Modified immune cells with a genetic modulation

Modified immune cells with modulated genes or expressed mRNA, like CAR T-cells, address the limited efficacy of current CLL treatments by enhancing proliferation and effector functions, offering improved therapeutic options.

WO2025179029A1PCT designated stage Publication Date: 2025-08-28THE CLEVELAND CLINIC FOUND +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/016616
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-02-20
Filing Date
2025-02-20
Publication Date
2025-08-28

AI Technical Summary

Technical Problem

Current CAR T-cell therapies for chronic lymphocytic leukemia (CLL) achieve long-term curative responses in only about one-third of patients, highlighting the need to understand treatment failure causes and identify targets for therapy enhancement.

Method used

Modified immune cells, such as CAR T-cells, with modulated endogenous genes or expressed/expressed mRNA, including overexpression or underexpression of specific genes, or introduction of exogenous mRNA via expression vectors, are developed to enhance therapeutic efficacy.

Benefits of technology

The modified immune cells demonstrate improved proliferation and effector functions, potentially leading to enhanced treatment outcomes for CLL and other diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000009_0001
    Figure IMGF000009_0001
  • Figure IMGF000010_0001
    Figure IMGF000010_0001
  • Figure IMGF000013_0001
    Figure IMGF000013_0001
Patent Text Reader

Abstract

Provided herein are systems, kits, compositions, and methods for treating a subject with cancer or other disease with a CAR T-cell (or other immune cell) that has at least one endogenous gene that is modulated, and / or wherein mRNA from the gene is over-expressed or under-expressed, or that has exogenous mRNA that is expressed (e.g., expressed by an expression vector, or comprising modified bases). In certain embodiments, the endogenous gene, or mRNA therefrom, is inhibited or silenced and is selected from Table 2 (e.g., selected from PCNX1, PDCD10, MYC, ASXL1, RPTOR, BCAP31, ANKRD11, TCF3, IQCB1, CTLA4, ZZEF1, SRCAP, CARD8, DNMT1 and HSF2). In some embodiments, the endogenous gene, or mRNA therefrom, or mRNA in an expression vector, is over-expressed and is selected from Table 1 (e.g., NOSIP, FADD, RUNX1, AQR, ATE1, ATP9B, LSM2, CD3D, WNK1, EIF2B3, and TAL2).
Need to check novelty before this filing date? Find Prior Art

Description

[0001] MODIFIED IMMUNE CELLS WITH A GENETIC MODULATION

[0002] The present application claims priority to U.S. Provisional application serial number 63 / 555,704, filed February 20, 2024, and which is herein incorporated by reference in its entirety.

[0003] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0004] This invention was made with government support under CA241762 awarded by the National Institutes of Health. The government has certain rights in the invention.

[0005] SEQUENCE LISTING PARAGRAPH

[0006] The text of the computer readable sequence listing filed herewith, titled “CCF_42860_601_SequenceListing.xml”, created February 20, 2025, having a file size of 676,011 bytes, is hereby incorporated by reference in its entirety.

[0007] FIELD OF THE INVENTION

[0008] Provided herein are systems, kits, compositions, and methods for treating a subject with cancer or other disease with a modified immune cell (e.g., CAR T-cell) that has at least one endogenous gene that is modulated, and / or wherein mRNA from the gene is overexpressed or under-expressed, or that has exogenous mRNA that is expressed (e.g., expressed by an expression vector, or comprising modified bases). In certain embodiments, the endogenous gene, or mRNA therefrom, is inhibited or silenced and is selected from Table 2 (e.g., selected from PCNX1, PDCD10, MYC, ASXL1, RPTOR, BCAP31, ANKRD11, TCF3, IQCB1, CTLA4, ZZEF1, SRCAP, CARD8, DNMT1 and HSF2). In some embodiments, the endogenous gene, or mRNA therefrom, or mRNA in an expression vector, is over-expressed and is selected from Table 1 (e.g., NOSIP, FADD, RUNX1, AQR, ATE1, ATP9B, LSM2, CD3D, WNK1, EIF2B3, and TAL2).

[0009] BACKGROUND

[0010] Chronic lymphocytic leukemia (CLL) is the most prevalent adult leukemia in the United States, with 20,000 new cases annually. Despite numerous efforts, effective curative treatments remain elusive. Anti-CD19 Chimeric Antigen Receptor (CAR 19) T-cell therapy has revolutionized the treatment of relapsed and refractory B cell malignancies, inducing long-term and potentially curative responses. Yet, in CLL, only about one-third of patients achieve such outcomes. This underscores the urgent need to understand the underlying causes of treatment failure and identify potential targets to enhance therapy.

[0011] SUMMARY OF THE INVENTION

[0012] Provided herein are systems, kits, compositions, and methods for treating a subject with cancer or other disease with a modified immune cell (e.g., CAR T-cell) that has at least one endogenous gene that is modulated, and / or wherein mRNA from the gene is overexpressed or under-expressed, or that has exogenous mRNA that is expressed (e.g., expressed by an expression vector, or comprising modified bases). In certain embodiments, the endogenous gene, or mRNA therefrom, is inhibited or silenced and is selected from Table 2 (e.g., selected from PCNX1, PDCD10, MYC, ASXL1, RPTOR, BCAP31, ANKRD11, TCF3, IQCB1, CTLA4, ZZEF1, SRCAP, CARD8, DNMT1 and HSF2). In some embodiments, the endogenous gene, or mRNA therefrom, or mRNA in an expression vector, is over-expressed and is selected from Table 1 (e.g., NOSIP, FADD, RUNX1, AQR, ATE1, ATP9B, LSM2, CD3D, WNK1, EIF2B3, and TAL2).

[0013] In some embodiments, provided herein are compositions comprising a modified immune cell or precursor cell thereof, wherein at least one first endogenous gene in said modified immune cell or precursor thereof is over-expressed (e.g., causing over-expression of resulting protein that is expressed by the cell) compared to wild-type, and / or wherein first mRNA from said first endogenous gene is over-expressed compared to wild-type, wherein said first endogenous gene is selected from Table 1, and optionally, wherein said first endogenous gene is selected from: NOSIP, FADD, RUNX1, AQR, ATE1, ATP9B, LSM2, CD3D, WNK1, EIF2B3, and TAL2; and / or wherein at least one second endogenous gene in said modified immune cell or precursor thereof is disrupted and / or knocked out, and / or wherein second mRNA from said second endogenous gene is inhibited or silenced, wherein said second endogenous gene is selected from Table 2, and optionally, wherein said at least one endogenous gene is selected from: PCNX1, PDCD10, MYC, ASXL1, RPTOR, BCAP31, ANKRD11, TCF3, IQCB1, ZZEF1, SRCAP, CARD8, DNMT1, HSF2 and CTLA4; and / or wherein said modified immune cell, or precursor cell thereof, comprises: i) an expression vector expressing a third mRNA encoding a protein that is encoded by a gene selected from Table 1, and optionally a gene selected from: NOSIP, FADD, RUNX1, AQR, ATE1, ATP9B, LSM2, CD3D, WNK1, EIF2B3, and TAL2; and / or ii) a fourth mRNA comprising modified bases, wherein said fourth mRNA encodes said proteins of said third mRNA.

[0014] In particular embodiments, provided herein are compositions comprising a modified immune cell or precursor cell thereof, wherein optionally said modified immune cell is a CAR T-cell; wherein said modified immune cell or precursor thereof over-expresses a first protein compared to wild-type, and wherein said first protein is: NOSIP, FADD, RUNX1, AQR, ATE1, ATP9B, LSM2, CD3D, WNK1, EIF2B3, or TAL2, and wherein said first protein is endogenous to, or exogenous to, said modified immune cell or precursor thereof, and / or said modified immune cell or precursor thereof under-expresses, or does not express, a second protein compared to wild type, and wherein said second protein is: PCNX1, PDCD10, MYC, ASXL1, RPTOR, BCAP31, ANKRD11, TCF3, IQCB1, , ZZEF1, SRCAP, CARD8, DNMT1 , HSF2, or CTLA4.

