Microorganism comprising nicotinamide nucleotide transhydrogenase derived from edwardsiella tarda, and method for producing l-amid acids or derivatives thereof using same

Abstract

The present application relates to a Corynebacterium sp. microorganism which has increased ability to produce L-amino acids or derivatives thereof, and in which a foreign nicotinamide nucleotide transhydrogenase protein is expressed or a polynucleotide encoding same is introduced.

Description

Microorganism containing nicotinamide nucleotide transhydrogenase derived from Edwardsiella talda and method for producing L-amino acid or derivative thereof using the same

[0001] The present application relates to a Corynebacterium microorganism having an improved ability to produce L-amino acids or derivatives thereof, into which a foreign nicotinamide nucleotide transhydrogenase protein or a polynucleotide encoding the same has been introduced; a method for producing L-amino acids or derivatives thereof, comprising a step of culturing the microorganism in a medium; a composition for producing L-amino acids or derivatives thereof, comprising the microorganism, a culture of the microorganism, a fermentation product of the microorganism, or a combination of two or more thereof; and a use of the microorganism for producing L-amino acids or derivatives thereof.

[0002] Coryneform microorganisms are Gram-positive microorganisms frequently used industrially to produce a variety of materials, including L-amino acids and various nucleic acids, for use in feed, pharmaceuticals, and food. Recently, coryneform microorganisms have also been used to produce diamines and keto acids.

[0003] To produce useful products through microbial fermentation, the demand for energy sources or reducing power increases along with the strengthening of the biosynthetic pathway of the target product in microorganisms. Among these, NADPH (nicotinamide adenine dinucleotide phosphate) is an essential element for supplying reducing power. The oxidized form, NADP+, and the reduced form, NADPH, are electron transport substances in the body and are involved in various synthetic processes. Among the central metabolic pathways, it is known that NADPH is mainly produced by 1) the oxidative pentose phosphate pathway and 2) the NADP-dependent isocitrate dehydrogenase (Icd gene) of the tricarboxylic acid (TCA) pathway. In addition, various alternative pathways for supplying NADPH in various microorganisms include malate enzyme and glucose dehydrogenase. It has nonphosphorylation glyceraldehyde-3-phosphate dehydrogenase.

[0004] Additionally, enzymes that produce NADPH independent of the central metabolic pathway include transhydrogenase and ferredoxin:NADP+oxidoredutase.

[0005] With the coexistence of various pathway enhancements and the demand for energy sources or reducing power, there is still a growing need for methods to increase the productivity of the desired L-amino acid or its derivatives.

[0006]

[0007] [Prior Art Literature]

[0008] [Patent Document]

[0009] (Patent Document 1) 1. U.S. Patent Publication No. US 7629142 B2

[0010] The problem to be solved by the present application is to provide a microorganism having improved ability to produce L-amino acids or derivatives thereof, into which an exogenous nicotinamide nucleotide transhydrogenase has been introduced.

[0011]

[0012] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application can also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application is not limited by the specific descriptions described below. Furthermore, numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated into this specification in their entirety by reference to more clearly explain the level of the technical field to which this application belongs and the contents of this application.

[0013]

[0014] One aspect of the present application provides a Corynebacterium microorganism having improved ability to produce L-amino acids or derivatives thereof, into which a nicotinamide nucleotide transhydrogenase protein derived from Edwardsiella talda or a polynucleotide encoding the same has been introduced.

[0015]

[0016] In this application, the term "nicotinamide nucleotide transhydrogenase" refers to [H + + NADP + + NADH ↔ H + + NADPH + NAD +] It is an enzyme that maintains the redox balance of the cell through a reaction, and exists as a homodimer with each protomer containing two soluble nucleotide binding domains that mediate the transfer of hydride between NAD(H) and NADP(H) and a proton-translocating transmembrane domain, and in the present application, it may mean a transmembrane pyridine nucleotide transhydrogenase that catalyzes the reduction of NADP+ to NADPH through the oxidation of NADH to NAD+ and is composed of two subunits each encoded by the pntA and pntB genes. Specifically, the nicotinamide nucleotide transhydrogenase of the present application is a protein having nicotinamide nucleotide transhydrogenase activity encoded by the pntAB (pntA and pntB) gene, and can be used interchangeably with PntAB, but is not particularly limited in type as long as it has an activity corresponding to nicotinamide nucleotide transhydrogenase. The nicotinamide nucleotide transhydrogenase encoded by the pntAB gene is known in the art, and the amino acid and polynucleotide sequences of the nicotinamide nucleotide transhydrogenase can be obtained from known data databases, such as, but not limited to, NCBI's GenBank.

[0017] For example, the nicotinamide nucleotide transhydrogenase derived from Edwardsiella talda may be composed of an alpha subunit PntA and a beta subunit PntB.

[0018] In addition, the alpha subunit PntA of the nicotinamide nucleotide transhydrogenase protein derived from Edwardsiella talda may be composed of or include an amino acid sequence of SEQ ID NO: 18 or an amino acid sequence having 60% or more homology or identity therewith, and the beta subunit PntB may be composed of or include an amino acid sequence of SEQ ID NO: 19 or an amino acid sequence having 60% or more homology or identity therewith, but is not limited thereto as long as it has nicotinamide nucleotide transhydrogenase protein activity. Specifically, even if it includes a sequence in which some sequences in the amino acid sequences of SEQ ID NOs: 18 and 19 are deleted, modified, substituted or added, as long as it is a protein that exhibits an effect corresponding to the nicotinamide nucleotide transhydrogenase protein, it may be included in the nicotinamide nucleotide transhydrogenase protein. In addition, PntA and PntB of the nicotinamide nucleotide transhydrogenase protein derived from Edwardsiella talda may have, include, consist of, or essentially consist of an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity with the amino acid sequences of SEQ ID NOs: 18 and 19, respectively. It is obvious that if it is an amino acid sequence having the homology or identity and exhibiting an effect corresponding to the protein, it is included within the scope of the present application even if it has an amino acid sequence in which some of the sequences are deleted, modified, substituted, or added.

[0019]

[0020] Even if the present application describes a "polypeptide (or protein) comprising an amino acid sequence described by a specific sequence number," a "polypeptide (or protein) consisting of an amino acid sequence described by a specific sequence number," or a "polypeptide (or protein) having an amino acid sequence described by a specific sequence number," it is obvious that a protein having an amino acid sequence in which a portion of the sequence is deleted, modified, substituted, or added can also be used in the present application, as long as it has the same or corresponding activity as the polypeptide or protein consisting of the amino acid sequence of the corresponding sequence number. For example, this includes cases in which the protein has an addition of a sequence that does not alter the function of the protein at the N-terminus and / or C-terminus, a mutation that may occur naturally, a silent mutation thereof, or a conservative substitution.

[0021] The term "conservative substitution" refers to the replacement of one amino acid with another amino acid with similar structural and / or chemical properties. Such amino acid substitutions may generally be based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on protein activity.

[0022]

[0023] In this application, the terms "identity" or "homology" refer to the degree of similarity between two given amino acid or base sequences, which may be expressed as a percentage. In this application, "homology" and "identity" may often be used interchangeably.

[0024] Sequence homology or identity of conserved polynucleotides or polypeptides (including proteins) is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences are generally capable of hybridizing under moderate or high stringency conditions with the entire sequence or a portion thereof that is at least about 50%, 60%, 70%, 80%, or 90% of the entire sequence. It should be appreciated that hybridization also includes hybridization with polynucleotides containing common codons or codons that are considered codon degeneracy.

[0025] Whether any two polynucleotide or polypeptide (including protein) sequences have homology, similarity or identity can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example, as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be determined using the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA / .](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity can be determined using BLAST or ClustalW of the National Center for Biotechnology Information Database.

[0026] Homology, similarity, or identity of polynucleotides or polypeptides (including proteins) can be determined by comparing sequence information, for example, using a GAP computer program such as that of Needleman et al. (1970), J Mol Biol. 48:443, as disclosed, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482. In brief, the GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). Default parameters for the GAP program include (1) a binary comparison matrix (containing values ​​of 1 for identity and 0 for non-identity) and (2) a binary comparison matrix as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979), Gribskov et al. (1986) Nucl. Acids Res. 14: 6745 weighted comparison matrix (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10 and a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0027] Additionally, whether any two polynucleotide sequences have homology, similarity or identity can be determined by comparing the sequences by Southern hybridization experiments under appropriate hybridization conditions, which are within the scope of the art and can be determined by methods well known to those skilled in the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F. M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York), but are not limited thereto.

[0028]

[0029] In this application, the term "polynucleotide" is a polymer of nucleotides in which nucleotide units (monomers) are covalently bonded to form a long chain, and is a DNA strand of a certain length or longer.

