Immunoenhancing RNA molecule, and composition, vaccine and kit thereof

By introducing the full-length, truncated and mutated forms of HSP70 and its homofamily proteins into RNA vaccines, the problems of insufficient DNA vaccine efficacy and lack of enhancement elements in mRNA vaccines were solved, and multi-angle enhancement of DC targeting, activation and antigen presentation were achieved, and antigen-specific immune response was improved.

WO2025180206A1PCT designated stage Publication Date: 2025-09-04UNIV OF SCI & TECH OF CHINA
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/076748
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-03-01
Filing Date
2025-02-11
Publication Date
2025-09-04

AI Technical Summary

Technical Problem

The effectiveness and durability of existing DNA vaccines are insufficient, the delivery method is limited, and safety needs to be studied in depth. mRNA vaccines lack enhancement elements to improve the effects of antigen targeting, activation of DCs and antigen presentation.

Method used

The RNA molecule encoding HSP70 and its proteins in the same family is adopted, including the HSP structural region, the SIG structural region and the AN structural region. Through the full-length, truncated and mutated forms of HSP70 and its proteins in the same family, it promotes antigen targeting DC, activates DC, enhances antigen presentation, and improves antigen-specific T-cell immune response through the full-length, truncated and mutated forms of HSP70 and its proteins in the same family.

Benefits of technology

It effectively enhances the immune effect of RNA vaccines, promotes the uptake and presentation of antigens by DCs, improves the level of antigen-specific T cell responses and antibody production, and is used to prevent and treat cancer, infectious diseases, autoimmune diseases and graft-versus-host diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2025076748_04092025_PF_FP_ABST
    Figure CN2025076748_04092025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to the technical field of biology, and provides an immunoenhancing RNA molecule, and a composition, vaccine and kit thereof. The present invention provides an RNA molecule, wherein a coding region of the RNA molecule comprises an HSP structural region, an SIG structural region and an AN structural region; and the HSP structural region encodes an HSP protein family or variants, fragments or derivatives thereof. The HSP protein family comprises HSP70 and family proteins in full-length, truncated, or mutated forms, which enhance antigen uptake, activation levels, and antigen presentation, thereby improving antigen-specific immune responses from multiple angles. In addition, the present invention provides a composition, vaccine and kit comprising the RNA molecule, for use in preventing and treating a variety of diseases, such as cancers, infectious diseases, autoimmune diseases, allergies, or graft versus host disease.
Need to check novelty before this filing date? Find Prior Art

Description

Immunopotentiating RNA molecules, compositions, vaccines, and kits thereof

[0001] This application claims priority to Chinese patent application No. 202410234227.6, filed with the Patent Office of the People's Republic of China on March 1, 2024, entitled "Immune-enhancing RNA molecules, compositions thereof, vaccines, and kits," the entire contents of which are incorporated by reference into this application. Technical Field

[0002] The present invention belongs to the field of biotechnology, and specifically relates to immune-enhancing RNA molecules and compositions, vaccines and kits thereof. Background Art

[0003] DNA vaccines are vaccines that transfect DNA sequences encoding specific antigens into cells of immune species. The working principle of DNA vaccines is to inject genetically engineered plasmids containing DNA sequences encoding antigens for the desired immune response, so that cells directly produce antigens, thereby eliciting a protective immune response. Unlike traditional protein subunit vaccines and viral vector vaccines, DNA vaccines inject DNA sequences into the human body during vaccination, and then the human cells use these DNAs to synthesize antigen proteins, thereby inducing an immune response. Some companies and research institutions have been conducting research on DNA vaccines, including diseases such as AIDS, influenza, malaria, and tumors. However, to date, no DNA vaccine products have been approved worldwide, largely because DNA vaccines still face some challenges, including: (1) Efficacy and durability: The efficacy and durability of DNA vaccines are not yet comparable to traditional vaccines, so further research and improvement are needed; part of the reason may be that DNA vaccines have difficulty producing enough antigen proteins in cells to stimulate a strong immune response. (2) Delivery method: DNA vaccines require a special delivery system to ensure that DNA can be taken up by cells and subsequently transcribed and translated, a process that may require higher technical requirements. The currently commonly used delivery method is electric shock, which may limit the application of DNA vaccines. (3) Safety: The long-term safety of DNA vaccines still needs further study, especially those related to potential genetic changes or adverse reactions.

[0004] In order to improve the effect of DNA vaccines, a variety of enhancement elements have been designed and added to DNA, which can be mainly divided into the following categories: (1) Secretory elements. After electric shock, DNA vaccines are mainly taken up by muscle cells at the injection site. These cells have poor ability to present antigens and activate antigen-specific T cells. Adding secretory elements can secrete antigen proteins to the extracellular space, thereby increasing the uptake of antigen proteins by APCs such as DCs. For example, the VGX-3100 HPV DNA vaccine contains a leader peptide of IgE to help guide protein synthesis and secretion; the GX-188 DNA vaccine contains a leader peptide of tissue plasminogen activator (tPA) to help the fusion protein enter the secretory pathway. (2) Elements that promote antigen presentation. The complete antigen protein cannot be recognized by T cells. It must be taken up by DCs, processed, and the resulting polypeptide forms a complex with MHC and is presented on the DC surface to activate antigen-specific T cell responses. Adding elements that promote antigen presentation can enhance antigen presentation and increase the intensity of antigen-specific T cell responses. For example, Flt3L is added to the GX-188 DNA vaccine. CRT and HSP70 are also used in DNA vaccines. (3) DC-targeting elements. Fusion antigens are more likely to be taken up by target cells such as DCs, which can better enhance the level of antigen processing and presentation by DCs and the subsequent activation of antigen-specific T cell responses. For example, CTLA-4 has been used in preclinical studies.

[0005] Despite the addition of different enhancing elements, the effect of DNA vaccines is still unsatisfactory, which may be related to the limited effectiveness of DNA vaccines themselves. Unlike DNA vaccines, mRNA encoding antigens only needs to enter the cytoplasm for translation to produce target proteins. In recent years, the field of mRNA vaccines has developed rapidly. mRNA is a disruptive technology in the field of biomedicine and can be applied to drug development in fields including tumor treatment, preventive vaccines and metabolic diseases. The core of mRNA vaccines is to introduce mRNA containing antigen-encoding proteins into the body, translate them into corresponding antigen proteins, and induce the body to produce specific immune responses, thereby achieving the purpose of treating diseases. Compared with traditional drugs, mRNA drugs have the advantages of rapid onset, high safety, diverse target selection, and easy production and transformation. At present, the clinical application of mRNA technology is gradually being promoted, and it has been widely used in the research and development of drugs including new crown vaccines and tumor vaccines. Its excellent short-term protective effect has been verified on a large scale during the new crown epidemic, and mRNA tumor vaccines have also been listed as breakthrough therapies by the US FDA. In recognition of the outstanding performance of mRNA vaccines in the COVID-19 pandemic, the 2023 Nobel Prize in Physiology or Medicine was awarded to American scientists Katalin Karikó and Drew Weissman for their invention of nucleotide-based modifications, which helped develop an effective mRNA vaccine for COVID-19. This will undoubtedly further promote the development of the mRNA vaccine field.

[0006] Currently, there is little research on enhancing elements for mRNA vaccines. BioNTech uses the N-terminal leader peptide of the MHC class I molecule combined with the C-terminal MHC class I trafficking signal (MITD) and adds it to the mRNA sequence encoding the target antigen to improve the presentation of MHC class I and class II epitopes in human and mouse DCs. Apart from this, there are no other enhancing elements for mRNA vaccines. In addition, there is no research on how to develop strategies to simultaneously enhance DC targeting of antigens in mRNA vaccines, activate DCs, and enhance antigen presentation, thereby significantly improving antigen-specific T cell responses. Summary of the Invention

[0007] In response to the above-mentioned deficiencies, the present invention provides immune-enhancing RNA molecules and compositions, vaccines, and kits thereof. The present invention provides an RNA molecule, characterized in that the RNA molecule coding region includes an HSP structural region, a SIG structural region, and an AN structural region, and the HSP structural region encodes an HSP protein family or a variant, fragment, or derivative thereof. The HSP protein family includes full-length, truncated, and mutant forms of HSP70 and its family proteins, which improve antigen uptake, activation levels, and antigen presentation, thereby enhancing antigen-specific immune responses from multiple angles. In addition, the present invention provides compositions, vaccines, and kits comprising the RNA molecules that can be used to prevent and treat a variety of diseases, such as cancer, infectious diseases, autoimmune diseases, allergies, or graft-versus-host disease.

[0008] The present invention is based in part on the surprising discovery that antigen-fusion functional combination elements in RNA vaccines advantageously target these antigens to DCs, activate DCs, enhance antigen presentation, and improve antigen-specific T cell immune responses and antibody production. The functional combination elements include full-length, truncated, and mutant forms of HSP70 and its family members. Sequences of HSP70 proteins and related forms advantageously enhance antigen uptake, presentation, and activation by APCs, such as DCs. The HSP70 proteins and related forms include wild-type and mutant forms of HSP70, HSP10, HSP27, HSP40, HSP60, HSP90, HSP110, gp96, calreticulin, and their truncated and mutant derivatives. The secretory sequences described promote extracellular secretion of antigens, which enhances the uptake, processing, and antigen presentation of HSP70-antigen fusion proteins by APCs, such as DCs. Therefore, the immune enhancement method of the present invention differs from other existing methods in that it simultaneously promotes antigen uptake, presentation, and activation by DCs following RNA vaccine immunization, enhancing antigen-specific immune responses from multiple angles. For APCs (APCs) such as DCs that have taken up the nucleic acid vaccine, it can directly enhance antigen presentation and activation. For muscle cells that have taken up the nucleic acid vaccine at the injection site and lack antigen presentation capacity, it can secrete the fusion antigen protein extracellularly, promoting DC uptake, subsequent processing, and antigen presentation.

[0009] By using the full-length amino acid sequence of HSP70 and its family members or preferably its specific domain (such as SBD), preferably together with a suitable signal peptide with targeting and secretion-promoting functions, the purpose of targeting and enhancing antigen presentation and activating DCs can be achieved. The immune enhancement strategy proposed in this article utilizes the ability of full-length, truncated and mutant forms of HSP70 and its family members to target DCs, enhance antigen presentation and promote DC activation. HSP70 can promote DC uptake of antigens by binding to CD91 on the surface of DCs, activate the expression of DC co-stimulatory molecules and cytokines through downstream signals, and at the same time, HSP70 can enter the endoplasmic reticulum through assisted degradation of peptides to enhance antigen presentation. Therefore, the immune enhancement method introduced in this article utilizes the characteristics of HSP70 and related proteins mediated by enhanced DC uptake, DC antigen presentation and activation levels, and enhances antigen-specific immune responses from multiple levels.

[0010] For this reason, the present invention has prepared the RNA molecule of this antigen fusion protein of coding, and studied their therapeutic potential in tumor model.Therefore, target antigenic protein, peptide or epitope are connected to selected domain or full-length protein derived from several HSP70 and related proteins.Usually, by designing nucleic acid construct by selected domain or full-length protein of antigen / epitope and HSP70 and related proteins.Can include signal peptide, to optimize transshipment and anchoring to intracellular vesicle compartment and plasma membrane external site.In addition, introduce suitable joint so that MHC I class and II class molecule correctly present immunogenic peptide.Can include T helper cell epitope to increase the induction of antigen-specific immune response for the epitope of coding.Design strategy allows specific epitope or complete antigen targeting enrichment MHC I class and II class cellular compartment.

[0011] Surprisingly, the immune-boosting-antigen RNA complexes were able to effectively induce antigen-specific T cell responses and were shown to effectively reduce tumor growth in mouse models.

[0012] The novel immunopotentiation method proposed herein provides a convenient and effective means to preferably ensure enhanced antigen presentation. Therefore, the immunopotentiation strategy preferably enhances the induction of antigen-specific immune responses against antigenic peptides, proteins, or epitopes and opens up new possibilities for improving the therapeutic efficacy of RNA vaccines.

[0013] In the present invention, the term "RNA molecule" can be understood as a non-natural RNA molecule. Such RNA molecules may be non-natural due to their individual sequences (which are not naturally occurring) and / or due to other modifications that are not naturally occurring, such as structural modifications of nucleotides. Generally, artificial nucleic acid molecules can be designed and / or produced by genetic engineering methods to correspond to the desired artificial nucleotide sequence (heterologous sequence). In this case, the artificial sequence is generally a sequence that may not exist naturally, that is, it differs from the wild-type sequence by at least one nucleotide. The RNA molecules of the present invention can encode antigenic polypeptide constructs, which contain several (identical or different) amino acid sequences derived from full-length, truncated and mutant forms of HSP70 and its homologous proteins, several (identical or different) RNA antigenic peptides or proteins, and optionally other (poly)peptides, proteins or protein domains (e.g., signal peptides, peptide linkers and T helper epitopes) of any combination disclosed herein. However, it is envisioned that the RNA molecules of the present invention encode "antigenic polypeptide constructs" that contain at least one antigenic peptide or protein and at least one amino acid sequence of full-length, truncated and mutant forms of HSP70 and its homologous proteins.

[0014] In the present invention, the term "wild-type RNA molecule" can be understood as a naturally occurring sequence.

[0015] In the present invention, the term "stabilized RNA molecule" refers to an RNA molecule that has been modified such that it is more stable to breakdown or degradation, for example by environmental factors or enzymatic digestion, such as degradation by exonucleases or endonucleases, than an unmodified RNA molecule. Preferably, in the context of the present invention, the stabilized nucleic acid molecule is stable in cells such as prokaryotic or eukaryotic cells, preferably mammalian cells such as human cells. Stabilization can also be achieved outside the cell, for example in a buffer solution, for example during the manufacture of a pharmaceutical composition comprising the stabilized nucleic acid molecule.

[0016] As used herein, the term "RNA" is a commonly used abbreviation for ribonucleic acid, a nucleic acid molecule, i.e., a polymer composed of nucleotides. These nucleotides are typically adenosine monophosphate monomers, uridine monophosphate monomers, guanosine monophosphate monomers, and cytidine monophosphate monomers, linked together along a so-called backbone. The backbone is formed by phosphodiester bonds between the sugar portion of the first monomer, i.e., the ribose sugar, and the phosphate portion of the second, adjacent monomer. The specific order of these monomers is called the RNA sequence.

[0017] The engineered combinatorial RNA sequences described herein contain a sequence encoding a leader / signal peptide. The protein expressed from this region assists the antigen sequence in achieving a) organelle targeting and b) extracellular secretion, ultimately impacting DC targeting and uptake of the protein expressed by the RNA therapeutic. Preferably, at least one leader / signal peptide protein performs this function. Without wishing to be bound by a particular theory, it is envisioned that any organelle-localized or secreted protein has a sequence that can be exploited to alter the localization fate of the antigen protein and thus influence the efficacy of the RNA therapeutic.

[0018] In the present invention, the term "leader sequence" refers to a sequence preceding the coding region in a structural gene that can be transcribed but not translated. The leader peptide contains all the information required for localization of the protein as an organelle.

[0019] In this invention, the term "signal peptide" refers to a short peptide chain that directs the extracellular secretion of newly synthesized proteins. It also refers to the amino acid sequence at the N-terminus of a newly synthesized polypeptide chain that directs protein translocation across the membrane. Almost all secretory proteins contain a signal sequence, which is generally 20-40 amino acids long and is ultimately removed by signal peptidase during transmembrane transport.

[0020] In this invention, the term "organelle-resident proteins" refers to proteins whose polypeptide chains, after entering the lumen of the endoplasmic reticulum (ER), require folding and assembly to form functional proteins. Some of these proteins are transported to other parts of the cell, while others remain in the ER. The latter are called ER-resident proteins. These proteins have four specific amino acid residues at their carboxyl termini that serve as retention signals. These resident proteins assist in the folding and assembly of proteins to be transported.

[0021] As used herein, the term "secretory protein" refers to proteins such as enzymes (primarily synthesized by attached ribosomes), antibodies, and some hormones (e.g., protein hormones) that are synthesized intracellularly and then secreted to function extracellularly. Secretory proteins synthesized on ribosomes undergo transport through the endoplasmic reticulum and Golgi apparatus rather than being directly transported to the cell membrane.

[0022] The organelle resident proteins or signal peptide proteins include but are not limited to the proteins shown in Table 1 below:

[0023] Table 1

[0024] Therefore, the leader sequence / signal peptide used in the present invention is fused with the antigen and expressed, but ultimately will not be presented in the antigen protein, which has an impact on the organelle localization or secretion fate of the antigen protein. In addition, the organelle resident or secretory protein pointed out in the present invention can also be directly fused with the antigen sequence to express, thereby giving the antigen protein corresponding function. Preferably, the leader sequence / signal peptide can assist in antigen translation or greatly promote antigen secretion, be taken up by other immune cells, and promote the nucleic acid drug to maximize utilization efficiency, thereby having stronger immune efficacy.