[0015] In certain embodiments, the modified immune cell is present and is selected from: a CAR T-cell, a tumor-infiltrating lymphocyte (TIL), or a TCR-engineered T cell. In some embodiments, the expression vector comprises a plasmid or viral vector. In other embodiments, the modified bases are selected from 1 -methyl-pseudouridine, comprises 5- methylcytosine, or N1 -methylpseudouridine (ml'P). In certain embodiments, provided herein are methods of treating cancer or other disease comprising: administering the composition above (and herein) to a subject (e.g., intravenously), wherein the subject has cancer or another disease. In particular embodiments, the subject has acute lymphoblastic leukemia (ALL) or Chronic lymphocytic leukemia (CLL), and optionally the modified immune cell is a CAR T cell targeting CD19. In further embodiments, the subject is a human. In other embodiments, the immune cell is originally from the subject. In particular embodiments, the immune cell is originally from a donor.

[0016] In some embodiments, the modified immune cell comprises a modified T cell. In additional embodiments, the modified T cell is CAR T cell that comprises a chimeric antigen receptor (CAR). In additional embodiments, the chimeric antigen receptor comprises an antigen binding domain, a transmembrane domain, and an intracellular domain.

[0017] In certain embodiments, the antigen binding domain binds a tumor associated antigen (TAA). In additional embodiments, the TAA is expressed by cells on a solid tumor. In some embodiments, the TAA is CD19 or BCMA. In further embodiments, TAA is selected from: mesothelin, VEGFR-2, CD4, CD5, CD20, CD30, CD22, CD24, CD25, CD28, CD30, CD33, CD38, CD47, CD52, CD56, CD80, CD81, CD86, CD123, CD138, CD171, CD276, B7H4, CD 133, EGFR, GPC3; PMSA, CD3, CEACAM6, c-Met, EGFRvIII, ErbB2 / HER-2, ErbB3 / HER3, ErbB4 / HER-4, EphA2, EphlOA, IGF1R, GD2, O-acetyl GD2, O-acetyl GD3, GHRHR, GHR, FLT1, KDR, FLT4, CD44v6, CD151, CA125, CEA, CTLA-4, GITR, BTLA, TGFBR2, TGFBR1, IL6R, gpl3O, Lewis A, Lewis Y, NGFR, MCAM, TNFR1, TNFR2, PD1, PD-L1, PD-L2, HVEM, MAGE-A, NY-ESO-1, PSMA, RANK, R0R1 , ROR-2, TNFRSF4, CD40, CD137, TWEAK-R, LTPR, LIFRP, LRP5, MUC1, TCRa, TCRp, TLR7, TLR9, PTCHI, WT-1, Robol, a, Frizzled, 0X40, CD79b, and Notch- 1-4.

[0018] In certain embodiments, the at least one second endogenous gene is knocked out. In other embodiments, the at least one endogenous gene is disrupted. In particular embodiments, the second mRNA is inhibited. In further embodiments, the second mRNA is silenced.

[0019] In additional embodiments, the modified immune cell is a human cell. In further embodiments, the second endogenous gene has been disrupted and / or knocked out via a CRISPR / Cas system. In some embodiments, wherein the second endogenous gene has been disrupted and / or knocked out via a CRISPR / Cas9 system. In further embodiments, the CRISPR / Cas system comprises an sgRNA specific for at least one of the endogenous genes (e.g., as shown in Tables 3 and 4). In additional embodiments, the mRNA has been inhibited or silenced by siRNA, miRNA, or antisense nucleic acid sequences specific for the mRNA. In some embodiments, the compositions further comprise a Cas protein or a nucleic acid sequence encoding said Cas protein, wherein the Cas protein is optionally selected from: Cas9, Casl2, Casl3, Casl4 (for gene disruption or knockout) or a catalytically deactivated Cas9 (dCas9) fused with a trans activation domain (for gene over-expression).

[0020] In particular embodiments, the compositions further comprise: a buffer, saline solution, and / or water. In other embodiments, the compositions comprise a nucleic acid sequence specific for the second endogenous gene and / or the second mRNA selected from: sgRNA (e.g., as shown in Tables 3 and 4), antisense oligonucleotide, siRNA sequence, and a miRNA sequence. In additional embodiments, the nucleic acid sequence is present in an expression vector, which is optionally a plasmid or viral vector.

[0021] In particular embodiments, provided herein are kits and systems comprising: a) an immune cell or precursor thereof, and b) at least one of the following: i) a nucleic acid sequence specific for at least one endogenous gene and / or mRNA from the at least one endogenous gene, wherein the at least one endogenous gene selected from Table 2, and optionally selected from: PCNX1, PDCD10, MYC, ASXL1, RPTOR, BCAP31, ANKRD11, TCF3, IQCB1, ZZEF1, SRCAP, CARD8, DNMT1, HSF2 and CTLA4, and wherein the nucleic acid sequence is selected from: sgRNA (e.g., as shown in Tables 3 and 4), antisense oligonucleotide, siRNA sequence, and a miRNA sequence, and ii) an expression vector expressing a first mRNA encoding a protein that is encoded by a gene selected from Table 1, and optionally a gene selected from: NOSIP, FADD, RUNX1, AQR, ATE1, ATP9B, LSM2, CD3D, WNK1, EIF2B3, and TAL2; and / or iii) a delivery system comprising a second mRNA comprising modified bases, wherein said second mRNA encodes said proteins of said first mRNA, and wherein said delivery system is optionally a lipid nanoparticle.

[0022] In additional embodiments, the system or kit further comprises a Cas enzyme or a nucleic acid sequence encoding the Cas enzyme. In some embodiments, the systems and kits further comprise one or more containers for individually or collectively enclosing the recited components. In some embodiments, the kits and systems further comprise a syringe or IV bag and needle.

[0023] In some embodiments, provided herein are kits and systems comprising: a) an administration device, which is optionally a syringe or IV bag and needle, and b) the compositions described above or otherwise herein.

[0024] BRIEF DESCRIPTION OF THE FIGURES

[0025] Figure 1. After cloning, manufacturing and titrating the lentivirus containing the CAR and the CRISPR-library, T cells from healthy donors are transduced. The manufacture of the CAR-T cells follows a standardized laboratory procedure, where on day 3 the CAR-T cells are selected and electroporated (EP) or not with the Cas9 protein, which will be responsible for the gene knockouts. The culture then goes for a total of 13 days. After harvest, these cells (-Cas9 or +Cas9) were exposed to a cell line containing the antigen targeted by the CAR-T cells, the K562-CD19 artificial antigen presenting cell (aAPC), simulating the engagement of the CAR-T cells with their targets. After 3 rounds of 5-day interval stimulations, the cells are harvested. The genomic DNA of both manufacture and chronic-stimulated CAR-T cells is isolated and PCR is performed using primers which are specific for the library sequences, being all selected genes detectable during analysis. After ranking the genes which had a higher frequency of detection, we can therefore identify targets that, upon their knockout, will promote cell proliferation and effector function.

[0026] Figure 2. In vitro CRISPR-library screen with enriched and dropout genes.

[0027] Figure 3. Growth curves (a) and cumulative expansion (b) of CAR-T cells in the presence of individual gene knockouts.

[0028] Figure 4A. In vivo pipeline. Figure 4b. In vivo CRISPR-library screen with enriched and dropout genes.

[0029] Figures 5 A and 5B show the growth curves of one healthy donor’s CAR T-cells containing 44 total guide RNAs (from Table 3) to evaluate a potential increase in proliferation during manufacture when compared to the safe-harbor control (AAVS1). Only the ones with similar or higher population doublings compared to control are represented in these graphs. Overall, there was no significant difference in growth (p > 0.05). However, some positive trends were identified in some guides that we previously observed in our CRISPR screen, such as LSM4, PCNX1 and PDCD10 (previously validated in 2 other donors in vitro). Figure 5A shows results for the following guide RNAs: AAVS 1, LSM4, TGFBR2, PIP5K1A, PCNX1, and PDCD10. Figure 5B shows results for the following guide RNAs: AAVS1, NUP98, CARD8, and ZZEF1.

[0030] Figures 6A, 6B, 6C, and 6D show the growth curves of another healthy donor’s CAR T-cells containing the same 44 guide RNAs from Table 3. The goal of this experiment was to evaluate the donor-to-donor variability in cell proliferation patterns, as well as to compare the proliferation of the CAR T-cells containing single-knockouts with the safe harbor control (AAVS1). Similar to Figure 5, no significant difference in growth compared to AAVS1 (negative control). Higher trends in a few guides previously observed in CRISPR screen, such as: IQCB1 (in vivo screen), LSM4, HSF2, DNMT1 (in vitro screen), PCNX1 and PDCD10 were observed (p > 0.05). Figure 6A shows results for the following guide RNAs: AAVS1, LSM4, TFGBR2, PIPSK1A, FASLG, PCNX1, and PDCD10. Figure 6B shows results for the following guide RNAs: AAVS1, NPRL3, DNMT1, HSF2, and CARD8 Figure 6C shows results for the following guide RNAs: AAVS1 and IQCB 1. Figure 6D shows results for the following guide RNAs: AAVS1, SRCAP, and CTLA4.

