinetics as dashed lines (right y-axis). Data are presented as mean with standard deviation (N=2). Area shaded in grey represents the period wherein protein expression increases or stays constant.
[0028] FIG. 8 Viability relative to positive control (PC) of HeLa cells transfected with 150 ng conventional saRNA (C-saRNA), E-15S1, E-4S1, or the empty Lipofectamine MessengerMax transfection reagent (PC), evaluated 24 hours (FIG. 8A) and 48 hours (FIG. 8B) after transfection. Data are represented as mean (bar) and SD (error bars) (N = 3 technical replicates [2 for PC]).
[0029] FIG. 9 Schematic illustration of the 5'UTR of conventional saRNA (C-saRNA) and multiple enhanced saRNA products. Circle=5'cap, nsPl-4 = non-structural proteins 1 to 4, SGP = sub-genomic promoter, GOI = gene of interest, An = poly(A) tail, dashed line = 5'UTR, AUG = first downstream start codon, nt = nucleotides.
[0030] FIG. 10 Detailed luminescence kinetics for 150 ng conventional saRNA (FIG. 10A), E-15S1 (FIG. 10B), E-9S1 (FIG. 10C), E-4S1 (FIG. 10D), or E+1S1 (FIG. 10E) in HeLa cells. Luminescence kinetics are presented as solid lines (left y-axis), and the first derivative (slope) of the luminescence kinetics as dashed lines (right y-axis). Data are presented as mean with standard deviation (N=6 between Oh and 24h, N=3 between 24h and 48h). Area shaded in grey represents the period wherein protein expression increases or stays constant.
[0031] FIG. 11 T(Vmax) (FIG. 11A), and T(Decline) (FIG. 11B) for conventional saRNA (C-saRNA), E-15S1, E-9S1, E- 4S1, and E+1S1 in HeLa cells. Data are presented as mean (N=6 between Oh and 24h after transfection, N=3 between 24h and 48h after transfection).
[0032] FIG. 12 Viability relative to positive control (PC) of HeLa cells transfected with 150 ng conventional saRNA (C-saRNA), E-15S1, E-9S1, E-4S1, E+1S1, or the empty Lipofectamine MessengerMax transfection reagent (PC), evaluated 24 hours (FIG. 12A) and 48 hours (FIG. 12B) after transfection. Data are represented as mean (bar) and SD (error bars) (N = 3 technical replicates).
[0033] FIG. 13 Detailed luminescence kinetics for 150 ng conventional saRNA (FIG. 13A), E-15S1 (FIG. 13B), or E- 4S1 (FIG. 13C) without dexamethasone in HeLa cells. Luminescence kinetics are presented as solid lines (left y-axis), and the first derivative (slope) of the luminescence kinetics as dashed lines (right y-axis). Data are presented as mean with standard deviation (N=2). Area shaded in grey represents the period wherein protein expression increases or stays constant.
[0034] FIG. 14 Detailed luminescence kinetics for 150 ng conventional saRNA (FIG. 14A), E-15S1 (FIG. 14B), or E- 4S1 (FIG. 14C) with 200 nM dexamethasone in HeLa cells. Luminescence kinetics are presented as solid lines (left y-axis), and the first derivative (slope) of the luminescence kinetics as dashed lines (right y-axis). Data are presented as mean with standard deviation (N=2). Area shaded in grey represents the period wherein protein expression increases or stays constant.
[0035] FIG. 15 Detailed luminescence kinetics for 150 ng conventional saRNA (FIG. 15A), or E-4S1 (FIG. 15B) with silica-based purification alone in HeLa cells. Luminescence kinetics are presented as solid lines (left y-axis), and the first derivative (slope) of the luminescence kinetics as dashed lines (right y-axis). Data are presented as mean with standard deviation (N=2). Area shaded in grey represents the period wherein protein expression increases or stays constant.
[0036] FIG. 16 Detailed luminescence kinetics for 150 ng conventional saRNA (FIG. 16A), or E-4S1 (FIG. 16B) with cellulose-based purification following silica-based purification in HeLa cells. Luminescence kinetics are presented as solid lines (left y-axis), and the first derivative (slope) of the luminescence kinetics as dashed lines (right y-axis). Data are presented as mean with standard deviation (N=2). Area shaded in grey represents the period wherein protein expression increases or stays constant.
[0037] FIG. 17 Cumulative protein production over 72 hours since transfection of 150 ng conventional saRNA or E-4S1 in HeLa cells, calculated as area under the curve (AUC). RNA has been purified either by silica- chromatography alone (FIG. 17A) or silica-chromatography followed by cellulose-purification (FIG. 18B). Data are presented as mean with SEM (N=2).
[0038] FIG. 18 Viability relative to positive control (PC) of HeLa cells transfected with 150 ng conventional saRNA (C-saRNA), E-4S1, or the empty Lipofectamine MessengerMax transfection reagent (PC). RNA has been purified either by silica-chromatography alone (FIG. 18A) or silica-chromatography followed by cellulose- purification (FIG. 18B). Data are represented as mean (bar) and SD (error bars) (N = 2 technical replicates).
[0039] FIG. 19 Detailed luminescence kinetics for 100 ng conventional saRNA (FIG. 19A), E-4S1 (FIG. 19B), E-4S2 (FIG. 19C), E-4S3 (FIG. 19D), E-4S4 (FIG. 19E), or E-4S5 (FIG. 19F) in HeLa cells. Luminescence kinetics are presented as solid lines (left y-axis), and the first derivative (slope) of the luminescence kinetics as dashed lines (right y-axis). Data are presented as mean with standard deviation (N=3). Area shaded in grey represents the period wherein protein expression increases or stays constant.
[0040] FIG. 20 Luminescence kinetics for 150 ng cellulose-purified conventional saRNA (circles) or E-4S1 (squares) in HeLa cells. Data presented as means + SD (n [0h-24h] = 6, n [24h-48h] = 4, n [48h-72h] = 2). Fresh medium and imaging at Oh, 24h (dotted line), and 48h (dotted line).
[0041] FIG. 21 Total cell count for HeLa cells transfected with conventional saRNA (FIG. 21A), E-4S1 (FIG. 21B), or Lipofectamine without saRNA (Pos. Ctrl.) (FIG. 21C). Data from two wells are presented as replicate 1 (circles) and replicate 2 (squares). Two distinct areas were counted in each well. Annotations are the foldchange in cell count between two timepoints. Data are presented as mean with range.
[0042] FIG. 22 Dead cell count for HeLa cells transfected with conventional saRNA (FIG. 22A), E-4S1 (FIG. 22B), or Lipofectamine without saRNA (Pos. Ctrl.) (FIG. 22C). Data from two wells are presented as replicate 1 (circles) and replicate 2 (squares). Two distinct areas were counted in each well. Annotations are the foldchange in cell count between two timepoints. Data are presented as mean with range. FIG. 23 Percentage of viable cells at different timepoints after transfection with 150 ng conventional saRNA (black bars), E-4S1 (checkered bars) or empty Lipofectamine transfection reagent (white bars).
[0043] FIG. 24 Detailed luminescence kinetics for 150 ng LNP-formulated conventional saRNA (FIG. 24A), or E- 4S1 (FIG. 24B) in HeLa cells. Luminescence kinetics are presented as solid lines (left y-axis), and the first derivative (slope) of the luminescence kinetics as dashed lines (right y-axis). Data are presented as mean with standard deviation (N=3). Area shaded in grey represents the period wherein protein expression increases or stays constant.
[0044] FIG. 25 Viability relative to positive control (PC) of HeLa cells transfected with 150 ng LNP-formulated conventional saRNA (C-saRNA, black bar), E-4S1 (checkered bar), or empty Lipofectamine MessengerMax transfection reagent (PC, white bar). Data are presented as mean (bar) and SD (error bars) (N = 3 technical replicates).
[0045] FIG. 26 In vivo luminescence kinetics in Balb / c mice, after intramuscular injection with 1 pg conventional saRNA (FIG. 26A) or E-4S1 (FIG. 26B) in LNPs. Data are presented as mean with range (N=3. N=2 for conventional saRNA after week 16). Background level is shaded in grey.
[0046] FIG. 27 Radiance of enhanced saRNA normalized to conventional saRNA. A ratio of one or above indicates higher radiance in the group that received E-4S1 than in the conventional saRNA-group. This is true between week 5 and week 20 (area not shaded in grey). Data presented as mean (N=3. N=2 for conventional saRNA after week 16).
[0047] FIG. 28 In vivo expression characteristics of conventional saRNA (C-saRNA) and enhanced saRNA (E-4S1). Duration of expression above background levels (FIG. 28A), and median radiance for conventional saRNA and enhanced saRNA (FIG. 28B). Calculations cover the full 22-week period for both experimental groups. Data presented as values (symbols) with mean (bar)(N=3).
[0048] FIG. 29 Summary of T(Vmax) (FIG. 29A) and T(Decline) (FIG. 29B) of conventional saRNA (C-saRNA) and E- 4S1 in HeLa cells. There is a significant (p<0.0001) 10-hour delay in the average T(Vmax) of E-4S1, relative to conventional saRNA. Additionally, there is a significant (p<0.0001) 23-hour delay in the average T(Decline) of E-4S1, relative to conventional saRNA. N=7, tested for statistical significance with two-tailed student's t-test.
[0049] FIG. 30 Summary of cumulative protein production over either 48 hours (N=8) (FIG. 30A) or 72 hours (N=5) (FIG. 30B). There is no statistically significant difference in average cumulative protein production over 48 hours between E-4S1 and conventional saRNA (C-saRNA), while the average cumulative protein production over 72 hours of E-4S1 is significantly higher than conventional saRNA (p=0.00228). Tested for statistical significance with two-tailed student's t-test.; FIG. 31 In vivo expression characteristics in Balb / c mice after intramuscular injection with 1 pg of conventional saRNA (FIG. 31A) or enhanced saRNA E-4S3 (FIG. 31B) in LNPs. Data presented as mean (symbols) with SEM (bar)(N=12). Area shaded in grey represents background.
[0050] FIG. 32 Median luminescence of conventional saRNA (C-saRNA) and enhanced saRNA E-4S3 over the complete duration of the experiment. Tested for statistical significance with a one-tailed student's t-test (*** p=0.0008).
[0051] FIG. 33 Change in time to peak (TTP) (FIG. 33A) or relative viability (FIG. 33B) as a function of polynucleotide insert length. Data presented as box-and-whiskers plot with whiskers representing the smallest and largest values, and boxes extending from the 25thto 75thpercentiles. Dotted lines represent the corresponding value for conventional saRNA.
[0052] FIG. 34 Change in time to peak (TTP) as a function of GC-content of polynucleotide inserts (FIG. 34A), or as a function of stability of minimum free energy secondary structure (MFE) per nucleotide of polynucleotide inserts (FIG. 34C). Relative viability as a function of GC-content of polynucleotide inserts (FIG. 34B), or as a function of stability of minimum free energy secondary structure (MFE) per nucleotide of polynucleotide inserts (FIG. 34D). Data presented as values (symbols) with simple linear regression (solid line) with 95% confidence intervals (dotted lines) and best-fit estimates (R2).
[0053] DETAILED DESCRIPTION OF THE INVENTION
[0054] As used herein, the singular forms "a", "an", and "the" include both singular and plural referents unless the context clearly dictates otherwise.
[0055] The terms "comprising", "comprises" and "comprised of" as used herein are synonymous with "including", "includes" or "containing", "contains", and are inclusive or open-ended and do not exclude additional, non-recited members, elements, or method steps. The terms also encompass "consisting of" and "consisting essentially of".
[0056] The recitation of numerical ranges by endpoints includes all numbers and fractions subsumed within the respective ranges, as well as the recited endpoints.
[0057] The term "about" as used herein when referring to a measurable value such as a parameter, an amount, a temporal duration, and the like, is meant to encompass variations of and from the specified value, in particular variations of + / -10% or less, preferably + / -5% or less, more preferably + / -1% or less, and still more preferably + / -0.1% or less of and from the specified value, insofar such variations are appropriate to perform in the disclosed invention. It is to be understood that the value to which the modifier "about" refers is itself also specifically, and preferably, disclosed.
[0058] Whereas the term "one or more", such as one or more members of a group of members, is clear per se, by means of further exemplification, the term encompasses inter alia a reference to any one of said members, or to any two or more of said members, such as, e.g., any >3, >4, >5, >6 or >7 etc. of said members, and up to all said members.
[0059] All documents cited in the present specification are hereby incorporated by reference in their entirety.
[0060] Unless otherwise specified, all terms used in disclosing the invention, including technical and scientific terms, have the meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. By means of further guidance, term definitions may be included to better appreciate the teaching of the present invention.
[0061] By extensive experiment testing, the present inventors have found that the enhanced saRNA illustrating the principles of the present invention is associated with less cellular toxicity, has a slower amplification speed, and / or results in an equivalent or higher cumulative protein production due to a gradually increasing protein expression. More specific, the present saRNAs are associated with less cellular toxicity, while maintaining an equivalent or higher cumulative protein production in vitro and within useful time windows in vivo. This finding was unexpected in light of Saito et al., 2010 (Nature Chemical Biology, 6, 71- 78) and Wagner et al., 2018 (Nature Chemical Biology, 14, 1043-1050) which reported a repression of translation when 1 or 2 k-turns were introduced in the 5' UTR of non-amplifying mRNA. Additionally, the 5' UTR of self-amplifying RNA was shown to be critical for replication and thus for functioning of the platform. The 5' UTR of self-amplifying RNA was demonstrated to be critical both for negative saRNA (- sense) and positive saRNA (+ sense) replication and deletions in the regions severely hampered replication. It was therefore counterintuitive that introducing a polynucleotide insert in the genomic 5' UTR would permit replication and can even result in higher cumulative protein production. Furthermore, as shown in the example section, the present saRNAs allow for a prolonged duration of protein production.
[0062] Accordingly, a first aspect of the invention relates to a self-amplifying ribonucleic acid (saRNA) or transamplifying RNA (taRNA) comprising: a genomic 5' untranslated region (5'UTR) or mutant thereof; a nucleic acid sequence encoding nonstructural proteins nsPl-4 or mutant thereof; a sub-genomic promoter or mutant thereof; and (i) an open reading frame sequence encoding a protein of interest or (ii) a non-coding RNA of interest, wherein the genomic 5'UTR or mutant thereof comprises one or more polynucleotide inserts downstream of a nucleotide at position -16 , wherein the last nucleotide of the genomic 5' UTR is position -1, and wherein the combined length of the polynucleotide inserts is at least 5 nucleotides.
[0063] As used herein, the last nucleotide of the genomic 5' UTR is position -1 and the nucleotides upstream of position -1 are defined as nucleotides at positions "-n", wherein n is an integer ranging from 2 to m with m being the total number of nucleotides of the genomic 5' UTR. The terms "self-amplifying RNA", "self-replicating RNA" or "saRNA" as used herein refer to a linear singlestranded RNA molecule that is synthesized with a 5' cap, 3' poly-A tail, and 5' and 3' untranslated regions (UTRs), and encodes non-structural proteins (nsPs) derived from a virus, preferably an alphavirus, in addition to a protein of interest or a non-coding RNA of interest. The non-structural proteins (nsPs) encode a replicase such as an RNA-dependent RNA polymerase (RDRP). As the saRNA or taRNA contains the necessary components for replication, the nsPs can be self-amplified in the host cell. RDRP replicates the entire genomic RNA strand, including the sub-genomic RNA, and thus, a large amount of protein of interest is produced. The different elements of the saRNA can originate or be derived from the same virus or can originate or be derived from two or more different viral species, i.e., chimeric saRNA. By means of an example, one or more nsPs of the saRNA may be from one viral species, such as one alphavirus species, e.g., from VEEV, while the remaining nsPs may be from another viral species, such as another alphavirus species, e.g., from EEEV.
[0064] The saRNA mechanism of action after the delivery in a cell is based on the following: saRNA enters the cells where the replicase can be directly translated, being able to use saRNA as a template to make a complementary negative saRNA (-saRNA) strand. Replicase can also use this -saRNA as a template to make more +saRNA, allowing its self-amplification. On the other hand, replicase can recognize the sub-genomic promoter in the negative strand from which a sub-genomic mRNA (SG-RNA) of positive polarity is synthesized. The sub-genomic RNA can be translated to produce the protein at (very) high levels or can be replicated to produce the non-coding RNA at (very) high levels, which protein will be secreted if having a corresponding signal peptide. The same principles apply to taRNA in which the sequence of the saRNA is split into two RNA molecules. taRNA advantageously overcomes the challenge of the large size of saRNA and has been demonstrated to be as effectively expressed as saRNA.
[0065] The terms "trans-amplifying RNA" or "taRNA" as used herein refers to a set of two linear, single-stranded RNA molecules that separately encode (a) non-structural proteins nsPl-4 derived from a virus, preferably an alphavirus, and (b) a protein or non-coding RNA of interest.
[0066] Any positive strand RNA virus (+ssRNA virus) which contains an RDRP can serve as a basis or source for an saRNA or taRNA platform. In particular, any virus of the Baltimore classification system Group IV may be employed. For example, +ssRNA viruses of the phyllum Lenarviricota, Pisuviricota, Kitrinoviricota (such as a virus of the alphavirus supergroup) may be used.
[0067] In embodiments, the heterologous nucleic acid sequence may replace one or all of the alphavirus structural protein genes. Whereas natural alphavirus genomes encode structural virion proteins in addition to the non-structural replicase polyprotein, it is preferred that an alphavirus-based saRNA or taRNA as taught herein does not encode alphavirus structural proteins. Thus, the saRNA or taRNA as taught herein can lead to the production of genomic RN A copies of itself in a cell, but not to the production of RNA-containing alphavirus virions. The inability to produce these virions means that, unlike a wild-type alphavirus, the saRNA or taRNA as taught herein cannot perpetuate itself in infectious form. In embodiments, the alphavirus structural proteins which are necessary for perpetuation in wild-type viruses are absent from the saRNA or taRNA as taught herein and their place is taken by (i) ORF(s) encoding the desired product, such that the sub-genomic transcript encodes the protein of interest or (ii) non-coding RNA of interest rather than the structural alphavirus virion proteins. Therefore, in a particular embodiment, the saRNA or taRNA as taught herein comprises a sequence encoding nonstructural alphavirus proteins and a sequence encoding a protein or a non-coding RNA. More in particular, the saRNA or taRNA as taught herein comprises a sequence encoding all nonstructural alphavirus proteins and a sequence encoding a protein or a non-coding RNA. Preferably, the saRNA or taRNA as taught herein is derived from an alphavirus which has been engineered to lack the ability to produce at least one structural alphavirus protein. More preferably, the saRNA or taRNA as taught herein is derived from an alphavirus which has been engineered to lack the ability to produce at least two, more preferably all, structural alphavirus proteins.
[0068] For example, when the saRNA or taRNA is based on an alphavirus, such as Sindbis virus (SINV), Semliki Forest virus (SFV), Eastern Equine Encephalitis Virus (EEEV), and Venezuelan equine encephalitis virus (VEEV), one or more genes encoding viral structural proteins, such as capsid and / or envelope glycoproteins, can be omitted. If desired, the saRNA or taRNA as taught herein can be designed to induce production of infectious viral particles that are attenuated or virulent, or to produce viral particles that are capable of a single round of subsequent infection.
[0069] In embodiments, the genomic 5' UTR or mutant thereof is operably connected to the nucleic acid sequence encoding nonstructural proteins nsPl-4 or mutant thereof, and / or wherein the sub-genomic promoter or mutant thereof is operably connected to (i) the open reading frame sequence encoding a protein of interest or (ii) the non-coding RNA of interest.
[0070] In embodiments, the saRNA or taRNA comprises: the following nucleic acid elements: a genomic 5' UTR, a nucleic acid sequence encoding alphavirus nonstructural proteins nsPl-4, and a sub-genomic promoter, wherein the genomic 5' UTR is operably connected to the nucleic acid sequence encoding nonstructural proteins nsPl-4; and an open reading frame sequence encoding a protein or a non-coding RNA sequence, wherein the sub-genomic promoter is operably connected to the open reading frame sequence encoding the protein or to the non-coding RNA sequence. Thus, the saRNA or taRNA as taught herein is derived from one or more alphaviruses and comprises a heterologous open reading frame sequence encoding a protein or a non-coding RNA instead of one or all of the alphaviral structural proteins, preferably instead of all the alphaviral structural proteins.
[0071] In embodiments, the saRNA or taRNA is derived from an alphavirus; preferably the saRNA or taRNA is derived from a Venezuelan Equine Encephalitis Virus (VEEV), Eastern Equine Encephalitis Virus (EEEV), Semliki Forest Virus (SFV), or Sindbis Virus (SINV); more preferably the saRNA or taRNA is derived from a VEEV or an EEEV.
[0072] In embodiments of the products (such as the saRNAs, taRNAs, vectors, cells, or pharmaceutical compositions), uses, or methods as taught herein, the nucleic acid elements are from one or more alphaviruses or mutants thereof.
[0073] In embodiments of the products (such as the saRNAs, taRNAs, vectors, cells, or pharmaceutical compositions), uses, or methods as taught herein, the nucleic acid elements are derived from one or more alphaviruses or mutants thereof, such as from one or more alphaviruses of mutants thereof selected from the group consisting of a VEEV, an EEEV, a SFV, or a SINV; preferably from one or more alphaviruses or mutants thereof selected from of a VEEV or an EEEV.
[0074] In a specific embodiment, the saRNA or taRNA according to the invention comprises: an alphavirus genomic 5' untranslated region (5' UTR) or mutant thereof, a nucleic acid sequence encoding alphavirus nonstructural proteins nsPl-4 or mutant thereof, an alphavirus sub-genomic promoter or mutant thereof, and (i) an open reading frame sequence encoding a protein of interest or (ii) a non-coding RNA of interest, wherein the alphavirus genomic 5' UTR or mutant thereof comprises one or more polynucleotide inserts downstream of a nucleotide at position -16, wherein the last nucleotide of the alphavirus genomic 5' UTR or mutant thereof is position -1, and wherein the combined length of the one or more polynucleotide inserts is at least 5 nucleotides. In embodiments, the alphavirus is independently selected from the group consisting of a Venezuelan Equine Encephalitis Virus (VEEV), Eastern Equine Encephalitis Virus (EEEV), Semliki Forest Virus (SFV), or a Sindbis Virus (SINV). In preferred embodiments, the alphavirus is independently a VEEV or a EEEV.
[0075] As used herein, the term "alphaviruses" comprise a genus (Alphavirus) in the family Togaviridae of enveloped, single-stranded, positive-sense RNA viruses that occur nearly worldwide. Alphaviruses are zoonotic pathogens that are maintained primarily in rodents, primates, and birds by mosquito vectors, although a few that infect fish and seals may have no arthropod vector. Human disease occurs when people intrude on enzootic transmission habitats and are bitten by infected mosquitoes, or when alphaviruses emerge to cause epizootics and epidemics. The qualifier "alphavirus" as used herein in connection with the saRNA or taRNA relates to the nucleic acid sequence or amino acid sequence of the saRNA or taRNA, rather than to its origin or source. For example, the alphavirus saRNA or taRNA may be obtained by technical means, e.g., by recombinant expression or cell-free transcription.
[0076] Suitable wild-type alphavirus sequences are well-known and are available from sequence depositories, such as the American Type Culture Collection, Rockville, Md. Representative examples of suitable alphaviruses include Aura virus (ATCC VR-368), Bebaru virus (ATCC VR-600, ATCC VR-1240), Cabassou virus (ATCC VR-922), Chikungunya virus (ATCC VR-64, ATCC VR-1241), Eastern equine encephalomyelitis virus (ATCC VR-65, ATCC VR-1242), Fort Morgan virus (ATCC VR-924), Getah virus (ATCC VR-369, ATCC VR- 1243), Kyzylagach virus (ATCC VR-927), Mayaro virus (ATCC VR-66, ATCC VR-1277), Middleburg virus (ATCC VR-370), Mucambo virus (ATCC VR-580, ATCC VR-1244), Ndumu virus (ATCC VR-371), Pixuna virus (ATCC VR-372, ATCC VR-1245), Ross River virus (ATCC VR-373, ATCC VR-1246), Semliki Forest virus (ATCC VR-67, ATCC VR-1247), Sindbis virus (ATCC VR-68, ATCC VR-1248), Tonate virus (ATCC VR-925), Triniti virus (ATCC VR-469), Una virus (ATCC VR-374), Venezuelan equine encephalomyelitis virus (ATCC VR-69, ATCC VR-923, ATCC VR-1250 ATCC, VR- 1249, ATCC VR-532), Western equine encephalomyelitis virus (ATCC VR- 70, ATCC VR- 1251, ATCC VR-622, ATCC VR-1252), Whataroa virus (ATCC VR-926), and Y-62-33 virus (ATCC VR-375). In embodiments, the alphavirus is selected from the group consisting of a Venezuelan Equine Encephalitis Virus (VEEV), Eastern Equine Encephalitis Virus (EEEV), Semliki Forest Virus (SFV), or a Sindbis Virus (SINV). In preferred embodiments, the alphavirus is a VEEV or a EEEV.
[0077] Exemplary Venezuelan equine encephalitis virus RNA sequence (complete genome) may be as annotated under NCBI GenBank (http: / / www.ncbi.nlm.nih.gov / ) accession number (reference sequence) NC 075022.1 (sequence version 1).
[0078] Exemplary Eastern Equine Encephalitis Virus RNA sequence (complete genome) may be as annotated under NCBI GenBank (http: / / www.ncbi.nlm.nih.gov / ) accession number (reference sequence) NC_003899.1 (sequence version 1).
[0079] Exemplary Semliki Forest virus RNA sequence (complete genome) may be as annotated under NCBI GenBank accession number (reference sequence) NC_003215.1 (sequence version 1).
[0080] Exemplary Sindbis virus RNA sequence (complete genome) may be as annotated under NCBI GenBank accession number (reference sequence) NC_001547.1 (sequence version 1).
[0081] In embodiments, the nucleic acid elements may be from one or more alphaviruses selected from the group consisting of a VEEV, EEEV, SFV, or a SINV or mutants thereof. Preferably, the nucleic acid elements are from a VEEV or mutants thereof. In embodiments of the products, uses, or methods as taught herein, the nucleic acid elements or mutants thereof may be derived from the same alphavirus. For instance, the nucleic acid elements or mutants thereof may be derived from a VEEV, an EEEV, a SFV, or a SINV. In embodiments of the products, uses, or methods as taught herein, the nucleic acid elements or mutants thereof may be derived from different alphaviruses such as from two, three, or all four of a VEEV, an EEEV, a SFV, or a SINV. The saRNA or taRNA may thus comprise a chimeric saRNA derived from one or more alphaviruses, such as from one or more alphaviruses selected from the group consisting of a VEEV, EEEV, SFV, or a SINV.
[0082] In embodiments, the alphavirus may be a live attenuated Venezuelan Equine Encephalitis Virus (VEEV), such as strain TC-83 or a strain having at least 90% sequence identity, preferably at least 95%, more preferably at least 97%, even more preferably at least 99% sequence identity to strain TC-83. Strain TC- 83 is publicly available and its genome is present in NCBI GenBank under accession number L01443.1 (sequence version 1). Various genetically modified variants of alphaviruses have been generated that improve their use for saRNA molecule generation and vaccination, such as disclosed in US2015299728A1, WO1999018226A2 and US7332322B2, all of which are incorporated herein by reference. In particular, it has been found to be beneficial to have a guanine as the third nucleotide in the genomic 5' UTR of the saRNA and / or to have a p.(Gly739Leu) mutation in nonstructural protein 2 (nsP2), such as an r.3865>U mutation or a g.3865A>T mutation. Therefore, in embodiments, the saRNA or taRNA as taught herein may comprise an r.3A>G mutation in the genomic 5' UTR. In embodiments, the saRNA or taRNA as taught herein may comprise a p.(Gly739Leu) mutation in nsP2, such as an r.3865A>U mutation or a g.3865A>T mutation. In embodiments, the saRNA or taRNA as taught herein may comprise a sequence encoding the nonstructural proteins of an alphavirus, particularly VEEV, more particularly VEEV TC-83, wherein the saRNA or taRNA as taught herein may comprise an r.3A>G mutation in the genomic 5' UTR and a p.(Gly739Leu) mutation in nsP2, such as an r.3865A>U mutation or a g.3865A>T mutation. In embodiments, the saRNA or taRNA as taught herein may encode the nonstructural proteins nsPl, nsP2, nsP3 and nsP4 of VEEV TC-83, wherein preferably the p.(Gly739Leu) mutation is present in nsP2.
[0083] The terms "nucleic acid(s)" or "nucleic acid molecule(s)" or "nucleic acid element" as used herein refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides; the sequential linear arrangement of the nucleotides together resulting in or forming the "nucleotide sequence", "DNA sequence", or "RNA sequence". This term refers only to the primary structure of the molecule. Thus, this term includes double- and single-stranded DNA, and RNA. It also includes known types of modifications, for example, methylation, "caps", and substitution of one or more of the naturally occurring nucleotides with an analog. Modifications to nucleic acids can be introduced at one or more levels: phosphate linkage modification (e.g. introduction of one or more of phosphodiester, phosphoramidate or phosphorothioate bonds), sugar modification (e.g. introduction of one or more of LNA (locked nucleic acids), 2'-O-methyl, 2'-O-methoxy-ethyl, 2' -fluoro, S-constrained ethyl or tricyclo- DNA) and / or non-ribose modifications (e.g. introduction of one or more of phosphorodiamidate morpholinos or peptide nucleic acids).
[0084] By "nucleic acid construct" it is meant a nucleic acid molecule that has been constructed in order to comprise one or more functional units not found together in nature, thus having a nucleotide sequence not found in nature (non-native nucleotide sequence). Examples include circular, linear, double-stranded, extrachromosomal DNA molecules (plasmids), cosmids (plasmids containing COS sequences from lambda phage), viral genomes comprising non-native nucleic acid sequences, and the like.