[0025] In the present invention, the term "linker", also known as a linker molecule, refers to a short peptide that plays a connecting role between the antigen and the synergistic immune protein in the fusion protein, and is fused with the antigen and the synergistic immune protein for expression. As an indispensable component of fusion protein recombination, the linker molecule plays an important role in constructing a stable, biologically active fusion protein. The linker molecule is an amino acid chain that acts as a link between two fusion proteins and has a certain flexibility to allow the proteins on both sides to perform their respective independent functions. Protein linker molecules are generally divided into three types, namely flexible linker molecules, rigid linker molecules and cleavable linker molecules. Linker molecules are generally between 10-15 amino acids and should not be too long or too short. A linker molecule sequence that is too long may reduce the yield of the fusion protein and cause immunogenicity problems; a linker molecule sequence that is too short may cause the two proteins to be too close to each other, affecting the folding of each other's higher-order structures, thereby interfering with each other and causing loss of protein function. The secondary structure in the linker molecule will also limit the elasticity of the fusion protein, thereby affecting the functional activity of the fusion protein;

[0026] The rigid linker molecules are mostly helical structures, rich in proline, and have the main structure of (EAAAK)m, (XP)n. They maintain the distance between the two fusion protein domains;

[0027] The cleavable linker molecule is usually composed of amino acids that can form disulfide bonds, and the sequence can be degraded by proteases, which often separates the two connected protein components in the body;

[0028] The flexible linker molecule is composed mostly of small, hydrophilic amino acids with a main structure of (GSSS)m, (G)n, which can improve the spatial separation of the two domains and thus ensure the interaction between the specific domains of the two fusion proteins;

[0029] The present invention selects a flexible linker molecule with a GS sequence to maintain a certain degree of freedom at the ends of the antigen and the synergistic immune protein, thereby preventing mutual interference between the two proteins and greatly shortening the length of the nucleic acid sequence, avoiding the generation of redundant secondary structures, and making the nucleic acid sequence easier to express.

[0030] As used herein, the term "peptide" or "polypeptide" generally refers to a polymer of amino acid monomers linked by peptide bonds. It typically contains fewer than 50 monomeric units. However, the term "peptide" does not exclude molecules having more than 50 monomeric units. Long peptides, also known as polypeptides, typically have between 50 and 600 monomeric units.

[0031] In the present invention, the term "protein" generally includes one or more than one peptide or polypeptide. Proteins are usually folded into a three-dimensional form, which may be necessary for the protein to perform its biological function.

[0032] As used herein, the term "derived from" generally indicates that a sequence can be isolated from, is related to, is based on, or is homologous to a reference sequence. Thus, a sequence "derived from" a reference sequence includes sequences identical to the reference sequence (i.e., a full-length sequence exhibiting 100% sequence identity with the reference sequence) as well as variants, fragments, and derivatives of the reference sequence. This definition applies mutatis mutandis to amino acid sequences and nucleic acid sequences.

[0033] In the present invention, the term "derivative" refers to a modification of a reference or parent (poly)peptide, protein or amino acid sequence so as to include or lack additional biological properties or functions. For example, a derivative can be modified by introducing or removing a domain that confers a specific biological function, such as the ability to bind to (another) target or enzymatic activity. Other modifications can modulate pharmacokinetic / pharmacodynamic properties, such as stability, biological half-life, bioavailability, absorption; distribution and / or reduced clearance. "Derivatives" can be prepared by introducing or deleting an amino acid sequence after translation or at the nucleic acid sequence level. "Derivatives" can be derived from, i.e., correspond to a modified full-length wild-type (poly)peptide, protein or amino acid sequence, or an isoform, homologue, fragment or variant thereof. The term "derivative" also includes (poly)peptides, proteins or amino acid sequences that are chemically modified or modifiable after translation, such as by PEGylation or PASylation.

[0034] In the present invention, the term "(poly)peptide / protein variant" generally refers to a "sequence variant", i.e. a (poly) or peptide protein comprising an amino acid sequence that is different from at least one amino acid residue of a reference amino acid sequence of a reference (poly)peptide or protein. Therefore, compared to their respective reference sequences, the variant (poly)peptide or variant protein may preferably comprise at least one amino acid mutation, substitution, insertion or deletion in its amino acid sequence. The substitution may be selected from conservative or non-conservative substitutions. The (poly) variant peptide or protein variant may comprise at least one conservative amino acid substitution, in which amino acids derived from the same class are exchanged with each other. In the present invention, a (poly) variant peptide or protein variant preferably refers to a (poly) peptide / protein having at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90%, most preferably at least 95% or even 97% sequence identity with the amino acid sequence of the respective naturally occurring wild-type (poly) peptide / protein or its fragment or derivative.

[0035] In the present invention, the term "(poly)peptide / protein variant fragment" generally refers to a (poly)peptide / protein consisting of a continuous subsequence of the full-length amino acid sequence of a reference (poly)peptide / protein. With respect to its amino acid sequence, it is truncated at the N-terminus, C-terminus and / or within the sequence compared to the amino acid sequence of the reference (poly)peptide / protein. This truncation can occur at the amino acid level or the nucleic acid level, respectively. In other words, a "fragment" can generally be a shorter portion of the full-length sequence of an amino acid sequence. Therefore, a fragment generally consists of the same sequence as the corresponding fragment within the full-length amino acid sequence. The term includes naturally occurring fragments (e.g., fragments produced by naturally occurring in vivo protease activity) as well as engineered fragments. In the present invention, a (poly)peptide / protein fragment may refer to a (poly)peptide / protein comprising an amino acid sequence of at least 5 consecutive amino acid residues, at least 10 consecutive amino acid residues, at least 15 consecutive amino acid residues, at least 20 consecutive amino acid residues, at least 25 consecutive amino acid residues, at least 40 consecutive amino acid residues, at least 50 consecutive amino acid residues, at least 60 consecutive amino acid residues, at least 70 consecutive amino acid residues, at least 80 consecutive amino acid residues, at least 90 consecutive amino acid residues, at least 100 consecutive amino acid residues, at least 125 consecutive amino acid residues, at least 150 consecutive amino acid residues, at least 175 consecutive amino acid residues, at least 200 consecutive amino acid residues or at least 250 consecutive amino acid residues of the amino acid sequence of a reference protein / (poly)peptide or a variant or derivative thereof. In the context of the present invention, a preferred sequence fragment consists of a continuous stretch of nucleic acid corresponding to a continuous stretch of the nucleic acid or gene entity from which the fragment is derived, which represents at least 20%, preferably at least 30%, more preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, even more preferably at least 70% and most preferably at least 80% of the entire (i.e. full-length) nucleic acid sequence or gene from which the fragment is derived. The sequence identity indicated with respect to such a fragment preferably refers to the entire nucleic acid sequence or gene. Preferably, a "fragment" may comprise a nucleic acid sequence that has at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, preferably at least 80%, even more preferably at least 85%, even more preferably at least 90%, most preferably at least 95% or even 97% sequence identity to the reference nucleic acid sequence or gene from which they were derived.

[0036] In the present invention, the term "HSP protein family" refers to a class of cell chaperone proteins produced by biological cells after being stimulated by stressors. It plays an important role in the activation of lymphocytes and macrophages, the classical and cross-presentation pathways of antigens, and as an adjuvant to enhance the immunogenicity of antigens and regulate the body's immune response level. Heat shock proteins have an important regulatory effect as immune adjuvants. They include but are not limited to full-length elements, truncated elements or mutant forms of HSP70, HSP10, HSP27, HSP40, HSP60, HSP90, HSP110, HSPE1, HSPB1, HSPB3, gp96 or calreticulin. The HSP protein family includes but is not limited to the proteins shown in Table 2 below:

[0037] Table 2

[0038] According to a preferred embodiment, the immunopotentiating RNA composition of the present invention can encode in at least one coding region the amino acid sequence of a full-length, truncated, or mutant form of at least one HSP and its homologous family proteins.

[0039] In the present invention, the term "HSP structural region" is a functional combination element, comprising full-length, truncated, and mutant forms of HSP protein family proteins; the HSP structural region preferably targets antigenic proteins or polypeptides to the target cell compartment, enhances antigen presentation, and enhances antigen-specific immune responses. Fusion of antigenic peptides or proteins to functional combination element sequences can simultaneously improve the antigen's ability to target DCs, enhance DC activation and antigen presentation, thereby increasing antigen-specific T cell immune responses and antibody production levels; the HSP structural region is capable of directing antigenic proteins or peptides (preferably fused thereto) to MHC class I and MHC class II processing compartments, thereby enhancing CD8+T / CD4+T cell responses, and thereby increasing CD8+CTL / CD4+CTL and / or antibody-mediated immunity.

[0040] In the present invention, HSP70 consists of a 45kDa N-terminal nucleotide binding domain and a 25kDa C-terminal substrate binding domain:

[0041] The N-terminal nucleotide-binding domain (NBD), also known as the ATPase domain, binds and hydrolyzes ATP. The NBD consists of two subdomains (I and II), which are further divided into four subdomains (IA, IIA, IB, and IIB). A cleft exists between subdomains I and II, with the nucleotide binding site located at the base of the cleft. Hydrolysis of ATP to ADP causes a conformational change in the NBD.

[0042] The C-terminal substrate-binding domain (SBD), also known as the peptide-binding domain, is located at amino acids 394-509. The SBD consists of a β-sandwich domain (β-SBD) with a substrate-binding site and a flexible α-helical lid domain (α-SBD) that modulates the affinity for misfolded proteins. SBD domains vary greatly in type and conformation, including N-terminal, C-terminal, and intermediate domains. Different SBD domains share certain surface properties, such as hydrophilicity, lipophilicity, or charge, that facilitate substrate recognition and binding.

[0043] HSP70 facilitates protein folding by transiently associating with short hydrophobic peptide segments within substrate proteins through its SBD. This substrate binding and release cycle is driven by the ATP / ADP conversion within the NBD. Key to HSP70's chaperone function lies in the transition between the open and closed conformations of the SBD. When the NBD is bound to ATP, the substrate-binding cavity of the SBD is in an open conformation, with the α-SBD and β-SBD separated and docked on different faces of the NBD. This results in low affinity for the substrate and a rapid exchange rate. When ATP is bound to the NBD, the SBD binds relatively weakly to the substrate protein. When ADP is bound to the NBD, the conformational change enhances the SBD's affinity for the substrate protein.

[0044] "RNA molecule" in the present invention encodes a full-length antigenic peptide or protein, or preferably a fragment thereof. The fragment may comprise or consist of a (functional) epitope of the antigenic peptide or protein. Preferably, the fragment or epitope is expressed in a host cell for MHC I class, preferably MHC II class processing compartment, and is recognized by immune cells, immune cell receptors and antibodies of the adaptive immune system. The antigenic peptide or protein is processed by an intracellular mechanism to be presented to the immune cells on the MHC molecules, preferably resulting in an antigen-specific immune response. The "antigenic peptide or protein" may be an RNA molecule of the present invention, preferably a translation product of RNA.

[0045] "Antigenic peptide or protein" in the present invention generally refers to any (poly) peptide or protein that can interact with / be recognized by components of the immune system (such as antibodies or immune cells) under appropriate conditions. Antigenic peptide or protein preferably interacts with / be recognized by components of the immune system through its "epitope" or "antigenic determinant". Antigenic peptide or protein comprises a (poly) peptide of at least one (functional) epitope, a (poly) peptide consisting of at least one (functional) epitope, or a (poly) peptide that can provide at least one (functional) epitope. The selection of suitable antigenic peptide or protein generally depends on the condition or disease to be treated or prevented. Generally, RNA molecules can encode any antigenic peptide or protein (or any desired combination of antigenic peptides or proteins) in at least one coding region thereof. Or a plurality of arbitrary combinations of antigenic peptides or proteins.

[0046] In the present invention, the term "tumor antigen" refers to an antigenic substance that appears newly or is overexpressed during the occurrence and development of a tumor. The possible mechanisms by which the body produces tumor antigens are: ① gene mutation; ② activation of genes that were not originally expressed during cell carcinogenesis; ③ abnormalities in certain links of the antigen synthesis process (such as abnormal glycosylation leading to the production of specific protein degradation products); ④ abnormal and ectopic expression of embryonic antigens or differentiation antigens; ⑤ overexpression of certain gene products, especially signal transduction molecules; ⑥ expression of exogenous genes (such as viral genes). There are many classification methods for tumor antigens, of which two are generally accepted. One is to classify according to the specificity of tumor antigens, and tumor antigens are divided into: tumor-specific antigens and tumor-associated antigens; the other is to classify according to the induction and occurrence of tumors, and tumor antigens are divided into: tumor antigens induced by chemical or physical factors, virus-induced tumor antigens, antigens of spontaneous tumors, embryonic antigens, differentiation antigens and overexpressed antigens.

[0047] "Tumor-specific antigens" are novel antigens that are unique to tumor cells or present only on certain tumor cells and not on normal cells. These antigens are confirmed through transplantation of tumors between animals of the same species and are therefore also called tumor-specific transplantation antigens or tumor rejection antigens. Tumor antigens induced by chemical or physical factors, spontaneous tumor antigens, and virus-induced tumor antigens often fall into this category.

[0048] "Tumor-associated antigens" are antigens that are not specific to tumor cells but are also present on normal cells and other tissues, but their levels increase significantly when cells become cancerous. These antigens only vary in quantity and lack strict tumor specificity. Embryonic antigens are a typical example.

[0049] The term "chemically or physically induced tumor antigens" refers to tumors with high specificity but weak antigenicity, exhibiting marked individual specificity. Tumors induced by the same chemical carcinogen or physical radiation can exhibit varying immunogenicity across different strains, within different individuals of the same strain, and even within different sites within the same individual. Because mutated tumor antigens rarely share common components, the application of immunological techniques to diagnose and treat these tumors presents challenges.

[0050] "Viral-induced tumor antigens" refer to those caused by viruses (including DNA and RNA viruses). For example, hepatitis B and C viruses (HBV and HCV) are associated with primary liver cancer. They are characterized by strong antigenicity. These antigens are encoded by viral genes and are distinct from the virus itself, hence the term "viral tumor-associated antigens."

[0051] The term "spontaneous tumor antigen" refers to a tumor with no clear triggering factor. Some tumors are similar to those induced by chemicals and have their own unique antigenicity, while others are similar to those induced by viruses and have common antigenicity.

[0052] Embryonic antigens are normal components produced by embryonic tissue during embryonic development. They decrease in the late embryonic stage and gradually disappear after birth, or only remain in trace amounts. However, when cells become cancerous, these antigens can be resynthesized. There are two types: alpha-fetoprotein and carcinoembryonic antigen.

[0053] Differentiation antigens are normal molecules expressed by organs and cells during development. Malignant tumor cells often remain in a naive stage of development, with morphology and function similar to undifferentiated embryonic cells. This is called dedifferentiation or retrodifferentiation of tumor cells. Therefore, tumor cells can express differentiation antigens from other normal tissues. For example, gastric cancer cells may express ABO blood group antigens or the tissue's own embryonic differentiation antigens. Melan-A, gp100, and tyrosinase are examples of such antigens.

[0054] When cells in tissues with these "overexpressed antigens" become cancerous, they express many signal transduction molecules at levels far higher than in normal cells. These signaling molecules can be normal proteins or mutant proteins, and their overexpression can also have anti-apoptotic effects, enabling long-term tumor cell survival. These antigens include gene products such as ras and c-myc. These antigens are recognized, and antigen-presenting cells can be destroyed by cytotoxic T cells. Furthermore, tumor antigens can also be present on the tumor surface in the form of mutant receptors, for example, which can be recognized by antibodies.

[0055] In the present invention, the term "alloantigen", also known as alloantigen or heteroantigen, is an antigenic substance present in different individuals of the same species of humans and animals (excluding identical twins). When cells or tissues of one individual enter another body, an immune response can be induced. Both red blood cell blood group antigens and leukocyte antigens in human blood belong to this category. For example, when type A red blood cells are transfused into a type B organism, the anti-A antibodies in the type B organism can agglutinate the type A red blood cells, and with the participation of complement, the type A red blood cells are lysed, resulting in a transfusion reaction. Providing RNA encoding an antigenic protein or peptide derived from an alloantigen can, for example, be used to induce immune tolerance to the alloantigen.

[0056] In the present invention, the term "autoantigen" refers to self-tissue components that can induce autoimmune responses, including hidden autoantigens and modified autoantigens.

[0057] The "hidden self-antigens" have never come into contact with the body's own lymphocytes during the embryonic period and cannot be recognized by the body as its own substances, such as lens proteins, brain tissue, sperm, etc.

[0058] These modified autoantigens, under the influence of infection, drugs, burns, ionizing radiation, and other factors, undergo conformational changes in the body's own tissues, becoming autoantigens. Although they are normal body components, they can induce autoimmune reactions in the host.

[0059] In the present invention, the term "T cell epitope" refers to an antigenic epitope recognized by the T cell receptor. The epitope component is a polypeptide after protein degradation, mostly present inside the antigen molecule. It needs to be processed by antigen-presenting cells and combined with the MHC molecule to form a complex before it can be recognized by the TCR. T cell epitopes can be divided into two types: a. Epitopes recognized by CD8+ T cells, containing 8-10 amino acids, of which the second and ninth amino acids are anchor amino acids; b. Epitopes recognized by CD4+ T cells, containing 13-17 amino acids. Most epitope types are linear epitopes, and T cell recognition of them is MHC-restricted.