[0031] Figure 7 shows our pipeline for manufacture of our single-edited CAR-T cells, as well as our in vitro repeated tumor stimulation assay. Briefly, T cells are isolated from peripheral blood mononuclear cells (PBMCs) and rested for 2 days at 37C and 5% CO2. After that, 2xl06cells are used for each individual knockout, where single-guide RNAs are electroporated with the Cas9-ribonucleoprotein (RNP) complex. The cells rest for 48 hours at 37C and 5% CO2 and later, they are activated with CD3 / CD28 beads and transduced with a humanized CAR19-BBz lentiviral vector. 3 days post-transduction the beads are removed from the media, and the cells grow for additional 7 days, when they are collected and viably frozen. For the repeated stimulation assay, the cells are thawed, rested for 16h and submitted to repeated tumor challenges every 3 days for a total of 9 days. At each time point, the cells are counted and the ratio of 1 CAR-T cell to 3 tumor cells is adjusted. At the end of the last time point, the cells are collected, viably frozen and RNA sequencing and phenotyping are performed to assess the gene profile and phenotype of the CAR-T cells.

[0032] Figure 8 shows proliferation (population doublings) of CAR-T cells manufactured from donor 9615 containing the shown single gene edits upon the restimulation assay experiment described above. This test was performed to test the ability of the CAR-T cells to proliferate and eliminate the tumor cells upon repeated challenges they are submitted to. The guides represented in Figure 8 did not perform better than safe harbor control (AAVS1). Figure 9 shows a set of CAR-T cells from the same healthy donor (9615) containing other single-gene knockouts tested for our repeated stimulation assay described above. The CAR-T cells containing these gene edits showed a strong proliferation trend compared to the safe harbor (AAVS1) control, unlike what we observed in Figure 8. Some examples were CARD8, IQCB1, MGA and NUP107, represented in Figure 9.

[0033] DEFINITIONS

[0034] The terms "individual," "host," "subject," and "patient" are used interchangeably herein, and generally refer to a mammal, including, but not limited to, primates, including simians and humans, equines (e.g., horses), canines (e.g., dogs), felines, various domesticated livestock (e.g., ungulates, such as swine, pigs, goats, sheep, and the like), as well as domesticated pets and animals maintained in zoos. In some embodiments, the subject is specifically a human subject.

[0035] DETAILED DESCRIPTION OF THE INVENTION

[0036] Provided herein are systems, kits, compositions, and methods for treating a subject with cancer or other disease with a modified immune cell (e.g., CAR T-cell) that has at least one endogenous gene that is modulated, and / or wherein mRNA from the gene is overexpressed or under-expressed, or that has exogenous mRNA that is expressed (e.g., expressed by an expression vector, or comprising modified bases). In certain embodiments, the endogenous gene, or mRNA therefrom, is inhibited or silenced and is selected from Table 2 (e.g., selected from PCNX1, PDCD10, MYC, ASXL1, RPTOR, BCAP31, ANKRD11, TCF3, IQCB1, CTLA4, ZZEF1, SRCAP, CARD8, DNMT1 and HSF2). In some embodiments, the endogenous gene, or mRNA therefrom, or mRNA in an expression vector, is over-expressed and is selected from Table 1 (e.g., NOSIP, FADD, RUNX1, AQR, ATE1, ATP9B, LSM2, CD3D, WNK1, EIF2B3, and TAL2).

[0037] Chronic lymphocytic leukemia (CLL) is the most prevalent adult leukemia in the United States, with 20,000 new cases annually. Despite numerous efforts, effective curative treatments remain elusive. Anti-CD19 Chimeric Antigen Receptor (CAR 19) T-cell therapy has revolutionized the treatment of relapsed and refractory B cell malignancies, inducing long-term and potentially curative responses. Yet, in CLL, only about one-third of patients achieve such outcomes. This underscores the urgent need to understand the underlying causes of treatment failure and identify potential targets to enhance therapy. In work conducted during development of embodiments of the present disclosure, a large study was conducted, examining lentiviral vector integration sites (LVIS) in 40 patients with ALL and CLL treated with CAR19 T-cells. This and other studies revealed a correlation between vector integration and therapeutic outcomes, hinting at the potential influence of gene mutagenesis. It was therefore hypothesized that LVIS-mediated gene disruptions modify CAR T-cells' growth kinetics and anti-tumor efficacy. To test this, as described in Example 1 below, we focused on the top 20 LVIS associated with the a) highest expansion in the first 28 days, b) long-term persistence, c) early loss post-infusion, and d) genes with the most integration sites across all subjects. We designed 818 guide RNAs targeting 180 genes, including controls, and cloned them into a vector carrying the anti-CD19 CAR. T-cells from two donors were transduced and electroporated with Cas9 protein for gene disruption, then expanded and stimulated iteratively with CD19-expressing artificial antigen presenting cells to simulate repeated CAR T-cell engagement with their target. Importantly, genes enriched in patients with complete response were also identified in our screenings, suggesting a proliferative advantage. Further validation in an established PDX model showed consistent enrichment of these gene disruptions upon repeat stimulations. Examples of genes that were identified, which are targets for modulation in immune cells (e.g., CAR T cells) include: PCNX1, PDCD10, TP53, TLX3, HSF2, TLX4, NOSIP, FADD, ATP9B, WNK1, RUNX1, TALI, TCF3, ANKRD11, ZZEF1, SRCAP, CARD8, DNMT1, and IQCB1, as well as those in Tables 1 and 2. In this regard, modified immune cells, such as modified CAR T cells can be generated with improved proliferation and / or effector functions. Further, in certain embodiments, given the important role of memory T cells in determining CAR T cell function and broader T cell responses, whether driven by intrinsic tumor specificity or conferred through gene engineering, at least some of the modifications to the immune cells herein may similarly enhance such tumor- specific T cell responses.

[0038] In some embodiments, genes that are normally under-expressed are targeted for increased or over-expression in order to generate modified immune cells, such as CAR-T cells. Such genes include, for example, those listed in Table 1 below:

[0039] TABLE 1

[0040]

[0041] For overexpression, in certain embodiments, one can utilize the CRISPR activation system (CRISPRa), wherein engineered guide RNAs and catalytically dead Cas proteins are employed to upregulate a target gene’s expression level. This system does not directly modify the DNA sequence itself, but rather stimulates the transcriptional machinery to increase the production of mRNA from the target gene. The effects of CRISPRa can also be transient, allowing for temporal control over gene expression. This reversibility and tunability offer additional safety benefits by enabling precise modulation of gene expression levels without permanent changes to the genome.

[0042] In other embodiments, the modified immune cell (or precursor thereof) comprises at least one expression vector (e.g., plasmid or virus) that allows expression (e.g., overexpression) of mRNA (and therefore protein) of one or more of the genes in table 1. In some embodiments, the modified immune cell (or precursor thereof) comprises mRNA (e.g., IVT mRNA) that comprises modified bases, wherein the mRNA encodes the same proteins as in the expression vector (i.e., the proteins from the genes in Table 1). In particular embodiments, the modified immune cell (or precursor thereof) are contacted with the expression vector and / or a delivery system (e.g., lipid nanoparticle) that contains modified mRNA. In particular embodiments, the delivery vehicle comprises a lipid nanoparticle encapsulating the modified mRNA. In further embodiments, the lipid nanoparticle comprises a cationic lipid, a neutral and / or non-cationic lipid, a sterol, or any combination thereof. In some embodiments, the non-cationic lipid comprises a phospholipid. In certain embodiments, the sterol comprises cholesterol or a modification or ester thereof. In particular embodiments, the lipid nanoparticle comprises a polyethylene glycol (PEG)-lipid conjugate.