[0085] The term "nucleotide" refers to a molecule that contains a nucleoside or deoxynucleoside, and at least one phosphate. A nucleoside or deoxynucleoside contains a single 5-carbon sugar moiety (e.g., ribose or deoxyribose) linked to a nitrogenous base, which is either a substituted pyrimidine (e.g., cytosine (C), thymine (T) or uracil (U)) or a substituted purine (e.g., adenine (A) or guanine (G)). As used herein, "nucleotide analog" or "modified nucleotide" refers to a nucleotide that contains one or more chemical modifications (e.g., substitutions) in or on the nitrogenous base of the nucleoside (e.g., cytosine (C), thymine (T) or uracil (U)), adenine (A) or guanine (G)). A nucleotide analog can contain further chemical modifications in or on the sugar moiety of the nucleoside (e.g., ribose, deoxyribose, modified ribose, modified deoxyribose, six-membered sugar analog, or open-chain sugar analog), or the phosphate. RNA sequences may be presented herein using their "DNA equivalent" sequences. As is well-known, a DNA equivalent sequence can be readily converted to the RNA sequence by replacing thymine (T) with uracil (U).
[0086] A "coding sequence" is a nucleotide sequence that can be transcribed into mRNA and / or translated into a polypeptide when placed under the control of appropriate (gene) regulatory sequences. The boundaries of the coding sequence are determined by a translation start codon at the 5'-terminus and a translation stop codon at the 3'-terminus. A coding sequence can include, but is not limited to mRNA, cDNA, recombinant nucleotide sequences or genomic DNA, while introns may be present as well under certain circumstances.
[0087] With a "chimeric construct", "chimeric replicon" or "chimeric gene" is interchangeably meant a recombinant nucleic acid sequence in which two nucleic acid sequences are operably or operatively linked, such as a (gene) promoter or regulatory nucleic acid sequence is operably or operatively linked to, or associated with, a nucleic acid sequence of interest (e.g. a coding sequence, a mRNA, etc.), such that the regulatory nucleic acid sequence is able to regulate transcription or expression of the nucleic acid of interest. The operable or operative linkage in a chimeric construct between the two or more nucleic acid sequences, e.g., a regulatory nucleic acid sequence and the nucleic acid sequence of interest, is not found in nature.
[0088] By "encoding" is particularly meant that a nucleic acid sequence or part(s) thereof corresponds to another nucleic acid sequence in a template - transcription product (e.g., RNA or RNA analogue) relationship, or corresponds, by virtue of the genetic code of an organism in question, to a particular amino acid sequence, e.g., the amino acid sequence of one or more desired proteins or polypeptides.
[0089] The term "heterologous" as used herein refers to any nucleic acid sequence which is different from the nucleic acid sequence originally present in the alphavirus.
[0090] The alphavirus-derived nucleic acid elements may be conveniently denoted as "mutated" or "mutant", or as comprising one or more mutations, when comprising one or more nucleotide sequence changes compared to the nucleotide sequence of alphavirus-derived nucleic acid elements that have not been so- mutated, such as, particularly, compared to the nucleotide sequence of wild-type alphavirus-derived nucleic acid elements.
[0091] As used herein, the term "wild type" as applied to a nucleic acid or polypeptide refers to a nucleic acid or a polypeptide that occurs in, or is produced by, a biological organism or entity as that biological organism or entity exists in nature. The term "wild type" may to some extent be synonymous with "native", the latter encompassing nucleic acids or polypeptides having a native sequence, i.e., ones of which the primary sequence is the same as that of the nucleic acids or polypeptides found in or derived from nature. A skilled person understands that native sequences may differ between or within different strains of the same virus due to normal genetic diversity (variation) within a given virus. Also, native sequences may differ between different viral strains or within viruses of the same viral strain due to serially passing of the viruses. Any such mutants or variants of nucleic acids or polypeptides are encompassed herein as being "native". Accordingly, all sequences of nucleic acids or polypeptides found in or derived from nature are considered "native". The term "native" encompasses the nucleic acids or polypeptides when forming a part of a living organism, organ, tissue, or cell, when forming a part of a biological sample, as well as when at least partly isolated from such sources. The term also encompasses the nucleic acids or polypeptides when produced by recombinant or synthetic means.
[0092] Considering that saRNA is by definition a synthetic construct not existing in nature, the term "conventional" saRNA or taRNA is adopted in this specification for an unmodified saRNA, such as an saRNA made up of sequence elements which are not modified compared to the respective sequence elements of the wild type virus they were derived from. In certain circumstances as may be apparent from the context, the term "conventional" saRNA is used for the unmodified saRNA which is used as a reference throughout the experimental part of the application (SEQ. ID NO: 26).
[0093] In embodiments, the saRNA or taRNA as taught herein comprises at least the following alphavirus-derived nucleic acid elements or a mutant thereof: a genomic 5' untranslated region (5' UTR), open reading frame (ORF) sequences encoding nonstructural proteins, and a sub-genomic promoter.
[0094] As used herein, the term "5' UTR" or "5' untranslated region" refers to a part of messenger RNA (mRNA) which is located 5' of the open reading frame of the mRNA. Typically, the 5' UTR starts with the transcriptional start site and ends one nucleotide before the start codon of the open reading frame. The 5' UTR may comprise elements for controlling gene expression, also called regulatory elements. Such regulatory elements may be, for example, ribosomal binding sites, a 5' Terminal Oligopyrimidine Tract, a start or stop codon, or upstream open reading frames (uORF). The 5' UTR may be post- or co- transcriptionally modified, for example by addition of a 5' cap.
[0095] In the context of the present invention, the "genomic 5' UTR" refers to the sequence of a mRNA which is located between the 5' cap and the start codon of the first open reading frame sequence encoding a nonstructural protein. Preferably, the genomic 5' UTR corresponds to the sequence which extends from a nucleotide located 3' to the 5' cap, preferably from the nucleotide located immediately 3' to the 5' cap, to a nucleotide located 5' to the start codon of the first open reading frame sequence encoding a nonstructural protein, preferably to the nucleotide located immediately 5' to the start codon of the first open reading frame sequence encoding a nonstructural protein. The nucleotide located immediately 3' to the 5' cap of a mature mRNA typically corresponds to the transcriptional start site. The term "corresponds to" means that the 5' UTR sequence may be an RNA sequence, such as in the mRNA sequence used for defining the 5' UTR sequence, or a DNA sequence, which corresponds to such RNA sequence.
[0096] In embodiments, the genomic 5' UTR or mutant thereof comprises one polynucleotide insert, wherein the length of the polynucleotide insert is at least 5 nucleotides; or the genomic 5' UTR or mutant thereof comprises two or more, such as two, three or four polynucleotide inserts, wherein the combined length of the polynucleotide inserts is at least 5 nucleotides. In embodiments, the genomic 5' UTR or mutant thereof comprises one polynucleotide insert, wherein the length of the polynucleotide insert is at least 24 nucleotides; or the genomic 5' UTR or mutant thereof comprises two or more, such as two, three or four polynucleotide inserts, wherein the combined length of the polynucleotide inserts is at least 24 nucleotides. In embodiments, the genomic 5' UTR or mutant thereof comprises one polynucleotide insert, wherein the length of the polynucleotide insert is at least 37 nucleotides; or the genomic 5' UTR or mutant thereof comprises two or more, such as two, three or four polynucleotide inserts, wherein the combined length of the polynucleotide inserts is at least 37 nucleotides. In embodiments, the length of the one polynucleotide insert or the combined length of the two or more, such as two, three, or four polynucleotide inserts, is at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, at least 22 nucleotides, at least 23 nucleotides, at least 24 nucleotides, at least 37 nucleotides, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50, at least 51, at least 52, at least 53, at least 54, at least 55, at least 56, at least 57, at least 58, at least 59, or at least 60, at least 61, at least 62, at least 63, at least 64, at least 65, or at least 66 nucleotides. Preferably, the genomic 5' UTR or mutant thereof comprises one polynucleotide insert, wherein the length of the polynucleotide insert is at least 5 nucleotides.
[0097] In the context of the invention, the genomic 5' UTR or mutant thereof comprises one or more polynucleotide inserts downstream of a nucleotide at position -16. In embodiments, the genomic 5' UTR or mutant thereof comprises one or more polynucleotide inserts downstream of a nucleotide at position -15, downstream of a nucleotide at position -14, downstream of a nucleotide at position -13, downstream of a nucleotide at position -12, or downstream of a nucleotide at position -11. Preferably, the genomic 5' UTR or mutant thereof comprises one or more polynucleotide inserts downstream of a nucleotide at position -11.
[0098] Accordingly, an aspect or embodiment relates to a saRNA or taRNA comprising: an alphavirus genomic 5'UTR or mutant thereof; a nucleic acid sequence encoding alphavirus nonstructural proteins nsPl-4 or mutant thereof; an alphavirus sub-genomic promoter or mutant thereof; and (i) an open reading frame sequence encoding a protein of interest or (ii) a non-coding RNA of interest, wherein the alphavirus genomic 5'UTR or mutant thereof comprises one or more polynucleotide inserts downstream of a nucleotide at position -11, wherein the last nucleotide (i.e., most 3' nucleotide) of the genomic 5' UTR is position -1, and wherein the combined length of the one or more polynucleotide inserts is at least 5 nucleotides. In embodiments, the combined length of the one or more polynucleotide inserts is at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, at least 22 nucleotides, at least 23 nucleotides, or at least 24 nucleotides. Hence, an aspect or embodiment relates to a saRNA or taRNA comprising: an alphavirus genomic 5'UTR or mutant thereof; a nucleic acid sequence encoding alphavirus nonstructural proteins nsPl-4 or mutant thereof; an alphavirus sub-genomic promoter or mutant thereof; and (i) an open reading frame sequence encoding a protein of interest or (ii) a non-coding RNA of interest, wherein the alphavirus genomic 5'UTR or mutant thereof comprises one or more polynucleotide inserts downstream of a nucleotide at position -11, wherein the last nucleotide (i.e., 3' nucleotide) of the genomic 5' UTR is position -1, and wherein the combined length of the one or more polynucleotide inserts is at least 24 nucleotides.
[0099] In embodiments, the genomic 5' UTR or mutant thereof comprises one or more polynucleotide inserts downstream of a nucleotide at position -10, downstream of a nucleotide at position -9, downstream of a nucleotide at position -8, downstream of a nucleotide at position -7, downstream of a nucleotide at position -6, or downstream of a nucleotide at position -5. Preferably, the alphavirus genomic 5' UTR or mutant thereof comprises a polynucleotide insert immediately downstream of a nucleotide at position - 6, -5 or -4.
[0100] In embodiments, the genomic 5' UTR or mutant thereof comprises one or more polynucleotide inserts downstream of a nucleotide at position -11, downstream of a nucleotide at position -6, downstream of a nucleotide at position -10, or downstream of a nucleotide at position -5. Preferably, the alphavirus genomic 5' UTR or mutant thereof comprises one polynucleotide insert immediately downstream of a nucleotide at position -5.
[0101] A polynucleotide (insert) being inserted "immediately downstream of a nucleotide at position X" refers to a polynucleotide (being) positioned (with its 5' -end) at the 3' -end of the nucleotide at position X.
[0102] A polynucleotide (insert) being inserted "immediately upstream of a nucleotide at position X" refers to a polynucleotide (being) positioned (with its 3' -end) at the 5' -end of the nucleotide at position X.
[0103] Accordingly, an aspect or embodiments relate to a saRNA or taRNA comprising: an alphavirus genomic 5'UTR or mutant thereof; a nucleic acid sequence encoding alphavirus nonstructural proteins nsPl-4 or mutant thereof; an alphavirus sub-genomic promoter or mutant thereof; and (i) an open reading frame sequence encoding a protein of interest or (ii) a non-coding RNA of interest, wherein the alphavirus genomic 5'UTR or mutant thereof comprises one or more polynucleotide inserts downstream of a nucleotide at position X, wherein the last nucleotide (i.e., most 3' nucleotide) of the genomic 5' UTR is position -1, and wherein the combined length of the one or more polynucleotide inserts is at least Y nucleotides, wherein:
[0104] - X is -20 and Y is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24;
[0105] - X is -19 and Y is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24;
[0106] - X is -18 and Y is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24;
[0107] - X is -17 and Y is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24;
[0108] - X is -16 and Y is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24; - X is -15 and Y is 5, 6, 7 , 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24;
[0109] - X is -14 and Y is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24;
[0110] - X is -13 and Y is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24;
[0111] - X is -12 and Y is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24;
[0112] - X is -11 and Y is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24;
[0113] - X is -10 and Y is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24;
[0114] - X is -9 and Y is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24;
[0115] - X is -8 and Y is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24;
[0116] - X is -7 and Y is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24;
[0117] - X is -6 and Y is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24;
[0118] - X is -5 and Y is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24;
[0119] - X is -4 and Y is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24;
[0120] - X is -3 and Y is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24;
[0121] - X is -2 and Y is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24; or
[0122] X is -1 and Y is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24ln embodiments of the products, uses, or methods as taught herein, the genomic 5' UTR or mutant thereof is derived from one or more alphaviruses. In embodiments, the genomic 5' UTR or mutant thereof may be derived from one or more alphaviruses selected from the group consisting of a VEEV, an EEEV, a SFV, or a SINV. Preferably, the genomic 5' UTR or mutant thereof is derived from a VEEV.
[0123] In embodiments, the genomic 5' UTR may be derived from a wild type SFV, may be as annotated under NCBI GenBank accession number NC 003215.1. In embodiments, the genomic 5' UTR may be derived from a wild type EEEV, may be as annotated under NCBI GenBank accession number NC 003899.1. In embodiments, the genomic 5' UTR may be derived from a wild type SINV, may be as annotated under NCBI GenBank accession number NC 001547.1 In embodiments, the genomic 5' UTR may be derived from a wild type VEEV, may be as annotated under NCBI GenBank (http: / / www.ncbi.nlm.nih.gov / ) accession number (reference sequence) NC 075022.1 (sequence version 1). In embodiments, the genomic 5' UTR may be derived from a mutant VEEV. In embodiments, the genomic 5' UTR may be derived from a VEEV strain TC-83. In embodiments, the genomic 5'UTR may be derived from a VEEV strain, wherein the genomic 5' UTR comprises an r.3a>g mutation.
[0124] The nucleic acid sequence of the genomic 5' UTR of VEEV strain TC-83 including the r.3a>g substitution is reproduced below (throughout this specification, as apparent from the context, T is to be construed as U in RNA):
[0125] VEEV TrD [NC_075022.1]: ATGGGCGGCGCATGAGAGAAGCCCAGACCAATTACCTACCCAAA (SEQ ID NO: 19) VEEV TC-83 [L01443.1]: ATAGGCGGCGCATGAGAGAAGCCCAGACCAATTACCTACCCAAA (SEQ ID NO: 20)
[0126] VEEV TC-83 with r.A3>G: ATGGGCGGCGCATGAGAGAAGCCCAGACCAATTACCTACCCAAA (SEQ ID NO: 21)
[0127] The nucleic acid sequence of the genomic 5' UTR of a wildtype VEEV is: ATGGGCGGCGCATGAGAGAAGCCCAGACCAATTACCTACCCAAA (SEQ ID NO: 6)
[0128] In embodiments, the genomic 5' UTR or mutant thereof may have a nucleotide sequence as set forth in SEQ ID NO: 6.
[0129] The term "open reading frame (ORF)" refers to a sequence of several nucleotide triplets, which may be translated into a peptide or protein. An open reading frame preferably contains a start codon, i.e., a combination of three subsequent nucleotides coding usually for the amino acid methionine (ATG), at its 5' -end and a subsequent region, which usually exhibits a length which is a multiple of 3 nucleotides. An ORF is preferably terminated by a stop-codon (e.g., TAA, TAG, TGA), but the stop codon is not considered part of the ORF. Typically, there is at least one stop-codon of the open reading frame (for example, where two or more stop codons are present in an ORF, the stop codon(s) upstream of the 3'-most stop codon may be 'leaky' in that they sometimes terminate translation and sometimes allow the translation to continue further. An example of such a 'leaky' stop codon is the UGA (TGA when the DNA sequence is listed) stop codon between nsP3 and nsP4, see elsewhere in this specification. Thus, an open reading frame in the context of the present invention is preferably a nucleotide sequence, consisting of a number of nucleotides that may be divided by three, which starts with a start codon (e.g., ATG) and which preferably terminates with a stop codon (e.g., TAA, TGA, or TAG). The open reading frame may be isolated, or it may be incorporated in a longer nucleic acid sequence, for example in a vector or an mRNA. An open reading frame may also be termed "protein coding region".
[0130] In embodiments, the nucleic acid sequence or mutant thereof encoding nonstructural proteins nsPl-4 comprises ORF sequence(s) encoding nonstructural proteins 1, 2, 3, and 4 or variants thereof. In embodiments of the products, uses, or methods as taught herein, the ORF sequence(s) encoding nonstructural proteins or variants thereof, or the nucleic acid sequence or mutant thereof encoding nonstructural proteins nsPl-4, or the amino acid sequence or mutant thereof corresponding to nonstructural proteins nsPl-4, is derived from one or more alphaviruses. In embodiments, the ORF sequences encoding nonstructural proteins or variants thereof, or the nucleic acid sequence or mutant thereof encoding nonstructural proteins nsPl-4, may be derived from one or more alphaviruses selected from the group consisting of a VEEV, an EEEV, a SFV, or a SINV. Preferably, the ORF sequences encoding nonstructural proteins or variants thereof, or the nucleic acid sequence or mutant thereof encoding nonstructural proteins nsPl-4, are derived from a VEEV. In embodiments, the ORF sequences encoding nonstructural proteins or the nucleic acid sequence encoding nonstructural proteins nsPl-4 may be derived from a wild type VEEV. In embodiments, the ORF sequences encoding nonstructural proteins or the nucleic acid sequence encoding nonstructural proteins nsPl-4 may be derived from a mutant VEEV. In embodiments, the ORF sequences encoding nonstructural proteins or the nucleic acid sequence encoding nonstructural proteins nsPl-4 may be derived from a VEEV strain TC-83, wherein the ORF sequence or nucleic acid sequence encoding nonstructural protein 2 may comprise a p.(Gly739Leu) mutation. In embodiments, the nucleic acid sequence or mutant thereof encoding nonstructural proteins nsPl-4 can be located within one single ORF. In embodiments, a stop codon (e.g. UGA) is present between the ORF sequences encoding nonstructural proteins nsP3 and nsP4 or the nucleic acid sequence encoding nonstructural proteins nsP3 and nsP4, which can result in translation of polyprotein P123. In embodiments, translational readthrough between the nucleic acid sequence encoding nonstructural proteins nsP3 and nsP4 occurs, even in presence of a stop codon, resulting in translation of polyprotein P1234.
[0131] The terms "sub-genomic promoter" or "subgenomic promoter" as used herein refer to those sequences that constitute a functional element required for production of subgenomic RNA species. A subgenomic promoter is necessary to drive expression of genes using RNA-dependent RNA replication of the subgenomic RNA. The subgenomic promoter may be recognized by an RNA-dependent RNA polymerase, which may be a viral RNA replicase. The promoter itself may be a composite of segments derived from more than one source, naturally occurring or synthetic. It should be noted that a subgenomic promoter is located in relation to a subgenomic RNA species or a particular gene whose transcription it initiates, and it is functionally recognized by an RNA-dependent RNA polymerase (or viral RNA replicase) when it is contained within an RNA molecule of the proper (-) polarity. The (-) sense RNA molecule containing the functional copy of the subgenomic promoter can be synthesized by RNA-dependent RNA polymerase using a (+) sense RNA molecule as template, or it may have been synthesized by (cellular) RNA polymerase II as a transcript initiated by a pol II promoter, or it may be produced synthetically e.g. by in vitro transcription.
[0132] In embodiments of the products, uses, or methods as taught herein, the sub-genomic promoter or mutant thereof is derived from one or more alphaviruses. In embodiments, the sub-genomic promoter or mutant thereof may be derived from one or more alphaviruses selected from the group consisting of a VEEV, an EEEV, a SFV, or a SINV. Preferably, the sub-genomic promoter or mutant thereof is derived from a VEEV. In embodiments, the sub-genomic promoter (SGP) or mutant thereof may comprise or consist of about 241 nucleotides, such as precisely 241 nucleotides, upstream of the transcription initiation start site of the sub-genomic promotor or mutant thereof, and 30 nucleotides downstream of the transcription initiation site. The upstream part of such -241 / +30 SGP thus encompasses a 3' region of nsP4 down to its UAA stop codon (bold below) plus 5 nucleotides downstream thereon; the downstream part encompasses 30 nucleotides downstream of the transcription initiation site and comprises at least a portion of the sub- genomic 5'UTR or even the complete sub-genomic 5'UTR. For example, in certain embodiments an saRNA construct may have a comparatively longer sub-genomic 5'UTR, such that the SGP will comprise only a 5' part of the sub-genomic 5'UTR. The 5' boundary of SGP is not exactly defined, and both 5' and 3' truncated versions of the SGP as described above have been shown as functional. By means of an example, truncation of the downstream part of SGP to only 15 nucleotides has been shown to even improve the expression of sub-genomic protein of interest. Accordingly, in embodiments the SGP may be any fragment or truncated version of the above described SGP that is capable of effecting experimentally or therapeutically meaningful expression of the sub-genomic protein or RNA of interest. For example, the expressed quantity of the sub-genomic product controlled by the truncated SGP may be in increasing order of preference at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the expressed quantity of the sub-genomic product controlled by the -241 / +30 SGP. By means of examples and without limitation, and adopting the above -241 / +30 annotation, SGP as intended herein may comprise or consist of — (i) / +(ii), wherein (i) is in increasing order of preference between 10 and 241, between 20 and 241, between 30 and 241, between 40 and 241, between 50 and 241, between 60 and 241, between 70 and 241, between 80 and 241, between 90 and 241, between 100 and 241, between 110 and 241, between 120 and 241, between 130 and 241, between 140 and 241, between 150 and 241, between 160 and 241, between 170 and 241, between 180 and 241, between 190 and 241, between 200 and 241, between 210 and 241, between 220 and 241, or between 230 and 241; and (ii) is in increasing order of preference between 1 and 30, such as 1, 2, 3, or 4, between 5 and 30, such as 5, 6, 7, 8 or 9, between 10 and 30, such as 11, 12, 13, or 14, between 15 and 30, such as 15, 16, 17, 18, or 19, between 20 and 30, such as 20, 21, 22, 23, or 24, or between 25 and 30, such as 25, 26, 27, 28, 29, or 30.
[0133] In embodiments, the sub-genomic promoter or mutant thereof may comprise or consist of a nucleotide sequence as set forth in SEQ. ID NO: 22.
[0134] AGCTTGGCAAACCTCTGGCAGCAGACGATGAACATGATGATGACAGGAGAAGGGCATTGCATGAAGAGTCAACA CGCTGGAACCGAGTGGGTATTCTTTCAGAGCTGTGCAAGGCAGTAGAATCAAGGTATGAAACCGTAGGAACTTCC ATCATAGTTATGGCCATGACTACTCTAGCTAGCAGTGTTAAATCATTCAGCTACCTGAGAGGGGCCCCTATAACTCT CTACGGCTAACCTGAATGGACTACGACATAGTCTAGTCCGCCAAG
[0135] It follows from the above that the subgenomic promoter and subgenomic 5'UTR sequence elements in saRNA or taRNA may typically at least partially overlap, and consequently where this specification refers to the saRNA or taRNA as comprising a subgenomic promoter but does not explicitly mention the presence of subgenomic 5'UTR, it shall be understood that the subgenomic promoter may drive RNA-dependent RNA replication which produces an RNA product that may and typically will contain a number of nucleotides upstream of the ATG start codon of the heterologous sequence, or in other words, will contain sequence elements deemed to constitute a subgenomic 5'UTR.
[0136] In embodiments, the sub-genomic promoter may be derived from a wild type VEEV. In embodiments, the sub-genomic promoter may be derived from a mutant VEEV. In embodiments, the sub-genomic promoter may be derived from a VEEV strain TC-83.
[0137] The nucleic acid sequence of the sub-genomic promoter of wild-type VEEV strain and VEEV strain TC-83, which is identical, is reproduced below:
[0138] AGCTTGGCAAACCTCTGGCAGCAGACGATGAACATGATGATGACAGGAGAAGGGCATTGCATGAAGAGTCAACACGCTGGA ACCGAGTGGGTATTCTTTCAGAGCTGTGCAAGGCAGTAGAATCAAGGTATGAAACCGTAGGAACTTCCATCATAGTTATGGCC ATGACTACTCTAGCTAGCAGTGTTAAATCATTCAGCTACCTGAGAGGGGCCCCTATAACTCTCTACGGCTAACCTGAATGGACT ACGACATAGTCTAGTCCGCCAAG (SEQ ID NO: 22)
[0139] In embodiments, the saRNA or taRNA as taught herein may comprise further alphavirus-derived nucleic acid elements or a mutant thereof such as a sub-genomic 5' UTR, a 3' UTR, and a poly- adenosine tail (i.e., poly(A) tail).
[0140] The term "sub-genomic 5' UTR" as used herein refers to the sequence of a mature mRNA which is at least partially contained within the subgenomic promoter and is located between the 5' end of the subgenomic RNA and (i) the start codon of the open reading frame (ORF) sequence encoding a protein or (ii) a noncoding RNA. The sub-genomic 5' UTR may optionally contain an upstream open reading frame (uORF), stop codon, or start codon, such as exemplified in SEQ ID NO: 22 (ATG codon at position 242 of that sequence).
[0141] In embodiments, the sub-genomic 5' UTR or mutant thereof is derived from one or more alphaviruses, such as one or more alphaviruses selected from the group consisting of a VEEV, SFV, EEEV, or a Sindbis Virus. Preferably, the sub-genomic 5' UTR or mutant thereof is derived from a VEEV. In embodiments, the sub-genomic 5' UTR or mutant thereof may comprise or consist of a nucleotide sequence as set forth in SEQ ID NO: 23. (ATGGACTACGACATAGTCTAGTCCGCCAAG).
[0142] In embodiments, the sub-genomic 5' UTR may be derived from a wild type VEEV. In embodiments, the sub-genomic 5' UTR may be derived from a mutant VEEV.
[0143] The nucleic acid sequence of the sub-genomic 5' UTR of VEEV strain TC-83 is reproduced below:
[0144] ATGGACTACGACATAGTCTAGTCCGCCAAG (SEQ ID NO: 23).
[0145] The term "3' UTR" or "3' untranslated region" refers to the part of an mRNA which is located between the protein coding region and the 3' -terminus of the mRNA. A 3' UTR of an mRNA is not translated into an amino acid sequence. The 3' UTR sequence is generally encoded by the gene, which is transcribed into the respective mRNA during the gene expression process.
[0146] In the context of the present invention, the term "3' UTR" corresponds to the sequence of a mature mRNA which is located 3' to the stop codon of the open reading frame sequence encoding a protein or a noncoding RNA, preferably immediately 3' to the stop codon of the open reading frame sequence encoding a protein or a non-coding RNA, and which extends to the 3' -terminus of the mRNA or the 5' side of the poly(A) sequence, preferably to the nucleotide immediately 5' to the poly(A) sequence. The term "corresponds to" means that the 3' UTR sequence may be an RNA sequence, such as in the mRNA sequence used for defining the 3' UTR sequence, or a DNA sequence, which corresponds to such RNA sequence.
[0147] In embodiments, the 3' UTR or mutant thereof may be derived from one or more alphaviruses. In embodiments, the 3' UTR or mutant thereof may be derived from one or more alphaviruses selected from the group consisting of a VEEV, EEEV, SFV, or a Sindbis Virus. Preferably, the 3' UTR or mutant thereof is derived from a VEEV. In embodiments, the 3' UTR or mutant thereof may have a nucleotide sequence as set forth in SEQ ID NO: 24.
[0148] VEEV TrD [NC_075022.1]:
[0149] ATACAGCAGCAATTGGCAAGCTGCTTACATAGAACTCGCGGCGATTGGCATGCCGCCTTAAAATTTTTATTTTATTT TTTCTTTTCTTTTCCGAATCGGATTTTGTTTTTAATATTTC
[0150] In embodiments, the 3' UTR may be derived from a wild type VEEV. In embodiments, the 3' UTR may be derived from a mutant VEEV. In embodiments, the 3' UTR may be derived from a VEEV strain TC-83.
[0151] The nucleic acid sequence of the 3' UTR of VEEV strain TC-83 [L01443.1] is reproduced below:
[0152] ATACAGCAGCAATTGGCAAGCTGCTTACATAGAACTCGCGGCGATTGGCATGCCGCCTTAAAATTTTTATTTTATTT nCTTTTCTTTTCCGAATCGGATTTTGTTTTTAATATTTC (SEQ ID NO: 25)
[0153] As used herein, the term "3'-poly(A) tail", "poly-adenosine tail", "poly-A tail" or "poly(A) tail" refers to a stretch of adenine nucleotides added to the 3' -end of the transcribed mRNA. It can, in some instances, be as short as 11-12 nucleotides or comprise up to about 500 adenine nucleotides. In some cases, the length of the poly(A) tail may be an essential element with respect to the stability of the individual mRNA. Said length can be of up to about 400 adenine nucleotides, e.g., from about 11 to about 400, preferably from about 20 to about 400, more preferably from about 30 to about 300, even more preferably from about 30 to about 250, most preferably from about 40 to about 250 adenine nucleotides. A poly(A) sequence is typically located at the 3' end of an mRNA. In the context of the present invention, a poly(A) sequence may be located within an mRNA or any other nucleic acid molecule, such as, e.g., in a vector, for example, 1 in a vector serving as template for the generation of an RNA, preferably an mRNA, e.g., by transcription of the vector. In embodiments, the poly(A) sequence can be added to the synthetic (sa)-mRNA after production or alternatively the mRNA can be untailed.
[0154] In embodiments, the saRNA or taRNA as taught herein may comprise further elements such as a 5' cap.