[0030] In addition, the sequence of a polynucleotide encoding a nicotinamide nucleotide transhydrogenase protein derived from Edwardsiella talda having the amino acid sequences of SEQ ID NO: 18 and SEQ ID NO: 19 or an amino acid sequence having 60% or more homology or identity therewith can be obtained, for example, based on codon information known in the art. For example, the alpha subunit PntA and the beta subunit PntB of the nicotinamide nucleotide transhydrogenase protein have the sequences of SEQ ID NO: 28 and SEQ ID NO: 29, respectively; Or it may be encoded by a polynucleotide having or comprising a base sequence having at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology or identity with the sequence of SEQ ID NO: 28 and SEQ ID NO: 29, or consisting of or consisting essentially of said base sequence, but is not limited thereto.

[0031] Additionally, the base sequences of the above sequence numbers 28 and 29 can be obtained from known databases, including, but not limited to, NCBI's GenBank.

[0032]

[0033] In the present application, the polynucleotide (gene) including the base sequences of SEQ ID NO: 28 and SEQ ID NO: 29 may be used interchangeably with a polynucleotide (gene) having the base sequences of SEQ ID NO: 28 and SEQ ID NO: 29, a polynucleotide (gene) consisting of the base sequences of SEQ ID NO: 28 and SEQ ID NO: 29, or pntAB.

[0034]

[0035] The polynucleotide of the present application may be modified in various ways in the coding region without changing the amino acid sequence of the nicotinamide nucleotide transhydrogenase protein of the present application due to codon degeneracy or in consideration of the codons preferred in the organism that is to express the nicotinamide nucleotide transhydrogenase protein of the present application. Therefore, it is obvious that the polynucleotide of the present application may also include a polynucleotide that can be translated into a polypeptide consisting of the amino acid sequence of the nicotinamide nucleotide transhydrogenase protein of the present application or a polypeptide having at least 60% homology or identity therewith due to codon degeneracy. For example, the polynucleotide of the present application may be SEQ ID NO: 28 and SEQ ID NO: 29; or a degenerated sequence thereof.

[0036] As another example, the polynucleotide of the present application may have or include a base sequence that is at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homologous or identical to SEQ ID NO: 28 and SEQ ID NO: 29, or may consist of or consist essentially of a base sequence that is at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homologous or identical to SEQ ID NO: 2, but is not limited thereto.

[0037] In addition, the polynucleotide of the present application may include, without limitation, a probe that can be prepared from a known genetic sequence, for example, a probe that can hybridize under stringent conditions with a complementary sequence to all or part of the polynucleotide sequence of the present application, and a sequence encoding the nicotinamide nucleotide transhydrogenase protein of the present application.

[0038]

[0039] In this application, the term "stringent conditions" refers to conditions that enable specific hybridization between polynucleotides. Such conditions are specifically described in the literature (e.g., J. Sambrook et al., supra). For example, it may be a condition in which polynucleotides having high homology or identity, specifically 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, or 90% or more, more specifically 95% or more, 96% or more, 97% or more, 98% or more, and even more specifically 99% or more, hybridize with each other, and polynucleotides having lower homology or identity do not hybridize with each other, or a condition in which washing is performed once, specifically twice or three times, at a salt concentration and temperature corresponding to 60°C, 1XSSC, 0.1% SDS, specifically 60°C, 0.1XSSC, 0.1% SDS, and more specifically 68°C, 0.1XSSC, 0.1% SDS, which are washing conditions of typical southern hybridization.

[0040] The above hybridization can occur between nucleotides having complementary sequences of bases, but the hybridized polynucleotides may contain some mismatches between bases, depending on the stringency of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, in DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Accordingly, the polynucleotides of the present application may also include isolated nucleic acid fragments that are complementary in their entirety, as well as substantially similar nucleic acid sequences.

[0041] Specifically, polynucleotides having homology or identity can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. In addition, the Tm value may be, but is not limited to, 60°C, 63°C, or 65°C and can be appropriately adjusted by those skilled in the art.

[0042] The appropriate stringency for hybridizing polynucleotides depends on the length and degree of complementarity of the polynucleotides, variables which are well known in the art (J. Sambrook et al., supra).

[0043] For example, homologous or identical polynucleotide sequences can generally hybridize along at least about 50%, 60%, 70%, 80%, or 90% of their entire length, or their entire length, under stringent conditions.

[0044]

[0045] In this application, "vector" refers to a DNA construct for delivering a target polynucleotide into a suitable host or host cell. For example, it may comprise, but is not limited to, a base sequence of a polynucleotide encoding a target polypeptide or protein operably linked to a suitable expression control region (or expression control sequence) so as to enable expression of the target polypeptide or protein in a suitable host.

[0046] The above expression control region may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. After being transformed into a suitable host cell (microorganism), the vector may replicate or function independently of the host genome, or may be integrated into the genome itself to replicate or function.

[0047] The vector of the present application may be, but is not limited to, an insertion vector for inserting a polynucleotide into a chromosome for introducing or increasing the activity of the foreign nicotinamide nucleotide transhydrogenase protein of the present application. The insertion of the polynucleotide into the chromosome may be accomplished by any method known in the art, for example, but is not limited to, homologous recombination. The vector may further include a selection marker for confirming whether the vector has been transformed into a host cell or further, whether the vector has been inserted into a chromosome within the host cell. The selection marker is used to select cells transformed with the vector or to confirm whether the target polynucleotide has been inserted into the chromosome, and markers that confer a selectable phenotype, such as drug resistance, nutrient requirement, cytotoxic agent resistance, or expression of a surface polypeptide or protein, may be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, thereby allowing the selection of transformed cells. The above insertion vector may not contain an origin of replication required for replication within the transformed cell.

[0048] The vector used in the present application is not particularly limited, and any vector known in the art can be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pDZ series, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series can be used as plasmid vectors. Specifically, pDZ, pDC, pDCM2, pDC24, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors can be used.

[0049]

[0050] In this application, the term "transformation" refers to changing the genetic characteristics of a host cell (microorganism) by introducing a target polynucleotide and / or a vector containing the same into the host cell. In this application, transformation may refer to changing the genetic characteristics of a host cell by introducing a vector containing a polynucleotide for introducing or increasing the activity of an exogenous nicotinamide nucleotide transhydrogenase protein into the host cell. The transformed polynucleotide may be inserted into the chromosome of the host cell or located extrachromosomally. In addition, the polynucleotide may include DNA and / or RNA encoding the target protein (e.g., nicotinamide nucleotide transhydrogenase protein, pntAB protein). The polynucleotide may be introduced in an appropriate form depending on the purpose of introduction. For example, a polynucleotide for expressing a target protein may be introduced into a host cell in the form of an expression cassette, which is a genetic construct containing all elements necessary for its own expression. The above expression cassette may typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal, which are operably linked to the coding sequence of the target polypeptide. The expression cassette may be in the form of a self-replicating expression vector. In addition, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence necessary for expression in the host cell, but is not limited thereto.

[0051] As used herein, the term "operably linked" refers to a configuration in which a regulatory sequence is positioned at an appropriate location to control the expression of a coding sequence. Therefore, "operably linked" includes a regulatory region of a functional domain with a known or desired activity, such as a promoter, terminator, signal sequence, or enhancer region, attached or linked to a target (gene or polypeptide) so that the expression, secretion, or function of the target can be controlled according to the known or desired activity. For example, it may mean that a promoter sequence that initiates and mediates transcription of a polynucleotide encoding a polypeptide is functionally linked to the polynucleotide sequence.

[0052] The method for transforming the vector of the present application includes any method for introducing nucleic acids into cells, and can be performed by selecting an appropriate standard technique known in the art depending on the host cell. Examples thereof include, but are not limited to, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and lithium acetate-DMSO method.

[0053]

[0054] In this application, the term "microorganism (or strain)" includes both wild-type microorganisms and prokaryotic or eukaryotic microorganisms that have undergone genetic modification, either naturally or artificially. It may be a microorganism that has a specific mechanism weakened or increased due to a cause such as the insertion of an external gene or the increased or inactivated activity of an endogenous gene, and may be a microorganism that includes genetic modification for the production of a desired polypeptide, protein, or product. In this application, the terms "microorganism," "strain," "host," and "host cell" may be used interchangeably.