[0043] In certain embodiments, the modified mRNA (which chemically modified bases) has at least 5% ... 10% ... 35% ... 55% ... 75% ... 90% .... 95% .... or 100% chemically modified bases. The chemical modifications may comprise any modification which is not naturally present in said RNA or any naturally-occurring modification of adenosine (A), guanosine (G), uridine (U), or cytidine (C) ribonucleosides. For example, a single polynucleotide or mRNA may include both naturally-occurring and non-naturally-occurring modifications. Chemical modifications may be located in any portion of the polynucleotide or mRNA molecule and the polynucleotide or mRNA molecule may contain any percentage of modified nucleosides (1-100%, such as at least 20% ... at least 40% ... or at least 60%). In some embodiments, every particular base or nucleoside may be modified (e.g., every uridine is a modified uridine). In some embodiments, at least 20%, or 50%, or 80% of any single nucleotide (e.g., uracil) in the of the polynucleotide or mRNA is chemically modified. In some embodiments, a particular modification is used for every particular type of nucleoside or base (e.g., every uridine is modified to a 1-methyl-pseudouridine). Exemplary RNA modifications can be found in the RNA modification database (See, mods(dot)ma(dot)albany(dot)edu / home).

[0044] In some embodiments, the at least one chemical modification comprises a modified uridine residue. Exemplary modified uridine residues include, but are not limited to, pseudouridine, 1 -methylpseudouridine, 1 -ethylpseudouridine, 2-thiouridine, 4'- thiouridine,

[0045] 5-methyluridine, 2-thio-l -methyl- 1 -deaza-pseudouridine, 2- thio-l-methyl-pseudouridine, 2- thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio- dihydrouridine, 2-thio- pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy- pseudouridine, 4-thio-l-methyl- pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine and 2'-0-methyl uridine.

[0046] In some embodiments, the at least one chemical modification comprises a modified cytosine residue. Exemplary nucleosides having a modified cytosine include 5 -aza-cytidine,

[0047] 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5-methyl-cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1-methyl- pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2- thio-cytidine, 2-thio-5- methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio- 1 -methyl-pseudoisocytidine, 4-thio-l- methyl- 1 -deaza-pseudoisocytidine, 1 -methyl- 1-deaza-pseudoisocytidine, zebularine, 5-aza- zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy- cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-l -methyl - pseudoisocytidine, lysidine, a-thio-cytidine, 2'-O-methyl-cytidine, 5,2'-O-dimethyl-cytidine, N4-acetyl-2'-O-methyl-cytidine, N4,2'-O-dimethyl-cytidine, 5-formyl-2'-O-methyl-cytidine, N4,N4,2'-O-trimethyl-cytidine, 1 -thio-cytidine, 2'-F-aracytidine, 2'-F-cytidine, and 2'-OH- aracytidine.

[0048] In some embodiments, the at least one chemical modification comprises a modified adenine residue. Exemplary nucleosides having a modified adenine include 2-amino-purine, 2,6-diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azido- adenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza- 2-amino-purine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyl- adenosine, 2-methyl-adenine, N6-methyl-adenosine, 2-methylthio-N6-methyl-adenosine, N6- isopentenyl-adenosine, 2-methylthio-N6-isopentenyl-adenosine, N6-(cis- hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6- glycinylcarbamoyl-adenosine, N6-threonylcarbamoyl-adenosine, N6-methyl-N6- threonylcarbamoyl-adenosine, 2-methylthio-N6-threonylcarbamoyl-adenosine, N6,N6- dimethyl-adenosine, N6-hydroxynoryalylcarbamoyl-adenosine, 2-methylthio-N6- hydroxynoryalylcarbamoyl-adenosine, N6-acetyl-adenosine, 7-methyl-adenine, 2-methylthio- adenine, 2-methoxy-adenine, a-thio-adenosine, 2'-O-methyl-adenosine, N6,2'-O-dimethyl- adenosine, N6,N6,2'-O-trimethyl-adenosine, l,2'-O-dimethyl-adenosine, 2'-O- ribosyladenosine (phosphate), 2-amino-N6-methyl-purine, 1 -thio-adenosine, 8-azido- adenosine, 2'-F-ara-adenosine, 2'-F-adenosine, 2'-OH-ara-adenosine, and N6-(19-amino- pentaoxanonadecyl)-adenosine.

[0049] In some embodiments, the at least one chemical modification comprises a modified guanine residue. Exemplary nucleosides having a modified guanine include inosine, 1 - methyl-inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxy wybutosine, hydroxywybutosine, undermodified hydroxywybutosine, 7-deaza- guanosine, queuosine, epoxy queuosine, galactosyl-queuosine, mannosyl-queuosine, 7-cyano- 7-deaza- guanosine, 7-aminomethyl-7-deaza- guanosine, archaeosine, 7-deaza-8-aza- guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7- methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1- methyl-guanosine, N2-methyl-guanosine, N2,N2-dimethyl-guanosine, N2,7-dimethyl- guanosine, N2,N2,7-dimethyl-guanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1- methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, a- thio-guanosine, 2'-O-methyl-guanosine, N2-methyl-2'-O-methyl-guanosine, N2,N2-dimethyl- 2'-O-methyl-guanosine, l-methyl-2'-O-methyl-guanosine, N2,7-dimethyl-2'-O-methyl- guanosine, 2'-O-methyl-inosine, l,2'-O-dimethyl-inosine, and 2'-O-ribosylguanosine (phosphate).

[0050] In some embodiments, genes that are over-expressed are targeted for knock out or disruption (to decrease or eliminate expression) in order to generate modified immune cells, such as CAR-T cells. Such genes include, for example, those listed in Table 2 below:

[0051] TABLE 2 The modified immune cells (e.g., CAR-T cells) herein may be engineered to target a tumor antigen of interest by way of engineering a desired antigen binding moiety that specifically binds to an antigen on a tumor cell. As used herein, a “tumor antigen” or “hyperproliferative disorder antigen” or “antigen associated with a hyperproliferative disorder” or “cancer antigen,” refers to antigens that are common to specific hyperproliferative disorders such as cancer. Exemplary antigens mentioned herein are included by way of example. Tumor antigens are proteins that are produced by tumor cells that elicit an immune response, particularly T-cell mediated immune responses. Thus, an antigen binding moiety can be selected based on the particular type of cancer to be treated by the modified immune cells (e.g., modified CAR T cells) herein.

[0052] Tumor antigens are well known in the art and include, for example, a glioma- associated antigen, carcinoembryonic antigen (CEA), beta-human chorionic gonadotropin, alphafetoprotein (AFP), lectin-reactive AFP, thyroglobulin, RAGE-1, MN-CA IX, human telomerase reverse transcriptase, RU1, RU2 (AS), intestinal carboxyl esterase, mut hsp70-2, M-CSF, prostate-specific antigen (PSA), PAP, NY-ESO-1, LAGE-la, p53, prostein, PSMA, Her2 / neu, survivin and telomerase, prostate-carcinoma tumor antigen- 1 (PCTA-1), MAGE, ELF2M, neutrophil elastase, ephrinB2, CD22, insulin growth factor (IGF)-I, IGF-II, IGF-I receptor and mesothelin.

[0053] A tumor antigen may comprise one or more antigenic cancer antigens / epitopes associated with a malignant tumor. Malignant tumors express a number of proteins that can serve as target antigens for an immune attack. These molecules include but are not limited to tissue-specific antigens such as MART-1, tyrosinase and GP100 in melanoma and prostatic acid phosphatase (PAP) and prostate-specific antigen (PSA) in prostate cancer. Other target molecules belong to the group of transformation-related molecules such as the oncogene HER-2 / Neu / ErbB-2. Still another group of target antigens are onco-fetal antigens such as carcinoembryonic antigen (CEA). In B-cell lymphoma the tumor- specific idiotype immunoglobulin constitutes a truly tumor-specific immunoglobulin antigen that is unique to the individual tumor. B-cell differentiation antigens such as CD19, CD20 and CD37 are other candidates for target antigens in B-cell lymphoma.