[0155] The terms "5' cap" or "five-prime cap" refer to an entity, typically a modified or altered nucleotide entity, on the 5' end of a mature mRNA. A 5' cap may typically be formed by a modified nucleotide, particularly by a derivative of a guanine nucleotide. Preferably, the 5' cap is linked to the 5' terminus via a 5' -5'- triphosphate linkage. A 5' cap may be methylated, e.g., m7GpppN, wherein N is the terminal 5' nucleotide of the nucleic acid carrying the 5' cap, typically the 5' end of an RNA; or m7GpppNm, wherein N is the terminal 5' nucleotide of the nucleic acid carrying the 5' cap and is methylated on the 2'0 ribose position; or m7GpppNlmN2m, wherein N1 is the terminal 5' nucleotide of the nucleic acid carrying the 5' cap and N2 is its 3' adjacent nucleotide and both are methylated on their respective 2'0 ribose positions. Further examples of 5' cap structures include glyceryl, inverted deoxy abasic residue (moiety), 4', 5' methylene nucleotide, l-(beta-D-erythrofuranosyl) nucleotide, 4'-thio nucleotide, carbocyclic nucleotide, 1,5- anhydrohexitol nucleotide, L-nucleotides, alpha-nucleotide, modified base nucleotide, threo- pentofuranosyl nucleotide, acyclic 3', 4' -seco nucleotide, acyclic 3,4-dihydroxybutyl nucleotide, acyclic 3,5 dihydro xypentyl nucleotide, 3'-3'-inverted nucleotide moiety, 3, 3 inverted abasic moiety, 3'-2'-inverted nucleotide moiety, 3'-2'-inverted abasic moiety, 1,4-butanediol phosphate, 3'-phosphoramidate, hexylphosphate, aminohexyl phosphate, 3'-phosphate, 3'phosphorothioate, phosphorodithioate, or bridging or non-bridging methylphosphonate moiety. A 5' cap can also be incorporated co- transcriptionally, for example in the form of a trinucleotide, such as m7G(5')ppp(5')(2'OI\ / leA)pU, or as a dinucleotide, such as 3'-O-Me-m7G(5')ppp(5')G.
[0156] The present disclosure also relates to "mutants" of the alphavirus-derived nucleic acid elements disclosed herein.
[0157] The term "mutant" of a nucleic acid such as an alphavirus-derived nucleic acid element as taught herein generally refers to a nucleic acid of which the nucleotide sequence is substantially identical (i.e., largely but not wholly identical) to the sequence of the nucleic acid, e.g., at least about 50%, 60%, 70%, 80% or 90% identical, e.g., preferably at least about 91% identical, e.g. at least about 92% identical, at least 93% identical, 94% identical, more preferably at least about 95% identical, e.g., at least about 96% identical, about 97% identical, e.g., at least 98% identical, at least 99% identical, at least 99.5% identical to the sequence of the nucleic acid, e.g., to the sequence of the alphavirus-derived nucleic acid element as taught herein. Preferably, a mutant may display such degrees of identity to a recited nucleic acid when the whole sequence of the recited nucleic acid is queried in the sequence alignment (i.e., overall sequence identity). Sequence identity may be determined using suitable algorithms for performing sequence alignments and determination of sequence identity as know perse.
[0158] The terms "identity", "sequence identity" or "identical" in the context of nucleotide sequences may be used interchangeably herein, and refer to the extent that nucleic acid sequences are identical on a nucleotide-by-nucleotide basis, over a window of comparison. The percentage of sequence identity may be calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity. The percent identity value may, but need not, be rounded to the nearest tenth. For example, 98.1, 98.2, 98.3, and 98.4 may be rounded down to 98, while 98.5, 98.6, 98.7, 98.8, and 98.9 may be rounded up to 99.
[0159] Sequence identity between nucleic acids as envisaged herein may be determined using suitable algorithms for performing sequence alignments and determination of sequence identity as know per se. Exemplary but non-limiting algorithms include those based on the Basic Local Alignment Search Tool (BLAST) originally described by Altschul et al. 1990 (J Mol Biol 215: 403-10), such as the "Blast 2 sequences" tool described by Tatusova and Madden 1999 (FEMS, Microbiol Lett, 174: 247-250), or the "blastn suite- 2sequences" sequence alignment algorithm described by Zheng Zhang et al. 2000 (J Comput Biol, 2000, vol. 7(1-2), 203-14), now incorporated into the BLAST program suite available at ncbi.nlm.nih.gov. The skilled person can implement such algorithms and set the requisite parameters. By means of an example and without limitation, parameters for the BLASTN program may be as follows: cost to open a gap = 0, cost to extend a gap = 2.5, reward for a match = 1, penalty for a mismatch = -2, Expect value = 0.05, word size = 28, Low Complexity Filter = Yes.
[0160] There are further algorithms known in the art that can be used to measure nucleotide sequence identity. Nucleotide sequence identity can be measured by a local or global alignment, preferably implementing an optimal local or optimal global alignment algorithm. For example, a global alignment may be generated using an implementation of the Needleman-Wunsch algorithm (Needleman & Wunsch. Journal of Molecular Biology 1970, vol. 48(3), 443-53). For example, a local alignment (which does not consider the entirety of the sequence but tries to find the longest subsequence that confirms to a given matching criteria) may be generated using an implementation of the Smith-Waterman algorithm (Smith & Waterman Journal of Molecular Biology 1981, vol. 147(1), 195-197). Optimal global alignments using the Needleman-Wunsch algorithm and optimal local alignments using the Smith-Waterman algorithm are implemented in USEARCH (https: / / www.drive5.com / usearch / ), for example USEARCH version 11.0.667. A gap is a region of an alignment wherein a sequence does not align to a position in the other sequence of the alignment. In global alignments, terminal gaps are discarded before identity is calculated. For both local and global alignments, internal gaps are counted as differences. A terminal gap is a region beginning at the end of a sequence in an alignment wherein the nucleotide in the terminal position of that sequence does not correspond to a nucleotide position in the other sequence of the alignment and extending for all contiguous positions in that sequence wherein the nucleotides of that sequence do not correspond to a nucleotide position in the other sequence of the alignment.
[0161] In embodiments, a mutant of a virus-derived nucleic acid element as taught herein, in particular an alphavirus-derived nucleic acid element as taught herein, is substantially identical (i.e., largely but not wholly identical) to the sequence of the virus-derived nucleic acid element, e.g., at least about 50%, 60%, 70%, 80% or 90% identical, e.g., preferably at least about 91% identical, e.g. at least about 92% identical, at least about 93% identical, at least about 94% identical, more preferably at least about 95% identical, e.g., at least about 96% identical, at least about 97% identical, e.g., at least about 98% identical, at least about 99% identical, at least about 99.5% identical to the sequence of the virus-derived nucleic acid element , e.g., to the sequence of the alphavirus-derived nucleic acid element as taught herein, such as the alphavirus genomic 5'UTR, the nucleic acid sequence encoding alphavirus nonstructural proteins nsPl-4, or the alphavirus sub-genomic promoter.
[0162] In embodiments, a mutant of a virus-derived nucleic acid element as taught herein, in particular an alphavirus-derived nucleic acid element as taught herein, may comprise one or more point mutations (i.e., single nucleotide additions, deletions, or substitutions) relative to (i.e., compared with) the corresponding nucleic acid, e.g., to the sequence of the alphavirus-derived nucleic acid element as taught herein. Preferably, a mutant of a virus -derived nucleic acid element as taught herein, in particular an alphavirus- derived nucleic acid element as taught herein may comprise one or more single nucleotide substitutions relative to (i.e., compared with) the corresponding nucleic acid, e.g., to the sequence of the alphavirus- derived nucleic acid element as taught herein, such as the alphavirus genomic 5'UTR, the nucleic acid sequence encoding alphavirus nonstructural proteins nsPl-4, or the alphavirus sub-genomic promoter.
[0163] In embodiments, a mutant of a virus-derived nucleic acid element as taught herein, in particular a alphavirus-derived nucleic acid element as taught herein may comprise at most twenty, such as at most fifteen, at most fourteen, at most thirteen, at most twelve, at most eleven, or at most ten, e.g., at most nine, at most eight, at most seven, at most six, or at most five, such as one, two, three, four or five, point mutations (i.e., single nucleotide additions, deletions, or substitutions) relative to (i.e., compared with) the corresponding nucleic acid, e.g., to the sequence of the alphavirus-derived nucleic acid element as taught herein, in particular a alphavirus-derived nucleic acid element as taught herein. Preferably, a mutant of a virus-derived nucleic acid element as taught herein may comprise at most twenty, such as at most fifteen, at most fourteen, at most thirteen, at most twelve, at most eleven, or at most ten, e.g., at most nine, at most eight, at most seven, at most six, or at most five, such as one, two, three, four or five, single nucleotide substitutions relative to (i.e., compared with) the corresponding nucleic acid, e.g., to the sequence of the alphavirus-derived nucleic acid element as taught herein.
[0164] Where the present specification refers to or encompasses mutants of nucleic acids such as the alphavirus- derived nucleic acid elements as taught herein, this denotes mutants which are functionally active or functional, i.e., which at least partly retain the biological activity or intended functionality of the respective or corresponding nucleic acids. By means of an example and not limitation, a functionally active mutant of an alphavirus-derived nucleic acid element as taught herein such as the genomic 5' UTR shall at least partly retain the biological activity of the alphavirus-derived nucleic acid element as taught herein such as the genomic 5' UTR. For example, the genomic 5' UTR may retain one or more aspects of the biological activity of the genomic 5' UTR, such as its activity to allow amplification of the nonstructural proteins. For example, the ORF sequences encoding nonstructural proteins may retain their activity to encode the non-structural proteins or functionally active variants thereof. For example, the sub-genomic promoter may retain one or more aspects of the biological activity of the sub-genomic promoter, such as its activity to allow amplification of the protein of interest or non-coding RNA of interest. Preferably, a functionally active mutant may retain at least about 20%, e.g., at least about 25%, or at least 30%, or at least about 40%, or at least about 50%, e.g., at least 60%, more preferably at least about 70%, e.g., at least 80%, yet more preferably at least about 85%, still more preferably at least about 90%, and most preferably at least about 95% or even about 100% or higher of the intended biological activity or functionality compared with the corresponding nucleic acid. Reference to the "activity" of a nucleic acid such as the alphavirus-derived nucleic acid elements as taught herein may generally encompass any one or more aspects of the biological activity of the nucleic acid, such as without limitation any one or more aspects of its biochemical activity, interaction activity, and / or structural activity, e.g., within a cell, tissue, organ, or an organism. By means of an example and not limitation, reference to the activity of the alphavirus- derived nucleic acid elements or functionally active mutant thereof may particularly denote their activity to drive the saRNA mechanism of action as described herein. Where the activity of a given nucleic acid such as the alphavirus-derived nucleic acid elements as taught herein can be readily measured in an established assay, e.g., an enzymatic assay such as measuring the production of the protein of interest (such as, for example, by enzyme immunoassay (EIA), e.g. enzyme-linked immunosorbent assay (ELISA), or by measuring bioluminescence, or by polysome profiling or by sequencing methods, e.g. Ribo-seq), a functionally active mutant of the nucleic acid may display activity in such assays, which is at least about 20%, e.g., at least about 25%, or at least 30%, or at least about 40%, or at least about 50%, e.g., at least 60%, more preferably at least about 70%, e.g., at least 80%, yet more preferably at least about 85%, still more preferably at least about 90%, and most preferably at least about 95% or even about 100% or higher of the activity of the respective or corresponding nucleic acid.
[0165] In embodiments, the saRNA or taRNA as taught herein further comprises a heterologous open reading frame sequence encoding a protein or a non-coding RNA, wherein the sub-genomic promoter or mutant thereof is operably connected to (i) the heterologous open reading frame sequence encoding the protein, or (ii) the non-coding RNA.
[0166] An "operable connection" or "operable linkage" is a connection or linkage in which regulatory sequences and sequences sought to be expressed are connected in such a way as to direct or regulate said expression. For example, sequences, such as, e.g., a promoter, subgenomic promoter, or 5'UTR, and an ORF, may be said to be operably connected if the nature of the connection between said sequences: (1) does not result in the introduction of a frame-shift mutation, (2) allows the promoter, subgenomic promoter, or 5' UTR to direct the expression of the ORF, (3) allows the ORF to be expressed under the control of the promoter, subgenomic promoter, or 5' UTR sequence. Hence, "operably connected" or "operably linked" may mean incorporated into a genetic construct so that expression control sequences, such as a promoter, subgenomic promoter, or 5' UTR, effectively control expression of a coding sequence of interest, such as the ORFs encoding the nspl-4 or the ORF sequence encoding the protein or non-coding RNA as defined herein.
[0167] In embodiments, the open reading frame sequence encoding a protein of interest may be any gene encoding a protein of interest. In embodiments, the protein is a therapeutic protein.
[0168] In embodiments, the non-coding RNA may be any nucleic acid sequence encoding a non-coding RNA. In embodiments, the non-coding RNA (ncRNA) may be transfer RNAs (tRNA), ribosomal RNA (rRNA), long ncRNA, or small RNA such as microRNA, siRNA, piRNA, snoRNA, snRNA, exRNA, and scaRNA.
[0169] In embodiments, the saRNA or taRNA as taught herein may comprise multiple nucleotide sequences, such as two or more open reading frames, thereby allowing co-expression of proteins. Such saRNA or taRNA as taught herein may be useful, for example, in the production of various gene products (e.g., proteins) at the same time or in gene therapy applications.
[0170] In embodiments, the saRNA or taRNA as taught herein comprises: an alphavirus genomic 5' UTR or mutant thereof, a nucleic acid sequence or mutant thereof encoding alphavirus nonstructural proteins nsPl-4, an alphavirus sub-genomic promoter or mutant thereof, and a heterologous open reading frame sequence encoding a protein of interest or a non-coding RNA of interest, wherein the alphavirus genomic 5' UTR or mutant thereof is operably connected to the nucleic acid sequence or mutant thereof encoding alphavirus nonstructural proteins nsPl-4, and wherein the alphavirus sub-genomic promoter or mutant thereof is operably connected to the heterologous open reading frame sequence. In embodiments, the saRNA or taRNA as taught herein may comprise: an alphavirus genomic 5' UTR or mutant thereof, a nucleic acid sequence or mutant thereof encoding alphavirus nonstructural proteins nsPl-4, wherein the alphavirus genomic 5' UTR or mutant thereof is operably connected to the nucleic acid sequence or mutant thereof encoding alphavirus nonstructural proteins nsPl-4, an alphavirus sub-genomic promoter or mutant thereof, a heterologous open reading frame sequence encoding a protein of interest or a non-coding RNA of interest, wherein the heterologous nucleic acid sequence replaces one or all of the alphavirus structural protein genes, and wherein the alphavirus sub-genomic promoter or mutant thereof is operably connected to the heterologous open reading frame sequence, an alphavirus 3' UTR or mutant thereof, and optionally a poly-adenosine tail.
[0171] In embodiments, the saRNA or taRNA as taught herein further comprises a 5' cap, in particular at the 5' end, and / or a poly adenosine tail, in particular at the 3' end. In embodiments, the saRNA or taRNA as taught herein further comprises an alphavirus sub-genomic 5' UTR or mutant thereof, in particular at least partially within (such as only partially within) the alphavirus sub-genomic promoter or mutant thereof and can be located between the 5' end of the subgenomic RNA and (i) the start codon of the open reading frame sequence encoding a protein of interest, or (ii) the non-coding RNA of interest.
[0172] In embodiments, the saRNA as taught herein comprises a single RNA molecule, the RNA molecule may comprise in 5' to 3' order: an alphavirus genomic 5' UTR or mutant thereof, a nucleic acid sequence or mutant thereof encoding alphavirus nonstructural proteins nsPl-4, wherein the alphavirus genomic 5' UTR or mutant thereof is operably connected to the nucleic acid sequence or mutant thereof encoding alphavirus nonstructural proteins nsPl-4, an alphavirus sub-genomic promoter or mutant thereof, an alphavirus sub-genomic 5' UTR or mutant thereof, a heterologous open reading frame sequence encoding a protein of interest or a non-coding RNA of interest, wherein the heterologous nucleic acid sequence replaces one or all of the alphavirus structural protein genes, and wherein the alphavirus sub-genomic promoter or mutant thereof is operably connected to the heterologous open reading frame sequence, an alphavirus 3' UTR or mutant thereof, and optionally a poly-adenosine tail. In embodiments, the saRNA as taught herein further comprises a 5' cap, in particular at the 5' end.
[0173] In embodiments, the taRNA as taught herein comprises two RNA molecules, the first RNA molecule may comprise in 5' to 3' order: optionally and preferably a 5' cap, an alphavirus genomic 5' UTR or mutant thereof, a nucleic acid sequence or mutant thereof encoding alphavirus nonstructural proteins nsPl-4, wherein the alphavirus genomic 5' UTR or mutant thereof is operably connected to the nucleic acid sequence or mutant thereof encoding alphavirus nonstructural proteins nsPl-4, optionally and preferably an alphavirus 3' UTR or mutant thereof, and optionally a poly-adenosine tail, and the second RNA molecule, which may be + sense or - sense, and which in case of + sense may comprise in 5' to 3' order: optionally and preferably a 5' cap, an alphavirus sub-genomic promoter or mutant thereof, - a heterologous open reading frame sequence encoding a protein of interest or a non-coding RNA of interest, wherein the heterologous nucleic acid sequence replaces one or all of the alphavirus structural protein genes, and wherein the alphavirus sub-genomic promoter or mutant thereof is operably connected to the heterologous open reading frame sequence, optionally and preferably an alphavirus 3' UTR or mutant thereof, and optionally and preferably a poly-adenosine tail, and in case of - sense may comprise in 3' to 5' order: an alphavirus sub-genomic promoter or mutant thereof; and an alphavirus 3' UTR or mutant thereof.
[0174] In embodiments, the first RNA molecule and the second + sense RNA molecule comprises a 5' cap, in particular at the 5' end.
[0175] In embodiments, the self-amplifying or trans-amplifying RNA molecule is based on the RNA genome of an alphavirus, preferably of a Venezuelan Equine Encephalitis virus.
[0176] In embodiments, the saRNA or taRNA as taught herein may comprise: a VEEV genomic 5' UTR or mutant thereof, a nucleic acid sequence or mutant thereof encoding VEEV nonstructural proteins nsPl-4, wherein the VEEV genomic 5' UTR or mutant thereof is operably connected to the nucleic acid sequence or mutant thereof encoding VEEV nonstructural proteins nsPl-4, a VEEV sub-genomic promoter or mutant thereof, a heterologous open reading frame sequence encoding a protein of interest or a non-coding RNA of interest, wherein the heterologous nucleic acid sequence replaces one or all of the VEEV structural protein genes, and wherein the VEEV sub-genomic promoter or mutant thereof is operably connected to the heterologous open reading frame sequence, a VEEV 3' UTR or mutant thereof, and optionally a poly-adenosine tail.
[0177] In embodiments, the saRNA or taRNA as taught herein further comprises a 5' cap, in particular at the 5' end. In embodiments, the saRNA or taRNA as taught herein further comprises a VEEV sub-genomic 5' UTR or mutant thereof, in particular at least partially within (such as only partially within) the VEEV sub- genomic promoter or mutant thereof and can be located between the 5'end of the subgenomic RNA and the start of the open reading frame sequence encoding a protein of interest or non-coding RNA of interest. In embodiments, the saRNA as taught herein comprises a single RNA molecule, the RNA molecule may comprise in 5' to 3' order: a VEEV genomic 5' UTR or mutant thereof, a nucleic acid sequence or mutant thereof encoding VEEV nonstructural proteins nsPl-4, wherein the VEEV genomic 5' UTR or mutant thereof is operably connected to the nucleic acid sequence or mutant thereof encoding VEEV nonstructural proteins nsPl-4, a VEEV sub-genomic promoter or mutant thereof, a heterologous open reading frame sequence encoding a protein of interest or a non-coding RNA of interest, wherein the heterologous nucleic acid sequence replaces one or all of the VEEV structural protein genes, and wherein the VEEV sub-genomic promoter or mutant thereof is operably connected to the heterologous open reading frame sequence, and a VEEV 3' UTR or mutant thereof.
[0178] In embodiments, the saRNA as taught herein further comprises a 5' cap, in particular at the 5' end, and / or a poly-adenosine tail, in particular at the 3' end.
[0179] In embodiments, the taRNA as taught herein comprises two RNA molecules, the first RNA molecule may comprise in 5' to 3' order: optionally and preferably a 5' cap, a VEEV genomic 5' UTR or mutant thereof, a nucleic acid sequence or mutant thereof encoding VEEV nonstructural proteins nsPl-4, wherein the VEEV genomic 5' UTR or mutant thereof is operably connected to the nucleic acid sequence or mutant thereof encoding VEEV nonstructural proteins nsPl-4, optionally and preferably a VEEV 3' UTR or mutant thereof, and optionally a poly-adenosine tail, and the second RNA molecule, which may be + sense or - sense, and which in case of + sense may comprise in 5' to 3' order: optionally and preferably a 5' cap, a VEEV sub-genomic promoter or mutant thereof, a heterologous open reading frame sequence encoding a protein of interest or a non-coding RNA of interest, wherein the heterologous nucleic acid sequence replaces one or all of the VEEV structural protein genes, and wherein the VEEV sub-genomic promoter or mutant thereof is operably connected to the heterologous open reading frame sequence, optionally and preferably a VEEV 3' UTR or mutant thereof, and optionally and preferably a poly-adenosine tail. and in case of - sense may comprise in 3' to 5' order: an VEEV sub-genomic promoter or mutant thereof; and an VEEV 3' UTR or mutant thereof.
[0180] In embodiments, the first RNA molecule and the second + sense RNA molecule may further comprise a 5' cap, in particular at the 5' end.
[0181] In aspects or embodiments of the products, uses, or methods as taught herein, the saRNA may comprise, preferably in 5' to 3' order, or the taRNA may comprise: a 5' cap, a VEEV genomic 5' UTR or mutant thereof, a nucleic acid sequence or mutant thereof encoding VEEV nonstructural proteins nsPl-4, a VEEV sub- genomic promoter or mutant thereof, a VEEV sub-genomic 5' UTR or mutant thereof, a heterologous open reading frame sequence encoding a protein of interest or a non-coding RNA of interest, a VEEV 3' UTR or mutant thereof, and a poly-adenosine tail, wherein the VEEV genomic 5' UTR or mutant thereof is operably connected to the nucleic acid sequence or mutant thereof encoding VEEV nonstructural proteins nsPl-4; and wherein the VEEV sub-genomic promoter or mutant thereof is operably connected to the heterologous open reading frame sequence, wherein the VEEV genomic 5' UTR or mutant thereof comprises one or more polynucleotide inserts downstream of a nucleotide at position -16, wherein the last nucleotide of the genomic 5' UTR is position -1 , and wherein the length of the combined polynucleotide inserts is at least 5 nucleotides.
[0182] As detailed herein, in embodiments, the saRNA or taRNA as taught herein or mutant thereof is modified according to the principles of the invention to acquire a reduced cellular toxicity, a long or prolonged protein production and / or an increased (accumulated) production of the protein or non-coding RNA of interest as compared to a non-modified saRNA or taRNA. The term "acquire" (obtain, attain, gain) is used broadly, encompassing a situation where: (i) the modification causes the saRNA or taRNA to exhibit no cellular toxicity where cellular toxicity was detectable before the modification, as well as a situation where the modification causes the saRNA or taRNA to exhibit decreased cellular toxicity compared with any cellular toxicity detectable before the modification, (ii) the modification causes the saRNA or taRNA to exhibit a production of the protein or non-coding RNA of interest of at least 10, 12, 15, 17, 19 weeks or longer in vivo where production was shorter before the modification; and / or (iii) the modification causes the saRNA or taRNA to exhibit (accumulated) production of the protein or non-coding RNA of interest where no (accumulated) production of the protein or non-coding RNA of interest was detectable before the modification, as well as a situation where the modification causes the saRNA or taRNA to exhibit additional (increased) (accumulated) production of the protein or non-coding RNA of interest compared with any (accumulated) production of the protein or non-coding RNA of interest detectable before the modification.
[0183] The modification entails the insertion of one or more polynucleotide inserts downstream of a nucleotide at position -16 of the genomic 5' UTR or mutant thereof, in particular an alphavirus genomic 5' UTR as taught herein or mutant thereof, wherein the last nucleotide of the alphavirus genomic 5' UTR or mutant thereof is position -1, and wherein the length of the combined polynucleotide inserts is at least 5 nucleotides.
[0184] The term "polynucleotide insert" or "polynucleotide" may be used interchangeably herein and refers to a linear polymer whose molecule is composed of covalently bonded nucleotide monomers, constituting a section of a nucleic acid molecule.
[0185] In embodiments of the products, uses, or methods as taught herein, the genomic 5' UTR or mutant thereof comprises one or more polynucleotide inserts. In embodiments, the genomic 5' UTR or mutant thereof may comprise one to ten, more specific one to five polynucleotide inserts, such as one, two, three, four or five polynucleotide inserts. Preferably, the genomic 5' UTR or mutant thereof comprises one polynucleotide insert. In embodiments, the genomic 5' UTR is an alphavirus genomic 5' UTR as taught herein or mutant thereof. In embodiments, the alphavirus genomic 5' UTR or mutant thereof may comprise one to ten, more specific one to five polynucleotide inserts, such as one, two, three, four or five polynucleotide inserts. In particular, the alphavirus genomic 5' UTR or mutant thereof comprises one polynucleotide insert.
[0186] Hence, in an aspect, the invention provides a saRNA or taRNA comprising: a genomic 5' UTR or mutant thereof, a nucleic acid sequence or mutant thereof encoding nonstructural proteins nsPl-4, a sub- genomic promoter or mutant thereof, and a heterologous open reading frame sequence encoding a protein of interest or a non-coding RNA of interest, wherein the genomic 5' UTR or mutant thereof is operably connected to the nucleic acid sequence or mutant thereof encoding nonstructural proteins nsPl- 4, and wherein the sub-genomic promoter or mutant thereof is operably connected to the heterologous open reading frame sequence; wherein the genomic 5' UTR or mutant thereof comprises one polynucleotide insert downstream of a nucleotide at position -16 of the genomic 5' UTR or mutant thereof, wherein the last nucleotide of the genomic 5' UTR or mutant thereof is position -1, and wherein the combined length of the one or more polynucleotide inserts is at least s nucleotides. "A polynucleotide insert" refers to a stretch of consecutive nucleotides. The "length" of the insert is the number of consecutive nucleotides which constitute or make up the insert, from the 5' end nucleotide to the 3' end nucleotide. In case of a single polynucleotide insert, the phrases "combined length" or "combined sequence" of the insert are synonymous with the phrases "length" or "sequence" and denote the number of nucleotides constituting the insert. In case of two or more polynucleotide inserts, the phrases "combined length" or "combined sequence" of the inserts mean the sum of the lengths of the individual inserts, i.e., the sum of the numbers of nucleotides constituting each insert. By means of an illustration and without limitation, when three inserts were present (denoted Insert 1, Insert 2, and Insert 3), and when Insert 1 was 4-nt long, Insert 2 was 26-nt long, and Insert 3 was 15 nt-long, then the combined length or sequence of these inserts would be 45 nt.
[0187] In embodiments, the genomic 5' UTR or mutant thereof, in particular the alphavirus genomic 5' UTR or mutant thereof, comprises one or more polynucleotide inserts, wherein the combined length of the one or more polynucleotide inserts is at least 5 nucleotides. In embodiments, the one or more polynucleotide inserts have a combined length of at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, at least 22 nucleotides, at least 23 nucleotides, or at least 24 nucleotides.
[0188] In embodiments, the one or more polynucleotide inserts have a combined sequence or length of at least 5 nucleotides. In embodiments, the one or more polynucleotide inserts have a combined sequence or length of at least 24 nucleotides. In embodiments, the one or more polynucleotide inserts have a combined sequence or length of at least 37 nucleotides. In embodiments, the one or more polynucleotide inserts may have a combined sequence or length of at least 38 nucleotides. In embodiments, the one or more polynucleotide inserts are heterologous nucleotides. Hence, the sequence of an insert can be as a whole different from the nucleic acid sequence originally present in the conventional saRNA or in a virus which it has been derived from. This of course does not preclude that an insert may contain shorter sequence stretches which are identical to stretches of the nucleic acid sequence originally present in the conventional saRNA or in a virus which it has been derived from.
[0189] In embodiments, the one or more polynucleotide inserts may have a combined sequence or length of at least 38 nucleotides, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50, at least 51, at least 52, at least 53, at least 54, at least 55, at least 56, at least 57, at least 58, at least 59, or at least 60, at least 61, at least 62, at least 63, at least 64, at least 65, or at least 66 nucleotides. As shown in the example section, such length of the polynucleotide insert(s) advantageously allows to decrease the cellular toxicity, prolong the protein production and / or maintain or increase the accumulated protein production of the saRNA or taRNA as taught herein. In embodiments, the one or more polynucleotide inserts have a combined sequence or length of at most 135 nucleotides. In embodiments, the one or more polynucleotide inserts may have a combined sequence or length of at most 133 nucleotides. In embodiments, the one or more polynucleotide inserts may have a combined sequence or length of at most 126 nucleotides, such as at most 123, at most 120, at most 117, at most 114, at most 111, at most 108, at most 105, at most 102, at most 99, or at most 96 nucleotides. As shown in the example section, such length of the polynucleotide insert(s) advantageously allows to decrease the cellular toxicity, prolong the protein production and / or maintain or increase the accumulated protein production of the saRNA or taRNA as taught herein.
[0190] In embodiments, the one or more polynucleotide inserts have a combined sequence or length of 5 to 210 nucleotides. In embodiments, the one or more polynucleotide inserts have a combined sequence or length of 24 to 210 nucleotides or 45 to 150 nucleotides. In embodiments, the one or more polynucleotide inserts have a combined sequence or length of 37 to 135 nucleotides. In embodiments, the one or more polynucleotide inserts may have a combined sequence or length of 6 to 133 nucleotides, such as 8 to 126 nucleotides, 10 to 124 nucleotides, 24 to 120 nucleotides, 39 to 126, 40 to 123, 42 to 120, 45 to 117, 48 to 114, 51 to 111, 54 to 108, 57 to 105, 60 to 102, or 63 to 99 nucleotides. In embodiments, the one or more polynucleotide inserts may have a combined sequence or length of 66 to 126 nucleotides. In embodiments, the one or more polynucleotide inserts may have a combined sequence or length of 66 to 96 nucleotides.