[0055] As used herein, the term "recombinant microorganism" refers to a microorganism that has been genetically modified to exhibit a different genotype and / or phenotype compared to a naturally occurring microorganism (e.g., when the genetic modification affects the nucleic acid sequence coding of the microorganism), and may include all progeny or potential progeny of the microorganism. The terms "recombinant microorganism," "genetically modified microorganism," "recombinant host cell," "recombinant cell," and "recombinant strain" may be used interchangeably in this application. The recombinant microorganism may, for example, express a gene not found in its native (non-recombinant) form; may not express a gene expressed in its native form; or may express a native gene in a manner different from that in which it is expressed in its native form.

[0056]

[0057] For the purpose of the present application, the microorganism of the present application may include any microorganism capable of producing a desired L-amino acid or a derivative thereof by introducing an exogenous nicotinamide nucleotide transhydrogenase protein or a polynucleotide encoding the same. For example, the microorganism of the present application is characterized by having an increased ability to produce L-amino acids or derivatives thereof by introducing an exogenous nicotinamide nucleotide transhydrogenase protein or a polynucleotide encoding the same, and may be a genetically modified microorganism or a recombinant microorganism, but is not limited thereto. Specifically, the recombinant strain having an increased ability to produce L-amino acids or derivatives thereof may be a microorganism having an increased ability to produce L-amino acids or derivatives thereof compared to a natural wild-type microorganism or an unmodified microorganism having an intrinsic activity of nicotinamide nucleotide transhydrogenase or lacking an intrinsic activity of nicotinamide nucleotide transhydrogenase, but is not limited thereto.

[0058] For example, a microorganism having the ability to produce L-amino acids or derivatives thereof may include a prokaryotic or eukaryotic microorganism strain capable of producing L-amino acids or derivatives thereof within the organism, and may include a microorganism that inherently has the ability to produce L-amino acids or derivatives thereof, or a microorganism that is endowed with the ability to produce L-amino acids or derivatives thereof due to the activity of the foreign nicotinamide nucleotide transhydrogenase protein introduced into a parent strain of the present application that does not have the ability to produce L-amino acids or derivatives thereof. The ability to produce L-amino acids or derivatives thereof may be endowed or enhanced by species improvement.

[0059]

[0060] The microorganism of the present application may include any microorganism into which an exogenous nicotinamide nucleotide transhydrogenase protein or a polynucleotide encoding the same has been introduced by various known methods.

[0061]

[0062] For example, the recombinant microorganism with improved ability to produce L-amino acids or derivatives thereof of the present application may include all microorganisms with improved ability to produce L-amino acids or derivatives thereof by being transformed through a vector into which a foreign gene encoding the nicotinamide nucleotide transhydrogenase of the present application, specifically, a foreign gene encoding the nicotinamide nucleotide transhydrogenase derived from Edwardsiella talda, is introduced.

[0063]

[0064] For example, the microorganism having improved ability to produce the L-amino acid or its derivatives may be a microorganism into which a polynucleotide sequence encoding a protein comprising an amino acid sequence of SEQ ID NO: 18 and SEQ ID NO: 19, or a protein comprising an amino acid sequence having at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity with the amino acid sequence of SEQ ID NO: 18 and SEQ ID NO: 19 has been introduced.

[0065]

[0066] For example, the microorganism having improved ability to produce the L-amino acid or its derivatives may be a microorganism into which a polynucleotide capable of encoding a protein including an amino acid sequence having at least 80% homology with the amino acid sequences of SEQ ID NO: 18 and SEQ ID NO: 19 has been introduced; or a polynucleotide including a base sequence having at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology or identity with the base sequences of SEQ ID NO: 28 and SEQ ID NO: 29 has been introduced.

[0067]

[0068] For example, the microorganism with improved L-amino acid or derivative production ability of the present application may be a microorganism with increased L-amino acid production ability compared to a non-modified microorganism, but is not limited thereto. For example, the non-modified microorganism, which is the target strain for comparing whether the L-amino acid production ability is increased, may be CA09-0903, CJ1R, KCCM12120P, KCCM11201P, CJ3P strains, but is not limited thereto.

[0069] For example, the microorganism with improved L-amino acid production ability has an L-amino acid production ability of about 1% or more, specifically, about 1% or more, about 2.5% or more, about 5% or more, about 6% or more, about 7% or more, about 8% or more, about 9% or more, about 10% or more, about 15% or more, about 16% or more, about 17% or more, about 18% or more, about 19% or more, about 20% or more, about 21% or more, about 22% or more, about 23% or more, about 24% or more, about 25% or more, about 26% or more, about 27% or more, about 28% or more, about 29% or more, about 30% or more, about 31% or more, about 32% or more, about 33% or more, about 34% or more, about It may be increased by 35% or more, about 36% or more, about 37% or more, about 39% or more, about 40% or more, about 45% or more, about 50% or more, about 55% or more, about 60% or more, about 65% or more, about 70% or more, about 75% or more, or about 80% or more (the upper limit is not particularly limited, and may be, for example, about 200% or less, about 150% or less, about 100% or less, about 90% or less, about 80% or less, about 70% or less, about 60% or less, about 50% or less, about 45% or less, about 40% or less, about 35% or less, about 30% or less, about 25% or less, or about 20% or less), but is not limited thereto as long as it has a positive increase compared to the productivity of the parent microorganism (parent strain) before mutation or the unmodified microorganism. In another example, the recombinant strain with increased L-amino acid productivity has an L-amino acid productivity of about 1.1 times or more, about 1.15 times or more, about 1.16 times or more, about 1.17 times or more, about 1.18 times or more, about 1.19 times or more, about 1.2 times or more, about 1.21 times or more, about 1.22 times or more, about 1.23 times or more, about 1.24 times or more, about 1.25 times or more, about 1.26 times or more, about 1.27 times or more, about 1.28 times or more, about 1.29 times or more, about 1.3 times or more, or about 1.31 times or more, about 1.32 times or more, about 1.33 times or more, about 1.34 times or more, about 1.35 times or more, about 1.36 times or more, about 1.37 times or more, about 1.38 times or more, about 1.39 times or more, about 1.4 times or more, about 1.45 times or more, about 1.5 times or more, about 1.55 times or more, about 1.6 times or more, about 1.65 times or more, about 1.7 times or more, about 1.75 times or more, or about 1.8 times or more (there is no special limitation on the upper limit, for example, about 10 times or less, about 5 times or less, about 3 times or less, about 2 times or less, about 1.9 times or less, about 1.8 times or less, about 1.7 times or less, about 1.6 times or less, about 1.5 times or less, about 1.4 times or less, about It may be increased by, but is not limited to, 1.3 times or less or about 1.2 times or less.

[0070] The term "about" above includes, but is not limited to, a range including ±0.5, ±0.4, ±0.3, ±0.2, ±0.1, etc., and includes all numerical values ​​in a range equal to or similar to the numerical value following the term "about."

[0071] In the present application, the term "unmodified microorganism (strain)" does not exclude a microorganism (strain) that contains a mutation that may occur naturally, and may refer to a wild-type microorganism (strain) or a natural microorganism (strain) itself, or a microorganism (strain) before its phenotype is changed by a genetic mutation caused by natural or artificial factors. For example, the unmodified microorganism may refer to a strain in which the nicotinamide nucleotide transhydrogenase protein of the present application is not expressed, or the expression is not increased, or before it is increased. In addition, as a specific example, the unmodified microorganism may refer to a strain in which the foreign nicotinamide nucleotide transhydrogenase protein of the present application is not expressed, or the expression is not increased, or before it is increased. In this case, the foreign nicotinamide nucleotide transhydrogenase protein may be derived from Edwardsiella talda, but is not limited thereto.

[0072] The above “unmodified microorganism” may be used interchangeably with “pre-modified microorganism (strain)”, “unmodified microorganism (strain)”, “parent microorganism”, “parent strain”, “wild type microorganism (strain)” or “reference microorganism (strain)”.

[0073]

[0074] For example, the microorganism with improved ability to produce L-amino acid or a derivative thereof of the present application may be either a prokaryotic cell or a eukaryotic cell, but may specifically be a prokaryotic cell. The prokaryotic cell may include, but is not limited to, microorganisms belonging to the genus Escherichia sp., Erwinia sp., Serratia sp., Providencia sp., Corynebacteria sp., Pseudomonas sp., Leptospira sp., Salmonella sp., Brevibacteria sp., Hypomononas sp., Chromobacterium sp., and Norcardia sp., or fungi or yeasts. Specifically, the prokaryotic cell may include microorganisms belonging to the genus Escherichia, Corynebacterium, and Leptospira, and yeasts. More specifically, it may be a microorganism of the genus Corynebacterium.

[0075] As a microorganism according to any one of the preceding specific examples, the microorganism of the present application may be a microorganism of the genus Corynebacterium.

