High-expression strain of lactoferrin peptide, construction method therefor, and use thereof in preparation of recombinant human lactoferrin peptide

By co-expressing auxiliary factors PDI, Aft1 and Sec9 in Pichia pastoris and optimizing the expression vector of lactoferrin peptide, the problems of high production cost and low yield of lactoferrin peptide were solved, and efficient and low-cost preparation of recombinant human lactoferrin peptide was achieved for application in cosmetics, food, health products and medical fields.

WO2025185548A1PCT designated stage Publication Date: 2025-09-11JIANGSU TRAUTEC MEDICAL TECH CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/080139
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-03-05
Filing Date
2025-03-03
Publication Date
2025-09-11

AI Technical Summary

Technical Problem

The existing technology has high production costs and low yields for lactoferrin peptides, making large-scale applications difficult. Moreover, most of them are artificially synthesized or modified derivatives, and there is a lack of high-yield preparation methods for natural sequences.

Method used

Through spatial structure simulation and Average RMSF calculation, four segments of human lactoferrin peptide were selected, and a vector containing three copies was constructed. The vector was transformed into a high-expression strain, and the auxiliary factors PDI, Aft1 and Sec9 were co-expressed. The Pichia pastoris expression system was optimized to achieve high copy and high expression.

Benefits of technology

The yield of recombinant human lactoferrin peptide was significantly improved, and production costs were reduced, making its application in cosmetics, food, health products and medical fields possible. The protein expression level was 6 times that of the initial strain, the freeze-dried product yield was 4 times, and it was non-cytotoxic.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2025080139_12092025_PF_FP_ABST
    Figure CN2025080139_12092025_PF_FP_ABST
Patent Text Reader

Abstract

Provided are a high-expression strain of a lactoferrin peptide, a construction method therefor, and a use thereof in the preparation of a recombinant human lactoferrin peptide, relating to the technical field of genetic engineering and biology. The method comprises: firstly selecting four human lactoferrin peptides by means of spatial structure simulation and Average RMSF calculation, then constructing a vector containing three copies, and transforming the vector containing the three copies into a high-expression strain to obtain a high-expression and high-copy engineered strain; and also integrating PDI, Aft1, and Sec9 expression cassettes into a vector by means of a special design and transforming the vector into the high-expression and high-copy engineered strain to obtain a high-expression strain of a lactoferrin peptide. The high-expression strain of the lactoferrin peptide enables the productivity of the engineered strain to be maximally released, and the high-expression strain of the lactoferrin peptide can reduce the production cost while achieving high yield of the recombinant human lactoferrin peptide, and has good practical value.
Need to check novelty before this filing date? Find Prior Art

Description

Lactoferrin peptide high expression strain and its construction method and application in preparing recombinant human lactoferrin peptide Technical Field

[0001] The invention belongs to the fields of genetic engineering and biotechnology, and particularly relates to a lactoferrin peptide high-expression strain, a construction method thereof, and an application in preparing recombinant human lactoferrin peptide. Background Art

[0002] Lactoferrin peptides are a variety of active polypeptides derived from lactoferrin with diverse physiological functions and excellent biological properties. Horoaki et al. discovered the presence of heat-resistant antimicrobial peptides in lactoferrin that are stable in acidic conditions. Tomita et al. studied the antimicrobial effects of bovine lactoferrin hydrolysates and found that the antimicrobial activity of small-molecule peptides obtained by porcine trypsin hydrolysis was over 20 times that of the undegraded peptides. Bellamy et al. isolated a peptide near the N-terminus of lactoferrin with an antimicrobial activity over 400 times that of lactoferrin and possessed all of lactoferrin's biological activities, including antimicrobial, anti-tumor, and anti-inflammatory properties.

[0003] As an antimicrobial peptide, lactoferrin peptides have extremely broad and attractive application prospects. Numerous researchers have cloned the genes for human, bovine, and porcine lactoferrin peptides and successfully expressed them in bacteria, fungi, plants, and animal cells. The applications of these products in medicine and animal nutrition are currently under investigation, but research has focused on human and bovine lactoferrin and its peptides.