[0060] T cell epitopes are recognized by T cells to induce cell-mediated immunity, but B cells cannot recognize them. T cell antigen receptors have relatively little surface area exposed outside the membrane and cannot bind to free antigens like antibodies. They can only recognize epitopes bound to MHC molecules and presented by antigen-presenting cells. Therefore, antigens recognized by T cells must first undergo a certain processing step: degradation from protein to peptides before binding to MHC molecules. However, conformational epitopes are destroyed during protein degradation, potentially rendering the peptides unrecognizable to T cells. Therefore, T cell epitopes are primarily sequential epitopes and are not necessarily located on the surface of antigen molecules. Like antibodies, T cells can also elicit cross-reactions with common antigens, but these reactions are generally less effective than binding to the original inducing antigen.

[0061] T cell epitopes can induce cellular immune responses, serving as targets for cytotoxic T cells. They are also essential for inducing antibody responses. This is because B cell activation requires the assistance of activated T cells, and T cell activation must be initiated by T cell epitopes. Therefore, every antigen molecule must have at least one T cell epitope to be immunogenic. Molecules possessing only B cell epitopes can serve as antibody targets but cannot induce an antibody response on their own. There are only a few possible exceptions.

[0062] Preferably, the synergistic RNA drug immune sequence used herein can greatly improve the presentation of antigen-specific T cell epitopes to T cells by promoting antigen secretion, antigen-presenting cell capture, antigen-presenting cell presentation, and antigen-presenting cell activation, thereby inducing a cellular immune response and promoting T cells to function against specific antigens.

[0063] In the present invention, the term "RNA drug" refers to a drug that is usually composed of a vector or delivery system containing an engineered gene construct, and its active ingredient is RNA. By introducing exogenous genes into target cells or tissues, specific genes are replaced, compensated, blocked, or corrected to achieve the purpose of treating and preventing diseases. Preferably, RNA drugs can be modified on their DNA templates. The synergistic immune sequence is introduced into the engineered gene construct, and the target site can be cut by a specific restriction enzyme. The synergistic immune sequence modified with the same sticky end is constructed into the vector by DNA ligase, so that the synergistic immune sequence is fused with the antigen and expressed to form a fusion protein.

[0064] In the present invention, the term "restriction enzyme" refers to a type of enzyme that can recognize specific nucleotide sequences in double-stranded DNA molecules and cut the phosphodiester bond in the DNA chain at a specific position, referred to as restriction enzyme.

[0065] In the present invention, the term "DNA ligase" is also called DNA adhesive enzyme, which plays a special and critical role in molecular biology, that is, connecting the 3'-OH end of a DNA chain and the 5'-P end of another DNA chain to form a phosphodiester bond between the two, thereby connecting two adjacent DNA chains into a complete chain. The catalytic action of ligase requires the consumption of ATP.

[0066] As used herein, the term "sticky ends" refers to the ends of single-stranded DNA with unpaired bases formed after the ends of double-stranded DNA are cleaved by specific restriction endonucleases. This single-stranded DNA can bind to another DNA fragment with a complementary sticky end sequence, thereby undergoing recombination or ligation. Identical sticky ends mean that they have the same nucleotide sequence and the same single-stranded DNA sequence.

[0067] In the present invention, the term "fusion protein" refers to a fusion protein that is formed by linking the target protein gene to be expressed with the fusion protein gene on the expression vector through DNA recombination technology. The protein expressed in this way is a recombinant protein containing both the target gene protein and the fusion gene protein. Fusion protein expression is a strategy for recombinant protein expression, and fusion expression is a method. In addition, a sequence for fusion expression of a synergistic immune sequence and an antigen can also be constructed by chemical de novo synthesis. First, the sequence to be synthesized is designed into multiple complementary single-stranded primers; these primers are synthesized by chemical synthesis; the synthesized primers are spliced ​​into a double-stranded gene by PCR; the double-stranded gene is cloned into a vector; and sequencing is used to verify the correctness of the synthesized gene.

[0068] As used herein, the DNA template of the RNA drug obtained needs to be further obtained by chemical or biological methods to obtain the corresponding RNA product to exert the desired drug activity. In a preferred embodiment, the nucleic acid drug is an RNA vaccine, which includes mRNA vaccines, circRNA vaccines, and saRNA vaccines.

[0069] Among these, mRNA vaccines are preferred. Messenger RNA (mRNA) is transcribed from a DNA template and carries the genetic information that guides cells to produce intracellular, membrane, and extracellular proteins. In theory, it can serve as a universal technology platform for expressing any protein. Currently, mRNA vaccines are being applied to preventive vaccines for infectious diseases, cancer vaccines, protein replacement therapies, CAR-T, and gene editing.

[0070] Among them, circRNA vaccines are preferred. CircRNA is a novel non-coding RNA produced by reverse splicing of pre-mRNA. Unlike traditional linear RNA, circRNA has a closed circular structure formed by covalent bonds, lacks a 5' end cap and a 3' end poly(A) tail, and is unaffected by RNA exonucleases, resulting in more stable expression and less degradation.

[0071] Among these, saRNA vaccines are preferred. Self-amplifying RNA (saRNA) is an emerging technology currently using RNA to develop new drugs and vaccines. While maintaining the advantages of traditional mRNA, such as rapid development, modular design, cell-free production, and high safety, IVT saRNA boasts the ability to self-replicate and amplify after entering cells, significantly enhancing the expression of IVT mRNA. As a positive-strand RNA molecule, upon entry into the cell, it is first translated by the ribosome into four nonstructural protein components: nsP1, nsP2, nsP3, and nsP4. These four components assemble as a polyprotein to form an RNA replicase complex. nsP1-4 each have unique functions, with nsP4 acting as an RNA polymerase using RNA as a template. Rep first synthesizes the negative strand of saRNA using the saRNA that initially enters the cell, and then uses the negative strand as a template to synthesize new copies of saRNA, thereby achieving self-amplification of saRNA. Rep also recognizes sgPr and, downstream of it, synthesizes subgenomic RNA. These subgenomic RNAs accumulate in large quantities in host cells, reaching a copy number approaching 106. In saRNA vaccine design, the antigen genes encoded by subgenomic RNA will translate into a large number of antigen molecules and trigger cellular antigen presentation.

[0072] As used herein, the term "RNA in vitro transcription" or "in vitro transcription" refers to the process of synthesizing RNA in a cell-free system (in vitro). DNA, particularly plasmid DNA (or PCR products), is typically used as a template for generating RNA transcripts. RNA can be obtained by DNA-dependent in vitro transcription from a suitable DNA template. According to the present invention, the suitable DNA template is preferably a linearized plasmid DNA template, primarily containing a T7 promoter (TAATACGACTCACTATAGGG) or SP6 promoter (ATTTAGGTGACACTATAG) sequence. DNA templates for in vitro RNA transcription can be obtained by cloning nucleic acids, particularly cDNA corresponding to the respective RNA to be transcribed in vitro, and introducing them into a suitable vector for in vitro transcription, such as plasmid DNA. In a preferred embodiment of the present invention, the DNA template is linearized with a suitable restriction enzyme prior to in vitro transcription. cDNA can be obtained by reverse transcription or chemical synthesis of mRNA. In addition, DNA templates for in vitro RNA synthesis can also be obtained by gene synthesis. Commonly, linearized plasmid DNA or PCR amplification products are used as templates for in vitro transcription using RNA polymerase. Under the conditions of T7 or SP6 RNA polymerase, NTP is used as a substrate to synthesize mRNA complementary to one strand of the template DNA, allowing for simple and rapid production of large quantities of mRNA molecules. The stability of the mRNA is enhanced by adding a cap structure at the 5' end and a polyA tail at the 3' end. High-purity mRNA is then produced through a series of isolation and purification processes.

[0073] After entering the body, a portion of a nucleic acid drug is cleared by phagocytes, while a portion performs its corresponding function. The efficiency of this portion ultimately determines the fate of the nucleic acid drug. The synergistic immune sequence described in this invention is crucial for the function of both forms of nucleic acid drugs. It can enhance the expression of the nucleic acid drug and expand its distribution range in the body, improving the reactivity of effector cells and enhancing its therapeutic efficacy.

[0074] Preferred RNA immune enhancement elements constructed by the present invention include chemical modification, sugar modification, backbone modification, base modification, lipid modification, sequence modification, G / C content modification, codon optimization, rare codon substitution, A / U content modification, unstable sequence element (DSE) modification, combined modification, 5' cap, polyadenine, polycytosine, and UTR modification optimization. The RNA immune enhancement elements of the present invention can be provided in the form of modified nucleic acids.

[0075] In the present invention, the term "modification" may refer to chemical modifications including functional structure and signal peptide backbone modifications and sugar modifications or base modifications. In the present invention, the term "modified" immunopotentiator may comprise nucleotide analogs / modifications (modified nucleotides or nucleosides), such as backbone modifications, sugar modifications or base modifications. The backbone modifications relevant to the present invention are modifications in which the phosphate backbone of the nucleotides contained in the immunopotentiator, preferably the RNA herein, is chemically modified. The sugar modifications relevant to the present invention are chemical modifications at the nucleotide ribose sites of the immunopotentiator. In addition, the base modifications relevant to the present invention are chemical modifications at the base moieties of the immunopotentiator associated site nucleotides. In this article, nucleotide analogs or modifications are preferably selected from nucleotide analogs, which are conducive to transcription and / or translation.

[0076] Sugar modifications are modifications made to the nucleoside / nucleotide moiety. For example, the 2' hydroxyl (OH) group can be modified or substituted with a variety of different "oxy" or "deoxy" substituents.

[0077] Examples of modifications of the -2' hydroxyl group of an "oxy" substituent include, but are not limited to, alkoxy or aryloxy (-OR, e.g., R = H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar); polyethylene glycol (PEG), -O(CH2CH2O); n CH2CH2OR; "locked" nucleic acid (LNA), in which the 2' hydroxyl group is linked to the 4' carbon of the same ribose, for example, via a methylene bridge; amino (-O-amino, where the amino group, for example, NRR, can be alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino or diheteroarylamino, ethylenediamine, polyamino) or aminoalkoxy;

[0078] "Deoxy" modifications include hydrogen, amino (e.g., NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid); or an amino group that can be attached to a sugar via a linker, wherein the linker comprises one or more than one of the atoms C, N, and O;

[0079] The sugar group may also contain one or more carbons in a stereo configuration opposite to that of the corresponding carbon in ribose. Thus, a modified immune enhancing element may contain a nucleotide containing, for example, arabinose as a sugar.

[0080] "Backbone modification" refers to the nucleoside / nucleotide modified in its phosphate backbone. The phosphate group of the backbone can be modified by replacing one or more than one oxygen atom with different substituents. In addition, the nucleoside and nucleotide modified can include fully replacing the unmodified phosphate moiety with the phosphate ester modified as herein described. The example of the phosphate group modified includes but is not limited to phosphorothioate, selenophosphate, boron phosphate, borophosphate, hydrogen phosphonate, phosphoramidate, alkyl or aryl phosphonate and phosphotriester. Two non-connected oxygens of dithiophosphate are replaced by sulfur. Phosphate joints can also be modified by replacing connected oxygen with nitrogen (phosphoramidate of bridged connection), sulfur (phosphorothioate of bridged connection) and carbon (methylene phosphonate of bridged connection).

[0081] "(Nucleo)base modification" refers to chemical modification and alteration of the nucleobase moiety. Nucleobases used in RNA sequences include, but are not limited to, adenine, guanine, cytosine, uracil, and pseudouracil. For example, the nucleosides and nucleotides described herein can be chemically modified on the major groove surface. In some embodiments, the major groove chemical modification can include amino groups, thiol groups, alkyl groups, or halogen groups.

[0082] "Lipid-modified " immunopotentiating element, preferably RNA of the present invention generally comprises (i) immunopotentiating element, preferably RNA as defined herein, (ii) at least one joint covalently linked to the immunopotentiating element, preferably RNA, and (iii) at least one lipid covalently linked to respective joints. The lipid-modified immunopotentiating element comprises at least one immunopotentiating element, and at least one (bifunctional) lipid covalently linked to the immunopotentiating element (without joint). The lipid-modified immunopotentiating element comprises (i) immunopotentiating element, (ii) at least one joint covalently linked to the immunopotentiating element, and (iii) at least one lipid covalently linked to respective joints, and (iv) at least one (bifunctional) lipid covalently linked to the immunopotentiating element (without joint). In this case, it is particularly preferred that lipid modification is present at the end of a linear immunopotentiating element.

[0083] "Sequence modification" may include at least one sequence modification as described below. Without wishing to be bound by a particular theory, such sequence modification may increase the stability of the immune enhancement element of the present invention and / or enhance the expression of the immune enhancement element of the present invention.

[0084] "G / C content modification" G / C modified RNA sequences generally refer to nucleic acids comprising a sequence that is based on a modified wild-type RNA sequence and that comprises an altered number of guanine and / or cytosine nucleotides compared to the wild-type RNA sequence. This altered number of G / C nucleotides can be generated by replacing codons containing adenosine or thymidine with "synonymous" codons containing guanosine or cytidine. Accordingly, codon substitutions preferably do not alter the encoded amino acid residue, but rather specifically alter the G / C content of the RNA.

[0085] In a preferred embodiment, the G / C content of the coding sequence of the immunopotentiating element of the present invention is modified, in particular increased, compared to the G / C content of the coding sequence of the corresponding wild-type, i.e., unmodified RNA. The amino acid sequence encoded by the immunopotentiating element of the present invention is preferably unchanged compared to the amino acid sequence encoded by the corresponding wild-type RNA.

[0086] This modification of the immunopotentiator of the present invention is based on the following fact: the sequence of any RNA region of the coding region is important for the effective translation of the RNA. Therefore, the composition of the RNA and the sequence of various nucleotides are important. It should be noted that sequences with a higher ratio of G (guanine) / C (cytosine) content are more stable than sequences with a higher ratio of A (adenine) / U (uracil) content.

[0087] According to the present invention, therefore, the codons of the immunopotentiating elements of the present invention can be selectively optimized to increase the G / C nucleotide content they comprise, compared to the corresponding wild-type sequence, while preserving the translated amino acid sequence.

[0088] Because multiple codons can encode one identical amino acid (degeneracy of genetic code), it is necessary to select the codon that is most favorable for stability (so-called alternative codon selection).Depending on the amino acid encoded by the preferred RNA of immunopotentiating element of the present invention, there is the possibility of multiple modification of its nucleotide sequence compared with its wild-type sequence.For the amino acid encoded by the codon that only comprises G or C nucleotides, the modification of codon is not needed.

[0089] Another preferred modification of the immunopotentiating element according to the invention is based on the finding that translation efficiency is also determined by the different frequencies of tRNA occurrence in the cell. Thus, if so-called "rare codons" are present in an increased degree in the immunopotentiating element according to the invention, the corresponding modified RNA sequence is translated to a significantly lower degree than if codons encoding relatively "common" tRNAs are present.

[0090] In some preferred embodiments, the protein-encoding region of the modified immune enhancing element, preferably an RNA as defined herein, is modified compared to the corresponding region of the wild-type nucleic acid such that at least one codon of the wild-type sequence encoding a tRNA that is relatively rare in the cell is replaced by a codon encoding a tRNA that is relatively common in the cell and carries the same amino acid as the relatively rare tRNA.

[0091] Thus, the sequence of the immunopotentiating element of the present invention is modified so that common tRNA codons can be inserted. In other words, according to the present invention, through this modification, all codons of the wild-type sequence encoding a tRNA that is relatively rare in cells can be replaced in various cases with codons encoding a tRNA that is relatively common in cells and carries the same amino acid as the relatively rare tRNA in various cases. It is known to those skilled in the art which tRNAs are relatively common in cells and which occur relatively rarely. The most common codons for specific amino acids in tRNAs are particularly preferred, for example, the Gly codon used in tRNAs is the most common in human cells.

[0092] According to the present invention, it is particularly preferred that the G / C content of the sequence in the modified immunopotentiating element of the present invention is increased, in particular maximized, in combination with "common" codons, without modifying the amino acid sequence encoded by the coding sequence of the immunopotentiating element, preferably RNA. Such a preferred embodiment allows the provision of a (modified) immunopotentiating element that is particularly efficiently translated and stabilized.

[0093] "A / U content modification" means that the A / U content in the environment of the ribosome binding site of the immunopotentiating element, preferably RNA, of the present invention is increased compared to its respective wild-type nucleic acid. This modification (increased A / U content around the ribosome binding site) improves the efficiency of ribosome binding to the immunopotentiating element, preferably RNA. Efficient binding of ribosomes to the ribosome binding site (Kozak sequence) in turn enables efficient translation of the immunopotentiating element.

[0094] "DSE Modification" The immunopotentiating elements of the present invention can be modified to target potentially destabilizing sequence elements. Specifically, the coding sequence and / or the 5' and / or 3' untranslated regions of the immunopotentiating element can be modified relative to the respective wild-type nucleic acid so as to exclude destabilizing sequence elements. The encoded amino acid sequence of the modified immunopotentiating element is preferably unchanged relative to the encoded amino acid sequence of the respective wild-type nucleic acid.

[0095] It is known that, for example, DSEs occur in eukaryotic RNA sequences, where they bind to signaling proteins in vivo and regulate the enzymatic degradation of RNA. To further stabilize the modified immunopotentiating element, one or more such modifications may be optionally made in at least one coding region thereof relative to the corresponding region of the wild-type nucleic acid, such that the region contains no or substantially no destabilizing sequence elements.