[0076] As an example of the present application, the microorganism of the present application is Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium ammoniagenes, Corynebacterium It may be Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris, or Corynebacterium flavescens. Specifically, the microorganism of the present application may be a microorganism of the genus Corynebacterium, more specifically, Corynebacterium glutamicum, but is not limited thereto.

[0077] Specifically, the microorganism of the present application may be a microorganism of the genus Corynebacterium, more specifically, Corynebacterium glutamicum, but is not limited thereto.

[0078] Meanwhile, the Corynebacterium genus microorganism with improved L-amino acid or derivative production ability of the present application may include a natural wild-type microorganism itself, a Corynebacterium genus microorganism with improved L-amino acid production ability by increasing or decreasing the activity of a gene related to the L-amino acid production mechanism, or a Corynebacterium genus microorganism with improved L-amino acid production ability by introducing or increasing the activity of an external gene. As a specific example, it may include a Corynebacterium genus microorganism with improved L-amino acid production ability by increasing reducing power through the activity of an exogenous nicotinamide nucleotide transhydrogenase protein introduced into an unmodified microorganism, but is not limited thereto.

[0079]

[0080] In this application, the term "increase" of protein (polypeptide) activity means that the activity of the protein (polypeptide) within a host cell (microorganism) is increased compared to its intrinsic activity. The increase may be used interchangeably with terms such as activation, up-regulation, overexpression, and enhancement. The host cell (microorganism) may be a prokaryotic or eukaryotic microorganism.

[0081] The increase in the above protein (polypeptide) activity may include the display of a protein (polypeptide) activity that the host cell (microorganism) did not inherently possess, or the display of an enhanced protein (polypeptide) activity compared to the inherent activity or activity before modification.

[0082] For example, the above “exhibiting a protein (polypeptide) activity that was not inherently present” or “exhibiting an improved protein (polypeptide) activity” may be due to, but is not limited to, “introduction of a protein (polypeptide).”

[0083] In this application, the term "introduction" of a protein (polypeptide) means that a gene that a microorganism did not originally possess is expressed within the microorganism, thereby causing the activity of a specific protein to be exhibited, or that the activity of the polypeptide is strengthened, increased, or improved compared to the intrinsic activity of the protein or the activity before modification. For example, this may be due to the introduction of a gene encoding the protein (polypeptide) into a host cell (microorganism). For example, a polynucleotide encoding a specific protein (polypeptide) may be introduced into the chromosome of a host cell (microorganism), or a vector containing a polynucleotide encoding a specific protein (polypeptide) may be introduced into the host cell (microorganism), thereby causing the activity of the protein (polypeptide) to be exhibited or improved.

[0084] The above "intrinsic activity" refers to the activity of a specific protein (polypeptide) originally possessed by a host cell (microorganism) or an untransformed host cell (microorganism) before transformation, when the trait changes due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with "activity before transformation."

[0085] An increase in the activity of a protein (polypeptide) compared to the intrinsic activity means that the activity and / or concentration (expression amount) of the protein (polypeptide) of the host cell (microorganism) is enhanced compared to the activity and / or concentration (expression amount) of the protein (polypeptide) originally present in the host cell (microorganism) before transformation or in the non-transformed host cell (microorganism).

[0086] For example, the increase may be, but is not limited to, an increase in the activity or concentration of the corresponding protein (polypeptide) from a previous state, or an increase in the activity or concentration thereof, typically by at least about 1%, at least about 10%, at least about 25%, at least about 50%, at least about 75%, at least about 100%, at least about 150%, at least about 200%, at least about 300%, at least about 400%, or at least about 500%, up to at least about 1000% or at least about 2000%, relative to the activity or concentration in the host cell (microorganism) before transformation or in the untransformed host cell (microorganism).

[0087] An increase in the activity of the above protein (polypeptide) can be achieved by introducing an exogenous protein (polypeptide) or by increasing the activity of an endogenous protein (polypeptide). Whether the activity of the above protein (polypeptide) has increased can be confirmed by an increase in the activity level of the protein (polypeptide), the expression level, or the amount of a product resulting from the activity of the protein (polypeptide).

[0088] The increase in the activity of the above protein (polypeptide) can be achieved by various methods well known in the art, and is not limited thereto, as long as the activity of the target protein (polypeptide) can be increased compared to the host cell (microorganism) before transformation. Specifically, it may be achieved by using genetic engineering and / or protein engineering, which are routine methods of molecular biology and are well known to those skilled in the art, but are not limited thereto (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).

[0089] Specifically, the increase in activity of the protein (polypeptide) of the present application is

[0090] 1) Increase in the intracellular copy number of a polynucleotide encoding a protein (polypeptide);

[0091] 2) Modification of the gene expression control region on the chromosome that codes for a protein (polypeptide) (e.g., introduction of a mutation in the expression control region, replacement with a sequence having stronger activity, or insertion of a sequence having stronger activity);

[0092] 3) Modification of the base sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a protein (polypeptide);

[0093] 4) Modification of the amino acid sequence of the protein (polypeptide) so as to increase the activity of the protein (polypeptide);

[0094] 5) Modification of a polynucleotide sequence encoding a protein (polypeptide) such that the activity of the protein (polypeptide) is increased (e.g., modification of a polynucleotide sequence of a protein (polypeptide) encoding gene such that the protein (polypeptide) is modified such that the activity of the protein (polypeptide) is increased);

[0095] 6) Introduction of a foreign protein (polypeptide) that exhibits the activity of a protein (polypeptide) or a foreign polynucleotide encoding the same;

[0096] 7) Codon optimization of polynucleotides encoding proteins (polypeptides);

[0097] 8) Analyze the tertiary structure of a protein (polypeptide) to select the exposed area and modify or chemically modify it;

[0098] 9) Control of cellular localization of proteins (polypeptides); or

[0099] 10) It may be a combination of two or more selected from 1) to 9), but is not particularly limited thereto.

[0100] for example,

[0101] The increase in the intracellular copy number of the polynucleotide encoding the protein (polypeptide) described above 1) may be caused by introducing a vector containing a polynucleotide encoding the protein (polypeptide) operably linked to an appropriate regulatory sequence into a host cell (microorganism). Alternatively, one copy or two or more copies of the polynucleotide encoding the protein (polypeptide) operably linked to an appropriate regulatory sequence may be introduced into a chromosome within the host cell (microorganism). The introduction into the chromosome may be performed by introducing a vector capable of inserting the polynucleotide into the chromosome within the host cell (microorganism), but is not limited thereto. The vector is as described above. The regulatory sequence may be a natural sequence (same in origin) or a foreign sequence (derived from another gene) to the polynucleotide sequence it encodes, or a mutant sequence thereof, or another artificial sequence, and may induce expression of the polynucleotide within the host cell (microorganism). As an example of implementation, the regulatory sequence of the gene (pntAB) encoding the nicotinamide nucleotide transhydrogenase protein derived from Edwardsiella talda of the present application may be, but is not limited to, the PgapA promoter.

[0102]

[0103] 2) The replacement of the gene expression control region (or expression control sequence) on the chromosome encoding the protein (polypeptide) with a sequence having strong activity may be, for example, introducing a mutation in the sequence by deletion, insertion, substitution, or a combination thereof to further increase the activity of the expression control region, or replacement with a sequence having stronger activity. The expression control region may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. As an example, the original promoter may be replaced with a strong promoter, but is not limited thereto.

[0104] Examples of known strong promoters include, but are not limited to, the cj1 to cj7 promoters (US Patent No. US 7662943 B2), the lac promoter, the trp promoter, the trc promoter, the tac promoter, the lambda phage PR promoter, the PL promoter, the tet promoter, the gapA promoter, the SPL7 promoter, the SPL13 (sm3) promoter (US Patent No. US 10584338 B2), the O2 promoter (US Patent No. US 10273491 B2), the tkt promoter, and the yccA promoter.

[0105] The above 3) modification of the base sequence of the region encoding the initiation codon or 5'-UTR of the gene encoding the protein (polypeptide) may be, for example, a modification that encodes another initiation codon having a higher protein (polypeptide) expression rate than the endogenous initiation codon, or an RBS sequence having a higher protein (polypeptide) expression rate than the endogenous RBS (ribosome binding site) sequence, but is not limited thereto.

[0106] The modification of the amino acid sequence or polynucleotide sequence of the protein (polypeptide) of the above 4) and 5) may be, but is not limited to, introducing a sequence mutation by deletion, insertion, substitution, or a combination thereof in the amino acid sequence of the protein (polypeptide) or the polynucleotide sequence encoding the protein (polypeptide) so as to increase the activity of the protein (polypeptide), or replacing it with an amino acid sequence or polynucleotide sequence modified to increase the activity. The replacement may be performed, for example, by inserting a polynucleotide into a chromosome by homologous recombination, but is not limited thereto.