[0054] The tumor antigen may also be a tumor-specific antigen (TSA) or a tumor-associated antigen (TAA). A TSA is unique to tumor cells and does not occur on other cells in the body. A TAA is not unique to a tumor cell and instead is also expressed on some normal cells under conditions that fail to induce a state of immunologic tolerance to the antigen. The expression of the antigen on the tumor may occur under conditions that enable the immune system to respond to the antigen. TA As may be antigens that are expressed on normal cells during fetal development when the immune system is immature and unable to respond or they may be antigens that are normally present at extremely low levels on normal cells but which are expressed at much higher levels on tumor cells. Examples of TSA or TAA include, but are not limited to, differentiation antigens such as MART-l / MelanA (MART-1), g lOO (Pmel 17), tyrosinase, TRP-1, TRP-2 and tumor-specific multilineage antigens such as MAGE-1, MAGE-3, BAGE, GAGE-1, GAGE-2, pl5; overexpressed embryonic antigens such as CEA; overexpressed oncogenes and mutated tumor- suppressor genes such as p53, Ras, HER-2 / neu; unique tumor antigens resulting from chromosomal translocations; such as BCR-ABL, E2A- PRL, H4-RET, IGH-IGK, MYL-RAR; and viral antigens, such as the Epstein Barr virus antigens EBVA and the human papillomavirus (HPV) antigens E6 and E7. Other large, protein-based antigens include TSP-180, MAGE-4, MAGE-5, MAGE-6, RAGE, NY-ESO-1, pl85erbB2, pl80erbB-3, c-met, nm-23Hl, PSA, TAG-72, CA 19-9, CA 72-4, CAM 17.1, NuMa, K-ras, beta-Catenin, CDK4, Mum-1, p 15, p 16, 43-9F, 5T4, 791Tgp72, alphafetoprotein, beta-HCG, BCA225, BTAA, CA 125, CA 15-3\CA 27.291\BCAA, CA 195, CA 242, CA-50, CAM43, CD68\P1, CO-029, FGF-5, G250, Ga733\EpCAM, HTgp-175, M344, MA-50, MG7-Ag, M0V18, NB / 70K, NY-CO-1, RCAS1, SDCCAG16, TA-90\Mac-2 binding protein\cyclophilin C-associated protein, TAAL6, TAG72, TLP, and TPS.

[0055] The present disclosure is not limited by the type of gene editing system employed to generate the modified immune cells (e.g., CAR T cells) herein. Various gene editing technologies are known to those skilled in the art. Gene editing technologies include, without limitation, homing endonucleases, zinc-finger nucleases (ZFNs), transcription activator-like effector (TALE) nucleases (TALENs), and clustered regularly interspaced short palindromic repeats (CRISPR) (e.g. CRISPR / Cas9). Homing endonucleases generally cleave their DNA substrates as dimers, and do not have distinct binding and cleavage domains. ZFNs recognize target sites that consist of two zinc-finger binding sites that flank a 5- to 7-base pair (bp) spacer sequence recognized by the FokI cleavage domain. TALENs recognize target sites that consist of two TALE DNA-binding sites that flank a 12- to 20-bp spacer sequence recognized by the FokI cleavage domain. The Cas9 nuclease is targeted to DNA sequences complementary to the targeting sequence within the single guide RNA (gRNA) located immediately upstream of a compatible protospacer adjacent motif (PAM). Accordingly, one of skill in the art would be able to select the appropriate gene editing technology for the present invention.

[0056] In some embodiments, the present disclosure provides a modified immune cell comprising a CRISPR-mediated modification in an endogenous gene (as described herein) that is capable of downregulating gene expression of endogenous protein expression from the endogenous gene. In certain embodiments, the CRISPR-mediated modification is introduced via a CRISPR / Cas9 system, comprising a Cas9 enzyme and at least one guide RNA (gRNA) (see, e.g., Tables 3 and 4). In certain embodiments, the guide RNA comprises a guide sequence that is sufficiently complementary with a target sequence in the endogenous gene.

[0057] Other non-limiting examples of a CRISPR / Cas system used to inhibit gene expression are CRISPRa and CRISPRi, which is described in U.S. Patent Appl. Publ. No. US20140068797, which is herein incorporated by reference in its entirety. CRISPRi induces permanent gene disruption that utilizes the RNA-guided Cas9 endonuclease to introduce DNA double stranded breaks which trigger error-prone repair pathways to result in frame shift mutations. A catalytically dead Cas9 lacks endonuclease activity. When coexpressed with a guide RNA, a DNA recognition complex is generated that specifically interferes with transcriptional elongation, RNA polymerase binding, or transcription factor binding. This CRISPRi system efficiently represses expression of targeted genes.

[0058] TABLE 3 - Exemplary gRNAs

[0059] DNMT1 gRNAl: ACGGTGCTCATGCTTACAAC (SEQ ID NO:719) DNMT1 gRNA2: CTTGATGGACTCATCCGATT (SEQ ID NO:720)

[0060] KMT2A gRNAl: GGTCTCCCACGAGGTTTTCG (SEQ ID NO:721) KMT2A gRNA2: GTACAAATTGTACGACGGAG (SEQ ID NO:722)

[0061] PIP5K1A gRNAl: AGGCTCAACCTACAAACGGC (SEQ ID NO:723) PIP5K1A gRNA2: CGTCGCTGGACACATAGAAT (SEQ ID NO:724)

[0062] NPRL3 gRNAl: GAACTACGCCCGACGTGCAC (SEQ ID NO:725) NPRL3 gRNA2: CAGCACGGTGGCGATACGAC (SEQ ID NO:726)

[0063] NUP107 gRNAl: CAACAAGCCGAAGCTTACTA (SEQ ID NO:727) NUP107 gRNA2: ACCCTGAAGACTGCGTAAGT (SEQ ID NO:728)

[0064] WDR82 gRNAl: CGCGGAACACCTTAGCGACG (SEQ ID NO:729) WDR82 gRNA2: CTGCATGAGTGTATCTGATG (SEQ ID NO:730)

[0065] MGA gRNAl: GACCATTCCACTTATAACGA (SEQ ID NO:731)

[0066] MGA gRNA2: GCACCAAATGAAGCCTCGGC (SEQ ID NO:732)

[0067] TGFBR2 gRNAl: CCCACCGCACGTTCAGAAGT (SEQ ID NO:733) TGFBR2 gRNA2: CGGCAAGACGCGGAAGCTCA (SEQ ID NO:734)

[0068] LYL1 gRNAl: AGGCTGATCACTGGTACACC (SEQ ID NO:735) LYL1 gRNA2: GGGCCCCACCATGACTGAGA (SEQ ID NO:736)

[0069] LSM4 gRNAl : GACCATGTCGATGATCTCGT (SEQ ID NO:737)

[0070] LSM4 gRNA2: GGAGACGTACAATGGACACC (SEQ ID NO:738)

[0071] SRCAP gRNAl: GCGTCGAATTGCTTCCACCA (SEQ ID NO:739) SRCAP gRNA2: GGGCCACACCCCGTTTCCAA (SEQ ID NO:740)

[0072] RAP1GDS1 gRNAl: AAGTGCTGCTTCAAACGGGC (SEQ ID NO:741) RAP1GDS1 gRNA2: CCCAGTAATTTCACTAAGGT (SEQ ID NO:742) CARD8 gRNAl: GTCACAGTGACGATTGCGTT (SEQ ID NO:743)

[0073] CARD8 gRNA2: GTTCCTGAGTGTCAACTATC (SEQ ID NO:744)

[0074] ZZEF1 gRNAl: CTTGTCAATGTCTGCCGAGT (SEQ ID NO:745)

[0075] ZZEF1 gRNA2: CCACATCATCAGACAACTAC (SEQ ID NO:746)

[0076] UBE2J2 gRNAl: CGGATTTCCACCCGGACACG (SEQ ID NO:747)

[0077] UBE2J2 gRNA2: ATATGATCACTCCCAACGGG (SEQ ID NO:748)

[0078] NUP98 gRNAl: TTTGGGTTTGGTACGTCAAC (SEQ ID NO: 749)

[0079] NUP98 gRNA2: GAGTCCTCCACTGCTAGTAC (SEQ ID NQ:750)

[0080] HSF2 gRNAl: GGTGATGAACTCGTTAGTGT (SEQ ID NO:751)

[0081] HSF2 gRNA2: AAAGTAGTACATATCGACTC (SEQ ID NO:752)

[0082] CTLA4 gRNAl: GTGCGGCAACCTACATGATG (SEQ ID NO:753)

[0083] CTLA4 gRNA2: GATGTAGAGTCCCGTGTCCA (SEQ ID NO:754)

[0084] FASLG gRNAl: ACCCATATCCCCAGATCTAC (SEQ ID NO:755)

[0085] FASLG gRNA2: CTGGTTGCCTTGGTAGGATT (SEQ ID NO:756)

[0086] TALI gRNAl: GAAGATACGCCGCACAACTT (SEQ ID NO:757)

[0087] TALI gRNA2: CGATTGTTGGTGGTGAACAT (SEQ ID NO:758)

[0088] IQCB1 gRNAl: TCAAGATTATTCTCGAATCC (SEQ ID NO:759)

[0089] IQCB1 gRNA2: CAGACGTCTACTAAGTAAAC (SEQ ID NO:760)

[0090] RHOA gRNAl: TATAACATCGGTATCTGGGT (SEQ ID NO:761)

[0091] RHOA gRNA2: AATCACCAGTTTCTTCCGGA (SEQ ID NO:762)

[0092] PCNX1 gRNAl: CTGGTACTACGACCCGCACC (SEQ ID NO:763)

[0093] PCNX1 gRNA2: GAAGTCCGTGGTACACCTCG (SEQ ID NO:764)

[0094] PDCD10 gRNAl: CACGGAGTCCCTTCTTCGTA (SEQ ID NO:765)

[0095] PDCD10 gRNA2: GTGCTCGTGCCTTTTCGTTT (SEQ ID NO:766)

[0096] TABLE 4 - Exemplary gRNAs

[0097] The modified immune cells herein may be included as part of a pharmaceutical composition and further include a pharmaceutically acceptable carrier. A therapeutically effective amount of the pharmaceutical composition comprising the modified immune cells herein may be administered to a subject (e.g., a human). In certain embodiments, adoptive cell transfer therapy is employed comprising administering to a subject in need thereof a modified immune cell or precursor cell thereof (e.g. CAR T cell) as disclosed herein.