[0096] Further preferred modifications of the immunopotentiating elements of the present invention are based on the discovery that codons encoding the same amino acid typically occur at different frequencies. According to another preferred embodiment, in the modified immunopotentiating element, the coding sequence is modified such that the frequency of codons encoding the same amino acid corresponds to the natural frequency of occurrence of the codons according to human codon usage, as compared to the corresponding region of the corresponding wild-type nucleic acid.

[0097] As described above, all codons of the wild-type sequence encoding a tRNA that is relatively rare in the cell can be replaced with codons encoding a tRNA that is relatively common in the cell and that carries the same amino acid as the relatively rare tRNA in each case.

[0098] In some embodiments, the present invention provides an immunoenhancing element comprising a plurality of coding sequences, wherein the codons of the coding sequences are selected from the group consisting of amino acids having a codon optimized sequence and a CAI optimized sequence. In some embodiments, the codons of the coding sequences are selected from the group consisting of amino acids having a codon optimized sequence and a CAI optimized sequence. In some embodiments, the codons of the coding sequences are selected from the group consisting of amino acids having a codon optimized sequence and a CAI optimized sequence. In some embodiments, the codons of the coding sequences are selected from the group consisting of amino acids having a codon optimized sequence and a CAI optimized sequence. In some embodiments, the codons of the coding sequences are selected from the group consisting of amino acids having a codon optimized sequence and a CAI optimized sequence. In some embodiments, the codons of the coding sequences are selected from the group consisting of amino acids having a codon optimized sequence and a CAI optimized sequence. In some embodiments, the codons of the coding sequences are selected from the group consisting of amino acids having a codon optimized sequence and a CAI optimized sequence.

[0099] For example, in the case where the amino acid alanine (Ala) is present in the amino acid sequence encoded by at least one coding sequence of the immunopotentiating element of the present invention, the wild-type coding sequence is adjusted in the following way: the most common human codon "GCC" is always used for said amino acid or for the amino acid cysteine ​​(Cys), the wild-type sequence is adjusted in the following way: the most common human codon "TGC" is always used for said amino acid, etc.

[0100] "C optimized sequence" The immunopotentiating element of the present invention may be modified by changing, preferably increasing, the cytosine (C) content of the immunopotentiating element, preferably RNA, in particular in at least one of its coding sequences.

[0101] The C content of the coding sequence of the immunopotentiating element of the present invention is altered, preferably increased, compared to the C content of the coding sequence of the corresponding wild-type (unmodified) nucleic acid. The amino acid sequence encoded by at least one coding sequence of the immunopotentiating element of the present invention is preferably unchanged compared to the amino acid sequence encoded by the corresponding wild-type nucleic acid.

[0102] The modified immunoenhancing element is modified to obtain at least 10%, 20%, 30%, 40%, 50%, 60%, 70% or 80% of the theoretically possible maximum cytosine content, or at least 90% or even the maximum cytosine content. At least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or even 100% of the codons of the wild-type nucleic acid sequence of the "cytosine content optimizeable" are replaced by codons in which the cytosine content is higher than the cytosine content present in the wild-type sequence.

[0103] It may further be preferred that some of the codons of the wild-type coding sequence are additionally modified such that codons for tRNAs that are relatively rare in the cell are replaced by codons for tRNAs that are relatively common in the cell, provided that the codons for the relatively common tRNA carry the same amino acid as the relatively rare tRNA of the original wild-type codon. Preferably, all codons for tRNAs that are relatively rare in the cell are replaced by codons for tRNAs that are relatively common, except for codons encoding amino acids that are encoded only by codons that do not contain any cytosines or except for the codon for glutamine (Gln), which is encoded by two codons, each containing the same number of cytosines.

[0104] The modified immune enhancing element is modified so that at least 80% or at least 90%, or even the maximum cytosine content, of the theoretically possible maximum cytosine content is achieved by codons encoding relatively common tRNAs in the cell, while the amino acid sequence remains unchanged.

[0105] Due to the natural degeneracy of the genetic code, more than one codon can encode a specific amino acid. Thus, of the 20 naturally occurring amino acids, 18 are encoded by more than one codon (except Tryp and Met), for example, by two codons (e.g., Cys, Asp, Glu), by three codons (e.g., Ile), by four codons (e.g., Al, Gly, Pro), or by six codons (e.g., Leu, Arg, Ser). However, not all codons encoding the same amino acid are used with the same frequency under in vivo conditions. A typical codon usage profile is established for each individual organism.

[0106] The term "cytosine content-optimizable codon" used in the context of the present invention refers to a codon with a lower cytosine content compared to other codons encoding the same amino acid. Therefore, any wild-type codon that can be substituted by another codon encoding the same amino acid and showing a higher cytosine number in the codon can be considered as cytosine-optimizable (C-optimizable). Any such replacement of a C-optimizable wild-type codon with a specific C-optimizable codon within the wild-type coding sequence will increase its overall C content and reflect a C-rich modified RNA sequence.

[0107] Preferably, the immunopotentiating element of the present invention, in particular in at least one coding sequence thereof, may comprise or consist of a C-maximized sequence comprising C-optimized codons for all potential C-optimizable codons. Thus, preferably, 100% or all theoretically replaceable C-optimizable codons are replaced by C-optimized codons over the entire length of the coding sequence.

[0108] "Combinatorial modifications" particularly contemplate that the sequence modifications described herein are applied to the coding sequences of the immunopotentiating elements, preferably RNA, as described herein. If appropriate or necessary, modifications (including chemical modifications, lipid modifications, and sequence modifications) can be combined with each other in any combination, provided that the combined modifications do not interfere with each other, and preferably, provided that the encoded antigen fusion proteins preferably retain their desired functions or properties as described above.

[0109] Preferably, the artificial nucleic acid according to the present invention comprises at least one coding sequence as defined herein, wherein said coding sequence is modified as described above and encodes an antigen fusion protein as defined herein.

[0110] According to a preferred embodiment, the immunopotentiating element of the present invention comprises at least one coding sequence as defined herein, wherein (a) the G / C content of the at least one coding sequence of the immunopotentiating element is increased compared to the G / C content of the corresponding coding sequence of the corresponding wild-type nucleic acid, and / or (b) wherein the C content of the at least one coding sequence of the immunopotentiating element is increased compared to the C content of the corresponding coding sequence of the corresponding wild-type nucleic acid, and / or (c) wherein the codons in the at least one coding sequence of the immunopotentiating element are adapted to human codon usage, wherein the Codon Adaptation Index (CAI) is preferably increased or maximized in the at least one coding sequence of the immunopotentiating element, and wherein is encoded by the immunopotentiating element.

[0111] In the present invention, the term "5' cap" or "5'CAP" can be used to modify an RNA molecule as defined herein by adding a so-called "5' cap" structure according to a preferred embodiment, which preferably stabilizes the immune enhancing element as described herein. A "5' cap" is an entity, typically a modified nucleotide entity, which is typically "capped" at the 5' end of a mature mRNA. The 5' cap can typically be formed by modified nucleotides, in particular by derivatives of guanine nucleotides. Preferably, the 5' cap is connected to the 5' end via a 5'-5'-triphosphate bond. The 5' cap can be methylated, for example m7GpppN, where N is the 5' terminal nucleotide of a nucleic acid bearing a 5' cap (typically the 5' end of an mRNA). m7GpppN is a 5' cap structure that occurs naturally in mRNA transcribed by polymerase II and is therefore preferably not considered as a modification comprised in a "modified" mRNA in this case. Thus, a "modified" immune enhancing element may comprise m7GpppN as a 5' cap, but in addition, the modified immune enhancing element, preferably RNA, typically comprises at least one other modification as defined herein. Cap analogs can be used to form a 5'-cap (cap 0 or cap 1) structure during chemical RNA synthesis or RNA in vitro transcription (co-transcriptional capping).

[0112] In the present invention, the term "lipid nanoparticles," also referred to as "LNPs," is not limited to any particular morphology and includes any morphology generated when a cationic lipid and optionally one or more other lipids are combined, for example, in an aqueous environment and / or in the presence of RNA. For example, liposomes, lipoplexes, lipoplexes, and the like are within the scope of LNPs. The RNA molecules of the present invention and / or any other nucleic acid disclosed herein can be formulated as aminoalcohol lipidoids. Aminoalcohol lipidoids useful in the present invention can be prepared by the methods described in U.S. Patent No. 8,450,298, which is incorporated herein by reference in its entirety.

[0113] LNP generally comprises cationic lipid and one or more than one excipient selected from neutral lipid, charged lipid, steroid and polymer conjugated lipid (such as PEGylated lipid).RNA can be encapsulated in the lipid portion of LNP or be encapsulated in the aqueous space that some or the whole lipid portion of LNP surround.RNA or its part also can associate and compound with LNP.LNP can comprise any lipid that can form particle, and nucleic acid is attached to this particle or one or more nucleic acids are encapsulated in this particle.Preferably, the LNP comprising nucleic acid comprises one or more than one cationic lipid and one or more than one stabilizing lipid.Stabilizing lipid comprises neutral lipid and PEGylated lipid.

[0114] The cationic lipids of the LNPs can be cationizable, i.e., when the pH drops below the pK of the ionizable groups of the lipid, the lipid will protonate, but gradually become neutral at higher pH values. At pH values ​​below the pK, the lipids are able to associate with negatively charged nucleic acids. In certain embodiments, the cationic lipids include zwitterionic lipids that exhibit a positive charge when the pH is reduced.

[0115] LNP can comprise any cationic lipid that is suitable for forming lipid nanoparticles.Preferably, the cationic lipid carries a net positive charge at about physiological pH.The cationic lipid can be an amino lipid.

[0116] In the present invention, the term "amino lipid" refers to lipids having one or two fatty acid or fatty alkyl chains and an amino head group (including alkylamino or dialkylamino), which can be protonated at physiological pH to form cationic lipids.

[0117] In the present invention, the term "polycationic compound" generally refers to a charged molecule that is positively charged (cationic) at a pH of typically 1 to 9, preferably at a pH of 9 or less (e.g., 5 to 9), at a pH of 8 or less (e.g., 5 to 8), at a pH of 7 or less (e.g., 5 to 7), and most preferably at a physiological pH (e.g., 7.3 to 7.4). Therefore, a "polycationic compound" can be any positively charged compound or polymer that is positively charged under physiological conditions, particularly under in vivo physiological conditions, preferably a cationic peptide or protein. A "polycationic peptide or protein" can contain at least one positively charged amino acid, or more than one positively charged amino acid.

[0118] In the present invention, the term "vaccine" is generally understood as a preventive or therapeutic material that provides at least one antigen, preferably an antigenic peptide or protein. Providing at least one antigen means that the vaccine contains the antigen or the vaccine contains a molecule that encodes the antigen.

[0119] In the present invention, the "safe dose for the drug to exert its best efficacy" refers to the therapeutic amount that can produce the expected biological effect in the "patient", "individual", "subject", non-human animal, tissue and / or organ. The "safe dose for the drug to exert its best efficacy" can induce the regression of the disease of the treated subject, alleviate the symptoms of the treated subject and / or prevent the occurrence of the disease. At the same time, the "safe dose for the drug to exert its best efficacy" is sufficient to avoid serious adverse reactions; the "safe dose for the drug to exert its best efficacy" should also vary with the sex, age, weight, physical health status, dietary structure, underlying diseases, medication status, onset time of the disease, progression rate, severity, treatment process, concomitant treatment status, specific adjuvants and / or additives used, and other similar factors of the treated subject. It can also be changed according to the nucleic acid sequence administered, preferably linear mRNA. The safe dose for the drug to exert its best efficacy is determined by drug efficacy and safety evaluation, pharmacological efficacy evaluation, adverse drug reaction evaluation and in vivo efficacy evaluation. For example, the therapeutic index and safety range are evaluated in living cells or experimental animals as indicators of drug safety. The therapeutic index is LD 50 (the dose that is lethal to 50% of the population) and ED 50 The ratio of the doses that are effective in 50% of the population is expressed as LD 50 / ED 50 The larger the therapeutic index, the higher the safety. The safety range refers to the ratio of LD1 (the dose that causes 1% of the population to die) to ED 99 The ratio of the dose that is effective in 99% of the population or the dose that is lethal to 5% of the population to the ED 95 (95% effective dose in the population), is expressed as a safety range with a larger distance, and the higher the safety level. Doses that are expressed as high safety levels are generally preferred. The safe and effective doses screened out through living cell experiments and animal experiments can be applied to the formulation of human medicines. For example, the safe and effective therapeutic dose of a drug (vaccine), reagent kit or test kit prepared from a RNA sequence provided by the present invention is about 10 μg-500 μg per dosage unit, preferably about 50 μg-400 μg per dosage unit, and more preferably about 50 μg-200 μg per dosage unit. Further, the safe and effective therapeutic dose of a drug (vaccine), reagent kit or test kit prepared from the RNA molecule or composition provided by the present invention can be 10 μg-500 μg per dosage unit, preferably about 50 μg-400 μg per dosage unit, and more preferably about 50 μg-200 μg per dosage unit. The safe and effective therapeutic dose is determined based on animal studies using models including, but not limited to, mice, rats, guinea pigs, rabbits, cats, dogs, and non-human primates. Based on the animal's greater tolerance, the safe and effective therapeutic dose obtained through animal studies should be converted to an equivalent dose for human use.

[0120] In the present invention, the term "pharmaceutically acceptable" refers to compounds or agents that are compatible with one or more active agents (here, RNA molecules) and do not interfere with and / or substantially reduce their pharmaceutical activity. Pharmaceutically acceptable carriers and / or excipients preferably have sufficiently high purity and sufficiently low toxicity to make them suitable for administration to the subject to be treated.

[0121] In this invention, the term "excipient" refers to any additive in a pharmaceutical preparation other than the main drug, also known as an adjuvant. Examples include adhesives, fillers, disintegrants, and lubricants in tablets; wine, vinegar, and medicinal juices in traditional Chinese medicine pills; the matrix component of semisolid ointments and creams; and preservatives, antioxidants, flavoring agents, aromatics, cosolvents, emulsifiers, solubilizers, osmotic pressure regulators, and colorants in liquid preparations. General requirements for excipients include stable properties, no incompatibility with the main drug, no side effects, no impact on efficacy, resistance to deformation, cracking, mildew, or insect damage at room temperature, harmlessness to the human body, no physiological effects, no chemical or physical interaction with the main drug, and no impact on the main drug's content determination. A chemically non-reactive pharmaceutical mixture (such as syrup, lard, or liquid petrolatum) to which a therapeutic drug is added or through which other ingredients are bonded together. An inactive substance (such as gum arabic, syrup, lanolin, or starch) that constitutes an excipient for a drug or antigen; especially a substance added to a drug mixture to make the mixture viscous enough to prepare a pill or tablet when there is sufficient liquid in the mixture. For example, phosphate or citrate buffered saline, fixed oils, vegetable oils such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, etc.); lecithin; surfactants; preservatives such as benzyl alcohol, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, etc.; isotonic agents such as sugars, polyols such as mannitol, sorbitol or sodium chloride; aluminum monostearate or gelatin; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid (EDTA); buffers such as acetate, citrate or phosphate; and agents for adjusting tonicity such as sodium chloride or glucose; microcrystalline cellulose, tragacanth gum or gelatin; starch or lactose; sugars such as lactose, glucose and sucrose; starches such as corn starch or potato starch; cellulose and its derivatives such as sodium carboxymethylcellulose, ethylcellulose, cellulose acetate; disintegrants, etc.

[0122] In the present invention, the term "vector" refers to a complete RNA molecule comprising an immunopotentiating element that can be complexed or associated with lipids (particularly cationic lipids and / or neutral lipids) to construct one or more LNPs or CLANs.

[0123] In the present invention, the term "complexed" refers to a preferred embodiment of the RNA molecule of the present invention, which is complexed with one or more than one cationic or polycationic compound, preferably a cationic or polycationic polymer, a cationic or polycationic peptide or protein such as protamine, a cationic or polycationic polysaccharide and / or a cationic or polycationic lipid.

[0124] The means and methods for providing "complexed" RNA molecules are described in the "complexation" section and are equally applicable to the compositions or medicaments (vaccines) of the present invention, mutatis mutandis. In particular, the RNA molecules forming part of the (pharmaceutical) composition or vaccine of the present invention may be complexed with lipids, (poly)cationic compounds and carriers (which are preferably selected from (poly)cationic amino acids, peptides and proteins, (poly)cationic polysaccharides, (poly)cationic lipids, (poly)cationic polymers or polymeric carriers as described above).

[0125] According to a preferred embodiment, the RNA molecule forming part of the composition or medicament (vaccine) of the present invention can be complexed with a polymer carrier formed by disulfide cross-linked cationic components, preferably a disulfide cross-linked cationic peptide, which polymer carrier preferably comprises a peptide according to formula (CAT-I), (CAT-Ia) and / or (CAT-Ib) as described above and / or a compound according to formula (Cat-II) (L-P1-S-[S-P2-S]nS-P3-L).

[0126] In the present invention, the term "systemic administration" includes, for example, intravenous administration (intravenous injection and push injection), muscle administration (intramuscular, subcutaneous, intradermal injection), digestive tract administration (oral), mucosal administration (sublingual, oral spray, oral patch, eye drops, rectal and vaginal suppository) or skin administration (absorption into the blood through the skin).