[0107] The introduction of the foreign polynucleotide exhibiting the activity of the above 6) protein (polypeptide) may be the introduction into the host cell (microorganism) of a foreign polynucleotide encoding a protein (polypeptide) exhibiting the same / similar activity as the protein (polypeptide). The foreign polynucleotide is not limited in its origin or sequence as long as it exhibits the same / similar activity as the protein (polypeptide). The method used for the above introduction can be performed by a person skilled in the art appropriately selecting a known transformation method, and the protein (polypeptide) can be produced by expressing the introduced polynucleotide in the host cell, thereby increasing its activity.

[0108] The above 7) codon optimization of a polynucleotide encoding a protein (polypeptide) may be codon optimization of an endogenous polynucleotide to increase transcription or translation within a host cell (microorganism), or codon optimization of a foreign polynucleotide to achieve optimized transcription or translation within a host cell (microorganism).

[0109] The above 8) analyzing the tertiary structure of a protein (polypeptide) and selecting an exposed portion to modify or chemically modify may be done by, for example, comparing the sequence information of the protein (polypeptide) to be analyzed with a database storing the sequence information of known proteins, determining a template protein candidate based on the degree of sequence similarity, confirming the structure based on this, and selecting an exposed portion to modify or chemically modify, and modifying or modifying it.

[0110] The above 9) regulation of the intracellular location of a protein (polypeptide) may target the protein (polypeptide) to a specific organelle or specific intracellular space within the cell. For example, targeting to the periplasm or cytoplasm may be achieved by adding or removing a leader sequence that functions in targeting the protein (polypeptide), but is not limited thereto.

[0111] Such an increase in protein (polypeptide) activity may be, but is not limited to, an increase in the activity or concentration of the corresponding protein (polypeptide) relative to the activity or concentration of the protein (polypeptide) expressed in the wild type or pre-transformed host cell (microorganism), or an increase in the amount of a product resulting from the activity of the corresponding protein (polypeptide).

[0112]

[0113] Modification of part or all of the polynucleotide in the microorganism of the present application may be induced by, but is not limited to, (a) a method using homologous recombination using a vector for chromosome insertion into the microorganism, or genome editing using genetic scissors (e.g., CRISPR-Cas9) and / or (b) treatment with light and / or chemicals such as ultraviolet rays and radiation.

[0114]

[0115] The microorganism of the present application may have an improved ability to produce L-amino acid or a derivative thereof.

[0116] In the present application, “L-amino acid or derivative thereof” includes all L-amino acids or derivatives thereof that can be produced by microorganisms through metabolic processes from various carbon sources, and specifically, may include, but is not limited to, L-lysine, L-valine, L-arginine, L-threonine, and L-homoserine.

[0117] In one specific example of the present application, the microorganism of the genus Corynebacterium may have an increased ability to produce at least one L-amino acid or a derivative thereof selected from L-lysine, L-valine, L-arginine, L-threonine, and L-homoserine compared to a non-modified microorganism.

[0118] Another aspect of the present application provides a method for producing an L-amino acid or a derivative thereof, comprising the step of culturing a Corynebacterium genus microorganism having an improved ability to produce an L-amino acid or a derivative thereof, into which a nicotinamide nucleotide transhydrogenase protein derived from Edwardsiella talda of the present application or a polynucleotide encoding the same has been introduced, in a medium.

[0119] The above microorganisms are as described in other aspects.

[0120] In this application, the term "cultivation" refers to growing the microorganism of this application under appropriately controlled environmental conditions. The culturing process in this application can be performed using any suitable medium and culture conditions known in the art. Such culturing process can be easily adjusted and used by those skilled in the art depending on the selected strain. Specifically, the culturing process may be batch, continuous, and / or fed-batch, but is not limited thereto.

[0121] The microorganism of the present application can be cultured under aerobic conditions in a conventional medium containing appropriate carbon sources, nitrogen sources, phosphorus, inorganic compounds, amino acids, and / or vitamins, while controlling temperature, pH, etc.

[0122] In the present application, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvic acid, lactic acid, citric acid, etc.; amino acids such as glutamic acid, methionine, lysine, etc. In addition, natural organic nutrients such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sugarcane bagasse, and corn steep liquor may be used, and specifically, carbohydrates such as glucose and sterilized pretreated molasses (i.e., molasses converted to reducing sugar) may be used, and other appropriate amounts of carbon sources may be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.

[0123] The nitrogen source may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc.; peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or its decomposition product, defatted soybean cake or its decomposition product, etc. These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.

[0124] The above-mentioned components may include potassium phosphate monobasic, potassium phosphate dibasic, or their corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. In addition, amino acids, vitamins, and / or suitable precursors may be included. These components or precursors may be added to the medium in batch or continuous manner, but are not limited thereto.

[0125] During the cultivation of the microorganism of the present invention, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. can be added to the medium in an appropriate manner to adjust the pH of the medium. In addition, during the cultivation, an antifoaming agent such as fatty acid polyglycol ester can be used to suppress bubble formation. In addition, to maintain the aerobic state of the medium, oxygen or an oxygen-containing gas can be injected into the medium, or to maintain anaerobic and microaerobic states, nitrogen, hydrogen, or carbon dioxide gas can be injected without gas injection, but the present invention is not limited thereto.

[0126] Additionally, the culture medium may contain metal salts, such as magnesium sulfate or iron sulfate, necessary for growth. Finally, in addition to the above substances, essential growth substances, such as amino acids and vitamins, may be used. Appropriate precursors may also be used in the culture medium. The above-mentioned raw materials may be added to the culture in a batch or continuous manner during the culture process, but are not limited thereto.

[0127] In the present application, during the cultivation of microorganisms, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. can be appropriately added to the culture to adjust the pH of the culture. In addition, during the cultivation, an antifoaming agent such as fatty acid polyglycol ester can be used to suppress bubble formation. Furthermore, to maintain the aerobic state of the culture, oxygen or an oxygen-containing gas can be injected into the culture, or to maintain anaerobic or microaerobic states, nitrogen, hydrogen, or carbon dioxide gas can be injected without gas injection, but is not limited thereto.

[0128] In the culture of the present application, the culture temperature can be maintained at 20 to 35°C, specifically 25 to 35°C, and the culture period can continue until the amount of useful material produced is obtained, and the culture can be performed for about 10 to 160 hours, about 20 to 130 hours, about 24 to 120 hours, about 36 to 120 hours, about 48 to 120 hours, about 48 hours or more, or about 48 hours, about 72 hours, or about 120 hours, but is not limited thereto.

[0129]

[0130] The L-amino acid or its derivative produced by the culture of the present application may be secreted into the medium or remain within the cells.

[0131] In one specific example of the present application, the L-amino acid or derivative thereof may be at least one selected from L-lysine, L-valine, L-arginine, L-threonine, and L-homoserine, but is not limited thereto.

[0132]

[0133] In one specific example, the method for producing an L-amino acid or a derivative thereof of the present application may further include, for example, a step of preparing a microorganism of the present application, a step of preparing a medium for culturing the strain, or a combination thereof (in any order), prior to the culturing step.

[0134] The method for producing L-amino acid or a derivative thereof of the present application may further include a step of recovering a target substance, specifically, L-amino acid or a derivative thereof, from the cultured microorganism, a culture of the microorganism, a fermented product of the microorganism, or the culture medium. The recovering step may be additionally included after the culturing step.

[0135] The above recovery may be performed by collecting the target L-amino acid or its derivative using a suitable method known in the art according to the culture method of the microorganism of the present application, for example, a batch, continuous or fed-batch culture method. For example, various chromatographies such as centrifugation, filtration, treatment with a crystallized protein precipitant (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC or a combination thereof may be used, and the target substance, specifically, the L-amino acid or its derivative, can be recovered from the medium or microorganism using a suitable method known in the art.

[0136] Additionally, the method for producing L-amino acids or derivatives thereof of the present application may additionally include a purification step. The purification may be performed using any suitable method known in the art. In one example, if the method for producing L-amino acids or derivatives thereof of the present application includes both a recovery step and a purification step, the recovery step and the purification step may be performed sequentially or discontinuously, regardless of the order, or may be performed simultaneously or integrated into a single step, but is not limited thereto.

[0137] In the method of the present application, the nicotinamide nucleotide transhydrogenase derived from Edwardsiella talda, the introduction and L-amino acid or derivative thereof, etc. are as described in the other embodiments above.

[0138]

[0139] Another aspect of the present application provides a composition for producing L-amino acids or derivatives thereof, comprising a Corynebacterium genus microorganism having an improved ability to produce L-amino acids or derivatives thereof, into which the Edwardsiella talda-derived nicotinamide nucleotide transhydrogenase protein of the present application or a polynucleotide encoding the same has been introduced; a culture of the microorganism, a fermentation product of the microorganism, or a combination of two or more thereof.