[0191] In embodiments, the genomic 5' UTR or mutant thereof, in particular the alphavirus genomic 5' UTR or mutant thereof, may comprise one polynucleotide insert. In embodiments, the genomic 5' UTR or mutant thereof, in particular the alphavirus genomic 5' UTR or mutant thereof, may comprise one polynucleotide insert having a length of at least 5 nucleotides. In embodiments, the genomic 5' UTR or mutant thereof, in particular the alphavirus genomic 5' UTR or mutant thereof, may comprise one polynucleotide insert having a length of at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, at least 22 nucleotides, at least 23 nucleotides, or at least 24 nucleotides. In embodiments, the genomic 5' UTR or mutant thereof, in particular the alphavirus genomic 5' UTR or mutant thereof, comprises one polynucleotide insert having a length of at least 24 nucleotides. As shown in the example section, such length of the polynucleotide insert(s) advantageously allows to decrease the cellular toxicity, prolong the protein production and / or maintain or increase the accumulated protein production of the saRNA or taRNA as taught herein.
[0192] In embodiments of the products, uses, or methods as taught herein, the genomic 5' UTR as disclosed may comprise one polynucleotide insert having a sequence or length of at least 37 nucleotides. In embodiments, the genomic 5' UTR may comprise one polynucleotide insert having a sequence or length of at least 38 nucleotides. In embodiments, the genomic 5' UTR may comprise one polynucleotide insert having a sequence or length of at least 37 nucleotides, such as at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50, at least 51, at least 52, at least 53, at least 54, at least 55, at least 56, at least 57, at least 58, at least 59, or at least 60, at least 61, at least 62, at least 63, at least 64, at least 65, or at least 66 nucleotides. As shown in the example section, such length of the polynucleotide insert(s) advantageously allows to decrease the cellular toxicity, prolong the protein production and / or maintain or increase the accumulated protein production of the saRNA or taRNA as taught herein.
[0193] In embodiments, the genomic 5' UTR may comprise one polynucleotide insert having a sequence or length of at most 135 nucleotides. In embodiments, the genomic 5' UTR may comprise one polynucleotide insert having a sequence or length of at most 133 nucleotides. In embodiments, the genomic 5' UTR may comprise one polynucleotide insert having a sequence or length of at most 126 nucleotides, such as at most 123, at most 120, at most 117, at most 114, at most 111, at most 108, at most 105, at most 102, at most 99, or at most 96 nucleotides.
[0194] In embodiments, the genomic 5' UTR or mutant thereof may comprise one polynucleotide insert having a sequence or length of 5 to 210 nucleotides. In embodiments, the genomic 5' UTR or mutant thereof may comprise one polynucleotide insert having a sequence or length of 24 to 210 nucleotides or 45 to 150 nucleotides. In embodiments, the genomic 5' UTR may comprise one polynucleotide insert having a sequence or length of 37 to 135 nucleotides. In embodiments, the genomic 5' UTR may comprise one polynucleotide insert having a sequence or length of 6 to 133 nucleotides, such as 8 to 126 nucleotides,
[0195] 10 to 124 nucleotides, 24 to 120 nucleotides, 39 to 126, 40 to 123, 42 to 120, 45 to 117, 48 to 114, 51 to
[0196] 111, 54 to 108, 57 to 105, 60 to 102, or 63 to 99 nucleotides. In embodiments of the products, uses, or methods as taught herein, the genomic 5' UTR or mutant thereof may comprise one polynucleotide insert having a sequence or length of 66 to 126 nucleotides. In embodiments, the genomic 5' UTR or mutant thereof may comprise one polynucleotide insert having a sequence or length of 66 to 96 nucleotides.
[0197] In embodiments, the genomic 5' UTR or mutant thereof, in particular the alphavirus genomic 5' UTR or mutant thereof, comprises two or more, such as two, three or four polynucleotide inserts. In embodiments, the genomic 5' UTR or mutant thereof, in particular the alphavirus genomic 5' UTR or mutant thereof, comprises two or more, such as two, three or four polynucleotide inserts, wherein the combined length of the polynucleotide inserts is at least 5 nucleotides. In embodiments, the genomic 5'
[0198] UTR or mutant thereof, in particular the alphavirus genomic 5' UTR or mutant thereof, comprises two or more, such as two, three or four polynucleotide inserts, wherein the combined length of the polynucleotide inserts is at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, at least 22 nucleotides, at least 23 nucleotides, or at least 24 nucleotides. In embodiments, the genomic 5' UTR or mutant thereof, in particular the alphavirus genomic 5' UTR or mutant thereof, comprises two or more, such as two, three or four polynucleotide inserts, wherein the combined length of the polynucleotide inserts is at least 24 nucleotides. As shown in the example section, such saRNAs or taRNAs advantageously allow to decrease the cellular toxicity, prolong the protein production and / or maintain or increase the accumulated protein production of the saRNA or taRNA as taught herein.
[0199] In embodiments of the products, uses, or methods as taught herein, the genomic 5' UTR or mutant thereof may comprise two, three, four, five or more polynucleotide inserts, wherein the combined length of the two, three, four, five or more polynucleotide inserts is at least 37 nucleotides. In embodiments, the genomic 5' UTR or mutant thereof may comprise two, three or four polynucleotide inserts, wherein the combined length of the two, three, or four polynucleotide inserts is at least 38 nucleotides. In embodiments, the genomic 5' UTR or mutant thereof may comprise two, three or four polynucleotide inserts, wherein the combined length of the two, three, or four polynucleotide inserts is at least 39 nucleotides, such as at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50, at least 51, at least 52, at least 53, at least 54, at least 55, at least 56, at least 57, at least 58, at least 59, or at least 60, at least 61, at least 62, at least 63, at least 64, at least 65, or at least 66 nucleotides. In embodiments, the genomic 5' UTR or mutant thereof may comprise two, three or four polynucleotide inserts, wherein the combined length of the two, three, or four polynucleotide inserts is at most 135 nucleotides. In embodiments, the genomic 5' UTR or mutant thereof may comprise two, three or four polynucleotide inserts, wherein the combined length of the two, three, or four polynucleotide inserts is at most 133 nucleotides. In embodiments, the genomic 5' UTR or mutant thereof may comprise two, three or four polynucleotide inserts, wherein the combined length of the two, three, or four polynucleotide inserts is at most 126 nucleotides, such as at most 123, at most 120, at most 117, at most 114, at most 111, at most 108, at most 105, at most 102, at most 99, or at most 96 nucleotides.
[0200] In embodiments, the genomic 5' UTR or mutant thereof may comprise two, three or four polynucleotide inserts, wherein the combined length of the two, three, or four polynucleotide inserts is 5 to 210 nucleotides. In embodiments, the genomic 5' UTR or mutant thereof may comprise two, three or four polynucleotide inserts, wherein the combined length of the two, three, or four polynucleotide inserts is 24 to 210 nucleotides or 45 to 150 nucleotides. In embodiments, the genomic 5' UTR or mutant thereof may comprise two, three or four polynucleotide inserts, wherein the combined length of the two, three, or four polynucleotide inserts is 37 to 135 nucleotides. In embodiments, the genomic 5' UTR or mutant thereof may comprise two, three or four polynucleotide inserts, wherein the combined length of the two, three, or four polynucleotide inserts is 6 to 133 nucleotides, such as 8 to 126 nucleotides, 10 to 124 nucleotides, 24 to 120 nucleotides, 39 to 126, 40 to 123, 42 to 120, 45 to 117, 48 to 114, 51 to 111, 54 to 108, 57 to 105, 60 to 102, or 63 to 99 nucleotides. In embodiments of the products, uses, or methods as taught herein, the genomic 5' UTR or mutant thereof may comprise two, three or four polynucleotide inserts, wherein the combined length of the two, three, or four polynucleotide inserts is 66 to 126 nucleotides. In embodiments, the genomic 5' UTR or mutant thereof may comprise two, three or four polynucleotide inserts, wherein the combined length of the two, three, or four polynucleotide inserts is 66 to 96 nucleotides.
[0201] In the context of the invention, the (alphavirus) genomic 5' UTR or mutant thereof comprises one or more polynucleotide inserts downstream (i.e., 3') of a nucleotide at position -16, wherein the last nucleotide of the genomic 5' UTR is position -1, and wherein the length of the combined polynucleotide inserts is at least 5 nucleotides.
[0202] When referring to the position or location of the polynucleotide insert(s) herein, the last nucleotide of the genomic 5' UTR is position -1 and the upstream nucleotides are defined as nucleotides at positions "-n", wherein n is an integer ranging from 2 to m with m being the total number of nucleotides of the genomic 5' UTR. "Downstream of a nucleotide at position -16" thus means that the insert, or in case of multiple inserts the upstream most insert (i.e. the 5' most insert) is inserted either between the nucleotide at position -16 and the nucleotide at position -15 of the genomic 5' UTR or downstream of this, such as between the two nucleotides at any of the following positions of the genomic 5' UTR: -15 and -14, -14 and -13, -13 and -12, -12 and -11, -11 and -10, -10 and -9, -9 and -8, -8 and -7, -7 and -6, -6 and -5, -5 and -4, - 4 and -3, -3 and -2, -2 and -1, or -1 and +1 (i.e., in between the last nucleotide of the genomic 5' UTR and the first nucleotide of the genomic ORF).
[0203] Conveniently, certain nucleotide(s) of a nucleic acid or nucleic acid element may be referred to herein as "corresponding to" certain nucleotide(s) of a reference nucleic acid or nucleic acid element, usually of an alphavirus nucleic acid or mutant thereof such as an alphavirus genomic 5' UTR or mutant thereof.
[0204] In embodiments, the alphavirus genomic 5' UTR or mutant thereof comprises one or more polynucleotide inserts, preferably one polynucleotide insert, located (in case of multiple inserts, each independently located) (i) immediately after the last nucleotide of the genomic 5' UTR (i.e., at the 3' end of the genomic 5' UTR), and / or (ii) immediately before (i.e., immediately upstream of or 5' of) any one of the last 15 nucleotides of the genomic 5' UTR. In embodiments, the alphavirus genomic 5' UTR or mutant thereof comprises one or more polynucleotide inserts, preferably one polynucleotide insert, located (in case of multiple inserts, each independently located) (i) immediately after the last nucleotide of the genomic 5' UTR (i.e., at the 3' end of the genomic 5' UTR), and / or (ii) immediately before any one of the last 14 nucleotides, the last 13 nucleotides, the last 12 nucleotides, the last 11 nucleotides, the last 10 nucleotides, the last 9 nucleotides, the last 8 nucleotides, the last 7 nucleotides, the last 6 nucleotides, the last 5 nucleotides, the last 4 nucleotides, the last 3 nucleotides, the last 2 nucleotides, or the last nucleotide, of the genomic 5' UTR. As shown in the examples, such position of the polynucleotide insert(s) advantageously allows to decrease the cellular toxicity, prolong protein production and / or maintain or increase the accumulated protein production of the saRNA or taRNA as taught herein.
[0205] In embodiments, the alphavirus genomic 5' UTR or mutant thereof comprises one or more polynucleotide inserts, preferably one polynucleotide insert, located immediately upstream (i.e., immediately 5') of the last 15 nucleotides of the genomic 5' UTR (i.e., immediately upstream of the nucleotide at position -15). In embodiments, the alphavirus genomic 5' UTR or mutant thereof comprises one or more polynucleotide inserts, preferably one polynucleotide insert, located immediately upstream (i.e., immediately 5') of the last 13 nucleotides, the last 12 nucleotides, the last 11 nucleotides, the last 10 nucleotides, the last 9 nucleotides, the last 8 nucleotides, the last 7 nucleotides, the last 6 nucleotides, the last 5 nucleotides, the last 4 nucleotides, the last 3 nucleotides, the last 2 nucleotides, or the last nucleotide, of the genomic 5' UTR. Preferably, the alphavirus genomic 5' UTR or mutant thereof comprises one or more polynucleotide inserts, preferably one polynucleotide insert, located immediately upstream (i.e., immediately 5') of the last 4 nucleotides of the genomic 5' UTR (i.e., immediately upstream of the nucleotide at position -4). In embodiments of the products, uses, or methods as taught herein, each polynucleotide insert of the two or more, such as two, three, four, five or more, polynucleotide inserts has, each independently, a sequence of at least 4 contiguous nucleotides. In embodiments, each polynucleotide insert of the two, three, four, five or more polynucleotide inserts has, each independently, a sequence of at least 5 contiguous nucleotides. In embodiments, each polynucleotide insert of the two, three, four, five or more polynucleotide inserts has, each independently, a sequence of at least 6, at least 7, at least 8, at least 9, at least 10, or at least 12 contiguous nucleotides.
[0206] The present inventors have found that the sequence of the polynucleotide insert, i.e., the type and order of nucleotides constituting the insert, is non-limiting. In other words, insert or inserts of various sequences can achieve the advantages of the invention.
[0207] In embodiments of the products, uses, or methods as taught herein, the total sequence of the one or more polynucleotide inserts, preferably of the one polynucleotide insert, has a Gibbs free energy of the minimum free energy RNA secondary structure of -55.0 to +0.5 kcal / mol, such as -53.0 to + 0.3 kcal / mol as predicted by Mfold V3.6 (accessed on the web server on 2023-Oct-ll). In embodiments of the products, uses, or methods as taught herein, the total sequence of the one or more polynucleotide inserts, preferably of the one polynucleotide insert, has a Gibbs free energy of the minimum free energy RNA secondary structure of at most +0.5 kcal / mol, at most -0.8 kcal / mol, or at most -4.0 kcal / mol, as predicted by Mfold V3.6 (accessed on the web server on 2023-Oct-ll).ln embodiments of the products, uses, or methods as taught herein, the total sequence of the one or more polynucleotide inserts, preferably the one polynucleotide insert, has a melting temperature of at least 50.0°C, such as at least 55.0°C, at least 56.0°C, at least 57.0°C, at least 58.0°C, at least 59.0°C, at least 60.0°C, at least 65.0°C, at least 70.0°C, at least 75.0°C, or at least 80°C, as predicted by UNIPRO Ugene V38.0 (on 2023-Oct-ll).
[0208] In embodiments of the products, uses, or methods as taught herein, the total sequence of the one or more polynucleotide inserts, preferably of the one polynucleotide insert, has a Gibbs free energy of the minimum free energy RNA secondary structure of at most -20.00 kcal / mol, such as at most -22.00 kcal / mol, at most -24.00 kcal / mol, at most -26.00 kcal / mol, at most -28.00 kcal / mol, at most -30.00 kcal / mol, at most -35.00 kcal / mol, at most -40.00 kcal / mol, or at most -45.00 kcal / mol as predicted by Mfold V3.6 (accessed on the web server on 2023-Oct-ll); and / or wherein the total sequence of the one or more polynucleotide inserts, preferably the one polynucleotide insert, has a melting temperature of at least 80°C, such as at least 81°C, at least 82°C, at least 83°C, at least 84°C, at least 85°C, at least 86°C, at least 87°C, or at least 88°C, as predicted by UNIPRO Ugene V38.0 (on 2023-Oct-ll).
[0209] The "minimum free energy" as predicted by Mfold V3.6, uses an algorithm predicting a minimum free energy (AG) of nucleic acid structures by assessing thermodynamic stability. The algorithm's core predicts AG and identifies other energetically favorable foldings within a specified deviation, expressed as a "percent suboptimality" (P). Users select "P", from which Mfold computes a free energy increment (55G), guiding subsequent predictions. The algorithm generates an "energy dot plot," a triangular matrix illustrating potential base pairings within 55G from the minimum energy. Users can automatically or manually select specific base pairs of interest. Mfold then computes the minimum free energy structure, incorporating the chosen base pairs, (doi: 10.1093 / nar / gkg595)
[0210] The melting temperature of the total sequence of the one or more polynucleotide inserts was predicted using UNIPRO Ugene V38.0, which uses the Primer3 algorithm. This algorithm is based on the nearest- neighbour thermodynamic model which considers the contribution of each base pair and its immediate neighbours and takes into account the enthalpy (AH) and entropy (AS) changes associated with each base pair and neighbouring pairs, (doi: 10.1093 / nar / gks596)
[0211] In embodiments, the one or more polynucleotide inserts, preferably one polynucleotide insert, may contain sequence fragments of the genomic 5' UTR.
[0212] In embodiments of the products, uses, or methods as taught herein, the saRNA or taRNA as taught herein may comprise a polynucleotide insert, for example may comprise a single polynucleotide insert, having a sequence as set forth in SEQ ID NO: 1-4.
[0213] The nucleic acid sequence of an exemplary polynucleotide insert (reference "SEQ 01") is reproduced below:
[0214] GGGCGTGATCCGAAAGGTGACCCGGATCTGGGGCGTGATCCGAAAGGTGACCCGGATCCACCGGTC (SEQ ID NO: 1)
[0215] The nucleic acid sequence of an exemplary polynucleotide insert (reference "SEQ 02") is reproduced below:
[0216] GGGCGTGATCCGAAAGGTGACCCGGATCACGGGCGTGATCCGAAAGGTGACCCTCGGATCGGGCGTGATCCGAA AGGTGACCCGGATCCACCGGTC (SEQ ID NO: 2)
[0217] The nucleic acid sequence of an exemplary polynucleotide insert (reference "SEQ 03") is reproduced below:
[0218] AGGCGGGCGGATAAGGGGAGTTCCGGAGTCCCAGGCCCGGCGGGGAGAACTTGATCTCCACTACTC (SEQ ID NO: 3)
[0219] The nucleic acid sequence of the polynucleotide insert SEQ 04 is reproduced below:
[0220] CGGGCAGGTCAGATTCGCCGGAGCAACCATCCACGCGGTTGCGGGTCCTGCGCTGACCAACGGGTG (SEQ ID NO: 4) In embodiments of the products, uses, or methods as taught herein, the saRNA or taRNA as taught herein may be capable of being expressed in a prokaryotic (such as bacterial, e.g., recombinant protein production in bacteria) or eukaryotic subject or cell.
[0221] In embodiments of the products, uses, or methods as taught herein, the saRNA or taRNA as taught herein may be capable of being expressed in a mammalian subject or cell. In embodiments of the products, uses, or methods as taught herein, the saRNA or taRNA as taught herein may be capable of being expressed in an animal or a human subject or cell.
[0222] The term "subject" as used herein refers to eukaryotes, in particular animals, plants, and fungi, preferably animals, more preferably vertebrates including mammals, fish, birds, reptiles, and amphibians, even more preferably mammals, still more preferably primates, and specifically includes human patients and nonhuman mammals and primates. Preferred patients are human subjects.
[0223] The term "eukaryote" refers to organisms whose cells have a membrane-bound nucleus. All animals, plants, fungi, and many unicellular organisms are eukaryotes. Eukaryotes, constituting the domain of Eukarya, exist alongside the two groups of prokaryotes: the Bacteria and the Archaea.
[0224] The term "animal" includes Annelida (segmented worms), Nematoda (rounds worms), Arthropoda (including spiders, scorpions, insects such as mosquitos), Plathelminths (flat worms), Chordata (vertebrates), Porifera (sponges), Echinodermata (starfish, sea urchins), Cnidaria (coral, jellyfish), and Mollusca (snails, clams, octopi).
[0225] The term "mammal" includes any animal classified as such, including, but not limited to, humans, domestic and farm animals, aquatic animals, zoo animals, sport animals, pet animals, companion animals and experimental animals, such as, for example, mice, rats, hamsters, rabbits, dogs, cats, guinea pigs, gerbils, cattle, cows, sheep, horses, pigs and primates, e.g., monkeys and apes (e.g., chimpanzee, baboon, or monkey). Particularly preferred are human subjects, including both genders and all age categories thereof.
[0226] In embodiments, the total sequence of the one or more polynucleotide inserts (i.e., the sequence of a single insert, or in case of multiple inserts an overall sequence constituted by the sequences of all individual inserts) comprises a GC-content between about 20% and 80%, between about 40% and 75%, between about 45% and 75%, between about 50% and 75%, between about 55% and 70%, or between about 60% and 70%.
[0227] Further aspects relate to: a vector comprising the saRNA or taRNA as taught herein or a nucleic acid sequence encoding for the saRNA or taRNA as taught herein, a cell comprising the saRNA or taRNA as taught herein, or a cell comprising the vector as taught herein.
[0228] A nucleic acid corresponding to the saRNA or taRNA as taught herein may be considered an expression cassette.
[0229] The term "expression cassette" as used herein comprises any nucleic acid construct capable of directing the transcription of an RNA or the expression of a gene / coding sequence / non-coding RNA of interest which is operably linked to a (gene) promoter. Expression cassettes are generally DNA constructs preferably including (5' to 3' in the direction of transcription): a (gene) promoter region, a polynucleotide sequence of interest with a transcription initiation region, and a termination sequence including a stop signal for RNA polymerase and a polyadenylation signal; all these elements being operably or operatively linked meaning that all of these regions should be capable of operating (being expressed) in a cell, such as prokaryotic (e.g. bacterial) or eukaryotic (e.g. mammalian, yeast, insect, fungal, plant, algal) cells, when transformed or transfected into that cell. The promoter region comprising the transcription initiation region, which preferably includes the RNA polymerase binding site, and the polyadenylation signal may be native to the cell to be transformed or transfected, may be derived from an alternative source, or may be synthetic, as long as it is functional in the cell. Such expression cassettes can be constructed in e.g., a "vector" or "expression vector" (linear or circular nucleic acids, plasmids, cosmids, viral vectors (defective or infectious), phagemids, phages, etc.).
[0230] The present invention also provides a vector including the nucleic acid sequence corresponding to the above-mentioned saRNA or taRNA inserted therein.
[0231] The term "vector", "vector construct", "expression vector", "recombinant vector" or "gene transfer vector", as used herein, is intended to refer to a nucleic acid molecule capable of carrying another nucleic acid molecule to which it has been linked.
[0232] Said vectors may include a cloning or expression vector, as well as a delivery vehicle such as a viral, lentiviral, or adenoviral vector. Expression vectors may comprise plasmids as well as viral vectors and generally contain a desired coding sequence and appropriate DNA sequences necessary for the expression of the operably linked coding sequence in a particular host organism (e.g., bacteria, yeast, plant, insect, or mammal) or in in vitro expression systems. In particular, an expression vector as described herein may comprise a nucleic acid molecule as described herein operably linked to at least one regulatory sequence. Regulatory sequences can be selected to direct the expression of the saRNA or taRNA in a suitable host cell, and include promoters, enhancers, and other expression control elements as known to the skilled person. Hence, in embodiments, the vector includes a promoter for driving expression of the nucleic acid of interest, optionally a nucleic acid sequence encoding a signal that secretes the saRNA or taRNA, and optionally a nucleic acid sequence encoding a terminator. When the expression vector is manipulated in a production strain or cell line, the vector may or may not be integrated into the genome of the host cell when introduced into the host cell. Cloning vectors are generally used to engineer and amplify a certain desired DNA fragment. Thus, cloning vectors may contain origin of replication that matches the cell type specified by the cloning vector and may lack functional sequences needed for expression of the desired DNA fragments. Preferably, the vector contains one or more selection markers. The choice of the selection markers may depend on the host cells of choice, although this is not critical to the present invention as is well known to persons skilled in the art. The construction of expression vectors for use in transfecting cells is also well known in the art, and thus can be accomplished via standard techniques (see, for example, Sambrook, Fritsch, and Maniatis, in: Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1989; Gene Transfer and Expression Protocols, pp. 109-128, ed. E. J. Murray, The Humana Press Inc., Clif ton, N.J.), and the Ambion 1998 Catalog (Ambion, Austin, Tex.).
[0233] More particular, said vector may include any vector known to the skilled person, including any suitable type, but not limited to, for instance, plasmid vectors, cosmid vectors, phage vectors, such as lambda phage, viral vectors, even more particular a lentiviral, adenoviral, AAV or baculoviral vectors, or artificial chromosome vectors such as bacterial artificial chromosomes (BAC), yeast artificial chromosomes (YAC), or Pl artificial chromosomes (PAC). The choice of the vector may be dependent amongst others on the nature of the host cell of choice.
[0234] One further aspect of the invention provides for a host cell comprising the saRNA or taRNA as described herein. The host cell may therefore comprise the nucleic acid molecule encoding said saRNA or taRNA as taught herein or the vector as taught herein. Host cells can be either prokaryotic or eukaryotic. The host cell may also be a recombinant host cell, which involves a cell which has been genetically modified to contain an isolated nucleic acid molecule encoding the saRNA or taRNA of the invention. Representative host cells that may be used to produce said saRNA or taRNA, include, but are not limited to, bacterial cells, yeast cells, plant cells, human cells, and animal cells. Bacterial host cells suitable for production of the saRNA or taRNA of the invention include Escherichia spp. cells, Bacillus spp. cells, Streptomyces spp. cells, Erwinia spp. cells, Klebsiella spp. cells, Serratia spp. cells, Pseudomonas spp. cells, and Salmonella spp. cells. Yeast host cells suitable for use with the invention include species within Saccharomyces, Schizosaccharomyces, Kluyveromyces, Pichia (e.g., Pichia pastoris), Hansenula (e.g., Hansenula polymorpha), Yarowia, Schwaniomyces, Zygosaccharomyces and the like. Saccharomyces cerevisiae, S. carlsbergensis and K. lactis are the most commonly used yeast hosts and are convenient fungal hosts. Animal host cells suitable for use with the invention include insect cells and mammalian cells (e.g., derived from Chinese hamster (e.g., CHO), and human cell lines, such as HeLa or cells isolated from an animal or human). Exemplary insect cell lines include, but are not limited to, Sf9 cells, mosquito cell lines e.g., C6 / 36 and C710, and baculovirus-insect cell systems (e.g., review Jarvis, Virology Volume 310, Issue 1, 25 May
[0235] 2003, Pages 1-7). Alternatively, the host cells may also be transgenic animals or plants.
[0236] Introduction of a vector in a host cell can be effected by, e.g., calcium phosphate transfection, virus infection, DEAE-dextran-mediated transfection, lipofectamine transfection, peptides / proteins, polymers, lipids, physical methods, like e.g., electroporation, and any person skilled in the art can select and use an introduction method suitable for the expression vector and host cell used.
[0237] In embodiments, the saRNA or taRNA as taught herein may be delivered naked to the subject or cell.
[0238] The term "naked" as used herein refers to nucleic acids that are substantially free of other (macro)molecules, such as lipids, polymers, and proteins. In embodiments, a naked nucleic acid such as a saRNA or taRNA may be not formulated with other macromolecules to improve cellular uptake. Accordingly, the naked saRNA or taRNA as taught herein may be not encapsulated in, absorbed on, or bound to a liposome, lipid carrier, polymer, an extracellular vesicle (e.g., an exosome), a microparticle or nanoparticle, a cationic emulsion, and the like.
[0239] In embodiments, the saRNA or taRNA as taught herein, such as the naked saRNA or taRNA as taught herein, may be delivered by a physical delivery system known in the art for the delivery of nucleic acids. Such physical delivery systems include electroporation, ultrasound, photoporation, gene gun, microneedles, and pressure-based systems.
[0240] In embodiments, the saRNA or taRNA as taught herein may be formulated with other (macro)molecules to improve cellular uptake. Hence, the saRNA or taRNA as taught herein may be encapsulated in, absorbed on, or bound to a liposome, lipid carrier, polymer, an extracellular vesicle (e.g., an exosome), a microparticle or nanoparticle, a cationic emulsion, and the like.
[0241] Recently, saRNA vaccination is recognized as innovative nanotechnology-based vaccination strategy. As mentioned previously, the saRNA or taRNA as taught herein can be produced by in vitro transcription. Thus, the whole manufacturing process is entirely cell-free, resulting in a therapeutic whose composition is precisely defined.
[0242] The saRNA or taRNA as taught herein can thus advantageously be formulated in a pharmaceutical composition. Alternatively, the saRNA or the taRNA can also be produced in a cell to generate e.g., viruslike particles containing the saRNA or taRNA.
[0243] A further aspect provides a pharmaceutical composition comprising the saRNA or taRNA, the nucleic acid, the vector, and / or the cell, as taught herein and further comprising a pharmaceutically acceptable carrier. The terms "pharmaceutical composition", "pharmaceutical formulation" or "pharmaceutical preparation" may be used interchangeably herein and refer to a mixture comprising an active ingredient. The terms "composition" or "formulation" may likewise be used interchangeably herein.
[0244] The terms "active ingredient" or "active component" can be used interchangeably and broadly refer to a compound or substance which, when provided in an effective amount, achieves a desired outcome. The desired outcome may be therapeutic and / or prophylactic. Typically, an active ingredient may achieve such outcome(s) through interacting with and / or modulating living cells or organisms.
[0245] The term "active" in the recitations "active ingredient" or "active component" refers to "pharmacologically active" and / or "physically active".
[0246] The present pharmaceutical formulations may comprise in addition to the saRNA, taRNA, the nucleic acid, the vector, and / or the cell as taught herein and further comprising one or more pharmaceutically acceptable excipients.
[0247] The term "pharmaceutically acceptable" as used herein is consistent with the art and means compatible with the other ingredients of a pharmaceutical composition and not deleterious to the recipient thereof. As used herein, "carrier" or "excipient" includes any and all solvents, diluents, buffers (such as, e.g., neutral buffered saline or phosphate buffered saline), solubilisers, colloids, polymer, dispersion media, vehicles, fillers, chelating agents (such as, e.g., EDTA or glutathione), amino acids (such as, e.g., glycine), proteins, disintegrants, binders, lubricants, wetting agents, emulsifiers, sweeteners, colorants, flavourings, aromatisers, thickeners, agents for achieving a depot effect, coatings, antifungal agents, preservatives, antioxidants, tonicity controlling agents, absorption delaying agents, and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active substance, its use in the therapeutic compositions may be contemplated.
[0248] Pharmaceutical compositions as intended herein may be formulated for essentially any route of administration, such as without limitation, oral administration (such as, e.g., oral ingestion), parenteral administration (such as, e.g., subcutaneous, intravenous, or intramuscular injection or infusion), or topical administration, and the like.