[0127] In the present invention, the term "local administration" includes administration through cavities such as joint cavity, trachea, respiratory tract, vagina, anus and other organs, and also includes administration into diseased areas such as lesions, tumors, peritumors, intracranial, intrapulmonary, intracardiac, and intranodular areas.

[0128] It is further contemplated that different medicaments (vaccines) or different parts of the kit of parts of the present invention may use different routes of administration.

[0129] In the present invention, " test kit " can be the suit of two or more than two parts, and usually comprises every kind of component as described herein in suitable container.For example, each container can be the form of the sleeve, envelope or pouch, tube or blister pack of bottle, bottle, squeeze bottle, jar, seal, or any other suitable form, and condition is that this container is configured to prevent the premature mixing of component.Each different component can be provided respectively, or can be provided together with some different components (that is, in the same container).Container can also be the compartment or the compartment in bottle, tube, jar or envelope or sleeve or blister pack or bottle, and condition is that before the pharmacist or doctor intentionally mix, the content of a compartment can not be physically associated with the content of another compartment.Optionally, reagent kit can comprise at least one other reagent, antimicrobial agent, RNA enzyme inhibitor, solubilizing agent, buffer etc. as defined herein in the context of pharmaceutical composition.In preferred embodiments, test kit can comprise lactated Ringer's solution as a part.

[0130] In the present invention, the term "patient", "individual" or "subject" includes mammals, fish, amphibians, reptiles and birds, as well as non-human animals. For example, primates include primitive monkeys, capuchins, lemurs, aye-aye, loris, cynomolgus, myrei, advanced monkeys, apes, white-cheeked gibbons, tarsiers, capuchins, green monkeys, saki, spider monkeys, monkeys, gibbons, and orangutans; mammals include tigers, wolves, mice, deer, minks, monkeys, tapirs, sloths, zebras, dogs, foxes, bears, elephants, leopards, musk oxen, lions, red pandas, warthogs, antelopes , reindeer, koala, rhino, lynx, pangolin, giraffe, panda, anteater, gorilla, manatee, otter, civet, dolphin, walrus, platypus, hedgehog, Arctic fox, koala, polar bear, kangaroo, armadillo, hippopotamus, seal, whale, weasel; and a variety of transgenic animals, genetically engineered animals and model animals; in the present invention, the terms "patient", "individual" and "subject" preferably refer to non-human primates or humans, most preferably humans.

[0131] The terms "treat," "treat," or "treat" should be understood as preventing a condition (i.e., causing the disease not to occur); inhibiting a condition (i.e., causing the disease not to develop); eradicating a condition (i.e., causing the disease to disappear); and / or stabilizing a condition (i.e., causing the disease to not progress). However, the occurrence and development of clinical conditions are multifactorial and multi-layered, and it is not always possible to clearly distinguish between "preventing," "suppressing," and / or "stabilizing" symptoms. Therefore, the term "prevention" to a certain extent covers the "treatment" and "treatment" types of "prevention," "suppression," and / or "stabilization." Therefore, the terms "treat" and "treatment" include "prevention" and "eradication."

[0132] The technical solutions of the present invention are as follows:

[0133] On the one hand, the present invention provides an RNA molecule, the coding region of which includes an HSP structural region, a SIG structural region, and an AN structural region; the HSP structural region encodes the HSP protein family or its variants, fragments or derivatives; the SIG structural region encodes a signal peptide; and the AN structural region encodes the same or different RNA antigenic peptides or proteins.

[0134] Specifically, the HSP protein family includes full-length elements, truncated elements or mutant forms of HSP70, HSP110, HSP10, HSP27, HSP40, HSP60, HSP90, HSPE1, HSPB1, HSPB3, gp96 or calreticulin.

[0135] More specifically, the HSP protein family includes full-length elements, truncated elements or mutant form elements of HSP70 or HSP110.

[0136] Preferably, the HSP protein family is an HSP70 full-length element, an HSP70 SBD element, an HSP110 full-length element or an HSP110 SBD element.

[0137] Further preferably, the HSP protein family includes any one of the amino acid sequences shown in SEQ ID NO. 5-8 or fragments, variants or derivatives thereof;

[0138] Specifically, the HSP structural region has any one or more nucleotide sequences shown in SEQ ID NO. 1-4.

[0139] More specifically, the HSP70 full-length element has the nucleotide sequence shown in SEQ ID NO.1 and the amino acid sequence shown in SEQ ID NO.5;

[0140] The HSP70 SBD element has the nucleotide sequence shown in SEQ ID NO.2 and the amino acid sequence shown in SEQ ID NO.6;

[0141] The full-length HSP110 element has the nucleotide sequence shown in SEQ ID NO.3 and the amino acid sequence shown in SEQ ID NO.7;

[0142] The HSP110 SBD element has a nucleotide sequence as shown in SEQ ID NO.4 and an amino acid sequence as shown in SEQ ID NO.8.

[0143] Specifically, the AN structural region encodes one, two, three, four, five, six, seven, eight, nine or ten identical or different RNA antigenic peptides or proteins.

[0144] More specifically, the RNA antigenic peptide or protein comprises a tumor antigen, a viral antigen, a bacterial antigen, a protozoan antigen, a fungal antigen, an alloantigen or an autoantigen.

[0145] Preferably, the RNA antigenic peptide or protein is a tumor antigen.

[0146] Further preferably, the tumor antigen includes HPV16 E6, HPV16 E7, Adpgk or MAGE-1.

[0147] Specifically, the signal peptide includes but is not limited to the full length or fragment of LAMP1, CRT, IgE, tPA, IL12, and HLA Ⅰ.

[0148] More specifically, the signal peptide has an amino acid sequence as shown in any one of SEQ ID NOs. 9-14 or a fragment, variant or derivative thereof; the SIG structural region includes a nucleic acid sequence as shown in any one of SEQ ID NOs. 15-20 or a fragment, variant or derivative thereof.

[0149] Preferably, the LAMP1 has the amino acid sequence shown in SEQ ID NO.9 and the nucleotide sequence shown in SEQ ID NO.15;

[0150] The CRT has an amino acid sequence as shown in SEQ ID NO.10 and a nucleotide sequence as shown in SEQ ID NO.16;

[0151] The IgE has the amino acid sequence shown in SEQ ID NO.11 and the nucleotide sequence shown in SEQ ID NO.17;

[0152] The tPA has an amino acid sequence as shown in SEQ ID NO.12 and a nucleotide sequence as shown in SEQ ID NO.18;

[0153] The IL12 has the amino acid sequence shown in SEQ ID NO.13 and the nucleotide sequence shown in SEQ ID NO.19;

[0154] The HLA I has the amino acid sequence shown in SEQ ID NO.14 and the nucleotide sequence shown in SEQ ID NO.20.

[0155] More preferably, the signal peptide is LAMP1, having the amino acid sequence shown in SEQ ID NO.9 and the nucleotide sequence shown in SEQ ID NO.15.

[0156] Specifically, the coding region of the RNA molecule has the following structure:

[0157] 5'-(SIG)a-(L)b-[(AN)c-(L)d]e-(HSP)m-3';

[0158] or 5'-(SIG)a-(L)b-[(HSP)m-(L)d]e-(AN)c-3';

[0159] or 5'-(HSP)m-(L)b-[(SIG)a-(L)d]e-(AN)c-3';

[0160] Wherein, the L structural region encodes a linker sequence; b and d are each independently selected from an integer of 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10; a, c, e, and m are each independently selected from an integer of 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0161] More specifically, the linker is a non-immunogenic linker, including but not limited to a flexible linker molecule, a rigid linker molecule and a cleavable linker molecule.

[0162] Preferably, the linker includes GS flexible linker-1, GS flexible linker-2, GS flexible linker-3, short peptide-1, short peptide-2, T2A, P2A, E2A, and Furin clevage linker.

[0163] Preferably, the linker has an amino acid sequence as shown in GS, AAA, AGA or any one of SEQ ID NOs. 21-26, or a fragment, variant or derivative thereof; the L structural region includes a nucleic acid sequence as shown in GGCAGC, GCCGCCGCC, GCCGGCGCC or any one of SEQ ID NOs. 27-32, or a fragment, variant or derivative thereof;

[0164] The GS flexible linker-1 has an amino acid sequence as shown in GS and a nucleotide sequence as shown in GGCAGC;

[0165] The GS flexible linker-2 has an amino acid sequence as shown in SEQ ID NO.21 and a nucleotide sequence as shown in SEQ ID NO.27;

[0166] The GS flexible linker-3 has an amino acid sequence as shown in SEQ ID NO.22 and a nucleotide sequence as shown in SEQ ID NO.28;

[0167] The short peptide-1 has an amino acid sequence as shown in AAA and a nucleotide sequence as shown in GCCGCCGCC;

[0168] The short peptide-2 has an amino acid sequence as shown in AGA and a nucleotide sequence as shown in GCCGGCGCC;

[0169] The T2A has an amino acid sequence as shown in SEQ ID NO.23 and a nucleotide sequence as shown in SEQ ID NO.29;

[0170] The P2A has an amino acid sequence as shown in SEQ ID NO.24 and a nucleotide sequence as shown in SEQ ID NO.30;

[0171] The E2A has the amino acid sequence shown in SEQ ID NO.25 and the nucleotide sequence shown in SEQ ID NO.31;

[0172] The Furin clevage linker has an amino acid sequence as shown in SEQ ID NO.26 and a nucleotide sequence as shown in SEQ ID NO.33.

[0173] Further preferably, the linker is GS flexible linker-1, having an amino acid sequence as shown by GS and a nucleotide sequence as shown by GGCAGC.

[0174] Specifically, the G / C content in the nucleic acid sequence of the coding region of the RNA molecule is increased compared to the G / C content in the nucleic acid sequence of the corresponding wild-type RNA molecule;

[0175] or the C content in the coding region nucleic acid sequence is increased compared to the C content in the corresponding wild-type RNA molecule nucleic acid sequence;

[0176] Or the codons in the coding region nucleic acid sequence are adapted to human codon usage, wherein the codon adaptation index is preferably increased or maximized in the RNA molecule nucleic acid sequence; and the amino acid sequence encoded by the RNA molecule nucleic acid sequence is unchanged compared to the amino acid sequence encoded by the corresponding wild-type RNA molecule nucleic acid sequence.

[0177] Specifically, the coding region of the RNA molecule comprises a nucleic acid sequence as shown in any one of SEQ ID NOs. 33-42; or a corresponding amino acid sequence encoded by the nucleic acid sequence as shown in any one of SEQ ID NOs. 33-42.

[0178] In Example 1 of the present invention, the coding region of the RNA molecule has the nucleotide sequence shown in SEQ ID NO.33; or the corresponding amino acid sequence encoded by the nucleic acid sequence shown in SEQ ID NO.33.

[0179] In Example 2 of the present invention, the coding region of the RNA molecule has the nucleotide sequence shown in SEQ ID NO.34; or the corresponding amino acid sequence encoded by the nucleic acid sequence shown in SEQ ID NO.34.

[0180] In Example 3 of the present invention, the coding region of the RNA molecule has the nucleotide sequence shown in SEQ ID NO.35; or the corresponding amino acid sequence encoded by the nucleic acid sequence shown in SEQ ID NO.35.

[0181] In Example 4 of the present invention, the coding region of the RNA molecule has the nucleotide sequence shown in SEQ ID NO.36; or the corresponding amino acid sequence encoded by the nucleic acid sequence shown in SEQ ID NO.36.

[0182] In Example 5 of the present invention, the coding region of the RNA molecule has a nucleotide sequence as shown in SEQ ID NO.33, SEQ ID NO.37 or SEQ ID NO.38; or a corresponding amino acid sequence encoded by the nucleic acid sequence as shown in SEQ ID NO.33, SEQ ID NO.37 or SEQ ID NO.38.

[0183] In Example 6 of the present invention, the coding region of the RNA molecule has a nucleotide sequence as shown in SEQ ID NO.34, SEQ ID NO.39 or SEQ ID NO.40; or a corresponding amino acid sequence encoded by the nucleic acid sequence as shown in SEQ ID NO.34, SEQ ID NO.39 or SEQ ID NO.40.

[0184] In Example 7 of the present invention, the coding region of the RNA molecule has the nucleotide sequence shown in SEQ ID NO.41; or the corresponding amino acid sequence encoded by the nucleic acid sequence shown in SEQ ID NO.41.

[0185] In Example 8 of the present invention, the coding region of the RNA molecule has the nucleotide sequence shown in SEQ ID NO.42; or the corresponding amino acid sequence encoded by the nucleic acid sequence shown in SEQ ID NO.42.

[0186] Specifically, the coding region of the RNA molecule is located between the 5'UTR and the 3'UTR.

[0187] Preferably, the coding region of the RNA molecule is located downstream of the 5'UTR and upstream of the 3'UTR.

[0188] Specifically, the RNA includes mRNA, viral RNA, replicon RNA or circular RNA.

[0189] Preferably, the RNA is mRNA.

[0190] Specifically, the RNA includes monocistronic RNA, dicistronic RNA or polycistronic RNA.

[0191] Specifically, the RNA is a modified RNA.

[0192] Preferably, the RNA is stabilized RNA.

[0193] In particular, the RNA molecule comprises a polyadenine sequence.

[0194] Preferably, the RNA molecule comprises 10 to 200, 10 to 100, 40 to 80 or 50 to 70 adenine nucleotides.

[0195] Specifically, the RNA molecule comprises a polycytosine sequence

[0196] Preferably, the RNA molecule comprises 10 to 200, 10 to 100, 20 to 70, 20 to 60 or 10 to 40 cytosine nucleotides.

[0197] Specifically, the RNA molecule has the following structure:

[0198] 5'CAP-5'UTR-(SIG)a-(L)b-[(AN)c-(L)d]e-(HSP)m-3'UTR-3'Ploy;

[0199] or 5'CAP-5'UTR-(SIG)a-(L)b-[(AN)c-(L)d]e-(HSP)m-3'UTR-3'Ploy;

[0200] Or 5'CAP-5'UTR-(HSP)m-(L)b-[(SIG)a-(L)d]e-(AN)c-3'UTR-3'Ploy.

[0201] Specifically, the 5'CAP includes m7GpppN, ARCA cap or cap 1.

[0202] Preferably, the amino acid sequence of the 5'CAP is AG.

[0203] Specifically, the 5'-UTR includes a nucleic acid sequence as shown in SEQ ID NO. 43-48 or a fragment, variant or derivative thereof; or a corresponding amino acid sequence encoded by the nucleic acid sequence as shown in any one of SEQ ID NO. 43-48.

[0204] In Example 1 of the present invention, the 5'-UTR has the nucleic acid sequence shown as SEQ ID NO.43.

[0205] In Example 2 of the present invention, the 5'-UTR has the nucleic acid sequence shown as SEQ ID NO.44.

[0206] In Example 3 of the present invention, the 5'-UTR has the nucleic acid sequence shown as SEQ ID NO.45.

[0207] In Example 4 of the present invention, the 5'-UTR has the nucleic acid sequence shown as SEQ ID NO.46.

[0208] In Example 5 of the present invention, the 5'-UTR has the nucleic acid sequence shown as SEQ ID NO.47.

[0209] In Example 6 of the present invention, the 5'-UTR has the nucleic acid sequence shown as SEQ ID NO.48.

[0210] In Example 7 of the present invention, the 5'-UTR has the nucleic acid sequence shown as SEQ ID NO.44.

[0211] In Example 8 of the present invention, the 5'-UTR has the nucleic acid sequence shown as SEQ ID NO.44.

[0212] Specifically, the 3'-UTR includes a nucleic acid sequence as shown in SEQ ID NO. 49-54 or a fragment, variant or derivative thereof; or a corresponding amino acid sequence encoded by the nucleic acid sequence as shown in any one of SEQ ID NO. 49-54.

[0213] In Example 1 of the present invention, the 3'-UTR has the nucleic acid sequence shown as SEQ ID NO.49.

[0214] In Example 2 of the present invention, the 3'-UTR has the nucleic acid sequence shown as SEQ ID NO.50.

[0215] In Example 3 of the present invention, the 3'-UTR has the nucleic acid sequence shown as SEQ ID NO.51.

[0216] In Example 4 of the present invention, the 3'-UTR has the nucleic acid sequence shown as SEQ ID NO.52.

[0217] In Example 5 of the present invention, the 3'-UTR has the nucleic acid sequence shown as SEQ ID NO.53.

[0218] In Example 6 of the present invention, the 3'-UTR has the nucleic acid sequence shown as SEQ ID NO.54.

[0219] In Example 7 of the present invention, the 3'-UTR has the nucleic acid sequence shown as SEQ ID NO.50.

[0220] In Example 8 of the present invention, the 3'-UTR has the nucleic acid sequence shown as SEQ ID NO.50.

[0221] Specifically, 3'Ploy includes a polyadenine tail or a polycytosine tail.

[0222] Preferably, the polyadenine tail comprises 10 to 1000, 10 to 500, 10 to 300, 10 to 200, 10 to 100, 40 to 80 or 50 to 70 adenine nucleotides.

[0223] Preferably, the polycytosine tail comprises 10 to 200, 10 to 100, 20 to 70, 20 to 60 or 10 to 40 cytosine nucleotides.

[0224] Preferably, the 3'Ploy has an amino acid sequence as shown in SEQ ID NO.55.