[0140] The composition of the present application may further comprise any suitable excipient commonly used in compositions for producing L-amino acids or derivatives thereof, and such excipients may be, for example, but are not limited to, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizers, or isotonic agents.

[0141] In one specific example, each component present in the composition of the present application may be included in a microbiologically effective amount, or an amount that can be suitably present in the composition for production.

[0142] In the composition of the present application, the nicotinamide nucleotide transhydrogenase derived from Edwardsiella talda, the introduction and L-amino acid or derivative thereof, etc. are as described in the other embodiments above.

[0143]

[0144] Another aspect of the present application provides a use for producing L-amino acid or a derivative thereof by a microorganism of the genus Corynebacterium, which has an improved ability to produce L-amino acid or a derivative thereof, and into which a nicotinamide nucleotide transhydrogenase protein derived from Edwardsiella talda of the present application or a polynucleotide encoding the same has been introduced.

[0145] In the purpose of the present application, the nicotinamide nucleotide transhydrogenase derived from Edwardsiella talda, the introduction and L-amino acid or derivative thereof, etc. are as described in the other embodiments above.

[0146]

[0147] Another aspect of the present application provides a method for producing a Corynebacterium microorganism having improved ability to produce L-amino acids or derivatives thereof, comprising the step of introducing a nicotinamide nucleotide transhydrogenase protein derived from Edwardsiella talda or a polynucleotide encoding the same into a Corynebacterium microorganism having the ability to produce L-amino acids or derivatives thereof.

[0148] Another aspect of the present application provides a method for increasing the production capacity of L-amino acids or derivatives thereof, comprising the step of introducing a nicotinamide nucleotide transhydrogenase protein derived from Edwardsiella talda or a polynucleotide encoding the same into a Corynebacterium genus microorganism having the production capacity of L-amino acids or derivatives thereof.

[0149] In the method of the present application, the nicotinamide nucleotide transhydrogenase derived from Edwardsiella talda, the introduction and L-amino acid or derivative thereof, etc. are as described in the other embodiments above.

[0150]

[0151] Hereinafter, this application will be described in more detail through examples and experimental examples. However, these examples and experimental examples are intended to exemplify this application and the scope of this application is not limited to these examples and experimental examples.

[0152]

[0153] Example 1: Construction of a recombinant vector for introducing exogenous nicotinamide nucleotide transhydrogenase (pntAB).

[0154]

[0155] Example 1-1: Construction of plasmids for gene insertion

[0156]

[0157] To insert a foreign nicotinamide nucleotide transhydrogenase (pntAB) gene into the Corynebacterium glutamicum chromosome, NCgl1287, known as a transposon-coding gene, was used as an insertion site (J Bacteriol. 2011 Mar; 193(5): 1237-1249). To replace the NCgl1287 gene with the foreign pntAB, NCgl1287 deletion and target gene insertion vectors were constructed. To construct the vectors, PCR was performed using the primer pairs of SEQ ID NO: 1 and SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4, respectively, using the respective chromosomes of ATCC13032, ATCC13869, and ATCC14067 as templates. The primer sequences used to perform each PCR are shown in Table 1 below.

[0158] PfuUltra as polymerase for PCR reaction TMHigh-fidelity DNA polymerase (Stratagene) was used, and the PCR conditions were denaturation at 95°C for 30 seconds; denaturation at 55°C for 30 seconds; and polymerization at 72°C for 1 minute. These denaturation, annealing, and polymerization cycles were repeated 28 times. Each DNA product obtained as a result was purified using a PCR purification kit (PCR Purification kit, QUIAGEN). The purified amplified product and the pDC24 vector (SEQ ID NO: 38) treated with the restriction enzyme smaI and heat-treated at 65°C for 20 minutes were cloned using the Infusion Cloning Kit (TaKaRa) according to the provided manual to construct vectors pDC24△N1287(13032), pDC24△N1287(13869), and pDC24△N1287(14067) for NCgl1287 deletion and target gene insertion.

[0159] SEQ ID NO NAME Sequence 1PrimerAATTCGAGCTCGGTACCCAATGGAGCTGAAAGAAT2PrimerCTTCCTGATAGTCCCGGGACATTGTTTTTC3PrimerGAAAAACAATGTCCCGGGACTATCAGGAAG4PrimerGTCGACTCTAGAGGATCCCCATAAAAACAGGCAGAGGA

[0160]

[0161] Example 1-2: Construction of a plasmid for promoter replacement

[0162]

[0163] To further enhance the expression of the pntAB gene, an expression cassette was constructed in which the endogenous promoter of the pntAB gene was replaced with the promoter of the gapA gene (PgapA).

[0164] Specifically, to produce a strain into which a foreign pntAB gene regulated by the PgapA promoter was introduced, a PgapA promoter fragment was obtained using the chromosomal DNA of Corynebacterium glutamicum 13032 as a template and sequence numbers 5 and 6.

[0165] In addition, information on the amino acid sequence and base sequence of the gene encoding pntAB from Escherichia coli, Corynebacterium urealyticum, Corynebacterium Amycolatum, and Cellulosimicrobium funkei was obtained from the NIH GenBank, and codon-optimized pntAB genes from each microorganism were synthesized using Cosmogenetech's gene synthesis service (Gene-synthesis).

[0166]

[0167] PCR was performed using the foreign pntAB genes synthesized above and the chromosomal DNA of Edwardsiella tarda (accession number KACC 15172) as templates using primers of SEQ ID NO: 7 and SEQ ID NO: 8; SEQ ID NO: 9 and SEQ ID NO: 10; SEQ ID NO: 11 and SEQ ID NO: 12; SEQ ID NO: 13 and SEQ ID NO: 14; and SEQ ID NO: 15 and SEQ ID NO: 16, respectively. The primer sequences used to perform each PCR are as shown in Table 2 below.

[0168] Sequence Number Name Sequence 5PrimerCCTGAAAAACAATGTCCCAACGACCGAGCCTATTG6PrimerGTTGTGTCTCCTCTAAAGAT7PrimerCTTTAGAGGAGACACAACATGCGTATTGGTGTAC8PrimerC CAACTTCCTGATAGTCCCTTATAATGCGCGTAG9PrimerAGAGGAGACACAACATGCGAATTGGCATACCA10PrimerAACTTCCTGATAGTCCCTTACAGAGCTTTCAGGAT11PrimerTCT TTAGAGGAGACACAACGTGCGTATCGGTATTC12PrimerACCAACTTCCTGATAGTCCCTTAGTTGCTGATCCCTGC13PrimerATCTTTAGAGGAGACACAACATGAGAATCGGCATCCCTT1 4PrimerCCAACTTCCTGATAGTCCCTTAAGCGTTGACCTT15PrimerATCTTTAGAGGAGACACAACATGCGCATCGGTTGCC16PrimerACTTCCTGATAGTCCCTCAACCCACCCGCAGC

[0169]

[0170] PfuUltra is used as a polymerase for PCR reaction. TM High-fidelity DNA polymerase (Stratagene) was used, and the PCR conditions were denaturation at 95°C for 30 seconds; denaturation at 55°C for 30 seconds; and polymerization at 72°C for 1 minute, and denaturation, annealing, and polymerization under these conditions were repeated 28 times.

[0171] As a result, a 472 bp DNA fragment of the PgapA promoter region of SEQ ID NO: 17 and a 2919 bp DNA fragment of the pntAB region of Edwardsiella talda encoding an amino acid sequence as set forth in SEQ ID NO: 18 and SEQ ID NO: 19; or SEQ ID NO: 20 and SEQ ID NO: 21; or SEQ ID NO: 22 and SEQ ID NO: 23; or SEQ ID NO: 24 and SEQ ID NO: 25; or SEQ ID NO: 26 and SEQ ID NO: 27, a 2932 bp DNA fragment of the pntAB region of Escherichia coli, a 3045 bp fragment of the pntAB region of Corynebacterium urealyticum, a 3066 bp DNA fragment of the pntAB region of Corynebacterium amicolatum, and a 3021 bp DNA fragment of the pntAB region of Cellulose Microbium fungi were obtained, respectively.