[0249] For example, for oral administration, pharmaceutical compositions may be formulated in the form of pills, tablets, lacquered tablets, coated (e.g., sugar-coated) tablets, granules, hard and soft gelatin capsules, aqueous, alcoholic, or oily solutions, syrups, emulsions, or suspensions. In an example, without limitation, preparation of oral dosage forms may be suitably accomplished by uniformly and intimately blending together a suitable amount of the active compound in the form of a powder, optionally also including finely divided one or more solid carrier, and formulating the blend in a pill, tablet, or a capsule. Exemplary but non-limiting solid carriers include calcium phosphate, magnesium stearate, talc, sugars (such as, e.g., glucose, mannose, lactose, or sucrose), sugar alcohols (such as, e.g., mannitol), dextrin, starch, gelatin, cellulose, polyvinylpyrrolidine, polyvinyl alcohol, low melting waxes and ion exchange resins. Compressed tablets containing the pharmaceutical composition can be prepared by uniformly and intimately mixing the active ingredient with a solid carrier such as described above to provide a mixture having the necessary compression properties, and then compacting the mixture in a suitable machine to the shape and size desired. Moulded tablets may be made by moulding in a suitable machine, a mixture of powdered compound moistened with an inert liquid diluent. Suitable carriers for soft gelatin capsules and suppositories are, for example, fats, waxes, semisolid and liquid polyols, natural or hardened oils, etc.
[0250] Preferably the pharmaceutical formulation may be formulated for parenteral administration such as administration by injection. In embodiments, the pharmaceutical composition may be formulated as an aqueous solution. For example, for parenteral administration, pharmaceutical compositions may be advantageously formulated as solutions, suspensions or emulsions with suitable solvents, diluents, solubilisers or emulsifiers, etc. Suitable solvents are, without limitation, water, physiological saline solution, or alcohols, e.g. ethanol, propanol, glycerol, in addition also sugar solutions such as glucose, invert sugar, sucrose or mannitol solutions, or alternatively mixtures of the various solvents mentioned. The injectable solutions or suspensions may be formulated according to known art, using suitable nontoxic, parenterally-acceptable diluents or solvents, such as mannitol, 1,3-butanediol, water, Ringer's solution or isotonic sodium chloride solution, or suitable dispersing or wetting and suspending agents, such as sterile, bland, fixed oils, including synthetic mono- or diglycerides, and fatty acids, including oleic acid. The pharmaceutical formulation or pharmaceutically acceptable salts thereof can also be lyophilized. The obtained lyophilizates can be used, for example, for injection or infusion preparation or for the production of injection or infusion preparations.
[0251] In embodiments, the pharmaceutical composition may further comprise a delivery system; preferably wherein the delivery system comprises one or more of a lipid nanoparticle, a polymeric nanoparticle, an organic nanoparticle, an inorganic nanoparticle (e.g., a gold nanoparticle, a magnetic nanoparticle, a quantum dot, a silica nanoparticle (e.g., DegradaBall of Lemonex)), a cationic lipid, a liposome, an extracellular vesicle (e.g. an exosome), a cationic nano-emulsion, a cochleate, a virosome, an immune- stimulating complex, a microparticle, a microsphere, a nanosphere, a unilamellar vesicle, a multilamellar vesicle, an oil-in-water emulsion, a water-in-oil emulsion, an emulsome, and a polycationic peptide.
[0252] A further aspect relates to a kit of parts comprising the saRNA or taRNA as taught herein or a nucleic acid corresponding to the saRNA or taRNA as taught herein. The terms "kit of parts" and "kit" as used throughout this specification refer to a product containing components necessary for carrying out the specified uses or methods, packed so as to allow their transport and storage. Materials suitable for packing the components comprised in a kit include crystal, plastic (e.g., polyethylene, polypropylene, polycarbonate), bottles, flasks, vials, ampules, paper, envelopes, or other types of containers, carriers or supports. Where a kit comprises a plurality of components, at least a subset of the components (e.g., two or more of the plurality of components) or all of the components may be physically separated, e.g., comprised in or on separate containers or supports. The components comprised in a kit may be sufficient or may not be sufficient for carrying out the specified uses or methods, such that external reagents or substances may not be necessary or may be necessary for performing the methods, respectively. Typically, kits are employed in conjunction with standard laboratory equipment, such as liquid handling equipment, environment (e.g., temperature) controlling equipment, analytical instruments, etc. In addition to the saRNA or taRNA as taught herein, the present kits may also include excipients such as solvents useful in the specified uses or methods. Typically, the kits may also include instructions for use thereof, such as on a printed insert or on a computer readable medium. The terms may be used interchangeably with the term "article of manufacture", which broadly encompasses any man-made tangible structural product, when used in the present context.
[0253] The saRNA or taRNA as used herein encoding a product of interest, such as a protein or non-coding RNA, can be delivered directly to a desired vertebrate subject or can be delivered ex vivo to cells obtained or derived from the subject, and the cells can be re implanted into the subject. Delivery of the saRNA or taRNA as used herein to a vertebrate subject is desirable for many purposes, such as, for gene therapy, to induce an immune response against an encoded polypeptide, or to regulate the expression of endogenous genes.
[0254] Hence, a further aspect provides the saRNA or taRNA as taught herein, the nucleic acid as taught herein, the vector as taught herein, the cell as taught herein, or the pharmaceutical composition as taught herein, for use as a medicament.
[0255] A further aspect provides the saRNA or taRNA as taught herein, the nucleic acid as taught herein, the vector as taught herein, the cell as taught herein, or the pharmaceutical composition as taught herein, for use in a method of producing a protein or non-coding RNA in a subject. In embodiments, the protein is a therapeutic protein. In embodiments, the non-coding RNA is a therapeutic non-coding RNA.
[0256] Related aspects provide: a method of producing a protein or non-coding RNA, such as a therapeutic protein or non-coding RNA, in a subject, the method comprising administering the saRNA or taRNA as taught herein, the vector as taught herein, or the pharmaceutical composition as taught herein to the subject. the use of the saRNA or taRNA as taught herein, the vector as taught herein, or the pharmaceutical composition as taught herein for the manufacture of a medicament for the production of a protein or non-coding RNA, such as a therapeutic protein or non-coding RNA, in a subject. the use of the saRNA or taRNA as taught herein, the vector as taught herein, or the pharmaceutical composition as taught herein for the production of a protein or non-coding RNA, such as a therapeutic protein or non-coding RNA, in a subject.
[0257] A further aspect relates to the saRNA or taRNA as taught herein, the vector as taught herein, or the pharmaceutical composition as taught herein, for use in a method of protein production, protein therapy, vaccination, stem cell reprogramming, induction of stem cells, induction of allergy tolerance, gene editing, gene modification, gene silencing, regulation of gene expression, immunotherapy, or cancer treatment in a subject.
[0258] Related aspects provide: a method of protein therapy (e.g. protein replacement therapy), vaccination, stem cell reprogramming, induction of stem cells, induction of allergy tolerance, gene editing, gene modification, gene silencing, regulation of gene expression, immunotherapy, or cancer treatment in a subject, the method comprising administering the saRNA or taRNA as taught herein, the nucleic acid as taught herein, the vector as taught herein, the cell as taught herein, or the pharmaceutical composition as taught herein to the subject. the use of the saRNA or taRNA as taught herein, the nucleic acid as taught herein, the vector as taught herein, the cell as taught herein, or the pharmaceutical composition as taught herein for the manufacture of a medicament for protein therapy (e.g. protein replacement therapy), vaccination, stem cell reprogramming, induction of stem cells, induction of allergy tolerance, gene editing, gene modification, gene silencing, regulation of gene expression, immunotherapy, or cancer treatment in a subject. the use of the saRNA or taRNA as taught herein, the nucleic acid as taught herein, the vector as taught herein, the cell as taught herein, or the pharmaceutical composition as taught herein for protein therapy (e.g. protein replacement therapy), vaccination, stem cell reprogramming, induction of stem cells, induction of allergy tolerance, gene editing, gene modification, gene silencing, regulation of gene expression, immunotherapy, or cancer treatment in a subject.
[0259] A further aspect provides the saRNA or taRNA as taught herein, the nucleic acid as taught herein, the vector as taught herein, the cell as taught herein, or the pharmaceutical composition as taught herein, for use in an in vivo diagnostic method in a subject.
[0260] Related aspects provide: an in vivo diagnostic method in a subject, the method comprising administering the saRNA or taRNA as taught herein, the nucleic acid as taught herein, the vector as taught herein, the cell as taught herein, or the pharmaceutical composition as taught herein to the subject. the use of the saRNA or taRNA as taught herein, the nucleic acid as taught herein, the vector as taught herein, the cell as taught herein, or the pharmaceutical composition as taught herein for the manufacture of a medicament for an in vivo diagnostic method in a subject. the use of the saRNA or taRNA as taught herein, the nucleic acid as taught herein, the vector as taught herein, the cell as taught herein, or the pharmaceutical composition as taught herein for an in vivo diagnostic method in a subject. In such methods the saRNA or taRNA as taught herein may serve as a sensor or reporter of an endogenous or exogenous diagnostic compound.
[0261] As used herein, a phrase such as "a subject in need of treatment" or "subject" includes subjects that would benefit from treatment of a given condition. Such subjects may include, without limitation, those that have been diagnosed with said condition, those prone to develop said condition and / or those in who said condition is to be prevented.
[0262] The terms "treat", or "treatment" encompass both the therapeutic treatment of an already developed disease or condition, as well as prophylactic or preventive measures, wherein the aim is to prevent or lessen the chances of incidence of an undesired affliction. Beneficial or desired clinical results may include, without limitation, alleviation of one or more symptoms or one or more biological markers, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration of the disease state, and the like. The term may encompass ex vivo or in vivo treatments.
[0263] The uses and methods as taught herein allow to administer a therapeutically effective amount of a saRNA or taRNA as taught herein in subjects which will benefit from such treatment. The term "therapeutically effective amount" as used herein, refers to an amount of active compound or pharmaceutical agent that elicits the biological or medicinal response in a subject that is being sought by a surgeon, researcher, veterinarian, medical doctor, or other clinician, which may include inter alia alleviation of the symptoms of the disease or condition being treated.
[0264] The term "therapeutically effective dose" refers to an amount of an agent as taught herein, such as the saRNA or taRNA as taught herein, that when administered brings about a positive therapeutic response with respect to treatment of a patient having the disease or condition being treated.
[0265] Appropriate therapeutically effective doses of an agent as taught herein, such as the saRNA or taRNA as taught herein, may be determined by a qualified physician with due regard to the nature of the agent, the disease condition and severity, and the age, size, and condition of the patient. In embodiments of the uses or methods as taught herein, the method may comprise administering the saRNA, taRNA, vector, cell, or pharmaceutical composition to cells of the subject, thereby producing the protein or non-coding RNA in the subject, optionally wherein the method comprises administering the saRNA, taRNA, nucleic acid, or vector to cells of the subject, thereby producing the protein or non-coding RNA in the subject.
[0266] In embodiments of the uses or methods as taught herein, the methods as taught herein result in a reduction in an innate immune response and / or in cytotoxicity in the subject compared to a control subject receiving the saRNA or taRNA without polynucleotide inserts.
[0267] As used herein, the term "immune response" refers to the reaction within the body that is caused by antigens (= foreign substances, tumour associated antigens or antigens used for desensitisation) or other danger signals, such as PAMPs (pathogen associated molecular patterns) or DAMPs (damage associated molecular patterns), and results in the induction of an (a) innate immune response and / or (b) adaptive immune response such as (i) a humoral response and (ii) a cellular response. Production of antibodies and immune cells can fight disease by killing or inhibiting the causative agent or affected cells or reprogramming the immune system.
[0268] The term "cytotoxicity" as used herein refers to a quality of being harmful to cells. Such effects can manifest as, for example but not limited to, disruption of cellular homeostasis, inhibition of cell growth, or cell death. This can be measured by methods well known to the skilled person such as WST-1 or other viability assays.
[0269] In embodiments of the uses or methods as taught herein, the subject may be a eukaryotic subject. In embodiments of the uses or methods as taught herein, the subject may be a mammalian subject. Preferably, the subject is a human subject.
[0270] A further aspect relates to the use of the saRNA or taRNA as taught herein or the nucleic acid as taught herein or the vector as taught herein for recombinant production of a protein of interest, i.e., for recombinant protein production.
[0271] A further aspect relates to the use of the saRNA or taRNA as taught herein or the nucleic acid as taught herein or the vector as taught herein for in vitro or ex vivo modifying a host cell such as to produce a protein or RNA of interest by the host cell. A related aspect relates to an in vitro or ex vivo method for modifying a host cell such as to produce a protein or RNA of interest comprising introducing into the host cell the saRNA or taRNA as taught herein or the nucleic acid as taught herein or the vector as taught herein which encode the protein or the RNA of interest. By means of an example, such cells can be used for autologous (patient specific) or allogeneic ("off the shelf") cell therapy methods to introduce into a patient cells which express a therapeutically beneficial protein. Hence, the host cell can be configured for autologous or allogeneic administration to a subject.
[0272] A further aspect of the invention relates to a method for the in vitro or ex vivo production of a protein or a non-coding RNA in an eukaryotic cell, comprising adding the saRNA or taRNA as taught herein, the nucleic acid as taught herein, the vector as taught herein, or the pharmaceutical composition as taught herein to an eukaryotic cell, thereby producing the protein or non-coding RNA. Such methods can advantageously be used in fields involving stem cells, CAR-T cells, natural killer cells, or dendritic cells.
[0273] A further aspect provides an in vitro diagnostic method comprising the use of the saRNA or taRNA as taught herein, the nucleic acid as taught herein, the vector as taught herein, the cell as taught herein, or the as taught herein.
[0274] A further aspect relates to an in vitro screening method for identifying a saRNA or taRNA as an agent useful for producing a protein or a non-coding RNA of interest, wherein the saRNA or taRNA comprises: an alphavirus genomic 5'UTR or mutant thereof; a nucleic acid sequence encoding alphavirus nonstructural proteins nsPl-4 or mutant thereof; an alphavirus sub-genomic promoter or mutant thereof; and (i) an open reading frame sequence encoding a protein of interest or (ii) a non-coding RNA of interest, wherein the alphavirus genomic 5'UTR or mutant thereof comprises one or more polynucleotide inserts, the method comprising: administering the saRNA or taRNA to cells, thereby producing the protein or non-coding RNA in the cells; measuring viability of the cells; measuring a metric for the rate of expression of the protein or non-coding RNA in the cells; identifying the saRNA or taRNA as an agent useful for producing a protein or a non-coding RNA of interest when (i) the viability of the cells is higher than the viability of the cells being administered the same saRNA or taRNA but without polynucleotide inserts in the alphavirus genomic 5'UTR or mutant thereof, and (ii) the metric for the rate of expression of the protein or non-coding RNA indicates an equal or lower rate of expression of the protein or non-coding RNA than the same metric in cells being administered the same saRNA or taRNA but without polynucleotide inserts in the alphavirus genomic 5'UTR or mutant thereof.
[0275] The term "in vitro” generally denotes outside, or external to, a body, e.g., an animal or human body. The term also encompasses "ex vivo”.
[0276] In embodiments, the method may be performed in a cell-free system or in isolated or cultured cells or in an isolated or cultured tissue. In embodiments, the method may be performed in HeLa cells. In embodiments, the saRNA or taRNA may be the saRNA or taRNA as taught herein.
[0277] In embodiments, the viability may be measured by any suitable method as known in the art, such as by a WST-1 viability assay using a water-soluble tetrazolium salt. The WST-1 viability assay may be performed as described herein using Cell proliferation reagent WST-1 (Merck, 11644807001).
[0278] In embodiments, the metric for the rate of expression of the protein or non-coding RNA may be determined by any suitable method as known in the art for measuring the expression of a protein or noncoding RNA as a function of time. For instance, the metric for the rate of expression of the protein or noncoding RNA may be the maximum slope of the expression of the protein or non-coding RNA as a function of time, the time to peak (TTP) of the expression of the protein or non-coding RNA as a function of time, the ratio of the area under the curve (AUC) of the expression of the protein or non-coding RNA before versus after the peak of the expression of the protein or non-coding RNA as a function of time, the ratio of expression of the protein or non-coding RNA at a later time point (e.g., at 24 to 40 hours after administration) versus at an earlier time point (e.g., at 6 to 12 hours after administration, such as at 6, 7, 8, 9, 10, 11 or 12 hours after administration), the expression level (i.e., accumulated expression) of the protein or non-coding RNA at a particular time point (e.g., at 6, 12, 18, 24, 30 or 36 hours after administration). In embodiments, the expression of the protein or non-coding RNA as a function of time may be measured during a period of at least 24 hours, at least 36 hours, at least 48 hours, at least 60 hours, or at least 72 hours, such as at least 96 hours (4 days), at leastl20 hours (5 days), at least 144 hours (6 days) or at least 168 hours (7 days).
[0279] In the following statements, different aspects or embodiments of the invention are defined in more detail. Each aspect or embodiment so defined may be combined with any other aspect(s) or embodiment(s) unless clearly indicated to the contrary. In particular, any feature indicated as being preferred or advantageous may be combined with any other feature or features indicated as being preferred or advantageous.
[0280] The present application also provides aspects and embodiments as set forth in the following Statements: Statement 1. A self-amplifying ribonucleic acid (saRNA) or trans-amplifying ribonucleic acid (taRNA) comprising: a genomic 5' untranslated region (5'UTR) or mutant thereof; a nucleic acid sequence encoding nonstructural proteins nsPl-4 or mutant thereof; a sub-genomic promoter or mutant thereof; and (i) an open reading frame sequence encoding a protein of interest or (ii) a non-coding RNA of interest, wherein the genomic 5'UTR or mutant thereof comprises one or more polynucleotide inserts downstream of a nucleotide at position -16, wherein the last nucleotide of the genomic 5' UTR or mutant thereof is position -1, and wherein the combined length of the one or more polynucleotide inserts is at least 37 nucleotides. Statement 2. The saRNA or taRNA according to statement 1, wherein the saRNA or taRNA is derived from an alphavirus; preferably wherein the saRNA or taRNA is derived from a Venezuelan Equine Encephalitis Virus (VEEV), Eastern Equine Encephalitis Virus (EEEV), Semliki Forest Virus (SFV), or Sindbis Virus (SINV); more preferably wherein the saRNA or taRNA is derived from a VEEV.
[0281] Statement 3. The saRNA or taRNA according to statement 1 or 2 comprising: an alphavirus genomic 5' untranslated region (5' UTR) or mutant thereof, a nucleic acid sequence encoding alphavirus nonstructural proteins nsPl-4 or mutant thereof, an alphavirus sub-genomic promoter or mutant thereof, and (i) an open reading frame sequence encoding a protein of interest or (ii) a non-coding RNA of interest, wherein the alphavirus genomic 5' UTR or mutant thereof comprises one or more polynucleotide inserts downstream of a nucleotide at position -16, wherein the last nucleotide of the alphavirus genomic 5' UTR or mutant thereof is position -1, and wherein the combined length of the one or more polynucleotide inserts is at least 37 nucleotides.
[0282] Statement 4. The saRNA or taRNA according to any one of statements 1 to 3, wherein the genomic 5' UTR or mutant thereof is operably connected to the nucleic acid sequence encoding nonstructural proteins nsPl-4 or mutant thereof, and / or wherein the sub-genomic promoter or mutant thereof is operably connected to (i) the open reading frame sequence encoding a protein of interest or (ii) the noncoding RNA of interest.
[0283] Statement 5. The saRNA or taRNA according to any one of statements 1 to 4, wherein the genomic 5' UTR or mutant thereof comprises one polynucleotide insert, wherein the length of the one polynucleotide insert is at least 37 nucleotides, or wherein the genomic 5' UTR or mutant thereof comprises two, three or four polynucleotide inserts, wherein the combined lengths of the two, three, or four polynucleotide inserts is at least 37 nucleotides; preferably wherein the genomic 5' UTR or mutant thereof comprises one polynucleotide insert, wherein the length of the polynucleotide insert is at least 37 nucleotides.
[0284] Statement 6. The saRNA or taRNA according to any one of statements 1 to 5, wherein the genomic 5' UTR or mutant thereof comprises one or more polynucleotide inserts downstream of a nucleotide at position -10 or downstream of a nucleotide at position -5, preferably wherein the alphavirus genomic 5' UTR or mutant thereof comprises one polynucleotide insert immediately downstream of a nucleotide at position -5.
[0285] Statement 7. The saRNA or taRNA according to any one of statements 1 to 6, wherein each polynucleotide insert of the two or more, such as two, three or four polynucleotide inserts has a sequence of at least 4 contiguous nucleotides.
[0286] Statement 8. The saRNA or taRNA according to any one of statements 1 to 7, wherein the genomic 5'
[0287] UTR or mutant thereof comprises one polynucleotide insert having a sequence of 66 to 126 nucleotides; or wherein the alphavirus genomic 5' UTR or mutant thereof comprises two, three or four polynucleotide inserts, wherein the combined length of the nucleotides of the two, three, or four polynucleotide inserts is 66 to 126 nucleotides.
[0288] Statement 9. The saRNA or taRNA according to any one of statements 1 to 8, wherein the total sequence of the one or more polynucleotide inserts has a Gibbs free energy of the minimum free energy RNA secondary structure of at most -20.00 kcal / mol, as predicted by UNAfold V3.6 (accessed on the web server on 2023-Oct-ll); and / or wherein the total sequence of the one or more polynucleotide inserts has a melting temperature of at least 80°C, as predicted by UNIPRO Ugene V38.0 (on 2023-Oct-ll).
[0289] Statement 10. The saRNA or taRNA according to any one of statements 1 to 9, wherein the saRNA or taRNA contains a total sequence of the one or more polynucleotide inserts comprising a GC-content between about 20% and 80%, between about 25% and 75%, between about 30% and 70%, between about 35% and 65%, between about 40% and 60%, or between about 45% and 55%.
[0290] Statement 11. A nucleic acid sequence encoding for the saRNA or taRNA as defined in any one of statements 1 to 10.
[0291] Statement 12. A vector comprising the saRNA or taRNA according to any one of statements 1 to 10 or a nucleic acid encoding for the saRNA or taRNA according to statement 11, a cell comprising the saRNA or taRNA according to any one of statements 1 to 10, or a cell comprising said vector.
[0292] Statement 13. A pharmaceutical composition comprising the saRNA or ta RNA according to any one of statements 1 to 10, the nucleic acid according to statement 11, the vector according to statement 12, and / or the cell according to statement 12, and further comprising and a pharmaceutically acceptable carrier.
[0293] Statement 14. The pharmaceutical composition according to statement 13, further comprising a delivery system; preferably wherein the delivery system comprises one or more of a lipid nanoparticle, a polymeric nanoparticle, an organic nanoparticle, an inorganic nanoparticle (e.g., a gold nanoparticle, a magnetic nanoparticle, a quantum dot, a silica nanoparticle (e.g., DegradaBall of Lemonex)), a cationic lipid, a liposome, an extracellular vesicle, a cationic nano-emulsion, a cochleate, a virosome, an immune- stimulating complex, a microparticle, a microsphere, a nanosphere, a unilamellar vesicle, a multilamellar vesicle, an oil-in water emulsion, a water-in-oil emulsion, an emulsome, and a polycationic peptide.
[0294] Statement 15. The saRNA or taRNA according to any one of statements 1 to 10, nucleic acid according to statement 11, the vector according to statement 12, the cell according to statement 12, or the pharmaceutical composition according to statement 13 or 14, for use in a method of producing a protein or a non-coding RNA in a subject. Statement 16. The saRNA or taRNA according to any one of statements 1 to 10, the nucleic acid according to statement 11, the vector according to statement 12, the cell according to statement 12, or the pharmaceutical composition according to statement 13 or 14, for use as a medicament.
[0295] Statement 17. The saRNA or taRNA according to any one of statements 1 to 10, the nucleic acid according to statement 11, the vector according to statement 12, the cell according to statement 12 or the pharmaceutical composition according to statement 13 or 14, for use in a method of protein therapy, vaccination, stem cell reprogramming, induction of stem cells, induction of allergy tolerance, gene editing, gene modification, gene silencing, regulation of gene expression, immunotherapy, or cancer treatment in a subject, or for use in an in vivo diagnostic method in a subject.
[0296] Statement 18. The saRNA or taRNA, nucleic acid, the vector, the cell or the pharmaceutical composition for use according to any one of statements 15 to 17, wherein the method comprises administering the saRNA, taRNA, nucleic acid, vector, cell, or pharmaceutical composition to cells of the subject, thereby producing the protein or non-coding RNA in the subject, optionally wherein the method comprises administering the saRNA, taRNA, nucleic acid, vector, cell, or pharmaceutical composition to cells of the subject, thereby producing the protein or non-coding RNA in the subject.
[0297] Statement 19. Use of the saRNA or taRNA according to any one of statements 1 to 10, the nucleic acid according to statement 11, or the vector according to statement 12 for recombinant production of a protein of interest.
[0298] Statement 20. Use of the saRNA or taRNA according to any one of statements 1 to 10, the nucleic acid of statement 11, or the vector according to statement 12 for in vitro or ex vivo modifying a host cell such as to produce a protein or RNA of interest by the host cell, optionally wherein the host cell is configured for autologous or allogeneic administration to a subject.
[0299] Statement 21. An in vitro diagnostic method comprising the use of the saRNA or taRNA according to any one of statements 1 to 10, the nucleic acid according to statement 11, the vector according to statement 12, the cell according to statement 12, or the pharmaceutical composition according to statement 13 or 14.
[0300] Statement 22. A method for treating a subject in need of said treatment comprising administering an effective amount of the saRNA or taRNA according to any one of statements 1 to 10, the nucleic acid according to statement 11, the vector according to statement 12, the cell according to statement 12 or the pharmaceutical composition according to statement 13 or 14 to the subject.
[0301] Statement 23. A method of protein therapy, vaccination, stem reprogramming, induction of stem cells, induction of allergy tolerance, gene editing, gene modification, gene silencing, regulation of gene expression, immunotherapy, or cancer treatment in a subject in need thereof comprising administering an effective amount of saRNA or taRNA according to any one of statements 1 to 10, the nucleic acid according to statement 11, the vector according to statement 12, the cell according to statement 12 or the pharmaceutical composition according to statement 13 or 14 to the subject.
[0302] Statement 24. An in vitro diagnostic method comprising the use of the saRNA or taRNA according to any one of statements 1 to 10, the nucleic acid according to statement 11, the vector according to statement 12, the cell according to statement 12 or the pharmaceutical composition according to statement 13 or 14.
[0303] The above aspects and embodiments are further supported by the following non-limiting examples.
[0304] EXAMPLES
[0305] Denomination of self-amplifying RNA (saRNA) and enhanced self-amplifying RNA (e-saRNA)
[0306] As illustrated in FIG. 1, the enhanced self-amplifying RNA (e-saRNA) according to embodiments of the invention used in the following examples is named as follows:
[0307] <ExnxAbbreviated SEQ ID> wherein:
[0308] E = e-saRNA, thus having modifications in the genomic 5' UTR the first nucleotide of the open reading frame of nsPl is defined as +1 the first preceding nucleotide is defined as -1 n = an integer representing the position of the nucleotide following the polynucleotide
[0309] Abbreviated SEQ ID = "S" followed by the SEQ ID number of the sequence of the polynucleotide
[0310] The unaltered self-amplifying RNA (saRNA) used in comparative examples is named as follows: conventional saRNA (c-saRNA)
[0311] For instance, an insertion of the polynucleotide with SEQ ID NO: 1 before the nucleotide at position n=-4 in the genomic 5' UTR is referred to as "E-4S1". The polynucleotide is thus inserted immediately downstream of the nucleotide at position -5.
[0312] For instance, an insertion of the polynucleotide with SEQ ID NO: 3 before the nucleotide at position n=+l in the genomic 5'UTR is referred to as "E+1S3". The polynucleotide is thus inserted immediately downstream of the nucleotide at position -1.
[0313] Material and methods
[0314] RNA production process
[0315] Self-amplifying RNA (saRNA) was produced by in vitro transcription (IVT) from a plasmid-derived PCR template. The backbones of the plasmids are derived from pUC19, and contain an saRNA derived from VEEV strain TC-83 and contain the VEEV genomic 5' UTR, the VEEV non-structural proteins 1 till 4 (nsPl- 4), the VEEV sub-genomic promotor (SGP), the VEEV sub-genomic 5' UTR, the coding sequence for Firefly Luciferase 2 (as present in pGL4, Promega), and the VEEV 3' UTR. A substitution in the 5' UTR (r.A3>G) and in nsP2 (p.(Gly739Leu)) is present to reduce cytopathogenic effects upon administration.