[0225] In another aspect, the present invention provides a composition comprising the above-mentioned RNA molecule and a pharmaceutically acceptable carrier or excipient thereof.

[0226] In particular, the RNA molecule is complexed with one or more cationic compounds or polycationic compounds.

[0227] Preferably, the cationic compound comprises a cationic polymer, a cationic peptide or protein, a cationic polysaccharide or a cationic lipid.

[0228] Preferably, the polycationic compound comprises a polycationic polymer, a polycationic peptide or protein, a polycationic polysaccharide or a polycationic lipid.

[0229] Further preferably, the RNA molecule is complexed with one or more cationic lipids or polycationic lipids to form lipid nanoparticles, lipid complexes or liposomes.

[0230] Preferably, the N / P ratio of the RNA molecule to the cationic compound or polycationic compound is comprised between 0.1 and 10:1.

[0231] Further preferably, the N / P ratio of the RNA molecule to the cationic compound or polycationic compound is 6:1.

[0232] In another aspect, the present invention provides use of the above-mentioned RNA molecules or compositions in the preparation of drugs or kits.

[0233] Specifically, the dosage forms of the drug include ointments, suppositories, aerosols, pastes, gels, decoctions, powders, pills, solutions, syrups, emulsions, suspensions, injections, nebulizers, and freeze-dried agents.

[0234] According to a further optimized embodiment, the drug composition of the present invention is provided primarily in the form of a lyophilized preparation to maintain optimal stability of the drug. The lyophilized drug product must be diluted to an appropriate concentration in an appropriate buffer prior to administration, which is primarily based on an aqueous carrier, such as sodium citrate buffer, phosphate buffer, etc.

[0235] According to a further optimized embodiment, the drug composed of the present invention is provided in the form of a lipid-based formulation. The formulation based on the nano-delivery system can include lipid nanoparticles, protein / polypeptide nanoparticles, cationic / lipid nanoparticles, and inorganic material nanoparticles.

[0236] According to a further optimized embodiment, the drug composed of the present invention is provided in the form of an aerosolized formulation. The formulation based on the aerosol delivery system is delivered by a nebulizer such as a nasal vaccination spray device. Preferably, the drug is a vaccine.

[0237] Specifically, the application includes application in preventing, treating or diagnosing tumors, cancers, infectious diseases, autoimmune diseases, graft-versus-host disease or allergic reactions.

[0238] Preferably, the infectious disease may manifest as a local reaction or a systemic reaction.

[0239] Preferably, the autoimmune disease includes but is not limited to type 1 diabetes, rheumatoid arthritis, psoriasis / psoriatic arthritis, multiple sclerosis, systemic lupus erythematosus (SLE), inflammatory bowel disease, Addison's disease, Graves' disease, Sjögren's syndrome, Hashimoto's thyroiditis, myasthenia gravis, autoimmune vasculitis, pernicious anemia, and celiac disease.

[0240] Preferably, the application also includes combined therapy, in which the subject of the combined therapy receives surgery, radiotherapy, chemotherapy, immunotherapy, targeted therapy, endocrine therapy, stem cell transplantation, RNA precision therapy, antifungal, antiviral and / or anti-infective therapy for tumors, cancers or infectious diseases described herein, and can be treated in combination with the drug (vaccine) or kit provided by the present invention. The administration of the combined therapy depends on the type of disease, the degree of malignancy, the degree of progression and the current efficacy of the drug. The combined therapy is usually administered before or after treatment with the drug (vaccine) or kit provided by the present invention, or at the same time.

[0241] Preferably, the drug (vaccine) or kit can be used for patients with tumors or cancer who have undergone or are undergoing surgery (surgical anesthesia, cryosurgery, laser therapy, thermotherapy, photodynamic therapy), radiotherapy (external irradiation, internal irradiation), chemotherapy (neoadjuvant chemotherapy, adjuvant chemotherapy), immunotherapy (such as CTLA-4 and PD-1 immune checkpoint inhibitors, adoptive cell therapy, therapeutic antibody therapy), targeted therapy (monoclonal antibodies, small molecule drugs), endocrine therapy, stem cell transplantation and DNA precision therapy, or patients who have relapsed after receiving one or more of the above therapies.

[0242] Preferably, prevention or treatment includes, but is not limited to, the administration of any combination of conventional therapy with the drugs (vaccines), reagent kits or kits provided by the present invention, such as conventional therapy surgery (surgical anesthesia, cryosurgery, laser therapy, thermotherapy, photodynamic therapy), radiotherapy (external irradiation, internal irradiation), chemotherapy (neoadjuvant chemotherapy, adjuvant chemotherapy), immunotherapy (such as CTLA-4 and PD-1 immune checkpoint inhibitors, adoptive cell therapy, therapeutic antibody therapy,), targeted therapy (monoclonal antibodies, small molecule drugs), endocrine therapy, stem cell transplantation and DNA precision therapy with any combination of the kit provided by the present invention.

[0243] Preferably, the medicament (vaccine) or kit can be administered before, simultaneously with and / or after another treatment for the conditions described herein.

[0244] Specifically, the application is achieved by administering an effective dose of RNA molecules or compositions to a subject in need thereof.

[0245] Preferably, the application is achieved by administering to a subject in need thereof a safe dose of RNA molecules or compositions that allows the drug to exert optimal efficacy;

[0246] Preferably, the administration regimen includes: the drug (vaccine) or kit can be administered to the subject, patient or individual multiple times a day, once a day, multiple times a week, once a week or monthly; or the drug (vaccine) or kit can be administered systemically or locally; or the drug (vaccine) or kit can be administered simultaneously or sequentially.

[0247] In another aspect, the present invention provides a vaccine comprising the above-mentioned RNA molecule or composition.

[0248] In particular, the vaccine is suitable for subcutaneous, intradermal, intradermal, intradermal, topical or transdermal administration.

[0249] Preferably, the vaccine is suitable for intralesional or intratumoral administration.

[0250] In another aspect, the present invention provides a kit comprising the above-mentioned RNA molecule or composition.

[0251] Specifically, the kit also includes a liquid carrier or technical instructions for administration and dosage information of the RNA molecule or composition.

[0252] In another aspect, the present invention provides an in vitro cell treatment method, characterized in that the method comprises:

[0253] (1) Providing cells in vitro;

[0254] (2) contacting the cells described in step (1) with the above-mentioned RNA molecules, composition, vaccine, or kit.

[0255] Specifically, the method includes transfection, i.e., introducing an exogenous nucleic acid comprising the nucleic acid sequence provided by the present invention into specific cells, translating the exogenous nucleic acid into a specific encoded protein, which can be presented to APCs such as DCs through MHC molecules to activate T cells in vivo and in vitro.

[0256] The positive and beneficial effects of the present invention are:

[0257] The present invention provides an RNA molecule characterized by comprising an HSP structural region, a SIG structural region, and an AN structural region within its coding region, wherein the HSP structural region encodes a family of HSP proteins or variants, fragments, or derivatives thereof. The HSP protein family includes full-length, truncated, and mutant forms of HSP70 and its family members, and enhances antigen uptake, activation levels, and antigen presentation, thereby enhancing antigen-specific immune responses from multiple perspectives. Furthermore, the present invention provides compositions, vaccines, and kits comprising the RNA molecule for use in preventing and treating a variety of diseases, such as cancer, infectious diseases, autoimmune diseases, allergies, or graft-versus-host disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0258] Figure 1 shows the use of the full-length HSP70 element in ELISpot detection of IFN-γ production after immunization with HPV antigen RNA vaccine.

[0259] Figure 2 shows the use of the full-length HSP70 element in HPV antigen RNA vaccine ICS to detect IFN-γ production after immunization.

[0260] Figure 3 shows the tumor treatment results of using the full-length HSP70 element for HPV antigen RNA vaccine.

[0261] Figure 4 shows the use of the HSP70SBD element in ELISpot detection of IFN-γ production after immunization with HPV antigen RNA vaccine.

[0262] Figure 5 shows the use of the HSP70 SBD element in the HPV antigen RNA vaccine ICS to detect IFN-γ production after immunization.

[0263] FIG6 shows the tumor treatment results of using the HSP70 SBD element for HPV antigen RNA vaccine.

[0264] Figure 7 shows the use of the full-length HSP110 element in the HPV antigen RNA vaccine ICS to detect IFN-γ production after immunization.

[0265] FIG8 shows the tumor treatment results of using the full-length HSP110 element for HPV antigen RNA vaccine.

[0266] Figure 9 shows the use of the HSP110 SBD element in the HPV antigen RNA vaccine ICS to detect IFN-γ production after immunization.

[0267] FIG10 shows the tumor treatment results of using the HSP110 SBD element for HPV antigen RNA vaccine.

[0268] Figure 11 shows the use of full-length HSP70 elements with different construction sequences in HPV antigen RNA vaccine ICS to detect IFN-γ production after immunization.

[0269] FIG12 shows the tumor treatment results of using HSP70 full-length elements with different construction sequences for HPV antigen RNA vaccines.

[0270] FIG13 shows the use of HSP70 SBD elements with different construction sequences in the HPV antigen RNA vaccine ICS to detect IFN-γ production after immunization.

[0271] FIG14 shows the tumor treatment results of HSP70 SBD elements with different construction sequences used in HPV antigen RNA vaccines.

[0272] FIG15 shows the use of the HSP70 SBD element in the ICS assay for IFN-γ production after immunization with the colon cancer carcinoembryonic antigen RNA vaccine.

[0273] FIG16 shows the tumor treatment results of using the HSP70 SBD element in colon cancer carcinoembryonic antigen RNA vaccine.

[0274] FIG17 shows the use of the HSP70 SBD element in the melanoma-associated antigen RNA vaccine ICS to detect IFN-γ production after immunization.

[0275] FIG18 shows the tumor treatment results of using the HSP70 SBD element for melanoma-associated antigen RNA vaccine. DETAILED DESCRIPTION

[0276] Although the present invention is described in detail below, it should be understood that the present invention is not limited to the specific methods, protocols and reagents described herein, as they may vary. It should also be understood that the terms used herein are not intended to limit the scope of the present invention, which is limited only by the appended claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art.

[0277] Hereinafter, the elements of the present invention will be described. These elements are listed together with specific embodiments, but it should be understood that they can be combined in any way and in any number to create other embodiments. The examples and preferred embodiments of the various descriptions should not be interpreted as limiting the present invention to only the embodiments clearly described. This description should be understood to support and encompass embodiments that combine the embodiments clearly described with any number of disclosed and / or preferred elements. In addition, unless the context indicates otherwise, it should be understood that any arrangement and combination of all elements described in this application are disclosed in the description of this application.

[0278] Throughout this specification and the claims that follow, unless the context requires otherwise, the term "comprise" and variations such as "comprising" and "containing" will be understood to imply the inclusion of stated members, integers, or steps but not the exclusion of any other unstated members, integers, or steps. The term "consisting of is a specific embodiment of the term "comprising," in which any other unstated members, integers, or steps are excluded. In the context of the present invention, the term "comprising" encompasses the term "consisting of." Thus, the term "comprising" encompasses "including" as well as "consisting of," e.g., a composition "comprising" X may consist solely of X, or may include other contents, e.g., X+Y.

[0279] In the context of describing the present invention, especially in the context of the claims, the use of numbers before elements should be interpreted as including the singular and the plural, unless otherwise indicated herein or clearly contradicted by the context. The enumeration of numerical ranges herein is intended only to be used as a shorthand method of referring to each individual numerical value within the range individually. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually cited herein. No language in the specification should be construed as indicating any unclaimed element as essential to the practice of the present invention.

[0280] The word "substantially" does not exclude "completely", for example, a composition that is "substantially free" of Y may be completely free of Y. Where necessary, the word "substantially" may be omitted from the definition of the present invention.

[0281] The term "about" with respect to a numerical value x refers to x ± 10%.

[0282] In the present invention, different features of the alternatives and embodiments may be combined with one another, if not indicated otherwise.

[0283] The present invention is further described below by way of specific examples. Unless otherwise specified, the various chemical reagents used in the examples of the present invention were obtained through conventional commercial channels.

[0284] experimental animals

[0285] The experimental animals used in the present invention are C57BL / 6 mice, which were purchased from Beijing Huafukang Biotechnology Co., Ltd., and female mice of 6-8 weeks old and weighing about 18 g were selected.

[0286] Experimental Method 1 Preparation of mRNA Lipid Nanoparticles

[0287] 1. Prepare a lipid stock solution with a total concentration of 10 mM, in which the molar ratio of the four lipids is SM102:DSPC:cholesterol:DMG-PEG2000=50:10:38.5:1.5;

[0288] 2. Prepare sodium citrate buffer; pH 4.0

[0289] (1) Prepare 100 mmol / L sodium citrate solution (weigh 14.705 g of sodium citrate powder and dissolve it in 500 mL of MilliQ).

[0290] (2) Prepare 100 mmol / L citric acid solution (weigh 10.507 g of sodium citrate powder and dissolve it in 500 mL of MilliQ).

[0291] (3) Combine the prepared sodium citrate solution and citric acid solution and adjust the pH to 4.0;

[0292] (4) The working concentration of sodium citrate buffer is 10 mmol / L; dilute 10 times with DEPC water and then filter with a 0.22 μm filter;

[0293] 3. Preparation of mRNA-LNPs;

[0294] (1) Calculate the mass of mRNA required for each mouse immunization by dividing the mass of mRNA by 0.09174 (the nitrogen-phosphorus ratio in the lipid mother solution formula is fixed. The molar amount of mRNA can be calculated by knowing the mass of mRNA and the molecular weight of a single nucleotide. The nitrogen-phosphorus ratio is set to 6:1 to calculate the molar amount of other lipids. The mass is deduced from the molar amount and the molecular weight, and then the concentration is calculated based on the mRNA aqueous phase volume: lipid phase volume ratio of 3:1). The volume of the aqueous phase is obtained (the volume of the absorbed mRNA + sodium citrate buffer).

[0295] (2) The ratio of the volume of lipid mother solution to the volume of water phase is 1:3

[0296] (3) The lipid phase and aqueous phase are drawn from the left and right channels of the microfluidic instrument, respectively;

[0297] The lipid phase and aqueous phase delivery flow rates were approximately 4 mL / min and 12 mL / min, respectively;

[0298] (5) Collect the resulting collection solution and immediately dilute it 10-fold with ultrapure water;

[0299] (6) Ultrafiltration centrifugation at 3000 rpm, washing once with DEPC water during the ultrafiltration process, and continuing to concentrate to the required injection volume. Adjust to isotonicity with 10*PBS before injection.

[0300] Example 1 Effect of the full-length HSP70 element in HPV antigen RNA vaccine

[0301] mRNA lipid nanoparticles (denoted as mRNA-HSP70) were prepared using the method described in Experimental Method 1. The mRNA coding region, from the 5' end to the 3' end, encodes a signal peptide, an HPV antigen, and the full-length HSP70 element. The mRNA coding region has the nucleotide sequence shown in SEQ ID NO. 33, and the HSP structural region has the nucleotide sequence shown in SEQ ID NO. 1.

[0302] 1. Detection of IFN-γ

[0303] After one week of adaptive feeding, healthy C57BL / 6 mice were randomly divided into two groups (experimental and control groups). TC-1 cells expressing HPV16 E6 and HPV16 E7 (purchased from CyBio (Shanghai) Biotechnology Co., Ltd., Catalog No. iCell-m080) were injected subcutaneously into the right flank of the C57BL / 6 mice. One million cells per mouse (in 50 μL PBS) were injected into the thigh muscles of the experimental and control groups on days 4, 7, and 13 after tumor inoculation. The following drugs were administered intramuscularly:

[0304] The experimental group received injections of drugs: mRNA lipid nanoparticles (mRNA-HSP70);

[0305] The control group was injected with drugs: empty lipid nanoparticles (denoted as eLNP).

[0306] One week after the end of immunization, the spleens of the mice in the experimental and control groups were removed, and the lymphocytes were separated and divided into two parts for subsequent IFN-γ detection.

[0307] 1.1. ELISpot detection of IFN-γ production after immunization

[0308] After stimulating lymphocytes with HPV16 E7 antigen peptide (synthesized by Wuhan Dangang Biotechnology Co., Ltd.) at a final concentration of 10 μg / mL for 48 hours, the cell culture supernatant was collected for enzyme-linked immunosorbent assay. The IFN-γ production after immunization was detected according to the instructions of the ELISpot kit (purchased from Shenzhen Dakoway Bioengineering Co., Ltd., catalog number 2210005).

[0309] The measurement results are shown in FIG1 . Antigen-specific T cell responses were observed in the mRNA-HSP70 group.

[0310] 1.2. ICS detection of IFN-γ production after immunization

[0311] After stimulating lymphocytes with HPV16 E7 antigen peptide at a final concentration of 10 μg / mL for 6 hours, cells were collected and CD8 + The level of IFN-γ production in cells.

[0312] The measurement results are shown in FIG2 . Antigen-specific T cell responses were observed in the mRNA-HSP70 group.

[0313] 2. Cancer treatment outcomes

[0314] After one week of adaptive feeding, healthy C57BL / 6 mice were randomly divided into two groups (experimental and control groups). TC-1 cells expressing HPV16 E6 and HPV16 E7 were injected subcutaneously into the right flank of the C57BL / 6 mice. One million cells per mouse (in 50 μL PBS) were injected. On days 4, 7, and 13 after tumor inoculation, the corresponding drug (injection volume: 50 μL, containing 5 μg of drug) was injected into the thigh muscle of the experimental and control groups.