[0172]

[0173] PCR was performed using the primers SEQ ID NO: 5 and SEQ ID NO: 8, using the amplified promoter and a 2919-bp DNA fragment of the pntAB region of Edwardsiella talda as templates; the primers SEQ ID NO: 5 and SEQ ID NO: 10, using the amplified promoter and a 2932-bp DNA fragment of the pntAB region of Escherichia coli as templates; the primers SEQ ID NO: 5 and SEQ ID NO: 12, using the amplified promoter and a 3045-bp DNA fragment of the pntAB region of Corynebacterium urealyticum as templates; the primers SEQ ID NO: 5 and SEQ ID NO: 14, using the amplified promoter and a 3021-bp DNA fragment of the pntAB region of Cellulose Microbium fungi as templates; and the primers SEQ ID NO: 5 and SEQ ID NO: 16. The PCR conditions were denaturation at 95°C for 5 minutes, followed by 30 cycles at 95°C for 30 seconds; After repeating 28 cycles of 30-second annealing at 55°C and 2-minute polymerization at 72°C, polymerization was performed at 72°C for 5 minutes.

[0174] As a result, a 3.4-kb foreign pntAB DNA fragment encoding a foreign nicotinamide nucleotide transhydrogenase linked to the PgapA promoter was amplified. The amplified product was purified using a PCR purification kit (PCR Purification kit, QUIAGEN) and used as an insert DNA fragment for vector construction.

[0175] The purified amplification product was treated with the restriction enzyme smaI, and then heat-treated at 65°C for 20 minutes to obtain a molar concentration (M) ratio of 1:2 between the pDC24△N1287(13032) or pDC24△N1287(13869) or pDC24△N1287(14067) vector and the amplification product, the inserted DNA fragment, using an Infusion Cloning Kit (TaKaRa) according to the provided manual, thereby introducing the foreign pntAB into the chromosome, vectors pDC24△N1287(13032)::PgapA_pntAB(E.ta), pDC24△N1287(13869)::PgapA_pntAB(E.ta), pDC24△N1287(14067)::PgapA_pntAB(E.ta), pDC24△N1287(13032)::PgapA_pntAB(E.co), pDC24△N1287(13032)::PgapA_pntAB(C.ur), pDC24△N1287(13032)::PgapA_pntAB(C.am), pDC24△N1287(13032)::PgapA_pntAB(C.fu) were constructed.

[0176]

[0177] Example 2: Production of a strain producing L-amino acid or its derivatives with foreign pntAB introduced and evaluation of L-amino acid or its derivative production ability

[0178] Example 2-1: Production of an L-threonine-producing strain with foreign pntAB introduced and evaluation of threonine production ability

[0179]

[0180] The five vectors produced in Example 1 were transformed into Corynebacterium glutamicum KCCM 12502P (CA09-0903, Republic of Korea Patent No. 10-2126951), a threonine-producing strain, by electroporation to produce strains expressing foreign pntAB.

[0181]

[0182] To confirm the threonine productivity of the above strains, they were cultured using the following method.

[0183] First, each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of seed medium and cultured at 30°C for 20 hours with shaking at 200 rpm. Then, 1 ml of the seed culture was inoculated into a 250 ml corner-baffle flask containing 24 ml of production medium and cultured at 32°C for 24 hours with shaking at 200 rpm.

[0184]

[0185] <Seed medium (pH 7.0)>

[0186] Glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4 7H2O 0.5 g, biotin 100 μg, thiamine HCl 1000 μg, calcium-pantothenic acid 2000 μg, nicotinamide 2000 μg (based on 1 liter of distilled water)

[0187]

[0188] <Production medium (pH 7.2)>

[0189] Glucose 30g, KH2PO4 2g, Urea 3g, (NH4)2SO4 40g, Peptone 2.5g, CSL(Sigma) 5g(10 ml), MgSO4.7H2O 0.5g, Leucine 400mg, CaCO3 20g (based on 1 liter of distilled water)

[0190]

[0191] After the culture was completed, the amount of L-threonine produced was measured using high-performance liquid chromatography (HPLC), and the concentration is shown in Table 3 below.

[0192]

[0193] Threonine production ability of microorganisms expressing pntAB from various microorganisms Strain name L-threonine concentration (g / L) Concentration percentage compared to parent strain (%) CA09-0903 (parent strain) 3.4100 CA09-0903 △N1287(13032)::PgapA_pntAB(E.ta) 5.9174 CA09-0903 △N1287(13032)::PgapA_pntAB(E.co) 4.1121 CA09-0903 △N1287(13032)::PgapA_pntAB(C.ur) 2.985 CA09-0903 △N1287(13032)::PgapA_pntAB(C.am) 3.5103 CA09-0903 △N1287(13032)::PgapA_pntAB(C.fu)1.750

[0194] As a result, as shown in Table 3 above, it was confirmed that the parent strain, Corynebacterium glutamicum CA09-0903, produced approximately 3.4 g / L of threonine. Among the strains expressing pntAB derived from foreign microorganisms, the threonine production ability of CA09-0903 △N1287(13032)::PgapA_pntAB(E.ta), a strain expressing pntAB derived from Edwardsiella talda, was confirmed to increase by 74% compared to the parent strain.

[0195]

[0196] Example 2-2. Production of an L-arginine-producing strain with foreign pntAB and evaluation of arginine production capacity.

[0197]

[0198] Among the five vectors produced in Example 1, pntAB derived from Edwardsiella talda, which showed excellent productivity improvement in Example 2-1, was introduced into an arginine-producing strain. Specifically, a strain expressing the foreign pntAB was produced by transforming the arginine-producing strain Corynebacterium glutamicum CJ1R (Korean Patent Application No. 10-2021-0045262) ​​using electroporation.

[0199]

[0200] To confirm the arginine productivity of the above strains, they were cultured using the following method.

[0201] First, the strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of seed medium and cultured at 30°C for 20 hours with shaking at 200 rpm. Then, 1 ml of the seed culture was inoculated into a 250 ml corner-baffle flask containing 24 ml of production medium and cultured at 30°C for 72 hours with shaking at 200 rpm.

[0202]

[0203] <Seed medium (pH 7.0)>

[0204] Glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4·7H2O 0.5 g, biotin 100 ㎍, thiamine HCl 1000 ㎍, calcium-pantothenic acid 2000 ㎍, nicotinamide 2000 ㎍ (based on 1 liter of distilled water)

[0205]

[0206] <Production medium (pH 7.0)>

[0207] Glucose 6%, ammonium sulfate 3%, potassium phosphate monobasic 0.1%, magnesium sulfate heptahydrate 0.2%, corn steep liquor 1.5%, NaCl 1%, yeast extract 0.5%, biotin 100 mg / L

[0208]

[0209] After the culture was completed, the amount of L-arginine produced was measured using high-performance liquid chromatography (HPLC), and the concentration is shown in Table 4 below.

[0210] Arginine production ability of microorganisms expressing foreign pntAB Strain name L-arginine concentration (g / L) Concentration percentage compared to parent strain (%) CJ1R (parent strain) 2.0 100 CJ1R △N1287 (13869)::PgapA_pntAB (E.ta) 2.7 2 136

[0211] As a result, as shown in Table 4 above, it was confirmed that the parent strain, Corynebacterium glutamicum CJ1R, produced approximately 2.0 g / L of arginine. The arginine production ability of CJ1R △N1287(13869)::PgapA_pntAB (E.ta), a strain expressing pntAB derived from Edwardsiella talda, was confirmed to increase by approximately 36% compared to the parent strain.

[0212]

[0213] Example 2-3: Production of an L-homoserine-producing strain with foreign pntAB introduced and evaluation of L-homoserine production capacity

[0214]

[0215] Among the five vectors produced in the above Example 1, pntAB derived from Edwardsiella talda, which showed excellent productivity improvement in Example 2-1, was transformed into Corynebacterium glutamicum KCCM12120P (Korean Patent No. 10-1947959), a homoserine-producing strain, by electroporation to produce strains expressing foreign pntAB.

[0216] To confirm the homoserine productivity of the above strains, they were cultured using the following method.

[0217] Specifically, each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of production medium and cultured with shaking at 200 rpm at 30°C for 24 hours. After completion of culture, the production amount of L-homoserine was measured by HPLC, and the results are shown in Table 5 below.

[0218]

[0219] <Production medium (pH 7.0)>

[0220] Glucose 45g, (NH4)2SO4 20g, MgSO4·7H2O 1.2g, KH2PO4 1.1g, biotin 900㎍, thiamine hydrochloride 4500㎍, calcium-pantothenic acid 4500㎍, CaCO3 30g (based on 1 liter of distilled water)

[0221] After the culture was completed, the amount of L-homoserine produced was measured using high-performance liquid chromatography (HPLC), and the concentration is shown in Table 5 below.