[0316] The nucleic acid sequence of the conventional saRNA described above is reproduced below in SEQ. ID NO: 26:
[0317] ATGGGCGGCGCATGAGAGAAGCCCAGACCAATTACCTACCCAAAATGGAGAAAGTTCACGTTGACATCGAGGAA GACAGCCCATTCCTCAGAGCTTTGCAGCGGAGCTTCCCGCAGTTTGAGGTAGAAGCCAAGCAGGTCACTGATAAT GACCATGCTAATGCCAGAGCGTTTTCGCATCTGGCTTCAAAACTGATCGAAACGGAGGTGGACCCATCCGACACG ATCCTTGACATTGGAAGTGCGCCCGCCCGCAGAATGTATTCTAAGCACAAGTATCATTGTATCTGTCCGATGAGAT GTGCGGAAGATCCGGACAGATTGTATAAGTATGCAACTAAGCTGAAGAAAAACTGTAAGGAAATAACTGATAAG GAATTGGACAAGAAAATGAAGGAGCTCGCCGCCGTCATGAGCGACCCTGACCTGGAAACTGAGACTATGTGCCTC CACGACGACGAGTCGTGTCGCTACGAAGGGCAAGTCGCTGTTTACCAGGATGTATACGCGGTTGACGGACCGACA AGTCTCTATCACCAAGCCAATAAGGGAGTTAGAGTCGCCTACTGGATAGGCTTTGACACCACCCCTTTTATGTTTAA GAACTTGGCTGGAGCATATCCATCATACTCTACCAACTGGGCCGACGAAACCGTGTTAACGGCTCGTAACATAGGC CTATGCAGCTCTGACGTTATGGAGCGGTCACGTAGAGGGATGTCCATTCTTAGAAAGAAGTATTTGAAACCATCCA ACAATGTTCTATTCTCTGTTGGCTCGACCATCTACCACGAGAAGAGGGACTTACTGAGGAGCTGGCACCTGCCGTC TGTATTTCACTTACGTGGCAAGCAAAATTACACATGTCGGTGTGAGACTATAGTTAGTTGCGACGGGTACGTCGTT AAAAGAATAGCTATCAGTCCAGGCCTGTATGGGAAGCCTTCAGGCTATGCTGCTACGATGCACCGCGAGGGATTC TTGTGCTGCAAAGTGACAGACACATTGAACGGGGAGAGGGTCTCTTTTCCCGTGTGCACGTATGTGCCAGCTACA TTGTGTGACCAAATGACTGGCATACTGGCAACAGATGTCAGTGCGGACGACGCGCAAAAACTGCTGGTTGGGCTC AACCAGCGTATAGTCGTCAACGGTCGCACCCAGAGAAACACCAATACCATGAAAAATTACCTTTTGCCCGTAGTGG CCCAGGCATTTGCTAGGTGGGCAAAGGAATATAAGGAAGATCAAGAAGATGAAAGGCCACTAGGACTACGAGAT AGACAGTTAGTCATGGGGTGTTGTTGGGCTTTTAGAAGGCACAAGATAACATCTATTTATAAGCGCCCGGATACCC AAACCATCATCAAAGTGAACAGCGATTTCCACTCATTCGTGCTGCCCAGGATAGGCAGTAACACATTGGAGATCG GGCTGAGAACAAGAATCAGGAAAATGTTAGAGGAGCACAAGGAGCCGTCACCTCTCATTACCGCCGAGGACGTA CAAGAAGCTAAGTGCGCAGCCGATGAGGCTAAGGAGGTGCGTGAAGCCGAGGAGTTGCGCGCAGCTCTACCACC TTTGGCAGCTGATGTTGAGGAGCCCACTCTGGAAGCCGATGTCGACTTGATGTTACAAGAGGCTGGGGCCGGCTC AGTGGAGACACCTCGTGGCTTGATAAAGGTTACCAGCTACGATGGCGAGGACAAGATCGGCTCTTACGCTGTGCT TTCTCCGCAGGCTGTACTCAAGAGTGAAAAATTATCTTGCATCCACCCTCTCGCTGAACAAGTCATAGTGATAACAC ACTCTGGCCGAAAAGGGCGTTATGCCGTGGAACCATACCATGGTAAAGTAGTGGTGCCAGAGGGACATGCAATA CCCGTCCAGGACTTTCAAGCTCTGAGTGAAAGTGCCACCATTGTGTACAACGAACGTGAGTTCGTAAACAGGTACC TGCACCATATTGCCACACATGGAGGAGCGCTGAACACTGATGAAGAATATTACAAAACTGTCAAGCCCAGCGAGC ACGACGGCGAATACCTGTACGACATCGACAGGAAACAGTGCGTCAAGAAAGAACTAGTCACTGGGCTAGGGCTC ACAGGCGAGCTGGTGGATCCTCCCTTCCATGAATTCGCCTACGAGAGTCTGAGAACACGACCAGCCGCTCCTTACC AAGTACCAACCATAGGGGTGTATGGCGTGCCAGGATCAGGCAAGTCTGGCATCATTAAAAGCGCAGTCACCAAAA
[0318] AAGATCTAGTGGTGAGCGCCAAGAAAGAAAACTGTGCAGAAATTATAAGGGACGTCAAGAAAATGAAAGGGCTG
[0319] GACGTCAATGCCAGAACTGTGGACTCAGTGCTCTTGAATGGATGCAAACACCCCGTAGAGACCCTGTATATTGAC
[0320] GAAGCTTTTGCTTGTCATGCAGGTACTCTCAGAGCGCTCATAGCCATTATAAGACCTAAAAAGGCAGTGCTCTGCG
[0321] GGGATCCCAAACAGTGCGGTTTTTTTAACATGATGTGCCTGAAAGTGCATTTTAACCACGAGATTTGCACACAAGT
[0322] CTTCCACAAAAGCATCTCTCGCCGTTGCACTAAATCTGTGACTTCGGTCGTCTCAACCTTGTTTTACGACAAAAAAA
[0323] TGAGAACGACGAATCCGAAAGAGACTAAGATTGTGATTGACACTACCGGCAGTACCAAACCTAAGCAGGACGATC
[0324] TCATTCTCACTTGTTTCAGAGGGTGGGTGAAGCAGTTGCAAATAGATTACAAAGGCAACGAAATAATGACGGCAG
[0325] CTGCCTCTCAAGGGCTGACCCGTAAAGGTGTGTATGCCGTTCGGTACAAGGTGAATGAAAATCCTCTGTACGCACC
[0326] CACCTCAGAACATGTGAACGTCCTACTGACCCGCACGGAGGACCGCATCGTGTGGAAAACACTAGCCGGCGACCC
[0327] ATGGATAAAAACACTGACTGCCAAGTACCCTGGGAATTTCACTGCCACGATAGAGGAGTGGCAAGCAGAGCATG
[0328] ATGCCATCATGAGGCACATCTTGGAGAGACCGGACCCTACCGACGTCTTCCAGAATAAGGCAAACGTGTGTTGGG
[0329] CCAAGGCTTTAGTGCCGGTGCTGAAGACCGCTGGCATAGACATGACCACTGAACAATGGAACACTGTGGATTATT
[0330] TTGAAACGGACAAAGCTCACTCAGCAGAGATAGTATTGAACCAACTATGCGTGAGGTTCTTTGGACTCGATCTGG
[0331] ACTCCGGTCTATTTTCTGCACCCACTGTTCCGTTATCCATTAGGAATAATCACTGGGATAACTCCCCGTCGCCTAAC
[0332] ATGTACGGGCTGAATAAAGAAGTGGTCCGTCAGCTCTCTCGCAGGTACCCACAACTGCCTCGGGCAGTTGCCACT
[0333] GGAAGAGTCTATGACATGAACACTGGTACACTGCGCAATTATGATCCGCGCATAAACCTAGTACCTGTAAACAGA
[0334] AGACTGCCTCATGCTTTAGTCCTCCACCATAATGAACACCCACAGAGTGACTTTTCTTCATTCGTCAGCAAATTGAA
[0335] GGGCAGAACTGTCCTGGTGGTCGGGGAAAAGTTGTCCGTCCCAGGCAAAATGGTTGACTGGTTGTCAGACCGGC
[0336] CTGAGGCTACCTTCAGAGCTCGGCTGGATTTAGGCATCCCAGGTGATGTGCCCAAATATGACATAATATTTGTTAA
[0337] TGTGAGGACCCCATATAAATACCATCACTATCAGCAGTGTGAAGACCATGCCATTAAGCTTAGCATGTTGACCAAG
[0338] AAAGCTTGTCTGCATCTGAATCCCGGCGGAACCTGTGTCAGCATAGGTTATGGTTACGCTGACAGGGCCAGCGAA
[0339] AGCATCATTGGTGCTATAGCGCGGCTGTTCAAGTTTTCCCGGGTATGCAAACCGAAATCCTCACTTGAAGAGACGG
[0340] AAGTTCTGTTTGTATTCATTGGGTACGATCGCAAGGCCCGTACGCACAATCCTTACAAGCTTTCATCAACCTTGACC
[0341] AACATTTATACAGGTTCCAGACTCCACGAAGCCGGATGTGCACCCTCATATCATGTGGTGCGAGGGGATATTGCCA
[0342] CGGCCACCGAAGGAGTGATTATAAATGCTGCTAACAGCAAAGGACAACCTGGCGGAGGGGTGTGCGGAGCGCTG
[0343] TATAAGAAATTCCCGGAAAGCTTCGATTTACAGCCGATCGAAGTAGGAAAAGCGCGACTGGTCAAAGGTGCAGCT
[0344] AAACATATCATTCATGCCGTAGGACCAAACTTCAACAAAGTTTCGGAGGTTGAAGGTGACAAACAGTTGGCAGAG
[0345] GCTTATGAGTCCATCGCTAAGATTGTCAACGATAACAATTACAAGTCAGTAGCGATTCCACTGTTGTCCACCGGCA
[0346] TCTTTTCCGGGAACAAAGATCGACTAACCCAATCATTGAACCATTTGCTGACAGCTTTAGACACCACTGATGCAGAT
[0347] GTAGCCATATACTGCAGGGACAAGAAATGGGAAATGACTCTCAAGGAAGCAGTGGCTAGGAGAGAAGCAGTGG
[0348] AGGAGATATGCATATCCGACGACTCTTCAGTGACAGAACCTGATGCAGAGCTGGTGAGGGTGCATCCGAAGAGTT
[0349] CTTTGGCTGGAAGGAAGGGCTACAGCACAAGCGATGGCAAAACTTTCTCATATTTGGAAGGGACCAAGTTTCACC
[0350] AGGCGGCCAAGGATATAGCAGAAATTAATGCCATGTGGCCCGTTGCAACGGAGGCCAATGAGCAGGTATGCATG TATATCCTCGGAGAAAGCATGAGCAGTATTAGGTCGAAATGCCCCGTCGAAGAGTCGGAAGCCTCCACACCACCT
[0351] AGCACGCTGCCTTGCTTGTGCATCCATGCCATGACTCCAGAAAGAGTACAGCGCCTAAAAGCCTCACGTCCAGAAC
[0352] AAATTACTGTGTGCTCATCCTTTCCATTGCCGAAGTATAGAATCACTGGTGTGCAGAAGATCCAATGCTCCCAGCCT
[0353] ATATTGTTCTCACCGAAAGTGCCTGCGTATATTCATCCAAGGAAGTATCTCGTGGAAACACCACCGGTAGACGAGA
[0354] CTCCGGAGCCATCGGCAGAGAACCAATCCACAGAGGGGACACCTGAACAACCACCACTTATAACCGAGGATGAG
[0355] ACCAGGACTAGAACGCCTGAGCCGATCATCATCGAAGAGGAAGAAGAGGATAGCATAAGTTTGCTGTCAGATGG
[0356] CCCGACCCACCAGGTGCTGCAAGTCGAGGCAGACATTCACGGGCCGCCCTCTGTATCTAGCTCATCCTGGTCCATT
[0357] CCTCATGCATCCGACTTTGATGTGGACAGTTTATCCATACTTGACACCCTGGAGGGAGCTAGCGTGACCAGCGGG
[0358] GCAACGTCAGCCGAGACTAACTCTTACTTCGCAAAGAGTATGGAGTTTCTGGCGCGACCGGTGCCTGCGCCTCGA
[0359] ACAGTATTCAGGAACCCTCCACATCCCGCTCCGCGCACAAGAACACCGTCACTTGCACCCAGCAGGGCCTGCTCGA
[0360] GAACCAGCCTAGTTTCCACCCCGCCAGGCGTGAATAGGGTGATCACTAGAGAGGAGCTCGAGGCGCTTACCCCGT
[0361] CACGCACTCCTAGCAGGTCGGTCTCGAGAACCAGCCTGGTCTCCAACCCGCCAGGCGTAAATAGGGTGATTACAA
[0362] GAGAGGAGTTTGAGGCGTTCGTAGCACAACAACAATGACGGTTTGATGCGGGTGCATACATCTTTTCCTCCGACA
[0363] CCGGTCAAGGGCATTTACAACAAAAATCAGTAAGGCAAACGGTGCTATCCGAAGTGGTGTTGGAGAGGACCGAA
[0364] TTGGAGATTTCGTATGCCCCGCGCCTCGACCAAGAAAAAGAAGAATTACTACGCAAGAAATTACAGTTAAATCCCA
[0365] CACCTGCTAACAGAAGCAGATACCAGTCCAGGAAGGTGGAGAACATGAAAGCCATAACAGCTAGACGTATTCTGC
[0366] AAGGCCTAGGGCATTATTTGAAGGCAGAAGGAAAAGTGGAGTGCTACCGAACCCTGCATCCTGTTCCTTTGTATTC
[0367] ATCTAGTGTGAACCGTGCCTTTTCAAGCCCCAAGGTCGCAGTGGAAGCCTGTAACGCCATGTTGAAAGAGAACTTT
[0368] CCGACTGTGGCTTCTTACTGTATTATTCCAGAGTACGATGCCTATTTGGACATGGTTGACGGAGCTTCATGCTGCTT
[0369] AGACACTGCCAGTTTTTGCCCTGCAAAGCTGCGCAGCTTTCCAAAGAAACACTCCTATTTGGAACCCACAATACGA
[0370] TCGGCAGTGCCTTCAGCGATCCAGAACACGCTCCAGAACGTCCTGGCAGCTGCCACAAAAAGAAATTGCAATGTC
[0371] ACGCAAATGAGAGAATTGCCCGTATTGGATTCGGCGGCCTTTAATGTGGAATGCTTCAAGAAATATGCGTGTAAT
[0372] AATGAATATTGGGAAACGTTTAAAGAAAACCCCATCAGGCTTACTGAAGAAAACGTGGTAAATTACATTACCAAAT
[0373] TAAAAGGACCAAAAGCTGCTGCTCTTTTTGCGAAGACACATAATTTGAATATGTTGCAGGACATACCAATGGACAG
[0374] GTTTGTAATGGACTTAAAGAGAGACGTGAAAGTGACTCCAGGAACAAAACATACTGAAGAACGGCCCAAGGTAC
[0375] AGGTGATCCAGGCTGCCGATCCGCTAGCAACAGCGTATCTGTGCGGAATCCACCGAGAGCTGGTTAGGAGATTAA
[0376] ATGCGGTCCTGCTTCCGAACATTCATACACTGTTTGATATGTCGGCTGAAGACTTTGACGCTATTATAGCCGAGCAC
[0377] TTCCAGCCTGGGGATTGTGTTCTGGAAACTGACATCGCGTCGTTTGATAAAAGTGAGGACGACGCCATGGCTCTG
[0378] ACCGCGTTAATGATTCTGGAAGACTTAGGTGTGGACGCAGAGCTGTTGACGCTGATTGAGGCGGCTTTCGGCGAA
[0379] ATTTCATCAATACATTTGCCCACTAAAACTAAATTTAAATTCGGAGCCATGATGAAATCTGGAATGTTCCTCACACT
[0380] GTTTGTGAACACAGTCATTAACATTGTAATCGCAAGCAGAGTGTTGAGAGAACGGCTAACCGGATCACCATGTGC
[0381] AGCATTCATTGGAGATGACAATATCGTGAAAGGAGTCAAATCGGACAAATTAATGGCAGACAGGTGCGCCACCTG
[0382] GTTGAATATGGAAGTCAAGATTATAGATGCTGTGGTGGGCGAGAAAGCGCCTTATTTCTGTGGAGGGTTTATTTT
[0383] GTGTGACTCCGTGACCGGCACAGCGTGCCGTGTGGCAGACCCCCTAAAAAGGCTGTTTAAGCTTGGCAAACCTCT GGCAGCAGACGATGAACATGATGATGACAGGAGAAGGGCATTGCATGAAGAGTCAACACGCTGGAACCGAGTG
[0384] GGTATTCTTTCAGAGCTGTGCAAGGCAGTAGAATCAAGGTATGAAACCGTAGGAACTTCCATCATAGTTATGGCCA
[0385] TGACTACTCTAGCTAGCAGTGTTAAATCATTCAGCTACCTGAGAGGGGCCCCTATAACTCTCTACGGCTAACCTGA
[0386] ATGGACTACGACATAGTCTAGTCCGCCAAGTCTAGAACAAGTTTGTACAAAAAAGCAGGCTGCCACCATGGAAGA
[0387] TGCCAAAAACATTAAGAAGGGCCCAGCGCCATTCTACCCACTCGAAGACGGGACCGCCGGCGAGCAGCTGCACA
[0388] AAGCCATGAAGCGCTACGCCCTGGTGCCCGGCACCATCGCCTTTACCGACGCACATATCGAGGTGGACATTACCTA
[0389] CGCCGAGTACTTCGAGATGAGCGTTCGGCTGGCAGAAGCTATGAAGCGCTATGGGCTGAATACAAACCATCGGAT
[0390] CGTGGTGTGCAGCGAGAATAGCTTGCAGTTCTTCATGCCCGTGTTGGGTGCCCTGTTCATCGGTGTGGCTGTGGCC
[0391] CCAGCTAACGACATCTACAACGAGCGCGAGCTGCTGAACAGCATGGGCATCAGCCAGCCCACCGTCGTATTCGTG
[0392] AGCAAGAAAGGGCTGCAAAAGATCCTCAACGTGCAAAAGAAGCTACCGATCATACAAAAGATCATCATCATGGAT
[0393] AGCAAGACCGACTACCAGGGCTTCCAAAGCATGTACACCTTCGTGACTTCCCATTTGCCACCCGGCTTCAACGAGT
[0394] ACGACTTCGTGCCCGAGAGCTTCGACCGGGACAAAACCATCGCCCTGATCATGAACAGTAGTGGCAGTACCGGAT
[0395] TGCCCAAGGGCGTAGCCCTACCGCACCGCACCGCTTGTGTCCGATTCAGTCATGCCCGCGACCCCATCTTCGGCAA
[0396] CCAGATCATCCCCGACACCGCTATCCTCAGCGTGGTGCCATTTCACCACGGCTTCGGCATGTTCACCACGCTGGGC
[0397] TACTTGATCTGCGGCTTTCGGGTCGTGCTCATGTACCGCTTCGAGGAGGAGCTATTCTTGCGCAGCTTGCAAGACT
[0398] ATAAGATTCAATCTGCCCTGCTGGTGCCCACACTATTTAGCTTCTTCGCTAAGAGCACTCTCATCGACAAGTACGAC
[0399] CTAAGCAACTTGCACGAGATCGCCAGCGGCGGGGCGCCGCTCAGCAAGGAGGTAGGTGAGGCCGTGGCCAAAC
[0400] GCTTCCACCTACCAGGCATCCGCCAGGGCTACGGCCTGACAGAAACAACCAGCGCCATTCTGATCACCCCCGAAG
[0401] GGGACGACAAGCCTGGCGCAGTAGGCAAGGTGGTGCCCTTCTTCGAGGCTAAGGTGGTGGACTTGGACACCGGT
[0402] AAGACACTGGGTGTGAACCAGCGCGGCGAGCTGTGCGTCCGTGGCCCCATGATCATGAGCGGCTACGTTAACAAC
[0403] CCCGAGGCTACAAACGCTCTCATCGACAAGGACGGCTGGCTGCACAGCGGCGACATCGCCTACTGGGACGAGGA
[0404] CGAGCACTTCTTCATCGTGGACCGGCTGAAGAGCCTGATCAAATACAAGGGCTACCAGGTAGCCCCAGCCGAACT
[0405] GGAGAGCATCCTGCTGCAACACCCCAACATCTTCGACGCCGGGGTCGCCGGCCTGCCCGACGACGATGCCGGCGA
[0406] GCTGCCCGCCGCAGTCGTCGTGCTGGAACACGGTAAAACCATGACCGAGAAGGAGATCGTGGACTATGTGGCCA
[0407] GCCAGGTTACAACCGCCAAGAAGCTGCGCGGTGGTGTTGTGTTCGTGGACGAGGTGCCTAAAGGACTGACCGGC
[0408] AAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGCAAGATCGCCGTGTAAACCCA
[0409] GCTTTCTTGTACAAAGTGGTGGCGCGCCATACAGCAGCAATTGGCAAGCTGCTTACATAGAACTCGCGGCGATTG
[0410] GCATGCCGCCTTAAAATTTTTATTTTATTTTTCTTTTCTTTTCCGAATCGGATTTTGTTTTTAATATTTCAAAAAAAAA
[0411] AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
[0412] The nucleic acid sequence of the genomic 5' UTR of VEEV strain TC-83 including the r.3A>G substitution is reproduced below:
[0413] ATGGGCGGCGCATGAGAGAAGCCCAGACCAATTACCTACCCAAA (SEQ ID NO: 6)
[0414] The plasmid was amplified in 5-alpha Competent E. coli (NEB, C2987H), which were cultivated in liquid broth (tryptone (10g / l; VWR International, Leuven, Belgium), yeast extract (5g / l; Invitrogen Merelbeke, Belgium), sodium chloride (10 g / l; VWR, 84610.0500)) containing ampicillin (0,1 mg / ml; PanReac Applichem ITW reagents, A0839.0010). The plasmids were subsequently isolated using the Plasmid Plus Midi kit (QIAGEN, 12943). All plasmid DNA was sequenced entirely with Whole Plasmid Sequencing (Eurofins Genomics) which revealed no abnormalities.
[0415] Polynucleotides were inserted using NEBuilder HiFi DNA Assembly (NEB, E2621). First, a linearized vector was created with high-fidelity PCR (Q5 High-Fidelity 2X Master Mix, NEB, M0492) using two custom primers (IDT).
[0416] > Forward primer (5' -3'): AGCCCATTCCTCAGAGCTTT (SEQ ID NO: 7)
[0417] > Reverse primer (5' -3'): GCCGCCCATTATAGTGAGTC (SEQ ID NO: 8)
[0418] PCR products were purified with a Monarch PCR & DNA Cleanup Kit (NEB, T1030). The purified PCR products were then mixed with a synthetic single-stranded DNA oligonucleotide (IDT Ultramer oligonucleotide) containing 25 nucleotides overlap with the linearized vector at a 200:1 molar ratio of oligo:vector. The incorporation of the oligo according to manufacturer's protocol re-circularized the vector and resulted in insertion of the polynucleotides. Transformation of 5-alpha Competent E. coli, subsequent plasmid purification, and sequencing were performed as described above.
[0419] A unique oligonucleotide was used for each e-saRNA product. The sequences are provided below (5' -3'):
[0420] > insert-15Sl as set forth in SEQ ID NO: 9
[0421] AATACGACTCACTATAATGGGCGGCGCATGAGAGAAGCCCAGACCGGGCGTGATCCGAAAGGTGACCCGGATCT GGGGCGTGATCCGAAAGGTGACCCGGATCCACCGGTCAATTACCTACCCAAAATGGAGAAAGTTCACGTTGACAT CGAGGAAGACAGCCCATTCCTCAGAGCTTTGCAGC
[0422] > insert-9Sl as set forth in SEQ ID NO: 10
[0423] AATACGACTCACTATAATGGGCGGCGCATGAGAGAAGCCCAGACCAATTACGGGCGTGATCCGAAAGGTGACCC GGATCTGGGGCGTGATCCGAAAGGTGACCCGGATCCACCGGTCCTACCCAAAATGGAGAAAGTTCACGTTGACAT CGAGGAAGACAGCCCATTCCTCAGAGCTTTGCAGC
[0424] > insert-4Sl as set forth in SEQ ID NO: 11
[0425] AATACGACTCACTATAATGGGCGGCGCATGAGAGAAGCCCAGACCAATTACCTACCGGGCGTGATCCGAAAGGT GACCCGGATCTGGGGCGTGATCCGAAAGGTGACCCGGATCCACCGGTCCAAAATGGAGAAAGTTCACGTTGACA TCGAGGAAGACAGCCCATTCCTCAGAGCTTTGCAGC
[0426] > insert+lSl as set forth in SEQ ID NO: 12
[0427] AATACGACTCACTATAATGGGCGGCGCATGAGAGAAGCCCAGACCAATTACCTACCCAAAGGGCGTGATCCGAAA GGTGACCCGGATCTGGGGCGTGATCCGAAAGGTGACCCGGATCCACCGGTCATGGAGAAAGTTCACGTTGACAT CGAGGAAGACAGCCCATTCCTCAGAGCTTTGCAGC > insert-4S2 as set forth in SEQ ID NO: 13
[0428] CTCACTATAATGGGCGGCGCATGAGAGAAGCCCAGACCAATTACCTACCGGGCGTGATCCGAAAGGTGACCCGG ATCACGGGCGTGATCCGAAAGGTGACCCTCGGATCGGGCGTGATCCGAAAGGTGACCCGGATCCACCGGTCCAA AATGGAGAAAGTTCACGTTGACATCGAGGAAGACAGCCCATTCCTCAGAGCT
[0429] > insert-4S3 as set forth in SEQ ID NO: 14
[0430] AATACGACTCACTATAATGGGCGGCGCATGAGAGAAGCCCAGACCAATTACCTACCAGGCGGGCGGATAAGGGG AGTTCCGGAGTCCCAGGCCCGGCGGGGAGAACTTGATCTCCACTACTCCAAAATGGAGAAAGTTCACGTTGACAT CGAGGAAGACAGCCCATTCCTCAGAGCTTTGCAGC
[0431] > insert-4S4 as set forth in SEQ ID NO: 15
[0432] AATACGACTCACTATAATGGGCGGCGCATGAGAGAAGCCCAGACCAATTACCTACCCGGGCAGGTCAGATTCGCC GGAGCAACCATCCACGCGGTTGCGGGTCCTGCGCTGACCAACGGGTGCAAAATGGAGAAAGTTCACGTTGACATC GAGGAAGACAGCCCATTCCTCAGAGCTTTGCAGC
[0433] > insert-4S5 as set forth in SEQ ID NO: 16
[0434] AATACGACTCACTATAATGGGCGGCGCATGAGAGAAGCCCAGACCAATTACCTACCGGGCGTGATCCGAAAGGT GACCCGGATCCACCGGTCCAAAATGGAGAAAGTTCACGTTGACATCGAGGAAGACAGCCCATTCCTCAGAGCTTT GCAGC
[0435] Next, IVT templates were created with a high-fidelity PCR (Q5 High-Fidelity 2X Master Mix, NEB, M0492) using two custom primers (IDT).
[0436] > Forward primer (5' -3') as set forth in SEQ ID NO: 17:
[0437] CAGGGTAATTAATACGACTCACTATAATG
[0438] > Reverse primer (5' -3') as set forth in SEQ ID NO: 18:
[0439] TT I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I GAAATATTAAAAACAAAATCCGATTC
[0440] PCR products were purified with a Monarch PCR & DNA Cleanup Kit (NEB, T1030).
[0441] The purified PCR products were then used as template for IVT (HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs, E2040)) with co-transcriptional capping (CleanCap Reagent AU (Trilink, N-7114)). The poly(A)-tail is encoded in the DNA template. Following IVT, the RNA was treated with DNase I (Invitrogen, AM2238) or DNase l-XT (NEB, M0570). The RNA was then purified using the Monarch RNA cleanup kit (NEB, T2050). After determining the concentration and purity with a NanoDroplOOO (Thermo Fisher), saRNA integrity was analysed using bleach gel electrophoresis as described earlier (Aranda, LaJoie and Jorcyk, 2012).
[0442] Where illustrated in the text, the purified RNA was processed further by cellulose-based purification, as described in Zhong Z, et al. (Mol Ther. 2021;29(4):1370-1381). In brief, 0.14 g cellulose fibers (Sigma- Aldrich Avicel, 11365) were transferred to a microcentrifuge spin column (AHN myTube SC 0.8 ml filter tube, CA 0.2 pm filter, 2.0 ml receiver tube) after resuspension by vigorous shaking for 10 minutes at room temperature in chromatography buffer (10 mM HEPES (pH 7.2), 0.1 mM EDTA, 125 mM NaCI, 16% (v / v) ethanol). After centrifugation for 60 seconds at 14000 g, the cellulose fibers were washed with 500 pl chromatography buffer after vigorous shaking for 5 minutes at room temperature. Next, 100-500 pg of RNA sample was diluted in chromatography buffer and transferred to a first microfuge column. After vigorous shaking for 30 minutes at room temperature, the column was centrifuged 60 seconds at 14000 g. The flow-through was then transferred to a second column containing prewashed cellulose, and shaking and centrifugation steps were repeated. Finally, the flow-through containing the RNA was purified with isopropanol precipitation or a Monarch RNA cleanup kit (NEB, T2050), according to manufacturer's protocol.
[0443] Cell culture, transfection, and kinetic luminescence assay
[0444] HeLa cells (ATCC, CCL-2) were cultured in 75 cm2ventilated flasks (VWR, 734-2313) in DM EM, low glucose, GlutaMAX Supplement, pyruvate (Gibco, 21885108), supplemented with 10% (v / v) fetal bovine serum (VWR, S181H-500), and 1% (v / v) of Penicillin-Streptomycin (5,000 U / ml, Thermo Fisher, 15070063). Subcultivation was performed 2 to 3 times per week. Cells were incubated at 37°C, 5% CO2, and at least 90% humidity. Cells were seeded twenty-four hours prior to transfection in TC-treated white 24-well microplates with clear bottom (PerkinElmer, 1450-603), unless otherwise specified.
[0445] Transfection was conducted with Lipofectamine MessengerMAX Transfection Reagent (Invitrogen, LMRNA003), according to manufacturer's protocol. A Lipofectamine:RNA ratio of 2 pl:pg was used for all transfections. Transfection mixtures were prepared in Opti-MEM™ Reduced Serum Medium, no phenol red (Gibco, 11058021), and were added to cells in DMEM, as described above. At least 30 minutes prior to transfection, all medium in the 24-well plates was removed and replaced by identical medium, supplemented with 150 pg / ml XenoLight D-Luciferin Potassium Salt (PerkinElmer, 122799). Luciferin- supplemented medium was changed every 24 hours after transfection.
[0446] Conventional saRNA and enhanced saRNA products had <1% difference in length, so identical masses of RNA were considered equimolar.
[0447] Kinetic luminescence assays were performed in a BioTek Cytation 5 (Agilent) in combination with a BioTek BioSpa 8 Automated Incubator (Agilent). Environmental parameters in the automated incubator were 37°C, 5% CO2, and at least 90% humidity. Luminescence was determined using 135 gain, 10 seconds integration time, 1.0 mm read height, and a 5-minute delay prior to reading to dark-adapt the plate. Semi-automated cell counting
[0448] This protocol describes how live HeLa cells were triple-stained to allow semi-automated cell counting. Cells were not fixated prior to staining.