[0315] The experimental group was injected with drugs: mRNA lipid nanoparticles (denoted as mRNA-HSP70);

[0316] The control group was injected with drugs: empty lipid nanoparticles (denoted as eLNP).

[0317] During the experiment, the general condition of the animals was observed twice daily, and the body weight of the mice was measured three times a week for more than 30 consecutive days. Tumor growth was monitored by measuring the tumor size in three dimensions using calipers. Tumor volume was calculated according to the following formula:

[0318] Volume (mm 3 )=length (mm)×width 2 (mm)÷2

[0319] The changes in mouse tumor volume are shown in Figure 3. Significant inhibition of mouse tumor growth was observed in the mRNA-HSP70 group.

[0320] Example 2 Effect of HSP70SBD Element in HPV Antigen RNA Vaccine

[0321] mRNA lipid nanoparticles (denoted as mRNA-HSP70SBD) were prepared using the method described in Experimental Method 1. The mRNA coding region, from the 5' end to the 3' end, encodes a signal peptide, an HPV antigen, and an HSP70SBD element. The mRNA coding region has the nucleotide sequence shown in SEQ ID NO. 34, and the HSP structural region has the nucleotide sequence shown in SEQ ID NO. 2.

[0322] 1. Detection of IFN-γ

[0323] After one week of adaptive feeding, healthy C57BL / 6 mice were randomly divided into two groups (experimental and control groups). TC-1 cells expressing HPV16 E6 and HPV16 E7 were injected subcutaneously into the right flank of the C57BL / 6 mice. One million cells per mouse (in 50 μL PBS) were injected. On days 4, 7, and 13 after tumor inoculation, the corresponding drug (injection volume: 50 μL, containing 5 μg of drug) was injected into the thigh muscle of the experimental and control groups.

[0324] The experimental group was injected with drugs: mRNA lipid nanoparticles (denoted as mRNA-HSP70SBD);

[0325] The control group was injected with drugs: empty lipid nanoparticles (denoted as eLNP).

[0326] One week after the end of immunization, the spleens of the mice in the experimental and control groups were removed, and the lymphocytes were separated and divided into two parts for subsequent IFN-γ detection.

[0327] 1.1. ELISpot detection of IFN-γ production after immunization

[0328] After stimulating lymphocytes with HPV16 E7 antigen peptide at a final concentration of 10 μg / mL for 48 hours, the cell culture supernatant was collected for enzyme-linked immunosorbent assay (ELISpot) to detect IFN-γ production after immunization according to the instructions of the ELISpot kit.

[0329] The assay results showed ( FIG. 4 ) that antigen-specific T cell responses were observed in the mRNA-HSP70SBD group.

[0330] 1.2. ICS detection of IFN-γ production after immunization

[0331] After stimulating lymphocytes with HPV16 E7 antigen peptide at a final concentration of 10 μg / mL for 6 hours, the cells were collected and the level of IFN-γ production in CD8+ cells was analyzed by flow cytometry.

[0332] The measurement results are shown in FIG5 . In the mRNA-HSP70SBD group, antigen-specific T cell responses were observed.

[0333] 2. Cancer treatment outcomes

[0334] After one week of adaptive feeding, healthy C57BL / 6 mice were randomly divided into two groups (experimental and control groups). TC-1 cells expressing HPV16 E6 and HPV16 E7 were injected subcutaneously into the right flank of the C57BL / 6 mice. One million cells per mouse (in 50 μL PBS) were injected. On days 4, 7, and 13 after tumor inoculation, the corresponding drug (50 μL, containing 5 μg of drug) was injected into the thigh muscle of both experimental and control groups.

[0335] The experimental group was injected with drugs: mRNA lipid nanoparticles (denoted as mRNA-HSP70SBD);

[0336] The control group was injected with drugs: empty lipid nanoparticles (denoted as eLNP).

[0337] During the experiment, the general condition of the animals was observed twice daily, and the body weight of the mice was measured three times a week for more than 30 consecutive days. Tumor growth was monitored by measuring the tumor size in three dimensions using calipers. Tumor volume was calculated according to the following formula:

[0338] Volume (mm 3 )=length (mm)×width 2 (mm)÷2

[0339] The changes in mouse tumor volume are shown in FIG6 . Significant inhibition of mouse tumor growth was observed in the mRNA-HSP70SBD group.

[0340] Example 3 Effect of the full-length HSP110 element in HPV antigen RNA vaccine

[0341] mRNA lipid nanoparticles (denoted as mRNA-HSP110) were prepared using the method described in Experimental Method 1. The mRNA coding region, from the 5' end to the 3' end, encodes a signal peptide, an HPV antigen, and the full-length HSP110 element. The mRNA coding region has the nucleotide sequence shown in SEQ ID NO. 35, and the HSP structural region has the nucleotide sequence shown in SEQ ID NO. 3.

[0342] 1. ICS detection of IFN-γ production after immunization

[0343] After one week of adaptive feeding, healthy C57BL / 6 mice were randomly divided into two groups (experimental and control groups). TC-1 cells expressing HPV16 E6 and HPV16 E7 were injected subcutaneously into the right flank of the C57BL / 6 mice. One million cells per mouse (in 50 μL PBS) were injected. On days 4, 7, and 13 after tumor inoculation, the corresponding drug (injection volume: 50 μL, containing 5 μg of drug) was injected into the thigh muscle of the experimental and control groups.

[0344] The experimental group was injected with drugs: mRNA lipid nanoparticles (denoted as mRNA-HSP110);

[0345] The control group was injected with drugs: empty lipid nanoparticles (denoted as eLNP).

[0346] One week after the end of immunization, the spleens of the mice in the experimental and control groups were removed and lymphocytes were isolated. After stimulating the lymphocytes with HPV16 E7 antigen peptide at a final concentration of 10 μg / mL for 6 hours, the cells were collected and the level of IFN-γ production in CD8+ cells was analyzed by flow cytometry.

[0347] The measurement results are shown in FIG7 . In the mRNA-HSP110 group, antigen-specific T cell responses were observed.

[0348] 2. Cancer treatment outcomes

[0349] After one week of adaptive feeding, healthy C57BL / 6 mice were randomly divided into two groups (experimental and control groups). TC-1 cells expressing HPV16 E6 and HPV16 E7 were injected subcutaneously into the right flank of the C57BL / 6 mice. One million cells per mouse (in 50 μL PBS) were injected. On days 4, 7, and 13 after tumor inoculation, the corresponding drug (injection volume: 50 μL, containing 5 μg of drug) was injected into the thigh muscle of the experimental and control groups.

[0350] The experimental group was injected with drugs: mRNA lipid nanoparticles (denoted as mRNA-HSP110);

[0351] The control group was injected with drugs: empty lipid nanoparticles (denoted as eLNP).

[0352] During the experiment, the general condition of the animals was observed twice daily, and the body weight of the mice was measured three times a week for more than 30 consecutive days. Tumor growth was monitored by measuring the tumor size in three dimensions using calipers. Tumor volume was calculated according to the following formula:

[0353] Volume (mm 3 )=length (mm)×width 2 (mm)÷2

[0354] The changes in mouse tumor volume are shown in FIG8 . Significant inhibition of mouse tumor growth was observed in the mRNA-HSP110 group.

[0355] Example 4 Effect of HSP110SBD Element in HPV Antigen RNA Vaccine

[0356] mRNA lipid nanoparticles (denoted as mRNA-HSP110SBD) were prepared using the method described in Experimental Method 1. The mRNA coding region, from the 5' end to the 3' end, encodes a signal peptide, an HPV antigen, and the HSP110SBD element. The mRNA coding region has the nucleotide sequence shown in SEQ ID NO. 36, and the HSP structural region has the nucleotide sequence shown in SEQ ID NO. 4.

[0357] 1. ICS detection of IFN-γ production after immunization

[0358] After one week of adaptive feeding, healthy C57BL / 6 mice were randomly divided into two groups (experimental and control groups). TC-1 cells expressing HPV16 E6 and HPV16 E7 were injected subcutaneously into the right flank of the C57BL / 6 mice. One million cells per mouse (in 50 μL PBS) were injected. On days 4, 7, and 13 after tumor inoculation, the corresponding drug (injection volume: 50 μL, containing 5 μg of drug) was injected into the thigh muscle of the experimental and control groups.

[0359] The experimental group was injected with drugs: mRNA lipid nanoparticles (denoted as mRNA-HSP110 SBD);

[0360] The control group was injected with drugs: empty lipid nanoparticles (denoted as eLNP).

[0361] One week after the end of immunization, the spleens of the mice in the experimental and control groups were removed and lymphocytes were isolated. After stimulating the lymphocytes with HPV16 E7 antigen peptide at a final concentration of 10 μg / mL for 6 hours, the cells were collected and the level of IFN-γ production in CD8+ cells was analyzed by flow cytometry.

[0362] The measurement results are shown in FIG9 . In the mRNA-HSP110 SBD group, antigen-specific T cell responses were observed.

[0363] 2. Cancer treatment outcomes

[0364] After one week of adaptive feeding, healthy C57BL / 6 mice were randomly divided into two groups (experimental and control groups). TC-1 cells expressing HPV16 E6 and HPV16 E7 were injected subcutaneously into the right flank of the C57BL / 6 mice. One million cells per mouse (in 50 μL PBS) were injected. On days 4, 7, and 13 after tumor inoculation, the corresponding drug (injection volume: 50 μL, containing 5 μg of drug) was injected into the thigh muscle of the experimental and control groups.

[0365] The experimental group was injected with drugs: mRNA lipid nanoparticles (denoted as mRNA-HSP110 SBD);

[0366] The control group was injected with drugs: empty lipid nanoparticles (denoted as eLNP).

[0367] During the experiment, the general condition of the animals was observed twice daily, and the body weight of the mice was measured three times a week for more than 30 consecutive days. Tumor growth was monitored by measuring the tumor size in three dimensions using calipers. Tumor volume was calculated according to the following formula:

[0368] Volume (mm 3 )=length (mm)×width 2 (mm)÷2

[0369] The changes in mouse tumor volume are shown in FIG10 . Significant inhibition of mouse tumor growth was observed in the mRNA-HSP110 SBD group.

[0370] Example 5: Different construction sequences of HSP70 full-length elements for use in HPV antigen RNA vaccines

[0371] mRNA lipid nanoparticles 1-3 were prepared using the preparation method described in Experimental Method 1. The information of mRNA lipid nanoparticles 1-3 is as follows:

[0372] The coding region of mRNA lipid nanoparticle 1 encodes signal peptide, HPV antigen, and HSP70 full-length element from 5' to 3' end, and has a nucleotide sequence as shown in SEQ ID NO.33, wherein the HSP structure region has a nucleotide sequence as shown in SEQ ID NO.1.

[0373] The coding region of mRNA lipid nanoparticle 2 encodes signal peptide, HSP70 full-length element, and HPV antigen from 5' to 3' end, and has a nucleotide sequence as shown in SEQ ID NO.37, wherein the HSP structure region has a nucleotide sequence as shown in SEQ ID NO.1.

[0374] The coding region of mRNA lipid nanoparticle 3 encodes the HSP70 full-length element, signal peptide, and HPV antigen from the 5' end to the 3' end, and has a nucleotide sequence as shown in SEQ ID NO.38, wherein the HSP structure region has a nucleotide sequence as shown in SEQ ID NO.1.

[0375] 1. ICS detection of IFN-γ production after immunization

[0376] After one week of adaptive feeding, healthy C57BL / 6 mice were randomly divided into four groups (Group 1, Group 2, Group 3, and a control group). TC-1 cells expressing HPV16 E6 and HPV16 E7 were injected subcutaneously into the right flank of the C57BL / 6 mice. One million cells per mouse (in 50 μL PBS) were injected into the thigh muscles of the experimental and control groups on days 4, 7, and 13 after tumor inoculation. The following drugs were administered intramuscularly:

[0377] Group 1 received injection of drug: mRNA lipid nanoparticle 1;

[0378] Group 2 received injection of drugs: mRNA lipid nanoparticles 2;

[0379] Group 3 injected drugs: mRNA lipid nanoparticle 3;

[0380] The control group was injected with drugs: empty lipid nanoparticles (denoted as eLNP).

[0381] One week after the end of immunization, the spleens of mice in groups 1, 2, 3 and the control group were harvested and lymphocytes were isolated. After stimulating the lymphocytes with HPV16 E7 antigen peptide at a final concentration of 10 μg / mL for 6 hours, the cells were collected and the level of IFN-γ production in CD8+ cells was analyzed by flow cytometry.

[0382] The results are shown in Figure 11. Antigen-specific T cell responses were observed in all vaccine groups, showing significant differences compared to the control group. While there were no statistically significant differences in immune responses among the three vaccines, Group 1 showed the best response, followed by Groups 2 and 3.

[0383] 2. Cancer treatment outcomes

[0384] After one week of adaptive feeding, healthy C57BL / 6 mice were randomly divided into four groups (Group 1, Group 2, Group 3, and a control group). TC-1 cells expressing HPV16 E6 and HPV16 E7 were injected subcutaneously into the right flank of the C57BL / 6 mice. One million cells per mouse (in 50 μL PBS) were injected into the thigh muscles of the experimental and control groups on days 4, 7, and 13 after tumor inoculation. The following drugs were administered intramuscularly:

[0385] Group 1 received injection of drug: mRNA lipid nanoparticle 1;

[0386] Group 2 received injection of drugs: mRNA lipid nanoparticles 2;

[0387] Group 3 injected drugs: mRNA lipid nanoparticle 3;

[0388] The control group was injected with drugs: empty lipid nanoparticles (denoted as eLNP).

[0389] During the experiment, the general condition of the animals was observed twice daily, and the body weight of the mice was measured three times a week for more than 30 consecutive days. Tumor growth was monitored by measuring the tumor size in three dimensions using calipers. Tumor volume was calculated according to the following formula:

[0390] Volume (mm 3 )=length (mm)×width 2 (mm)÷2

[0391] The results are shown in Figure 12. All three vaccine-immunized groups showed significant inhibition of tumor growth, with significant differences compared to the control group. While there were no statistically significant differences in tumor volume between the three vaccines, Group 1 showed the greatest effect, followed by Groups 2 and 3.

[0392] Example 6: Different Construction Orders of HSP70SBD Elements for HPV Antigen RNA Vaccines

[0393] mRNA lipid nanoparticles 1-3 were prepared using the preparation method described in Experimental Method 1. The information of mRNA lipid nanoparticles 1-3 is as follows:

[0394] The coding region of mRNA lipid nanoparticle 1 encodes signal peptide, HPV antigen, and HSP70SBD element from 5' to 3' end, and has a nucleotide sequence as shown in SEQ ID NO.34, wherein the HSP structure region has a nucleotide sequence as shown in SEQ ID NO.2.

[0395] The coding region of mRNA lipid nanoparticle 2 encodes signal peptide, HSP70SBD element, and HPV antigen from 5' to 3' end, and has a nucleotide sequence as shown in SEQ ID NO.39, wherein the HSP structure region has a nucleotide sequence as shown in SEQ ID NO.2.

[0396] The coding region of mRNA lipid nanoparticle 3 encodes HSP70SBD, signal peptide, and HPV antigen from the 5' end to the 3' end, and has a nucleotide sequence as shown in SEQ ID NO.40, wherein the HSP structure region has a nucleotide sequence as shown in SEQ ID NO.2.

[0397] 1. ICS detection of IFN-γ production after immunization

[0398] After one week of adaptive feeding, healthy C57BL / 6 mice were randomly divided into four groups (Group 1, Group 2, Group 3, and a control group). TC-1 cells expressing HPV16 E6 and HPV16 E7 were injected subcutaneously into the right flank of the C57BL / 6 mice. One million cells per mouse (in 50 μL PBS) were injected into the thigh muscles of the experimental and control groups on days 4, 7, and 13 after tumor inoculation. The following drugs were administered intramuscularly:

[0399] Group 1 received injection of drug: mRNA lipid nanoparticle 1;

[0400] Group 2 received injection of drugs: mRNA lipid nanoparticles 2;

[0401] Group 3 injected drugs: mRNA lipid nanoparticle 3;

[0402] The control group was injected with drugs: empty lipid nanoparticles (denoted as eLNP).

[0403] One week after the end of immunization, the spleens of mice in groups 1, 2, 3 and the control group were harvested and lymphocytes were isolated. After stimulating the lymphocytes with HPV16 E7 antigen peptide at a final concentration of 10 μg / mL for 6 hours, the cells were collected and the level of IFN-γ production in CD8+ cells was analyzed by flow cytometry.

[0404] The results are shown in Figure 13. Antigen-specific T cell responses were observed in all vaccine groups, showing significant differences compared to the control group. While there were no statistically significant differences in immune responses among the three vaccines, Group 1 showed the best response, followed by Groups 2 and 3.