[0098] Methods for administration of immune cells for adoptive cell therapy are known and may be used in connection with the methods, compositions, and systems herein. For example, adoptive T cell therapy methods are described, e.g., in US Patent Application Publication No. 2003 / 0170238 to Gruenberg et al; US Patent No. 4,690,915 to Rosenberg; Rosenberg (2011) Nat Rev Clin Oncol. 8( 10):577-85). Themeli et al. (2013) Nat Biotechnol. 31(10): 928-933; Tsukahara et al. (2013) Biochem Biophys Res Commun 438(1): 84-9; Davila et al. (2013) PLoS ONE 8(4): e61338, all of which are herein incorporated by reference in their entirities. In some embodiments, the cell therapy, (e.g., adoptive T cell therapy) is carried out by autologous transfer, in which the immune cells are isolated and / or otherwise prepared from the subject who is to receive the cell therapy, or from a sample derived from such a subject. Thus, in some aspects, the immune cells are derived from a subject (e.g., patient, in need of a treatment and the cells) following isolation and processing are administered to the same subject.

[0099] In some embodiments, the cell therapy, (e.g., adoptive T cell therapy) is carried out by allogeneic transfer, in which the cells are isolated and / or otherwise prepared from a subject other than a subject who is to receive or who ultimately receives the cell therapy (e.g., a first subject). In such embodiments, the cells then are administered to a different subject (e.g., a second subject) of the same species. In some embodiments, the first and second subjects are genetically identical. In some embodiments, the first and second subjects are genetically similar. In some embodiments, the second subject expresses the same HLA class or supertype as the first subject.

[0100] In some embodiments, the subject herein has been treated with a therapeutic agent targeting the disease or condition (e.g. the tumor) prior to administration of the immune cells herein. In some embodiments, the subject is refractory or non-responsive to the other therapeutic agent. In some embodiments, the subject has persistent or relapsed disease, e.g., following treatment with another therapeutic intervention, including chemotherapy, radiation, and / or hematopoietic stem cell transplantation (HSCT), e.g., allogenic HSCT. In some embodiments, the administration effectively treats the subject despite the subject having become resistant to another therapy. In some embodiments, the subject is responsive to the other therapeutic agent, and treatment with the therapeutic agent reduces disease burden. In some embodiments, the subject is initially responsive to the therapeutic agent, but exhibits a relapse of the disease or condition over time. In some embodiments, the subject has not relapsed. In some such embodiments, the subject has not received prior treatment with another therapeutic agent.

[0101] The modified immune cells of the present disclosure can be administered to an animal, preferably a mammal, even more preferably a human, to treat a cancer. In addition, the modified immune cells of the present disclosure can be used for the treatment of any condition related to a cancer, especially a cell-mediated immune response against a tumor cell(s), where it is desirable to treat or alleviate the disease. The types of cancers to be treated with the modified cells or pharmaceutical compositions of the invention include, for example, carcinoma, blastoma, and sarcoma, and certain leukemia or lymphoid malignancies, benign and malignant tumors, and malignancies e.g., sarcomas, carcinomas, and melanomas. Other exemplary cancers include but are not limited breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, renal cancer, liver cancer, brain cancer, lymphoma, leukemia, lung cancer, thyroid cancer, and the like. The cancers may be non-solid tumors (such as hematological tumors) or solid tumors. Adult tumors / cancers and pediatric tumor s / cancers are also included. In some embodiments, the cancer is a solid tumor or a hematological tumor. In one embodiment, the cancer is a carcinoma. In some embodiments, the cancer is a sarcoma. In other embodiments, the cancer is a leukemia. In certain embodiments, the cancer is a solid tumor.

[0102] The administration of the modified immune cells provided herein may be carried out in any convenient manner known to those of skill in the art. The modified immune cells of the present disclosure may be administered to a subject by aerosol inhalation, injection, ingestion, transfusion, implantation or transplantation. The compositions described herein may be administered to a patient transarterially, subcutaneously, intradermally, intratumorally, intranodally, intramedullary, intramuscularly, by intravenous (i.v.) injection, or intraperitoneally. In some embodiments, the modified immune cells provided herein are injected directly into a site of inflammation in the subject, a local disease site in the subject, alymph node, an organ, a tumor, and the like.

[0103] EXAMPLES

[0104] EXAMPLE 1

[0105] CAR T Cells with Gene Modulations

[0106] The mechanisms by which the cancer cells negatively impact CAR T potency are still not fully understood. Several factors play a role in determining the resistance mechanisms involved with treatment failure, as they can be primary (lack of initial response) or acquired (relapsed response)6. Nonetheless, while a few biological processes have been implicated with acquired resistance and antigen loss7 10, there is still a gap in our knowledge regarding why some patients do not respond to CAR T-cell therapy. In this Example, we have conducted a large study, examining lentiviral vector integration sites (LVIS) in 40 patients with acute lymphoblastic leukemia (ALL) and CLL treated with CAR19 T-cells12. This and other studies revealed a correlation between vector integration and therapeutic outcomes, hinting at the potential influence of gene mutagenesis. While the present invention is not limited to any particular mechanism, and an understanding of the mechanism is not necessary to practice the invention, we hypothesized that LVIS-mediated gene disruptions modify CAR T-cells’ growth kinetics and anti-tumor efficacy.

[0107] To test our hypothesis that integration sites correlate with CAR T-cell function and persistence, we created a CRISPR library, focusing on the top 20 LVIS associated with the a) highest expansion in the first 28 days, b) long-term persistence, c) early loss post-infusion, and d) genes with the most integration sites across all subjects. This would give us a higher chance of selecting genes which were more relevant for durable remissions in ALL and CLL. We designed 818 guide RNAs targeting 180 genes, including controls, and cloned them into a vector carrying the anti-CD19 CAR. T-cells from two donors were transduced and electroporated with Cas9 protein for gene disruption, then expanded and stimulated iteratively with CD19-expressing artificial antigen presenting cells to simulate repeated CAR T-cell engagement with their target. A schematic of the pipeline is depicted on Figure 1. Interestingly, genes enriched in patients with complete response were also identified in our screenings, suggesting a proliferative advantage. Further validation in an established PDX model showed consistent enrichment of these gene disruptions upon repeat stimulations.

[0108] The reasons for CAR-T cell therapy failure are still not completely understood, with a plethora of variables involved in this process. We have tested this in vitro pipeline in two independent experiments, obtaining reproducible results (Figure 2). As our first read-out, we assessed shifts in sgRNA abundance following the acute stimulation (manufactured cells). Our results demonstrate that among the most selected genes within that ten-day time span since double stranded DNA break, TP53 was the highest enriched gene, appearing to augment T cell proliferation. While the present disclosure is not limited to any particular mechanism, we hypothesize that the ablation of this cell cycle regulator made the CAR-T cells less susceptible to apoptosis and have a greater capacity of expansion and persistence compared to the others. Other highly enriched genes found in this screen were TLX3, and HSF2. TLX3 is a gene that encodes a transcription factor involved in the regulation of genes important for T-cell development, influencing cell fate decisions and differentiation processes. Enrichment of this gene suggests that the differentiation state of CAR-T cells was reduced, sustaining an early-memory, self-renewing phenotype, increasing their proliferative capacity. HSF2 encodes for Heat Shock Factor Protein 2, a transcription factor involved in the cellular response to (mainly) heat stress. In the presence of such stressors, HSF2 becomes activated and regulates the expression of various heat shock proteins (HSPs) that help protect cells from damage and promote cell survival. Though, since this gene enrichment happened during a stressor-free environment, we hypothesize that due to its ability to regulate genes involved in cell cycle and metabolism, making the cells undergo a more rapid cell cycle progression, leading to increased proliferation.