[0222]

[0223] Homoserine production ability of microorganisms expressing foreign pntAB Strain name L-homoserine concentration (g / L) Concentration percentage compared to parent strain (%) KCCM12120P (parent strain) 0.40 100 KCCM12120P △N1287(13032)::PgapA_pntAB(E.ta) 0.64 160

[0224] As a result, as shown in Table 5 above, it was confirmed that the parent strain, Corynebacterium glutamicum KCCM12120P, produced approximately 0.4 g / L of homoserine. Among the strains expressing pntAB derived from foreign microorganisms, the homoserine production ability of KCCM12120P △N1287(13032)::PgapA_pntAB(E.ta), a strain expressing pntAB derived from Edwardsiella talda, was confirmed to increase by 60% compared to the parent strain.

[0225]

[0226] Example 2-4. Production of an L-valine-producing strain with foreign pntAB and evaluation of L-valine production capacity.

[0227]

[0228] Among the five vectors produced in Example 1, pntAB derived from Edwardsiella talda, which showed excellent productivity improvement in Example 2-1, was introduced into a valine-producing strain. Specifically, a strain expressing the foreign pntAB was produced by transforming Corynebacterium glutamicum KCCM11201P (US 8465962 B), a valine-producing strain, using electroporation.

[0229] To confirm the valine productivity of the above strains, they were cultured using the following method.

[0230] First, the strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of seed medium and cultured at 30°C for 20 hours with shaking at 200 rpm. Then, 1 ml of the seed culture was inoculated into a 250 ml corner-baffle flask containing 24 ml of production medium and cultured at 30°C for 72 hours with shaking at 200 rpm.

[0231]

[0232] <Seed medium (pH 7.0)>

[0233] Glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4·7H2O 0.5 g, biotin 100 ㎍, thiamine HCl 1000 ㎍, calcium-pantothenic acid 2000 ㎍, nicotinamide 2000 ㎍ (based on 1 liter of distilled water)

[0234]

[0235] <Production medium (pH 7.0)>

[0236] Glucose 6%, ammonium sulfate 3%, potassium phosphate monobasic 0.1%, magnesium sulfate heptahydrate 0.2%, corn steep liquor 1.5%, NaCl 1%, yeast extract 0.5%, biotin 100 mg / L

[0237]

[0238] After the culture was completed, the amount of L-valine produced was measured using high-performance liquid chromatography (HPLC), and the concentration is shown in Table 6 below.

[0239] Valine production ability of microorganisms expressing foreign pntAB Strain name L-valine concentration (g / L) Concentration percentage compared to parent strain (%) KCCM11201P 2.7 100 KCCM11201P △N1287(14067)::PgapA_pntAB(E.ta) 2.9 107

[0240] As a result, as shown in Table 6 above, it was confirmed that the parent strain, Corynebacterium glutamicum KCCM11201P, produced approximately 2.7 g / L of valine. The valine production ability of KCCM11201P △N1287(14067)::PgapA_pntAB(E.ta), a strain expressing pntAB derived from Edwardsiella talda, was confirmed to increase by 7.4% compared to the parent strain.

[0241]

[0242] Example 2-5: Production of an L-lysine-producing strain with foreign pntAB introduced and evaluation of L-lysine production capacity

[0243]

[0244] Among the five vectors produced in Example 1, pntAB derived from Edwardsiella talda, which showed excellent productivity improvement in Example 2-1, was introduced into a lysine-producing strain. Specifically, a strain expressing the foreign pntAB was produced by transforming Corynebacterium glutamicum CJ3P (US 9556463 ​​B2), a lysine-producing strain, using the electric pulse method (Van der Rest et al., Appl. Microbiol. Biotecnol. 52:541-545, 1999).

[0245]

[0246] To confirm the lysine productivity of the above strains, they were cultured using the following method.

[0247] First, each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of seed medium and cultured at 37°C for 20 hours with shaking at 200 rpm. 1 ml of the seed culture was inoculated into a 250 ml corner-baffle flask containing 24 ml of production medium and cultured at 37°C for 36 hours with shaking at 200 rpm.

[0248]

[0249] <Seed medium (pH 7.0)>

[0250] Glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4·7H2O 0.5 g, biotin 0.1 mg, thiamine HCl 1 mg, calcium-pantothenic acid 2 mg, nicotinamide 2 mg (per 1 liter of distilled water)

[0251]

[0252] <Production medium (pH 7.0)>

[0253] Glucose 100 g, (NH4)2SO4 40 g, Soy protein 2.5 g, Corn Steep Solids 5 g, Urea 3 g, KH2PO4 1 g, MgSO4 7H2O 0.5 g, Biotin 100 μg, Thiamine hydrochloride 1000 μg, Calcium pantothenate 2000 μg, Nicotinamide 3000 μg, CaCO3 30 g (per 1 liter of distilled water).

[0254] After the culture was completed, the amount of L-lysine produced was measured using high-performance liquid chromatography (HPLC), and the concentration is shown in Table 7 below.

[0255] Lysine production ability of microorganisms expressing foreign pntAB Strain name L-lysine concentration (g / L) Concentration percentage compared to parent strain (%) CJ3P7.51100 CJ3P△N1287(13032)::PgapA_pntAB (E.ta)7.9105.3

[0256] As a result, as shown in Table 7 above, it was confirmed that the parent strain, Corynebacterium glutamicum CJ3P, produced approximately 7.51 g / L of lysine. The lysine productivity of CJ3P△N1287(13032)::PgapA_pntAB (E.ta), a strain expressing pntAB derived from Edwardsiella talda, was confirmed to increase by approximately 5.3% compared to the parent strain.

[0257]

[0258] The above results confirmed that by introducing a gene encoding pntAB derived from Edwardsiella tarda among the five enzymes selected in the present invention, the reducing power was increased through pntAB activity, thereby enabling more efficient production of L-amino acids and their derivatives.

[0259]

[0260] From the above description, those skilled in the art will understand that the present application can be implemented in other specific forms without altering its technical concept or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of this application should be interpreted to include all changes or modifications derived from the meaning and scope of the following claims and their equivalents, rather than the detailed description above.

Claims

1. A microorganism of the genus Corynebacterium having improved L-amino acid or derivative production ability, into which a polynucleotide encoding a nicotinamide nucleotide transhydrogenase protein derived from Edwardsiella tarda has been introduced.

2. A microorganism of the genus Corynebacterium, wherein the nicotinamide nucleotide transhydrogenase derived from Edwardsiella talda in the first paragraph is encoded by the pntAB gene.

3. A microorganism of the genus Corynebacterium, wherein the nicotinamide nucleotide transhydrogenase derived from Edwardsiella talda is composed of an alpha subunit PntA and a beta subunit PntB.

4. A microorganism of the genus Corynebacterium, wherein the alpha subunit PntA of the nicotinamide nucleotide transhydrogenase derived from Edwardsiella talda comprises an amino acid sequence having sequence ID No. 18 or at least 80% sequence identity therewith, and the beta subunit PntB comprises an amino acid sequence having sequence ID No. 19 or at least 80% sequence identity therewith.

5. In the first paragraph, the Corynebacterium microorganism having improved L-amino acid or derivative production ability is Corynebacterium glutamicum.

6. A microorganism of the genus Corynebacterium, according to any one of claims 1 to 5, wherein the microorganism of the genus Corynebacterium has an increased ability to produce at least one L-amino acid or a derivative thereof selected from L-lysine, L-valine, L-arginine, L-threonine, and L-homoserine compared to a non-modified microorganism.

7. A method for producing an L-amino acid or a derivative thereof, comprising the step of culturing a Corynebacterium microorganism having an improved ability to produce an L-amino acid or a derivative thereof, into which a polynucleotide encoding a nicotinamide nucleotide transhydrogenase protein derived from Edwardsiella talda has been introduced, in a medium.

8. A method according to claim 7, further comprising a step of recovering L-amino acid or a derivative thereof from the cultured microorganism, a culture of the microorganism, a fermented product of the microorganism, or the culture medium.

9. A method according to claim 7, wherein the L-amino acid or derivative thereof is at least one selected from L-lysine, L-valine, L-arginine, L-threonine, and L-homoserine.

10. A microorganism of the genus Corynebacterium having improved ability to produce L-amino acids or derivatives thereof, into which a polynucleotide encoding a nicotinamide nucleotide transhydrogenase protein derived from Edwardsiella talda has been introduced; a composition for producing L-amino acids or derivatives thereof, comprising a culture of the microorganism, a fermented product of the microorganism, or a combination of two or more thereof.

11. Use of a microorganism of the genus Corynebacterium for producing L-amino acids or derivatives thereof, wherein the microorganism has improved ability to produce L-amino acids or derivatives thereof, and wherein a nicotinamide nucleotide transhydrogenase protein derived from Edwardsiella talda or a polynucleotide encoding the same has been introduced.

Images