[0405] 2. Cancer treatment outcomes

[0406] After one week of adaptive feeding, healthy C57BL / 6 mice were randomly divided into four groups (Group 1, Group 2, Group 3, and a control group). TC-1 cells expressing HPV16 E6 and HPV16 E7 were injected subcutaneously into the right flank of the C57BL / 6 mice. One million cells per mouse (in 50 μL PBS) were injected into the thigh muscles of the experimental and control groups on days 4, 7, and 13 after tumor inoculation. The following drugs were administered intramuscularly:

[0407] Group 1 received injection of drug: mRNA lipid nanoparticle 1;

[0408] Group 2 received injection of drugs: mRNA lipid nanoparticles 2;

[0409] Group 3 injected drugs: mRNA lipid nanoparticle 3;

[0410] The control group was injected with drugs: empty lipid nanoparticles (denoted as eLNP).

[0411] During the experiment, the general condition of the animals was observed twice daily, and the body weight of the mice was measured three times a week for more than 30 consecutive days. Tumor growth was monitored by measuring the tumor size in three dimensions using calipers. Tumor volume was calculated according to the following formula:

[0412] Volume (mm 3 )=length (mm)×width 2 (mm)÷2

[0413] The results are shown in Figure 14. All three vaccine-immunized groups showed significant inhibition of tumor growth, with significant differences compared to the control group. While there were no statistically significant differences in tumor volume between the three vaccines, Group 1 showed the greatest effect, followed by Groups 2 and 3.

[0414] Example 7 Effect of HSP70SBD Element in Colon Cancer Carcinoembryonic Antigen RNA Vaccine

[0415] mRNA lipid nanoparticles (denoted as mRNA-HSP70SBD) were prepared using the preparation method described in Experimental Method 1, wherein the coding region of the mRNA encodes the signal peptide, the Adpgk neoantigen, and the HSP70SBD element from the 5' end to the 3' end. The coding region of the mRNA has the nucleotide sequence shown in SEQ ID NO. 41, wherein the HSP structural region has the nucleotide sequence shown in SEQ ID NO. 2.

[0416] 1. ICS detection of IFN-γ production after immunization

[0417] After one week of adaptive feeding, healthy C57BL / 6 mice were randomly divided into two groups (experimental and control groups). MC38 cells expressing the Adpgk neoantigen (purchased from Beyotime, catalog number C7399) were injected subcutaneously into the right flank of the C57BL / 6 mice. One million cells per mouse (in 50 μL PBS) were injected into the thigh muscles of the experimental and control groups on days 4, 7, and 13 after tumor inoculation. The following drugs were administered:

[0418] The experimental group was injected with drugs: mRNA lipid nanoparticles (denoted as mRNA-HSP70 SBD);

[0419] The control group was injected with drugs: empty lipid nanoparticles (denoted as eLNP).

[0420] One week after the end of immunization, the spleens of the mice in the experimental and control groups were removed, and lymphocytes were isolated. After stimulating the lymphocytes with the Adpgk neoantigen peptide ASMTNMELM (synthesized by Wuhan Dangang Biotechnology Co., Ltd.) at a final concentration of 10 μg / mL for 6 hours, the cells were collected, and the level of IFN-γ production in CD8+ cells was analyzed by flow cytometry.

[0421] The measurement results are shown in FIG15 . In the mRNA-HSP70 SBD group, antigen-specific T cell responses were observed.

[0422] 2. Cancer treatment outcomes

[0423] After one week of adaptive feeding, healthy C57BL / 6 mice were randomly divided into two groups (experimental and control groups). MC38 cells expressing the Adpgk neoantigen were injected subcutaneously into the right flank of the C57BL / 6 mice, with 1 million cells per mouse (in 50 μL PBS). On days 4, 7, and 13 after tumor inoculation, the corresponding drug (injection volume: 50 μL, containing 5 μg of drug) was injected into the thigh muscle of the experimental and control groups:

[0424] The experimental group was injected with drugs: mRNA lipid nanoparticles (denoted as mRNA-HSP70 SBD);

[0425] The control group was injected with drugs: empty lipid nanoparticles (denoted as eLNP).

[0426] During the experiment, the general condition of the animals was observed twice daily, and the body weight of the mice was measured three times a week for more than 30 consecutive days. Tumor growth was monitored by measuring the tumor size in three dimensions using calipers. Tumor volume was calculated according to the following formula:

[0427] Volume (mm 3 )=length (mm)×width 2 (mm)÷2

[0428] The changes in mouse tumor volume are shown in FIG16 . Significant inhibition of mouse tumor growth was observed in the mRNA-HSP70 SBD group.

[0429] Example 8 Effect of HSP70SBD Element in Melanoma-associated Antigen RNA Vaccine

[0430] mRNA lipid nanoparticles (denoted as mRNA-HSP70SBD) were prepared using the method described in Experimental Method 1. The mRNA coding region, from the 5' end to the 3' end, encodes a signal peptide, a MAGE-1 antigen, and an HSP70SBD element. The mRNA coding region has the nucleotide sequence shown in SEQ ID NO. 42, and the HSP structural region has the nucleotide sequence shown in SEQ ID NO. 2.

[0431] 1. ICS detection of IFN-γ production after immunization

[0432] After one week of adaptive feeding, healthy C57BL / 6 mice were randomly divided into two groups (experimental and control groups). B16-F10 cells expressing the MAGE-1 antigen (purchased from the Chinese Academy of Sciences Cell Bank, catalog number SCSP-5233) were injected subcutaneously into the right flank of the C57BL / 6 mice. One million cells per mouse (in 50 μL PBS) were injected into the thigh muscles of the experimental and control groups on days 4, 7, and 13 after tumor inoculation. The following drugs were administered intramuscularly:

[0433] The experimental group was injected with drugs: mRNA lipid nanoparticles (denoted as mRNA-HSP70 SBD);

[0434] The control group was injected with drugs: empty lipid nanoparticles (denoted as eLNP).

[0435] One week after the end of immunization, the spleens of the mice in the experimental and control groups were removed and lymphocytes were isolated. After stimulating the lymphocytes with a final concentration of 10 μg / mL MAGE-1 antigen peptide library (synthesized by Wuhan Dangang Biotechnology Co., Ltd.) for 6 hours, the cells were collected and the level of IFN-γ production in CD8+ cells was analyzed by flow cytometry.

[0436] The measurement results are shown in FIG17 . In the mRNA-HSP70 SBD group, antigen-specific T cell responses were observed.

[0437] 2. Cancer treatment outcomes

[0438] After one week of adaptive feeding, healthy C57BL / 6 mice were randomly divided into two groups (experimental and control groups). B16F10 cells expressing the MAGE-1 antigen were injected subcutaneously into the right flank of the C57BL / 6 mice. One million cells per mouse were injected in 50 μL of PBS. On days 4, 7, and 13 after tumor inoculation, the corresponding drug (injection volume: 50 μL, containing 5 μg of drug) was injected into the thigh muscle of the experimental and control groups.

[0439] The experimental group was injected with drugs: mRNA lipid nanoparticles (denoted as mRNA-HSP70 SBD);

[0440] The control group was injected with drugs: empty lipid nanoparticles (denoted as eLNP).

[0441] During the experiment, the general condition of the animals was observed twice daily, and the body weight of the mice was measured three times a week for more than 30 consecutive days. Tumor growth was monitored by measuring the tumor size in three dimensions using calipers. Tumor volume was calculated according to the following formula:

[0442] Volume (mm 3 )=length (mm)×width 2 (mm)÷2

[0443] The changes in mouse tumor volume are shown in FIG18 . Significant inhibition of mouse tumor growth was observed in the mRNA-HSP70 SBD group.

[0444] The above detailed description is a specific description of one feasible embodiment of the present invention and is not intended to limit the scope of the present invention. It should be noted that any equivalent implementation or modification that does not depart from the present invention should be included within the scope of the technical solution of the present invention. Therefore, the scope of protection of the patent of this invention should be based on the attached requirements.

Claims

1. An RNA molecule, characterized in that The coding region of the RNA molecule includes an HSP structural region, a SIG structural region, and an AN structural region; the HSP structural region encodes the HSP protein family or variants, fragments, or derivatives thereof; the SIG structural region encodes a signal peptide; and the AN structural region encodes the same or different RNA antigenic peptides or proteins; The HSP protein family includes full-length elements, truncated elements or mutant forms of HSP70, HSP110, HSP10, HSP27, HSP40, HSP60, HSP90, HSPE1, HSPB1, HSPB3, gp96 or calreticulin.

2. The RNA molecule according to claim 1, characterized in that The HSP protein family includes full-length elements, truncated elements or mutant forms of HSP70 or HSP110.

3. The RNA molecule according to claim 2, characterized in that The HSP protein family includes HSP70 full-length elements, HSP70 SBD elements, HSP110 full-length elements or HSP110 SBD elements.

4. The RNA molecule according to claim 3, characterized in that The HSP protein family includes any one of the amino acid sequences shown in SEQ ID NOs. 5-8 or fragments, variants or derivatives thereof.

5. The RNA molecule according to claim 1, characterized in that The HSP structural region has any one of the nucleotide sequences shown in SEQ ID NO. 1-4.

6. The RNA molecule according to claim 1, characterized in that The AN structural region encodes one, two, three, four, five, six, seven, eight, nine or ten identical or different antigenic peptides or proteins.

7. The RNA molecule according to claim 1, characterized in that The RNA antigenic peptides or proteins include tumor antigens, viral antigens, bacterial antigens, protozoan antigens, fungal antigens, alloantigens or self-antigens.

8. The RNA molecule according to claim 1, characterized in that The tumor antigens include HPV16 E6, HPV16 E7, Adpgk or MAGE-1.

9. The RNA molecule according to claim 1, characterized in that The signal peptide includes an amino acid sequence as shown in any one of SEQ ID NOs. 9-14 or a fragment, variant or derivative thereof; the SIG structural region includes a nucleic acid sequence as shown in any one of SEQ ID NOs. 15-20 or a fragment, variant or derivative thereof.

10. The RNA molecule according to claim 1, characterized in that The coding region of the RNA molecule has the following structure: 5'-(SIG)a-(L)b-[(AN)c-(L)d]e-(HSP)m-3'; or 5'-(SIG)a-(L)b-[(HSP)m-(L)d]e-(AN)c-3'; or 5'-(HSP)m-(L)b-[(SIG)a-(L)d]e-(AN)c-3'; Wherein, the L structural region encodes a linker sequence; b and d are each independently selected from an integer of 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10; a, c, e, and m are each independently selected from an integer of 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

11. The RNA molecule according to claim 10, characterized in that The linker is a non-immunogenic linker, including an amino acid sequence such as GS, AAA, AGA or any one of SEQ ID NOs. 21-26, or a fragment, variant or derivative thereof; the L structural region includes a nucleic acid sequence such as GGCAGC, GCCGCCGCC, GCCGGCGCC or any one of SEQ ID NOs. 27-32, or a fragment, variant or derivative thereof.

12. The RNA molecule according to claim 1, characterized in that The G / C content in the nucleic acid sequence of the coding region of the RNA molecule is increased compared to the G / C content in the nucleic acid sequence of the corresponding wild-type RNA molecule; or the C content in the nucleic acid sequence of the coding region is increased compared to the C content in the nucleic acid sequence of the corresponding wild-type RNA molecule; or coding region of the codons in the nucleic acid sequence are adapted to human codon usage, wherein the codon adaptation index is increased or maximized in the RNA molecule nucleic acid sequence; and the amino acid sequence encoded by the RNA molecule nucleic acid sequence is unchanged compared to the amino acid sequence encoded by the corresponding wild-type RNA molecule nucleic acid sequence.

13. The RNA molecule according to claim 1, characterized in that The coding region of the RNA molecule has a nucleic acid sequence as shown in any one of SEQ ID NOs. 33-42; or a corresponding amino acid sequence encoded by the nucleic acid sequence as shown in any one of SEQ ID NOs. 33-42.

14. The RNA molecule according to claim 1, characterized in that The coding region of the RNA molecule is located between the 5'UTR and the 3'UTR.

15. The RNA molecule according to claim 1, characterized in that The RNA includes mRNA, viral RNA, replicon RNA or circular RNA.

16. The RNA molecule according to claim 1, characterized in that The RNA includes monocistronic RNA, bicistronic RNA or polycistronic RNA.

17. The RNA molecule according to claim 1, characterized in that The RNA is a modified RNA.

18. The RNA molecule according to claim 1, characterized in that The RNA molecule comprises a polyadenine sequence comprising 10 to 200, 10 to 100, 40 to 80 or 50 to 70 adenine nucleotides.

19. The RNA molecule according to claim 1, characterized in that The RNA molecule comprises a polycytosine sequence comprising 10 to 200, 10 to 100, 20 to 70, 20 to 60 or 10 to 40 cytosine nucleotides.

20. The RNA molecule according to claim 1, characterized in that The RNA molecule has the following structure: 5'CAP-5'UTR-(SIG)a-(L)b-[(AN)c-(L)d]e-(HSP)m-3'UTR-3'Ploy; or 5'CAP-5'UTR-(SIG)a-(L)b-[(AN)c-(L)d]e-(HSP)m-3'UTR-3'Ploy; or 5'CAP-5'UTR-(HSP)m-(L)b-[(SIG)a-(L)d]e-(AN)c-3'UTR-3'Ploy.

21. The RNA molecule according to claim 20, characterized in that The 5'CAP includes m7GpppN, ARCA cap or cap 1.

22. The RNA molecule according to claim 21, characterized in that The amino acid sequence of the 5'CAP is AG.

23. The RNA molecule according to claim 20, characterized in that The 5'-UTR includes a nucleic acid sequence as shown in SEQ ID NOs. 43-48 or a fragment, variant or derivative thereof; or a corresponding amino acid sequence encoded by the nucleic acid sequence as shown in any one of SEQ ID NOs. 43-48.

24. The RNA molecule according to claim 20, characterized in that The 3'-UTR includes a nucleic acid sequence as shown in SEQ ID NOs. 49-54 or a fragment, variant or derivative thereof; or a corresponding amino acid sequence encoded by the nucleic acid sequence as shown in any one of SEQ ID NOs. 49-54.

25. The RNA molecule according to claim 20, characterized in that The 3'Ploy comprises a polyadenine tail or a polycytosine tail.

26. The RNA molecule according to claim 25, characterized in that The polyadenine tail comprises 10 to 1000, 10 to 500, 10 to 300, 10 to 200, 10 to 100, 40 to 80 or 50 to 70 adenine nucleotides.

27. The RNA molecule according to claim 26, characterized in that The polycytosine tail comprises 10 to 200, 10 to 100, 20 to 70, 20 to 60 or 10 to 40 cytosine nucleotides.

28. A composition, characterized in that The composition comprises the RNA molecule according to any one of claims 1 to 27 and a pharmaceutically acceptable carrier or excipient thereof.

29. The composition according to claim 28, characterized in that The RNA molecule is complexed with one or more cationic or polycationic compounds.

30. The composition according to claim 29, characterized in that The cationic compound includes a cationic polymer, a cationic peptide or protein, a cationic polysaccharide or a cationic lipid; the polycationic compound includes a polycationic polymer, a polycationic peptide or protein, a polycationic polysaccharide or a polycationic lipid.

31. The composition according to claim 30, characterized in that The RNA molecule is complexed with one or more cationic lipids or polycationic lipids to form lipid nanoparticles, lipid complexes or liposomes.

32. The composition according to claim 29, characterized in that The N / P ratio of the RNA molecule to the cationic compound or polycationic compound is comprised between 0.1 and 10:

1.

33. The composition according to claim 32, characterized in that The N / P ratio of the RNA molecule to the cationic compound or polycationic compound is 6:

1.

34. Use of the RNA molecule according to any one of claims 1 to 27 or the composition according to any one of claims 28 to 33 in the preparation of a medicament or a kit.

35. The use according to claim 34, characterized in that The use is achieved by administering an effective dose of the RNA molecule or composition to a subject in need thereof.

36. The use according to claim 35, characterized in that The application includes application in the preparation of drugs or kits for preventing, treating or diagnosing tumors, cancers, infectious diseases, autoimmune diseases, graft-versus-host diseases or allergic reactions.

37. The use according to claim 34, characterized in that The medicine is a vaccine.

38. A vaccine, characterized in that The vaccine comprises the RNA molecule according to any one of claims 1 to 27 or the composition according to any one of claims 28 to 33.

39. The vaccine according to claim 38, characterized in that The vaccine is suitable for subcutaneous, intradermal, intradermal, topical or transdermal administration.

40. A kit, characterized in that The kit comprises the RNA molecule according to any one of claims 1 to 27 or the composition according to any one of claims 28 to 33.

41. The kit according to claim 40, characterized in that The kit may also include a liquid carrier or instructions for administration and dosage information for the RNA molecule or composition.

42. An in vitro cell treatment method, characterized in that The method comprises: (1) Providing cells in vitro; (2) contacting the cell described in step (1) with the RNA molecule described in any one of claims 1 to 27, the composition described in any one of claims 28 to 33, the vaccine described in any one of claims 38 to 39, or the kit described in any one of claims 40 to 41.

Citation Information

Patent Citations

  • Heat shock protein binding compounds, compositions, and methods for making and using same

    CN108752280A

  • Fusion proteins for use as immunogenic enhancers for inducing antigen-specific t cell responses

    CN109535228A

  • Novel nucleic acid molecules

    CN111328287A

  • Immune enhancement RNA molecule and composition, vaccine and kit thereof

    CN118389553A

  • Immunogens for HIV vaccination

    US20150050310A1