[0109] Altogether, the disruption of these genes led to an increase in cell proliferation, potentially because their functions are related to T cell development, DNA repair, and cell signaling pathways. TP53 is a master regulator of the cell cycle, so it is reasonable to hypothesize that its disruption can greatly enhance proliferation and persistence of the edited CAR-T cells.

[0110] Next, we examined CAR T cells upon chronic stimulation. The analysis of gRNA abundance (Chronically stimulated cells) corresponds to the enriched and depleted genes identified on the paired samples. The Model-based Analysis of Genome-wide CRISPR / Cas9 Knockout (MAGeCK) is a validated method for prioritizing single-guide RNAs, genes and pathways in CRISPR / Cas9 knockout screens (Li et al., 2014). Our dataset has identified that the most significantly depleted genes on paired samples included NOSIP, ATP9B, WNK1 and RUNX1. NOSIP is a gene that encodes a protein which interacts with nitric oxide synthase, regulating nitric oxide production. FADD is involved in apoptosis and necrosis, while ATP9B is a gene involved in lipid transport and homeostasis. WNK1 encodes a protein kinase that regulates ion transport, and RUNX 1 is a transcription factor involved in hematopoietic stem cell development and differentiation. Together, these genes play diverse roles in cellular signaling, metabolism and development. Therefore, their ablation poses a negative impact in cell viability and proliferation. The enriched genes included PDCD10, PCNX, TALI, TCF3 and ANKRD11, meaning that a selective growth was observed in cells carrying these knockouts. As previously outlined, after harvest, the CAR-T cells were exposed to CD19-expressing K562 cells, recapitulating the encounter of tumor cells by effector cells in the disease setting. After antigen presentation, the CAR-T cells then start to express different set of markers that will lead to cell activation, proliferation and effector functions against target cells. Importantly, ANKRD11 encodes for the ANKRD1 1 protein, which interacts with histone deacetylases, thus controlling gene activity and cell cycle progression. This protein may also enhance the activity of p53, and this might correlate with what we observed after acute stimulation, where proliferating cells can be rescued from contracting. TCF3 plays a critical role in lymphopoiesis, and its encoded protein is required for B and T lymphocyte development, which is expected after antigen exposure. TAL-1 has been implicated with (normal and aberrant) hemopoietic differentiation, and PDCD10 modulates apoptotic pathways and promotes cell proliferation, with functions that are already well documented in the literature.

[0111] PCNX was the second highest enriched gene in our screen, and it encodes for the protein PCNX-1 (Pecanex-like homolog 1). However, its functions in human tissues and immune cells are not yet fully described. The protein Pecanex, found in Drosophila, is associated with neurogenesis and is identified as a positive regulator of Notch-signaling (Yamakawa et al., 2012). A cancer-related function for PCNX-1 was described a few years ago, where it seems to be a positive regulator of the oncoprotein Skp2 in lung cancer (Li et al., 2017). PCNX-1 is a relatively large protein (2341 aminoacids), which suggests that it may have multiple domains or binding sites that allow it to interact with other proteins or molecules. The presence of conserved domains such as the EF-hand calcium- binding motif and the proline-rich domain may also indicate specific functions related to protein-protein interactions or calcium signaling (NCBI; The Human Protein Atlas database).

[0112] Among the 13 interactors of PCNX-1 (according to Biogrid database), the epidermal growth factor receptor (EGFR) can be highlighted for being involved in cell signaling pathways that control cell division and survival. The interaction with the transcription factor CREB has also been reported, it is involved with T cell differentiation and function. While not limited to any particular mechanism, we hypothesize that the enhanced proliferation in cells harboring PCNX ablation after chronic stimulation is related to changes in gene expression patterns or alterations in other signaling pathways, such as those involving cytokines or other immune-related molecules. Altogether, these findings suggest that PCNX1 may have a role in modulating intracellular signaling pathways in T cells, potentially influencing differentiation, activation or other aspects of T cell function.

[0113] After selecting 2 genes (PCNX1 and PDCD10) from the chronic stimulation samples, we have manufactured CAR-T cells in the presence of single-gene knockout for these targets and performed the same chronic stimulation assay to evaluate for CAR-T cell proliferation and function (Figure 3), showing that they could potentially increase those features. Furthermore, as a means of validating the screen, we performed an in vivo experiment (Figure 4a), treating tumor-bearing immunocompromised (NSG) mice with CAR-T cells from the same donors as in the previous experiments. The results of this in vivo screen were in agreement with the in vitro data (see Figure 4b and data not shown - full ranked list), confirming our hypothesis that some gene disruptions can be involved in CAR-T cell proliferation and function.

[0114] REFERENCES

[0115] 1. Cappell et al. Long-Term Follow-Up of Anti-CD19 Chimeric Antigen Receptor T- Cell Therapy. J Clin Oncol. 2020;38(32):3805-15.

[0116] 2. Mi et al. CAR T-cell immunotherapy: a powerful weapon for fighting hematological B-cell malignancies. Front Med. 2021;15(6):783-804.

[0117] 3. Caimi et al. Prophylactic Tocilizumab Prior to Anti-CD19 CAR-T Cell Therapy for Non-Hodgkin Lymphoma. Front Immunol. 2021 ; 12:745320.

[0118] 4. Milone et al. Engineering enhanced CAR T-cells for improved cancer therapy. Nat Cancer. 2021 ;2(8):780-93.

[0119] 5. Maude et al., Chimeric antigen receptor T cells for sustained remissions in leukemia. New England Journal of Medicine. 2014; 10(10).

[0120] 6. Singh et al., Impaired death receptor signalling in leukemia causes antigenindependent resistance by inducing CAR T cell dysfunction. Cancer Discovery. 2020; 10:552- 67.

[0121] 7. Orlando et al., Genetic Mechanisms of target antigen loss in CAR19 therapy of acute lymphoblastic leukemia. Nature Medicine. 2018;24: 1504-6.

[0122] 8. Sotillo et al., Convergence of Acquired Mutations and Alternative Splicing of CD 19 Enables Resistance to CART-19 Immunotherapy. Cancer Discovery. 2015;5:1282-95. 9. Ruella et al., Induction of resistance to chimeric antigen receptor T cell therapy by transduction of a single leukemic B cell. Nature Medicine. 2018;24:1499-503.

[0123] 10. Hamieh et al. CAR T cell trogocytosis and cooperative killing regulate tumour antigen escape. Nature. 2019;568(7750):l 12-6.

[0124] 11. Fraietta et al. Disruption of TET2 promotes the therapeutic efficacy of CD19-targeted T cells. Nature. 2018;558(7709):307-12.

[0125] 12. Nobles et al. CD19-targeting CAR T cell immunotherapy outcomes correlate with genomic modification by vector integration. J Clin Invest. 2020;130(2):673-85.

[0126] 1. Wei et al., MAGeCK enables robust identification of essential genes from genomescale CRISPR / Cas9 knockout screens Genome Biology, 2014, 15, p.554.

[0127] 2. Yamakawa T, et al., Deficient notch signaling associated with neurogenic pecanex is compensated for by the unfolded protein response in Drosophila. Development, 2012. 139: p. 558-67.

[0128] 3. Li, J.Q et al., Pecanex functions as a competitive endogenous RNA of S-phase kinase associated protein 2 in lung cancer. Cancer Letters, 2017. 406: p.36-46.

[0129] Although only a number exemplary embodiments have been described in detail, those skilled in the art will readily appreciate that many modifications are possible in the exemplary embodiments without materially departing from the novel teachings and advantages of this disclosure. Accordingly, all such modifications and alternative are intended to be included within the scope of the invention as defined in the following claims. Those skilled in the art should also realize that such modifications and equivalent constructions or methods do not depart from the spirit and scope of the present disclosure, and that they may make various changes, substitutions, and alterations herein without departing from the spirit and scope of the present disclosure.