[0449] The used dyes are:
[0450] 1. Hoechst 33342 (nuclear stain to enable cell-counting, Invitrogen, H1399)
[0451] 2. LIVE / DEAD™ Cell Imaging Kit (Invitrogen, R37601); contains: a. Calcein AM (live-cell specific) b. BOBO-3 (dead-cell specific)
[0452] To perform the triple staining, Hoechst 33342 was resuspended in water to a stock concentration of 1 mg / ml. Next, 10 pl from this stock solution was added to 1 ml of Calcein AM. This combined product was then used to resuspend the dried BOBO-3 stain, according to Thermo Fisher's instructions. Finally, 150 pl of the staining solution was added to each well, already containing 150 pl DPBS. Thus, the final Hoechst concentration equated to 5 pg / ml.
[0453] After addition of the dyes, the plate was left to incubate for 20 minutes.
[0454] Next, each well was imaged manually on a Nikon Ti inverted fluorescence microscope with a Nikon DS U- 1 camera (non-cooled).
[0455] Two distinct areas in each well were micrographed using the 10X objective in four channels: phase contrast, DAPI, FITC, and Cy3.
[0456] After collection of the images, they were processed as follows. The raw 8-bit grayscale tif-files acquired with the DAPI and Cy3 filter set were loaded in ImageJ (FIJI, (Schindelin et al., 2012)). First, background was subtracted to reduce counting background noise. A rolling ball diameter of 50 or 75 pixels was maintained for all images. Next, a threshold was applied. For the DAPI images, the auto threshold was usually sufficient. For Cy3 however, the threshold had to be set manually due to the small difference between stained nuclei and background signal. After applying the threshold, a 'watershed' algorithm was applied to separate touching particles. Particles counted with Hoechst dye are all cells (both live and dead), while cells counted with BOBO3 dye have damaged cell membranes, indicating that they are either dead or dying. Thus, the number of alive cells was calculated by subtracting dead cells from the total cell number.
[0457] LNP formulation
[0458] RNA was formulated in lipid nanoparticles (LNP) at an N / P ratio of 10. The LNPs consisted of ALC-0315, l,2-dimyristoyl-sn-glycero-3-methoxypolyethyleneglycol 2000 (DMG-PEG 2K), cholesterol, and 1,2- dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE). To formulate the saRNA-LNPs, a lipid mixture was made in pure ethanol (Chemlab Analytical, CL00.0556) (Table 1).
[0459] Table 1: Lipid mixture composition, stock concentration in 100% ethanol, and sources
[0460] Next, RNA was dissolved in RNase-free NaOAc buffer (7.5 mM, pH 4.5, Thermo Fisher, J63669.AE). Subsequently, the RNA solution was added to the lipid mixture at a 2:1 volumetric ratio whilst shaking. After addition, the mixture was shaken for an additional 10 seconds.
[0461] Next, buffer-exchange of the formulated LNPs was conducted by overnight dialysis (Slide-A-Lyzer dialysis cassette 20K MCWO 0.1-0.5mL, Thermo Fisher, PI66005) in sterile DPBS (Gibco, 14190250) at 4°C.
[0462] Encapsulation efficiency was determined by the Quant-it RiboGreen RNA Assay Kit (Thermo Fisher Scientific, R11490) per manufacturer's instruction. The size, polydispersity index and zeta potential of the saRNA LNPs were determined using a Nano ZS90 (Malvern Pananalytical). Calculations regarding these parameters employed a refractive index of 1,330 and a viscosity of 0,8872 mPa.s.
[0463] Example 1: Cell growth and toxicity of non-modified saRNA (conventional saRNA), modified saRNA according to an embodiment of the invention (enhanced saRNA), and a comparative modified saRNA in HeLa cells
[0464] Experimental setup
[0465] In this experiment, conventional saRNA was engineered to contain a polynucleotide insert having a sequence as set forth in SEQ ID NO: 1 upstream of nucleotide n=-4 (E-4S1), and upstream of nucleotide n=-15 (E-15S1) of the genomic 5' UTR.
[0466] The nucleic acid sequence of the polynucleotide insert (reference "SEQ 01") is reproduced below:
[0467] GGGCGTGATCCGAAAGGTGACCCGGATCTGGGGCGTGATCCGAAAGGTGACCCGGATCCACCGGTC (SEQ ID NO: 1)
[0468] The polynucleotide insert SEQ 01 consists of plbox C / D mini (underlined), followed by a 7-nucleotide spacer element, followed by plbox C / D mini again (underlined), followed by a final 13-nucleotide spacer. The plbox C / D was originally used as an RNA motif, which is bound by an RNA-binding protein to repress translation (Saito et al., 2010, Nature Chemical Biology, 6, 71-78). In the 23-nucleotide sequence, a base pair [G-C] was changed to [C-G] to remove the start codon in plbox C / D mini.
[0469] RNA was produced and cells were transfected as described above. A dose of 150 / 300 / 600 nanogram (ng) saRNA / well was used. Luminescence was quantified every 4 hours for 48 hours.
[0470] Primary outcomes were:
[0471] T(Vmax): Time at which the luminescence output demonstrates the fastest increase (i.e., the highest slope).
[0472] T(Decline): Time at which the luminescence value starts to decline significantly and irreversibly. This is typically identical to the time at which peak luminescence is observed.
[0473] Lurripeak: The highest observed luminescence value.
[0474] Results
[0475] The luminescence data indicated that doses above 150 ng saRNA were associated with abnormal cell growth and toxicity. This is illustrated by the fact that the luminescence for all saRNA types tested was inversely related to the transfection dose (FIG. 2 and FIG. 3). Micrographs (data not shown) confirmed morphological abnormalities and cell death. The mock transfection with lipofectamine alone did not induce the observed toxicity. This indicates that the toxicity originated from the saRNA, rather than the transfection reagent. The toxicity is further investigated in Example 3.
[0476] The luminescence kinetics were evaluated in more detail using the 150 ng dose, although the same conclusions can be drawn irrespective of transfection dose. Remarkably, the luminescence kinetics of E- 4S1 (FIG. 4C) were slower, compared to both conventional saRNA (FIG. 4A) and E-15S1 (FIG. 4B, Table 2). The influence of inserting SEQ. ID NO: 1 in conventional saRNA strongly depended on the position. If n=- 15, there was no obvious difference in the luminescence kinetics, while n=-4 slowed down the kinetics. Despite the slow rise in luminescence during the first 24 hours, E-4S1 showed a continued steady increase in luminescence, to reach a peak luminescence of similar height to conventional saRNA. This was reflected in the cumulative protein production of E-4S1, which was lower during the first 24 hours (FIG. 3A) but eventually exceeded the cumulative protein production of conventional saRNA during the second day (FIG. 3B).
[0477] These data indicated that the behaviour (i.e. the kinetics of protein production and cellular toxicity) of saRNA was significantly influenced by modifying the genomic 5' UTR with a pronounced positional effect. Table 2: T(Vmax), T(Decline), and Lumpeak for conventional saRNA, E-15S1, and E-4S1 in HeLa cells (150 / 300 / 600 ng saRNA)
[0478] Conventional saRNA: unmodified saRNA, E-15S1: comparative modified saRNA, and E-4S1: modified saRNA according to an embodiment of the invention
[0479] Example 2: Cell growth and toxicity of lower doses of non-modified saRNA (conventional saRNA), modified saRNA according to an embodiment of the invention (enhanced saRNA), and a comparative modified saRNA in HeLa cells
[0480] Experimental setup
[0481] This experiment used identical saRNAs as described in Example 1. However, transfection doses were reduced to 50 ng, 100 ng, and 150 ng to avoid the cytotoxicity that occurred with doses of at least 300 ng, irrespective of the type of saRNA used. Additionally, luminescence was quantified more frequently (every 2 hours) to characterize the kinetic profile in more detail. Finally, 50% less cells were seeded in each well to allow continued measurements up to 72 hours after transfection, without the cells overgrowing too much.
[0482] Primary outcomes were the same as in Example 1: T(Vmax), T(Decline), and Lumpeai<
[0483] Results
[0484] The expression profile for all three saRNA types was similar at 50 ng (FIG. 5A), 100 ng (FIG. 5B), and 150 ng (FIG. 5C). However, the overall brightness was lower at 50 ng.
[0485] For all doses, E-15S1 demonstrated a similar profile to conventional saRNA (see further). In contrast, the expression level of E-4S1 was lower than both conventional saRNA and E-15S1 during the first 24 hours. After that point however, E-4S1 demonstrated a continued steady increase and surpassed both other saRNA products. The resulting luminescence after 24h of E-4S1 became 8-fold to 50-fold higher than conventional saRNA. One likely contributing factor is the difference in live cell numbers. At the 150 ng dose there were clearly more cells in wells transfected with E-4S1 than the other saRNAs (micrographs not shown). For the other two doses, this difference was much less pronounced. This difference in cytotoxicity probably also explains why the cumulative protein production for conventional saRNA and E- 15S1 did not increase from 100 ng to 150 ng (FIG. 6A, and 6B respectively), while that of E-4S1 did (FIG. 6C). Further analysis of the kinetic profiles at the 150 ng dose revealed that both conventional saRNA (FIG. 7A) and E-15S1 (FIG. 7B) demonstrated a very rapid increase in luminescence, with the fastest increase in luminescence (Vmax) between 4 and 8 hours after transfection (Table 3). However, the luminescence quickly reached a maximum at 18 h and started to decline at 22 h. In comparison, E-4S1 demonstrated a more gradual increase in luminescence, reaching its Vmax only 8 hours later, namely between 12 and 16 hours after transfection (FIG. 7C, Table 3). Similarly, its maximum was reached 28 hours later, namely at 48 h, with decline starting at 50 h. Moreover, the observed decline was less rapid for E-4S1 compared to both other saRNAs. The net result was a longer period wherein the protein expression increased or stayed constant (FIG. 7, area shaded in grey). The more gradual kinetics of E-4S1 resulted in a 2.5-fold and 2-fold increase in cumulative protein production compared to conventional saRNA at the 150 ng and 100 ng dose respectively (FIG. 6). Finally, it should be noted that the kinetics were similar at all evaluated transfection doses, with Vmax still occurring at 6h and T(Decline) at 22h for conventional saRNA and E- 15S1, while Vmax and T(Decline) of E-4S1 were observed at 14h and 50h respectively (FIG. 5).
[0486] Table 3: T(Vmax), T(Decline), and Lumpeai< for conventional saRNA, E-15S1, and E-4S1 in HeLa cells
[0487] Conventional saRNA: unmodified saRNA, E-15S1: comparative modified saRNA, and E-4S1: modified saRNA according to an embodiment of the invention (enhanced saRNA)
[0488] Example 3: Reduced toxicity of modified saRNA according to an embodiment of the invention (enhanced saRNA) compared to non-modified saRNA (conventional saRNA) and comparative modified saRNA in HeLa cells
[0489] Experimental setup
[0490] Micrographs obtained from Example 1 and Example 2 indicated a difference in cellular morphology and cell density in HeLa cells transfected with same doses of conventional saRNA or enhanced saRNA (data not shown). To further evaluate this difference, a WST-1 viability assay was performed to gain insight on the viability of the cell population within a well.
[0491] This experiment used 150 ng identical conventional saRNA and enhanced saRNA as described in Example 1. This time, a Costar Transparent TC-coated 24-well plate was used (VWR, 734-1604). A transfection dose of 150 ng saRNA / well was used, identical to Example 2. Twenty-four hours after transfection, all medium was removed and replaced by identical medium with 10% (v / v) Cell proliferation reagent WST-1 (Merck, 11644807001). Absorbance was then measured at 430 nm and 650 nm in a BioTek Cytation 5 (Agilent). As a positive control (PC), wells transfected with 0.3 pl Lipofectamine MessengerMax transfection reagent without saRNA were measured.
[0492] After measuring absorbance, viability was calculated with the following formula: n / . „nn%{yiability) = 100 wherein:
[0493] SampleA43o is the absorbance of the sample measured at 430 nm,
[0494] SampleA65o is the absorbance of the sample measured at 650 nm,
[0495] MediumA43o is the absorbance of the medium measured at 430 nm,
[0496] MediumA65o is the absorbance of the medium measured at 650 nm,
[0497] PCA43o is the absorbance of the positive control measured at 430 nm,
[0498] PCMSO is the absorbance of the positive control measured at 650 nm, all as measured in a BioTek Cytation 5 (Agilent).
[0499] Primary outcome was viability (%) relative to PC (WSTl-viability) at 24 hours after transfection.
[0500] Results
[0501] First, cells transfected with any saRNA had a significantly lower viability at both timepoints, compared to transfection reagent alone (FIG. 8). Second, cells transfected with E-4S1 had a significantly higher viability than both unmodified conventional saRNA and E-15S1 (FIG. 8). It should be noted that later experiments indicated that the remaining reduction in viability observed with E-4S1 can be abolished completely by using an optimized purification method (see Example 6, FIG. 18B).
[0502] Example 4: Pinpointing the insertion position of the polynucleotide in a modified saRNA according to an embodiment of the invention
[0503] Experimental setup
[0504] Two additional enhanced saRNA products were created to further characterize the pronounced positional effect of insertion of SEQ ID NO: 1 in the genomic 5' UTR. These additional products were E-9S1, and E+1S1 (FIG. 9). The previously produced products E-15S1 and E-4S1 were included as a reference.
[0505] Cell seeding, transfection (150 ng saRNA dose / well), luminescence assay, and WST-1 assays were conducted as previously described in Examples 1-3.
[0506] Primary outcomes were T(Vmax), T(Decline), Lumpeak and WSTl-viability at 24h and 48h. Results
[0507] The kinetic profiles of conventional saRNA and enhanced saRNA can be divided into three groups (FIG. 10). First, conventional saRNA (FIG. 10A) and E-15S1 (FIG. 10B) had a near-identical kinetic profile, with the fastest increase in luminescence occurring about 6 hours after transfection, and decline starting about 20 hours after transfection (FIG. 11, and Table 4).
[0508] The second group consisted exclusively of E-4S1, which was characterized by the slowest kinetics (FIG. 10D). Here, the fastest increase was observed about 18 hours after transfection, while decline only occurred about 44 hours after transfection (FIG. 11, and Table 4).
[0509] Finally, E-9S1 (FIG. 10C), and E+1S1 (FIG. 10E) demonstrated intermediate kinetics, with the fastest increase occurring around 6-8 hours, and decline starting about 28 hours after transfection (FIG. 11, and Table 4).
[0510] In addition to the kinetic findings, there was a clear difference in WST-1 metabolic activity. Forty-eight hours after transfection, the metabolic activity for cell populations transfected with E-4S1 was 30% higher compared to all other saRNAs (FIG. 12B). A similar trend was also observed twenty-four hours after transfection (FIG. 12A).
[0511] Table 4: T(Vmax), T(Decline), and Lumpeak for conventional saRNA (C-saRNA), E-15S1, E-9S1, E-4S1, and E+1S1 in HeLa cells
[0512] C-saRNA: unmodified, conventional saRNA, E-15S1: comparative modified saRNA, and E-9S1, E-4S1, E+1S1: modified saRNA according to an embodiment of the invention (enhanced saRNA)
[0513] Example 5: Dexamethasone does not significantly affect the kinetic profile of a modified saRNA according to an embodiment of the invention (enhanced saRNA) compared to non-modified saRNA (conventional saRNA) and comparative modified saRNA in HeLa cells
[0514] Experimental setup
[0515] In this example, HeLa cells were transfected with conventional saRNA, E-15S1, and E-4S1, with and without priming the cells with Dexamethasone. This small molecule can inhibit NF-KB signalling. As such, the involvement of this pathway in the different kinetic profiles was evaluated.
[0516] Thirty minutes prior to transfection, the medium of designated wells was supplemented with 200 nM dexamethasone in ethanol, or an equivalent volume of ethanol without dexamethasone. Other groups have previously determined that 100 nM was optimal (Kelly etal., 2016; Ohto etal., 2019), but this yielded little results in a pilot experiment. One of these groups also determined that 30 minutes prior to transfection was the optimal time to add dexamethasone (Kelly etal., 2016), so this timing was used here. After the 30-minute incubation, transfection was conducted as described earlier, using 150 ng saRNA / well.
[0517] Primary outcomes were T(Vmax), T(Decline), and Lumpeak.
[0518] Results
[0519] The observed measurements indicated that the profiles of all saRNAs were identical to the ones observed previously, both without dexamethasone (FIG. 13) and with 200 nM dexamethasone (FIG. 14)(Table 5). The fastest increase in luminescence occurred around 7h for conventional saRNA (FIG. 13A, and 14A) and E-15S1 (FIG. 13B, and 14B) but was only observed about22h after transfection for E-4S1 (FIG. 13C, and 14C) (Table 5).The luminescence started to decline around 18h for conventional saRNA (FIG. 13A) and E- 15S1 (FIG. 13B) but kept increasing to 44h for E-4S1 (FIG. 13C) (Table 5).
[0520] The addition of dexamethasone (FIG. 14) slowed the onset of decline by 2 hours for both conventional saRNA and enhanced saRNA, compared to no dexamethasone (FIG. 13) (Table 5), which is not deemed significant.
[0521] Table 5: T(Vmax), T(Decline), and Lumpeai< for conventional saRNA, E-15S1, and E-4S1 with and without 200 nM dexamethasone in HeLa cells
[0522] Conventional saRNA: unmodified saRNA, E-15S1: comparative modified saRNA, and E-4S1: modified saRNA according to an embodiment of the invention (enhanced saRNA) Example 6: Cellulose purification does not significantly affect the kinetic profile of a modified saRNA according to an embodiment of the invention (enhanced saRNA) compared to non-modified saRNA (conventional saRNA) in HeLa cells
[0523] Experimental setup
[0524] This experiment aimed to characterize the kinetics of conventional saRNA and E-4S1 in HeLa cells after cellulose purification. This purification method is known to effectively reduce the immunogenicity of saRNA, by strongly reducing dsRNA products that are produced during in vitro transcription. Doublestranded RNA is recognized by endosomal TLR3 as foreign material, thus triggering a type I interferon response.
[0525] Finally, this experiment was essential to demonstrate that a cellulose-purified product behaves identical to a silica-purified product, since cellulose purification is preferential for in vivo testing, but so far only silica-based purification has been used.
[0526] To evaluate the kinetics, fresh saRNA was created one day in advance. The RNA was first purified with the usual silica-based technique, and subsequently purified with cellulose-based chromatography as described elsewhere (Baiersdbrfer et al., 2019). The regular silica-purified products that were used as a control have been used in earlier transfections.
[0527] Transfection, luminescence readout, and WST-1 assay were conducted as described earlier.
[0528] Primary outcomes were T(Vmax), T(Decline), Lumpeak, WSTl-viability at 24h and 48h, and cumulative protein production: AUC.
[0529] Results
[0530] Cellulose purification increased the luminescence for both conventional saRNA (FIG. 16A versus FIG. 15A) and E-4S1 (FIG. 16B versus FIG. 15B) in a similar way. During the majority of the 72 hour-period, the luminescence was 2.5-fold (conventional saRNA) or 2-fold (E-4S1) higher for the cellulose purified samples. These same ratios were also observed in the cumulative protein production over the 3-day period of cellulose-purified RNA (FIG. 17B), compared to silica-purified RNA (FIG. 17A).
[0531] However, the different purification method did not alter the kinetic profile for either saRNA type (Table 6, and FIG. 16). The observed maximum increase in luminescence and time of decline were identical for both methods and were consistent with previous observations.
[0532] The introduction of a polynucleotide having a sequence as set forth in SEQ. ID NO: 1 in the genomic 5' UTR of conventional saRNA upstream of nucleotide n=-4 increased both the cumulative protein production 2.2-fold (FIG. 17A), as well as the viability with about 13% (FIG. 18A). Remarkably, cellulose-purification of conventional saRNA resulted in a similar increase in both AUC and viability. Both effects were synergistic, and combining both, namely introducing a polynucleotide having a sequence as set forth in SEQ. ID NO: 1 upstream of nucleotide n=-4, and cellulose purification resulted in a 4.4-fold increase in AUC (FIG. 17B), and a 33% increase in viability compared to silica-purified conventional saRNA, resulting in almost 100% viability of E-4S1 transfected cells (FIG. 18B). This data also indicate that cellulose-purification alone was not sufficient to completely eliminate conventional saRNA-induced cytotoxicity. Contrastingly, E-4S1 allowed for almost complete restoration of cellular viability.
[0533] Table 6: T(Vmax), T(Decline), and Lumpeak for conventional saRNA, and E-4S1 with and without cellulose purification in HeLa cells Conventional saRNA: unmodified saRNA, and E-4S1: modified saRNA according to an embodiment of the invention
[0534] Example 7: Slower expression kinetics of a modified saRNA according to an embodiment of the invention (enhanced saRNA) depend on sequence length and not on sequence primary or secondary structure
[0535] Experimental setup To identify the necessary characteristics of the inserted polynucleotide, 4 additional sequences were designed. Some of their identifying properties are illustrated in Table 7.
[0536] Table 7: Characteristics of different polynucleotides. Nt.= nucleotides, AG(MFE) = Gibbs free energy of the minimum free energy RNA secondary structure, as predicted by Mfold v3.6, GC% = GC-content, Tm = melting temperature, as predicted by Primer3
[0537] The nucleic acid sequence of the polynucleotide insert SEQ 02 is reproduced below:
[0538] GGGCGTGATCCGAAAGGTGACCCGGATCACGGGCGTGATCCGAAAGGTGACCCTCGGATCGGGCGTGATCCGAA AGGTGACCCGGATCCACCGGTC (SEQ ID NO: 2)
[0539] The polynucleotide insert SEQ 02 consists of plbox C / D mini (underlined), a 7-nucleotide spacer (GGATCAC), a plbox C / D mini (underlined), a 7-nucleotide spacer (TCGGATC), a plbox C / D mini (underlined), and a 13-nucleotide spacer (GGATCCACCGGTC).
[0540] The nucleic acid sequence of the polynucleotide insert SEQ 03 is reproduced below:
[0541] AGGCGGGCGGATAAGGGGAGTTCCGGAGTCCCAGGCCCGGCGGGGAGAACTTGATCTCCACTACTC (SEQ ID NO: 3)
[0542] The polynucleotide insert SEQ 03 consists of the same bases used in SEQ 01, but the primary structure (i.e., their order) has been shuffled to abolish the secondary k-turn structure.
[0543] The nucleic acid sequence of the polynucleotide insert SEQ 04 is reproduced below:
[0544] CGGGCAGGTCAGATTCGCCGGAGCAACCATCCACGCGGTTGCGGGTCCTGCGCTGACCAACGGGTG (SEQ ID NO: 4)
[0545] The polynucleotide insert SEQ 04 consists of the same nucleotides as in the polynucleotide insert SEQ 01 but the primary structure (i.e. the order of nucleotides) was created by first specifying a target secondary structure, namely the one predicted for SEQ 01 by Nupack software algorithms, and then having the Nupack software determine which nucleotide composition is most likely to result in the specified secondary structure.
[0546] The nucleic acid sequence of the polynucleotide insert SEQ 05 is reproduced below:
[0547] GGGCGTGATCCGAAAGGTGACCCGGATCCACCGGTC (SEQ ID NO: 5)
[0548] The polynucleotide insert SEQ 05 consists of plbox C / D mini (underlined) and a 13-nucleotide spacer (GGATCCACCGGTC).
[0549] Transfection, and luminescence readout were conducted as described earlier. A transfection dose of 100 ng saRNA was used.
[0550] Primary outcomes were T(Vmax), T(Decline), Lumpeak, and cumulative protein production over 72 hours: AUC72
[0551] Results
[0552] The luminescence kinetics could be divided into three distinct groups. First, the insertion of SEQ 01 (FIG. 19B), SEQ 02 (FIG. 19C), SEQ 03 (FIG. 19D), and SEQ 04 (FIG. 19E) all demonstrated an identical kinetic profile, with T(Vmax) at 14-18 h after transfection, and T(Decline) at BOBS hours (Table 8). Contrastingly, the insertion of the shortest sequence (SEQ 05) almost completely abolished expression of the encoded transgene (Table 8, and FIG. 19F). It is possible that the PCR product to create E-4S5 contained an error, which resulted in dysfunctional saRNA. This may explain why a length of 36 nucleotides did not work, while a length of 24 nucleotides did work in subsequent examples (Example 14, FIG. 33).
[0553] These results indicate that the lower limit for the polynucleotide length is about 37 nucleotides or more, while the upper limit had not yet been reached. Additionally, these polynucleotides were designed to have different secondary structures with different thermodynamic stabilities. Given the fact that 4 / 5 sequences resulted in near-identical kinetic profiles, neither the presence of distinct secondary structures nor the thermodynamic stability of these structures, seems to be critical for the functionality of the enhanced saRNA.
[0554] Table 8: T(Vmax), T(Decline), Lumpeai<, and AUC72 for conventional saRNA (C-saRNA), E-4S1, E-4S2, E-4S3, E- 4S4, and E-4S5 in HeLa cells
[0555] C-saRNA: unmodified, conventional saRNA, E-4S5: comparative modified saRNA, and E-4S1, E-4S2, E-4S3, E-4S4: modified saRNA according to an embodiment of the invention (enhanced saRNA)
[0556] Example 8: Modified saRNA according to an embodiment of the invention (enhanced saRNA) does not slow down in vitro cell growth, while unmodified saRNA (conventional saRNA) does
[0557] Experimental setup
[0558] The goal of this experiment was to quantify the previously observed lower cell density in wells transfected with conventional saRNA, compared to E-4S1.
[0559] HeLa cells were seeded and transfected with 150 ng cellulose-purified conventional saRNA, E-4S1 with 0.3 pl Lipofectamine MessengerMax, or Lipofectamine alone, as described earlier. Luminescence data was obtained throughout the experiment to verify correct transfection. At four timepoints (0-24-48-72h with Oh = time of transfection), live cells were stained with Hoechst 33342 (nuclear stain), Calcein AM (living cells), and BOBO-3 (dead cells), as described above. Next, two distinct areas in each well were imaged in four channels: phase contrast, DAPI, FITC, and Cy3.
[0560] Collected images were analyzed in ImageJ (FIJI, (Schindelin et al., 2012)) as described above. Briefly, cells counted with Hoechst dye are all cells (both live and dead), while cells counted with BOBO3 dye have damaged cell membranes, indicating that they are either dead or dying. Thus, the number of alive cells was calculated by subtracting dead cells from the total cell number.
[0561] Results
[0562] The observed luminescence values verify good transfection, with similar kinetic profiles as observed previously (FIG. 20).
[0563] Normal HeLa cells in similar environmental conditions double in numbers about once every 20-24 hours (Posakony, England and Attardi, 1977). This means that the ratio of two cell counts, measured 24 hours apart, should equate to about 2 on average. Indeed, this ratio or fold-change was observed in cells transfected with only Lipofectamine (FIG. 21C) but also in cells transfected with E-4S1 (FIG. 21B). For both conditions, the growth rate seemed to slow down a bit after 48 hours, which is most likely caused by contact-inhibition due to overgrowth in the wells. Contrastingly, the growth rate for cells transfected with conventional saRNA seemed to halt completely during the first 24 hours (FIG. 21A). After 24 hours, replicate 1 demonstrated an increased growth rate, which stabilized again after 48 hours. For the second replicate, the initial delay was partly continued up to 48 hours, after which a similar increase in growth rate was observed (FIG. 21A).
[0564] Dead cell counts were expected to increase at a similar rate to total cell counts, i.e., doubling about every 24 hours. Due to overgrowth past 48 hours, this number was expected to increase faster after this timepoint. Indeed, these fold-changes were observed for positive control wells (FIG. 22C), as well as cell transfected with E-4S1 (FIG. 22B). Interestingly, wells transfected with conventional saRNA did not demonstrate an increased number in dead cells at the 24-hour point, despite the growth arrest (FIG. 22A). However, the number of dead cells increased faster than expected after that point until the end of the experiment.
[0565] Similarly, the percentage of viable cells remained steady for positive control wells, as well as cells transfected with E-4S1 (FIG. 23). Contrastingly, the percentage of viable cells after conventional saRNA transfection demonstrated a steady decline over time. Remarkably, the highest reduction in viable cells observed in this assay was 11%, while preceding WST-1 assays (Example 6) demonstrated a reduction in relative viability of 20%. A possible explanation lies in the fact that the current assay detects dead cells based on cell membrane defects, while the WST-1 assay quantifies metabolic activity (more specifically, the activity of the mitochondrial succinate-tetrazolium-reductase system (Merck KGaA, 2023)). It is therefore possible that cells with reduced viability, and thus a lower WST-1 metabolic activity, still have an intact cell membrane, thus excluding them from detection in the current assay.
[0566] Example 9: Formulation of unmodified saRNA (conventional saRNA) in lipid nanoparticles increases peak luminescence compared to modified saRNA according to an embodiment of the invention (enhanced saRNA) but does not alter V(max) or T(Decline)
[0567] Experimental setup
[0568] The goal of this experiment was twofold. First, it served to verify functionality of the freshly formulated lipid nanoparticles which were used in the in vivo experiment. Second, it refuted the hypothesis that the observed gradual kinetics of enhanced saRNA are significantly influenced by the Lipofectamine MessengerMax transfection reagent.
[0569] Briefly, saRNA was formulated in-house in lipid nanoparticles (LNPs). The LNPs had an N / P ratio of 10, and consisted of ALC-0315, DMG-PEG2K, DOPE, and cholesterol (see Materials and methods).
[0570] Cell seeding, medium change prior to transfection, and luminescence measurements were performed (every hour) as described above. Transfection was slightly different, however. In detail, a dose of 150 ng saRNA-LNPs in DPBS was diluted in a final volume of 50 pl OptiMEM. This is the same medium and the same volume as used for Lipofectamine MessengerMax. The lipid nanoparticles were then added to each well of a 24-well plate.
[0571] Forty-eight hours after transfection, a WST-1 assay was performed as described in Example 3.