Claims

CLAIMSWe claim:

1. A composition comprising a modified immune cell or precursor cell thereof, wherein at least one first endogenous gene in said modified immune cell or precursor thereof is over-expressed compared to wild-type, and / or wherein first mRNA from said first endogenous gene is over-expressed compared to wild-type, wherein said first endogenous gene is selected from Table 1 , and optionally, wherein said first endogenous gene is selected from: NOSIP, FADD, RUNX1, AQR, ATE1, ATP9B, LSM2, CD3D, WNK1, EIF2B3, and TAL2; and / or wherein at least one second endogenous gene in said modified immune cell or precursor thereof is disrupted and / or knocked out, and / or wherein second mRNA from said second endogenous gene is inhibited or silenced, wherein said second endogenous gene is selected from Table 2, and optionally, wherein said at least one endogenous gene is selected from: PCNX1, PDCD10, MYC, ASXL1, RPTOR, BCAP31, ANKRD11, TCF3, IQCB1, , ZZEF1, SRCAP, CARD8, DNMT1, HSF2 and CTLA4, and / or wherein said modified immune cell, or precursor cell thereof, comprises: i) an expression vector expressing a third mRNA encoding a protein that is encoded by a gene selected from Table 1, and optionally a gene selected from: NOSIP, FADD, RUNX1, AQR, ATE1, ATP9B, LSM2, CD3D, WNK1, EIF2B3, and TAL2; and / or ii) a fourth mRNA comprising modified bases, wherein said fourth mRNA encodes said proteins of said third mRNA.

2. A composition comprising a modified immune cell or precursor cell thereof, wherein optionally said modified immune cell is a CAR T-cell; wherein said modified immune cell or precursor thereof over-expresses a first protein compared to wild-type, and wherein said first protein is: NOSIP, FADD, RUNX1, AQR, ATE1, ATP9B, LSM2, CD3D, WNK1, EIF2B3, or TAL2, and wherein said first protein is endogenous to, or exogenous to, said modified immune cell or precursor thereof, and / or said modified immune cell or precursor thereof under-expresses, or does not express, a second protein compared to wild type, and wherein said second protein is: PCNX1 , PDCD10, MYC, ASXL1, RPTOR, BCAP31, ANKRD11, TCF3, IQCB1, , ZZEF1, SRCAP, CARD8, DNMT1, HSF2, or CTLA4.

3. The composition of claim 1 or 2, wherein said modified immune cell comprises a modified T cell, and / or wherein said expression vector comprises a plasmid or viral vector, and / or wherein said modified bases are selected from 1-methyl-pseudouridine, comprises 5- methylcytosine, or N1 -methylpseudouridine (m IT).

4. The composition of claim 3, wherein said modified T cell is CAR T cell that comprises a chimeric antigen receptor (CAR).

5. The composition of claim 4, wherein said chimeric antigen receptor comprises an antigen binding domain, a transmembrane domain, and an intracellular domain.

6. The composition of claim 5, wherein said antigen binding domain binds a tumor associated antigen (TAA).

7. The composition of claim 6, wherein said TAA is expressed by cells on a solid tumor.

8. The composition of claim 6, wherein said TAA is CD 19 or BCMA.

9. The composition of claim 6, wherein said TAA is selected from: mesothelin, BCMA,VEGFR-2, CD4, CD5, CD19, CD20, CD30, CD22, CD24, CD25, CD28, CD30, CD33, CD38, CD47, CD52, CD56, CD80, CD81, CD86, CD123, CD138, CD171, CD276, B7H4, CD133, EGFR, GPC3; PMSA, CD3, CEACAM6, c-Met, EGFRvIII, ErbB2 / HER-2, ErbB3 / HER3, ErbB4 / HER-4, EphA2, EphlOA, IGF1R, GD2, O-acetyl GD2, O-acetyl GD3, GHRHR, GHR, FLT1, KDR, FLT4, CD44v6, CD151, CA125, CEA, CTLA-4, GITR, BTLA, TGFBR2, TGFBR1, IL6R, gpl30, Lewis A, Lewis Y, NGFR, MCAM, TNFR1, TNFR2, PD1, PD-L1, PD-L2, HVEM, MAGE- A, NY-ESO-1, PSMA, RANK, R0R1, ROR-2, TNFRSF4, CD40, CD137, TWEAK-R, LTPR, LIFRP, LRP5, MUC1, TCRa, TCRp, TLR7, TLR9, PTCHI, WT-1, Robol, a, Frizzled, 0X40, CD79b, and Notch-1-4.

10. The composition of claim 1 , wherein said at least one second endogenous gene is knocked out.

11. The composition of claim 1 or 2, wherein said modified immune cell is a human cell.

12. The composition of claim 1, wherein the second endogenous gene has been disrupted and / or knocked out via a CRISPR / Cas system; and / or wherein said second endogenous gene has been disrupted and / or knocked out via a CRISPR / Cas9 system.

13. The composition of claim 1, wherein said modified immune cell is present and is selected from: a CAR T-cell, a tumor-infiltrating lymphocyte (TIL), or a TCR-engineered T cell.

14. The composition of claim 12, wherein said CRISPR / Cas system comprises an sgRNA specific for at least one of said endogenous genes.

15. The composition of claim 1, wherein said second mRNA has been inhibited or silenced by siRNA, miRNA, or antisense nucleic acid sequences specific for said mRNA.

16. The composition of claim 1 or 2, further comprising: a buffer, saline solution, and / or water.

17. The composition of claim 1, wherein said composition comprises a nucleic acid sequence specific for said second endogenous gene; and / or said mRNA selected from: sgRNA, antisense oligonucleotide, siRNA sequence, and a miRNA sequence; and / or said nucleic acid sequence is present in an expression vector, which is optionally a plasmid or viral vector.

18. The composition of claim 1, further comprising a Cas protein or a nucleic acid sequence encoding said Cas protein, wherein the Cas protein is optionally selected from: Cas9, Casl2, Casl3, Casl4, and dCas9.

19. A method of treating cancer or other disease comprising: administering said composition of any one of claims 1-18 to a subject, wherein said subject has cancer or another disease.

20. The method of claim 19, wherein said subject has acute lymphoblastic leukemia (ALL) or Chronic lymphocytic leukemia (CLL), and optionally said modified immune cell is a CAR T cell targeting CD 19.

21. The method of any one of claims 19-20, wherein said subject is a human.

22. The method of claim 19, wherein said immune cell is originally from said subject.

23. The method of claim 19, wherein said immune cell is originally from a donor.

24. A kit or system comprising: a) an immune cell or precursor thereof, optionally wherein said wherein said immune cell comprises a modified T cell, and optionally wherein said modified T cell is CAR T cell that comprises a chimeric antigen receptor (CAR), and b) at least one of the following: i) a nucleic acid sequence specific for at least one endogenous gene and / or mRNA from said at least one endogenous gene, wherein said at least one endogenous gene is selected from Tables 1 and 2, and optionally wherein said at least one endogenous gene is selected from: PCNX1, PDCD10, MYC, ASXL1, RPTOR, BCAP31, ANKRD11, TCF3, 1QCB1, ZZEF1, SRCAP, CARD8, DNMT1, HSF2 and CTLA4, and wherein said nucleic acid sequence is selected from: sgRNA, antisense oligonucleotide, siRNA sequence, and a miRNA sequence, and ii) an expression vector expressing a first mRNA encoding a protein that is encoded by a gene selected from Table 1, and optionally a gene selected from: NOSIP, FADD, RUNX1, AQR, ATE1, ATP9B, LSM2, CD3D, WNK1, EIF2B3, and TAL2; and / or iii) a delivery system comprising a second mRNA comprising modified bases, wherein said second mRNA encodes said proteins of said first mRNA, and wherein said delivery system is optionally a lipid nanoparticle.

25. The kit or system of claim 24, wherein said system or kit further comprises a Cas enzyme or a nucleic acid sequence encoding said Cas enzyme.

26. The kit or system of any of claims 24 and 25, further comprising one or more containers for individually or collectively enclosing the recited components, and / or wherein said kit further comprises a syringe.

27. The kit or system of claim 24, wherein said modified immune cell is present and is selected from: a CAR T-cell, a tumor-infiltrating lymphocyte (TIL), or a TCR-engineered T cell.

28. A kit or system comprising: a) an administration device, which is optionally a syringe or IV bag and needle, and b) said composition of any one of claims 1 - 18 to a subject.

Citation Information

Patent Citations

  • Car t cell therapies with enhanced efficacy

    US20210047405A1