[0572] Results
[0573] The use of lipid nanoparticles as a transfection reagent resulted in a pronounced increase in peak luminescence for conventional saRNA (FIG. 24A) but not E-4S1 (FIG. 24B, and Table9). This higher peak of conventional saRNA was also observed 1-2 hours earlier than with Lipofectamine MessengerMax. After the peak however, luminescence declined quickly. Similar to previous experiments using Lipofectamine MessengerMax, the maximum increase in luminescence was observed between 7 and 8 hours after transfection. Moreover, the higher peak luminescence was accompanied by a drastic reduction in cellular viability of over 50% (Table 9, and FIG. 25).
[0574] The kinetic profile of E-4S1 on the other hand was identical to what had been observed with Lipofectamine MessengerMax. In detail, the maximum increase in luminescence was observed 13-15 hours after transfection, while decline in luminescence started about 36 hours after transfection (FIG. 24B, and Table 9). In addition, the relative viability was close to 100% (Table 9, and FIG. 25). Table 9: T(Vmax), T(Decline), Lumpeai<, and relative viability for LNP-formulated conventional saRNA, and E-
[0575] 4S1 in HeLa-cells
[0576] Conventional saRNA: unmodified saRNA, and E-4S1: modified saRNA according to an embodiment of the invention
[0577] Example 10: In vivo luminescence kinetics reveals extended duration of expression of a modified saRNA according to an embodiment of the invention (enhanced saRNA)
[0578] Experimental setup
[0579] To evaluate the behaviour of conventional saRNA and E-4S1 in mice, a pilot experiment was set up in Balb / c mice.
[0580] Two groups of three male 9-week-old Balb / c mice each were injected with either conventional saRNA or E-4S1. The same cellulose-purified saRNA-LNPs of Example 9 were used. A dose of 1 pg saRNA was injected in the caudal thigh muscles. At indicated timepoints, mice received 200 pl D-Luciferin (PerkinElmer, 122799) in DPBS at a concentration of 15 mg / ml. Twelve minutes later, in vivo bioluminescence was quantified using an IVIS Lumina III (PerkinElmer). Bioluminescence was quantified as average radiance (p / s / cm2 / sr).
[0581] One mouse in the conventional saRNA-group was excluded from analysis after week sixteen.
[0582] Results
[0583] During the first week, the bioluminescent signal in the conventional saRNA-group (FIG. 26A) was on average 30.5-fold higher (FIG. 27) than the E-4S1 group (FIG. 26B). Between week 2 and week 4 however, the radiance for both groups converged to almost identical values, and both groups demonstrated a similar decline in luminescence. After week 4, the signal in the conventional saRNA-group continued this decline to reach background in all three mice between week 8 and week 13 (FIG. 26A).
[0584] Contrastingly, the radiance observed in two out of three mice that received E-4S1 reached a plateau that lasted from week 4 to week 16 after intramuscular injection (FIG. 26B). In one E-4S1 mouse however, the signal did not stabilize but instead continued to decline after week 4 at a similar rate as observed in the conventional saRNA-group (hence the broad range in FIG. 26B) This mouse reached background in week 7. On average, expression in the conventional saRNA-group lasted 9.7 weeks, while the duration in the E- 4S1 group lasted more than 5 weeks longer, namely 15 weeks (FIG. 28A). Remarkably, the signal persevered up to 21 weeks in one of these mice.
[0585] While the conventional saRNA-group demonstrated about 30.5-fold more radiance during the first week, the opposite is true for E-4S1 between week 7 and 17. In detail, the radiance in the group receiving E-4S1 was on average 31.3-fold higher during this 10-week period (FIG. 27). These differences can be further quantified by calculating the median radiance over the entire 22-week period, which is 11.6-fold higher in the E-4S1 group (FIG. 28B).
[0586] In summary, the kinetic profile of conventional saRNA and E-4S1 were analogous to the in vitro profiles. In both contexts, conventional saRNA is characterized by a fast and high protein expression, which wanes quickly. Contrastingly, E-4S1 demonstrates a much slower kinetic, which does not peak as high, but wanes much less quickly.
[0587] Example 11: Statistical analysis of in vitro kinetic parameters of modified saRNA according to an embodiment of the invention (enhanced saRNA) and unmodified saRNA (conventional saRNA)
[0588] As mentioned before, the different kinetics observed for conventional saRNA and enhanced saRNA, such as E-4S1, can be quantified by the time at which a the fastest increase in luminescence is observed (T(Vmax)), and by the time at which luminescence starts to decline significantly and irreversibly (T(Decline)). To evaluate statistical significance of the in vitro findings reported in previous examples, a paired two- tailed t-test (GraphPad Prism 8.4.3) was performed on both variables. Indeed, T(Vmax) of E-4S1 occurred on average 10 hours later (95%CI: 7.73-12.56), which is a very significant difference (p<0.0001) (FIG. 29A). Similarly, the decline of luminescence only occurred 23 hours later on average (95%CI: 18.04-28.25), which is again very significant (p<0.0001) (FIG. 29B).
[0589] Interestingly, these slower kinetics do not come at the cost of lower cumulative protein expression. Indeed, the cumulative protein expression is either not significantly different when measured over a two- day period (FIG. 30A), or even slightly higher when measured over a three-day period (FIG. 30B). Again, a paired two-tailed t-test was performed to evaluate the statistical significance of these variables. As expected, this revealed no statistical difference between both saRNA platforms in cumulative protein production over 48 hours. Contrastingly, the cumulative protein production over 72 hours was significantly higher (p=0.0228) for enhanced saRNA, compared to conventional saRNA. Example 12: In vivo luminescence kinetics confirms extended duration of expression of a modified saRNA according to an embodiment of the invention (enhanced saRNA)
[0590] Experimental setup
[0591] To evaluate the behaviour of conventional saRNA and an saRNA according to an embodiment of the invention comprising a different polynucleotide insert as compared to Example 10 in mice, an experiment was set up in Balb / c mice. The saRNA according to an embodiment of the invention, namely E-4S3 (Example 7) contains the polynucleotide insert having a sequence as represented by SEQ ID NO: 3 (Example 7, Table 7, Reference "SEQ 03"). The polynucleotide insert SEQ 03 consists of the same bases used in SEQ ID NO: 1, but the primary structure has been randomized to abolish the secondary structure. This sequence is thus random as compared to the sequence of the polynucleotide insert in E-4S1. Further, as compared to Example 10, a larger sample size (n = 12) was tested.
[0592] Two groups of twelve female 8-week-old Balb / c mice each were injected with either conventional saRNA or E-4S3. Identical saRNA-LNPs to those of Example 9 were used, however, without cellulose-purification. A dose of 1 pg saRNA was injected in the caudal thigh muscles. At indicated timepoints, mice received 200 pl D-Luciferin (PerkinElmer, 122799) in DPBS at a concentration of 15 mg / ml. Twelve minutes later, in vivo bioluminescence was quantified using an I VIS Lumina III (PerkinElmer). Bioluminescence was quantified as average radiance (p / s / cm2 / sr).
[0593] Results
[0594] The luminescence kinetics of the conventional saRNA (FIG. 31A) in this experiment were lower compared to the pilot experiment in Example 10. This conforms to our expectations, as the saRNA was not cellulose- purified. Similar to the observations in Example 10, the bioluminescent signal in the conventional saRNA- group was higher than E-4S3 (FIG. 31B) during the first two weeks. Between week 3 and week 5 however, the radiance for both groups converged to almost identical values, and both groups demonstrated a similar decline in luminescence. After week 5, the signal in the conventional saRNA-group continued this decline to reach background in all twelve mice between week 5 and week 6 (FIG. 31A).
[0595] Contrastingly, the radiance observed in the mice that received E-4S3 reached a plateau from week 4 and was maintained all the way until the end of the measurement at week 21.
[0596] The median duration of expression in the conventional saRNA-group was 5 weeks while the median duration in the E-4S3 group was 17 weeks.
[0597] While the conventional saRNA-group demonstrated about 27-fold more radiance during the first two weeks, the opposite was true for the entire period after week two. This results in a median radiance over the entire 22-week period that was 34.6-fold higher in the E-4S3 group than in the conventional saRNA- group (FIG. 32). In summary, the kinetic profile of conventional saRNA and saRNA illustrating the invention (E-4S3) were analogous to the in vitro profiles. In both contexts, conventional saRNA was characterized by a fast and high protein expression, which wanes quickly. Contrastingly, E-4S3 demonstrated a much slower kinetic, which did not peak as high, but waned much less quickly. Moreover, this experiment demonstrated that the in vivo findings were not limited to a single enhanced saRNA construct (E-4S1, Example 10) but could be repeated with a second enhanced saRNA construct (E-4S3).
[0598] Example 13: Evaluation of positional effect of polynucleotide insert in saRNA according to an embodiment of the invention comprising a different polynucleotide insert confirms the claimed positional range
[0599] The aim of this experiment was to establish proof that the positional effect of the polynucleotide insert applies to a further saRNA illustrating the invention comprising a polynucleotide insert having a sequence as represented by SEQ ID NO: 3 (Example 7, Table 7, Reference "SEQ 03").
[0600] Cloning and cell transfection were slightly different for this experiment. Differences are highlighted below.
[0601] Materials and methods
[0602] A. Cloning
[0603] Cloning started from the same plasmid as described earlier (Examples, Material and methods, RNA production process). Polynucleotides were inserted using NEBuilder HiFi DNA Assembly (NEB, E2621). First, a linearized vector was created with high-fidelity PCR (Q5 High-Fidelity 2X Master Mix, NEB, M0492) using two custom primers (IDT).
[0604] > Forward primer (5' -3'): ATGGAGAAAGTTCACGTTGA (SEQ ID NO: 27)
[0605] > Reverse primer (5' -3'): GTGAGTCGTATTAATTACCCTGT (SEQ ID NO: 28)
[0606] The PCR product was purified with a GeneJET PCR Purification Kit (ThermoFisher, K0701). Correct error- free amplification was then verified using both oxford nanopore technology sequencing and sanger sequencing of the extremities (EurofinsGenomics Linear Amplicon Sequencing and TubeSeq Supreme respectively). The purified PCR product was then mixed with a synthetic single-stranded DNA oligonucleotide (IDT Ultramer oligonucleotide) with the linearized vector at a 200:1 molar ratio of oligo:vector. The plasmids with a polynucleotide insertion of 150 and 210 nucleotides were created by first annealing two overlapping synthetic single-stranded DNA oligonucleotides, and then assembling the annealed oligonucleotides with the PCR product as described above. The incorporation of the oligonucleotide according to manufacturer's protocol re-circularized the vector and resulted in restoration of the genomic 5'UTR with simultaneous insertion of the polynucleotides at various positions. Transformation of 5-alpha Competent E. coli, subsequent plasmid purification, and sequencing were performed as described above. As mentioned, a unique oligonucleotide was used for each saRNA product. Each oligonucleotide consist of three components. The first is a universal upstream homology region and non-homologous spacer (underlined), reproduced below.
[0607] GGATAACAGGGTAATTAATACGACTCACTATA (SEQ ID NO: 29) This sequence is followed by a unique combined UTR sequence with a polynucleotide insert. The third component is a universal downstream homology region reproduced below.
[0608] ATGGAGAAAGTTCACGTTGACATCG (SEQ ID NO: 30).
[0609] The unique genomic 5'UTR sequences with polynucleotides (underlined) inserted are reproduced in Table 10. A control (conventional saRNA) was created in the same way by restoring the VEEV genomic 5'UTR without polynucleotide insert (SEQ ID NO: 100).
[0610] Table 10: Nucleic acid sequences of exemplary alphavirus genomic 5'UTR without (SEQ ID NO: 100) or with polynucleotide insert (underlined) as used in modified saRNAs in Example 13 (SEQ ID NO: 31-38), Example 14 (SEQ ID NO: 32, 39-93, 95, 97, 101-102), Example 15 (SEQ ID NO: 94-98), Example 16 (SEQ ID NO: 32 and 80-91) and Example 17 (SEQ ID NO: 32 and 99)
[0611]
[0612]
[0613]
[0614]
[0615]
[0616]
[0617] *Position of polynucleotide insert is the position immediately upstream of n
[0618] **MFE: minimum free energy; nt: nucleotide
[0619] Next, IVT template production and IVT reactions with subsequent purification and quality control were performed as described above.
[0620] B. Cell culture, transfection, and kinetic luminescence assay
[0621] HeLa cells were cultured as described earlier (Material and methods, Cell culture, transfection, and kinetic luminescence assay). Cells were seeded twenty-four hours prior to transfection in a 96 Well Black / Clear Bottom Plate, TC Surface (ThermoFisher, 165305).
[0622] Transfection of 25 ng saRNA per well was conducted with Lipofectamine MessengerMAX Transfection Reagent (Invitrogen, LMRNA003), according to manufacturer's protocol. A Lipofectamine:RNA ratio of 2 pl:pg was used for all transfections. Transfection mixtures were prepared in Opti-MEM™ Reduced Serum Medium, no phenol red (Gibco, 11058021), and were added to cells in DMEM, as described above. At least 30 minutes prior to transfection, all medium in the 96-well plates was removed and replaced by identical medium, supplemented with 150 pg / ml XenoLight D-Luciferin Potassium Salt (PerkinElmer, 122799). Conventional saRNA and enhanced saRNA products had <2% difference in length, so identical masses of RNA were considered equimolar.
[0623] Kinetic luminescence assays and WST-1 assays were performed as described earlier in Example 3.
[0624] Experimental setup
[0625] In this experiment, cells were transfected with conventional saRNA containing the VEEV genomic 5'UTR without insert (SEQ ID NO: 100) or an identical dose of enhanced saRNA containing the VEEV genomic 5'UTR with the polynucleotide insert of SEQ ID NO: 3 directly upstream of a nucleotide at position -3, - 4, -5, -10, -20, -30, -35, or -42. The genomic 5'UTR sequences with the polynucleotide insert directly upstream of a nucleotide at position -3, -4, -5, -10, -20, -30, -35, or -42 are reproduced in Table 10 as SEQ ID NO: 31 to 38.
[0626] Primary outcomes were: change in time-to-peak (TTP, i.e. the elapsed time between transfection and peak luminescence. The change is calculated as the TTP of a sample minus the TTP of conventional saRNA); viability relative to cells that received transfection reagent without RNA;
[0627] AUC until peak, i.e. the cumulative protein production from the time of transfection until peak luminescence has been reached. Expressed as a percentage relative to conventional saRNA.
[0628] Results
[0629] The results from this experiment correspond to the findings in Example 4, which evaluated insert SEQ ID
[0630] NO: 1 at position -15, -9, -4, or +1. Again, no significant effect on the luminescence kinetics or viability was observed at positions upstream of position -20, whereas insertion downstream of this position clearly altered luminescence kinetics and resulted in a significant increase in viability (Table 11).
[0631] Table 11: Change in TTP (hours), viability (%) and AUC until peak (%) in HeLa cells for conventional saRNA and saRNAs comprising the polynucleotide insert of SEQ ID NO: 3 directly upstream of the position -42, - 35, -30, -20, -10, -5, -4, or -3
[0632] These results show that the observed positional effect of Example 4 can be repeated with a different saRNAs illustrating the invention comprising the polynucleotide insert of SEQ ID NO: 3 at a position downstream of -20.
[0633] Example 14: Evaluating the effect of length, GC-content and stability of secondary structures of the polynucleotide inserts at positions -9, -4, and -1
[0634] Experimental setup
[0635] In this experiment, multiple saRNA constructs were evaluated with polynucleotide inserts with a length of 3, 4, 24, 45, 66, 87, 96, 150, and 210 nucleotides at different positions. The genomic 5'UTR sequences without or with a polynucleotide insert are reproduced in Table 10 as SEQ ID NO: 100 or SEQ ID NO: 32, 39 to 93, 95, 97, 101, and 102. FIG. 33 contains all these sequences. FIG 34 contains a subset of these sequences (as indicated below).
[0636] For lengths up to 96 nucleotides, the GC content of the inserts was varied between 33% and 67%. This results in a range in stability of minimum free energy secondary structure (MFE) of polynucleotide inserts per nucleotide between +0.0125 kcal.mo nt1and -0.4034 kcal. mol1. nt1. The polynucleotides up to 96 nucleotides were inserted at positions -9, -4, and -1. The inserts of 150 and 210 nucleotides were inserted at position -4. Methods were identical to those described in Example 13. Results
[0637] The results from this experiment provide additional insight into the correlation between the length of the polynucleotide, luminescence kinetics and viability. Short inserts with a length of 3 or 4 nucleotides did not result in a change in time-to-peak (TTP, FIG. 33A), nor an improvement in viability relative to conventional saRNA (FIG. 33B). Remarkably, all constructs with a minimum length of 24 nucleotides did result in a clear change in TTP and an improved viability. The data also illustrate that the upper limit of functional polynucleotide inserts has not yet been reached at 210 nucleotides.
[0638] This experiment also evaluated polynucleotide inserts at position -4 with a range in GC-content and stability of secondary structures (SEQ ID NO: 32, 55 to 68, 80 to 91, 93, 97, 101 and 102). There was no demonstrable correlation between GC-content and a change in TTP (FIG. 34A), nor viability (FIG. 34B). Similarly, the stability of the minimum free energy secondary structure did not correlate with either a change in TTP (FIG. 34C), nor viability (FIG. 34D).
[0639] Example 15: saRNA according to an embodiment of the invention comprising an EEEV genomic 5'UTR
[0640] Experimental setup
[0641] In this experiment, multiple saRNA constructs were evaluated with polynucleotide insert having a sequence represented by SEQ ID NO: 103 at positions directly upstream of -5, -4, -3, -1, and +1 in the genomic 5'UTR of EEEV having a sequence as represented by SEQ ID NO: 104 [derived from Eastern equine encephalitis virus, complete genome, NC_003899.1],
[0642] CATCTATGCACGGCTCAGGTGAATTGGTAGCGGGGATAGGGGTTTGAACAAAGCCATGACGGGAAA (SEQ ID NO: 103)
[0643] ATAGGGTACGGTGTAGAGGCAACCACCCTATTTCCACCTATCCAAA (SEQ ID NO: 104).
[0644] Methods were identical to those described in Example 13. The VEEV genomic 5'UTR sequence without (conventional saRNA) is reproduced in Table 10 as SEQ ID NO: 100. The EEEV genomic 5'UTR sequences with a polynucleotide insert are reproduced in Table 10 as SEQ ID NO: 94 to 98.
[0645] Results
[0646] Similar to previous observations, the insertions in all tested positions resulted in a significant change in TTP as well as a marked improvement in viability.
[0647] Table 12: Change in TTP (hours), viability (%) and AUC until peak (%) in HeLa cells for conventional saRNA and saRNAs comprising the polynucleotide insert of SEQ ID NO: 103 directly upstream of the position -5, -4, -3, -1, or +1 of the EEEV genomic 5'UTR
[0648] These results show that the saRNAs according to an embodiment of the invention are not limited to the VEEV genomic 5'UTR but also work using an EEEV genomic 5'UTR.
[0649] Example 16: The primary structure of the polynucleotide insert in saRNAs illustrating the invention may vary
[0650] Experimental setup
[0651] In this experiment, twelve random polynucleotide inserts were generated with a length of 66 nucleotides and a GC-content between 39% and 59%. These were inserted at position -4 of the genomic 5'UTR of VEEV and compared to conventional saRNA and an enhanced saRNA with a polynucleotide insert of SEQ ID NO:3 inserted at position -4 (SEQ ID NO:32), which has verified functionality. Methods were identical to those described in Example 13. The genomic 5'UTR sequences without (conventional saRNA) or with a polynucleotide insert are reproduced in Table 10 as SEQ ID NO: 100 and SEQ ID NO: 80 to 91.
[0652] Results
[0653] All random sequences resulted in an improved viability between 0.47 and 0.86, and a change in TTP between 19.5 hours and 24.5 hours. Exemplary results are provided in Table 13 below.
[0654] Table 13: GC-content (%), change in TTP (hours), viability (%) and AUC until peak (%) in HeLa cells for conventional saRNA and saRNAs comprising random sequence polynucleotide insert directly upstream of the position -4 of the VEEV genomic 5'UTR The results from this example established further proof that the effects of the saRNAs according to embodiments of the invention were obtained independently of the primary structure of the polynucleotide insert.
[0655] Example 17: A bipartite polynucleotide insert in saRNAs illustrating the invention is not significantly different from a singular polynucleotide insert
[0656] Experimental setup
[0657] In this experiment, a comparison was made between an enhanced saRNA with a singular polynucleotide insert, and an enhanced saRNA with a bipartite polynucleotide insert. The first construct contains an insert of 66 nucleotides at position -4 (SEQ ID NO: 32), whereas the second construct contains two nucleotide inserts (SEQ ID NO: 99), namely one of 20 nucleotides at position -8, and a second one of 42 nucleotides at position -4. Thus, a combined length of 62 nucleotides was inserted. Methods were identical to those described in Example 13. The results are shown in Table 14.
[0658] Table 14: Change in TTP (hours), viability (%) and AUC until peak (%) in HeLa cells for conventional saRNA, saRNAs comprising the VEEV genomic 5'UTR of SEQ ID NO: 32, or saRNAs comprising the VEEV genomic 5'UTR of SEQ ID NO: 99
[0659] The results demonstrate that having a singular polynucleotide insert is not a requirement for the functionality of an enhanced saRNA as taught herein.
Claims
CLAIMS1. A self-amplifying ribonucleic acid (saRNA) or trans-amplifying ribonucleic acid (taRNA) comprising: an alphavirus genomic 5' untranslated region (5'UTR) or mutant thereof; a nucleic acid sequence encoding alphavirus nonstructural proteins nsPl-4 or mutant thereof; an alphavirus sub-genomic promoter or mutant thereof; and (i) an open reading frame sequence encoding a protein of interest or (ii) a non-coding RNA of interest, wherein the alphavirus genomic 5' UTR or mutant thereof comprises one or more polynucleotide inserts downstream of a nucleotide at position -16, wherein the last nucleotide of the genomic 5' UTR is position -1, and wherein the combined length of the one or more polynucleotide inserts is at least 5 nucleotides.
2. The saRNA or taRNA according to claim 1, wherein the alphavirus is independently selected from the group consisting of a Venezuelan Equine Encephalitis Virus (VEEV), Eastern Equine Encephalitis Virus (EEEV), Semliki Forest Virus (SFV), or Sindbis Virus (SINV); preferably wherein the alphavirus is independently a VEEV or an EEEV.
3. The saRNA or taRNA according to claim 1 or 2, wherein the combined length of the one or more polynucleotide inserts is at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, at least 22 nucleotides, at least 23 nucleotides, at least 24 nucleotides, or at least 37 nucleotides.
4. The saRNA or taRNA according to any one of claims 1 to 3, wherein the genomic 5' UTR or mutant thereof is operably connected to the nucleic acid sequence encoding nonstructural proteins nsPl-4 or mutant thereof, and / or wherein the sub-genomic promoter or mutant thereof is operably connected to (i) the open reading frame sequence encoding a protein of interest or (ii) the non-coding RNA of interest.
5. The saRNA or taRNA according to any one of claims 1 to 4, wherein the genomic 5' UTR or mutant thereof comprises one polynucleotide insert, wherein the length of the polynucleotide insert is at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, at least 22 nucleotides, at least 23 nucleotides, at least 24 nucleotides, or at least 37 nucleotides, or wherein the genomic 5' UTR or mutant thereof comprises two, three or fourpolynucleotide inserts, wherein the combined length of the two, three, or four polynucleotide inserts is at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, at least 22 nucleotides, at least 23 nucleotides, at least 24 nucleotides, or at least 37 nucleotides.
6. The saRNA or taRNA according to any one of claims 1 to 4, wherein the genomic 5' UTR or mutant thereof comprises one or more polynucleotide inserts downstream of a nucleotide at position -11, downstream of a nucleotide at position -10, downstream of a nucleotide at position -6, or downstream of a nucleotide at position -5, preferably wherein the genomic 5' UTR or mutant thereof comprises one polynucleotide insert immediately downstream of a nucleotide at position -5.
7. The saRNA or taRNA according to any one of claims 1 to 6, wherein each polynucleotide insert of the two or more, such as two, three or four polynucleotide inserts has a sequence of at least 4 contiguous nucleotides.
8. The saRNA or taRNA according to any one of claims 1 to 7, wherein the genomic 5' UTR or mutant thereof comprises one polynucleotide insert having a length of 24 to 210 nucleotides; or wherein the genomic 5' UTR or mutant thereof comprises two, three or four polynucleotide inserts, wherein the combined length of the two, three, or four polynucleotide inserts is 24 to 210 nucleotides; preferably wherein the genomic 5' UTR or mutant thereof comprises one polynucleotide insert having length of 45 to 150 nucleotides; or wherein the genomic 5' UTR or mutant thereof comprises two, three or four polynucleotide inserts, wherein the combined length of the two, three, or four polynucleotide inserts is 45 to 150 nucleotides; more preferably wherein the genomic 5' UTR or mutant thereof comprises one polynucleotide insert having length of 66 to 126 nucleotides; or wherein the genomic 5' UTR or mutant thereof comprises two, three or four polynucleotide inserts, wherein the combined length of the two, three, or four polynucleotide inserts is 66 to 126 nucleotides.
9. A nucleic acid encoding for the saRNA or taRNA according to any one of claims 1 to 8.
10. A vector comprising the saRNA or taRNA according to any one of claims 1 to 8 or comprising the nucleic acid according to claim 9, a cell comprising the saRNA or taRNA according to any one of claims 1 to 8, or a cell comprising said vector.
11. A pharmaceutical composition comprising the saRNA or taRNA according to any one of claims 1 to 8, the nucleic acid according to claim 9, the vector according to claim 10, and / or the cell according to claim 10, and further comprising a pharmaceutically acceptable carrier.
12. The pharmaceutical composition according to claim 11, further comprising a delivery system; preferably wherein the delivery system comprises one or more of a lipid nanoparticle, a polymeric nanoparticle, an organic nanoparticle, an inorganic nanoparticle, such as a gold nanoparticle, a magnetic nanoparticle, a quantum dot, or a silica nanoparticle, a cationic lipid, a liposome, an extracellular vesicle, a cationic nano-emulsion, a cochleate, a virosome, an immune-stimulating complex, a microparticle, a microsphere, a nanosphere, a unilamellar vesicle, a multilamellar vesicle, an oil-in water emulsion, a water-in-oil emulsion, an emulsome, and a polycationic peptide.
13. The saRNA or taRNA according to any one of claims 1 to 8, the nucleic acid according to claim 9, the vector according to claim 10, the cell according to claim 10, or the pharmaceutical composition according to claim 11 or 12, for use in a method of producing a protein or a non-coding RNA in a subject.
14. The saRNA or taRNA according to any one of claims 1 to 8, the nucleic acid according to claim 9, the vector according to claim 10, the cell according to claim 10, or the pharmaceutical composition according to claim 11 or 12, for use as a medicament.
15. The saRNA or taRNA according to any one of claims 1 to 8, the nucleic acid according to claim 9, the vector according to claim 10, the cell according to claim 10, or the pharmaceutical composition according to claim 11 or 12, for use in a method of protein therapy, vaccination, stem cell reprogramming, induction of stem cells, induction of allergy tolerance, gene editing, gene modification, gene silencing, regulation of gene expression, immunotherapy, or cancer treatment in a subject, or for use in an in vivo diagnostic method in a subject.
16. The saRNA or taRNA, nucleic acid, vector, cell, or pharmaceutical composition for use according to any one of claims 13 to 15, wherein the method comprises administering the saRNA, taRNA, nucleic acid, vector, cell, or pharmaceutical composition to a subject, thereby producing the protein or noncoding RNA in the subject, optionally wherein the method comprises administering the saRNA, taRNA, nucleic acid, or vector to cells of the subject, thereby producing the protein or non-coding RNA in the subject, such as in cells of the subject.
17. Use of the saRNA or taRNA according to any one of claims 1 to 8, the nucleic acid according to claim 9, the vector or cell according to claim 10, for recombinant production of a protein of interest.
18. Use of the saRNA or taRNA according to any one of claims 1 to 8, the nucleic acid according to claim 9, or the vector according to claim 10, for in vitro or ex vivo modifying a host cell such as to produce a protein or RNA of interest by the host cell, optionally wherein the host cell is configured for autologous or allogeneic administration to a subject.
19. An in vitro diagnostic method comprising the use of the saRNA or taRNA according to any one of claims 1 to 8, the nucleic acid according to claim 9, the vector according to claim 10, the cell according to claim 10, or the pharmaceutical composition according to claim 11 or 12.
20. An in vitro method for identifying a saRNA or taRNA as an agent useful for producing a protein or a non-coding RNA of interest, wherein the saRNA or taRNA comprises: an alphavirus genomic 5' untranslated region (5'UTR) or mutant thereof; a nucleic acid sequence encoding alphavirus nonstructural proteins nsPl-4 or mutant thereof; an alphavirus sub-genomic promoter or mutant thereof; and (i) an open reading frame sequence encoding a protein of interest or (ii) a non-coding RNA of interest, wherein the alphavirus genomic 5'UTR or mutant thereof comprises one or more polynucleotide inserts, the method comprising: administering the saRNA or taRNA to cells, thereby producing the protein or non-coding RNA in the cells; measuring viability of the cells; measuring a metric for rate of expression of the protein or non-coding RNA in the cells; identifying the saRNA or taRNA as an agent useful for producing a protein or a non-coding RNA of interest when (i) the viability of the cells is higher than the viability of the cells being administered the same saRNA or taRNA but without polynucleotide inserts in the alphavirus genomic 5'UTR or mutant thereof, and (ii) the metric for the rate of expression of the protein or non-coding RNA indicates an equal or lower rate of expression than the same metric in cells being administered the same saRNA or taRNA but without polynucleotide inserts in the alphavirus genomic 5'UTR or mutant thereof.
Citation Information
Patent Citations
TC-83-derived alphavirus vectors, particles and methods
US20150299728A1
Venezuelan equine encephalitis virus replicons with adaptive mutations in the genome and uses thereof
US7332322B2
Recombinant alphavirus-based vectors with reduced inhibition of cellular macromolecular synthesis
WO1999018226A2
RNA-based regulatory technologies for mirna sensors
US20200040338A1
Formulation for administration of RNA
US20210023100A1