[0004] Currently, lactoferrin peptides are primarily produced using Escherichia coli, yeast, Aspergillus, and animal expression systems. However, the production of lactoferrin peptides still presents numerous challenges. Human milk contains an average of approximately 1-2 g / L of lactoferrin, while the lactoferrin content in mid-lactation cow milk is only approximately 0.1 g / L. Consequently, the production of lactoferrin is costly and yield-intensive. Lactoferrin peptides, a hydrolyzed product of lactoferrin, also suffer from low yield, complex processes, and high costs. Artificially synthesized lactoferrin peptides and their derivatives are even more expensive, making large-scale production impossible. While recombinant human lactoferrin peptides have achieved some success, their yields are also very low, and most are engineered derivatives of human lactoferrin peptides, rather than the native sequence.

[0005] The yield and production cost of lactoferrin peptide restrict its wide application. Therefore, it is necessary to provide a high-yield, low-cost recombinant human lactoferrin peptide with a natural sequence and an expression method thereof. Summary of the Invention

[0006] In response to the deficiencies in the prior art, the present invention provides a lactoferrin peptide high-expression strain, a construction method thereof, and an application thereof in preparing recombinant human lactoferrin peptide. The present invention first selects four segments of human lactoferrin peptide through spatial structure simulation and Average RMSF calculation, then constructs a vector containing three copies, and transforms the three-copy vector into a high-expression strain to obtain a high-expression, high-copy engineered strain. The present invention also integrates PDI, Aft1, and Sec9 expression cassettes into one vector through special design, and transforms the vector into a high-expression, high-copy engineered strain to obtain a lactoferrin peptide high-expression strain. The lactoferrin peptide high-expression strain maximizes the production capacity of the engineered strain. The lactoferrin peptide high-expression strain can produce high recombinant human lactoferrin peptide while reducing production costs, and has excellent practical value.

[0007] The present invention achieves the above technical objectives through the following technical means.

[0008] The present invention first provides a method for constructing a lactoferrin peptide high-expressing strain, the construction method comprising:

[0009] (1) Construction of high-expression recombinant engineering bacteria:

[0010] Design and select the amino acid sequence of the target recombinant human lactoferrin peptide, construct a recombinant expression vector containing the recombinant human lactoferrin peptide nucleic acid sequence; linearize the recombinant expression vector and then transfer it into the host bacteria to obtain a high-expression recombinant engineered bacteria;

[0011] (2) Construction of high-copy, high-expression recombinant engineering bacteria:

[0012] Amplifying the fragment containing the promoter, α signal peptide, CDS, and terminator in the recombinant expression vector in step (1), constructing a multi-copy recombinant expression vector containing n pieces of the fragment, and transferring the multi-copy recombinant expression vector into the high-expression recombinant engineered bacteria obtained in step (1) to obtain a high-copy, high-expression recombinant engineered bacteria;

[0013] (3) Construction of a lactoferrin peptide high-expression strain:

[0014] Construct auxiliary factor co-expression vector;

[0015] The auxiliary factor co-expression vector is linearized and then transferred into the high-copy, high-expression recombinant engineered bacteria obtained in step (2) to obtain a high-copy strain co-expressing the auxiliary factor, that is, the lactoferrin peptide high-expression strain.

[0016] Preferably, the target recombinant human lactoferrin peptide in step (1) comprises the amino acid sequence shown in any one of SEQ ID Nos: 1 to 4, or an amino acid sequence having 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more identity thereto, and maintains the biological activity of human lactoferrin peptide.

[0017] Preferably, the nucleic acid sequence encoding the target recombinant human lactoferrin peptide includes the sequences shown in SEQ ID Nos: 5 to 8, or degenerate sequences thereof.

[0018] Preferably, the host bacteria in step (1) includes yeast, preferably Pichia pastoris.

[0019] Preferably, the recombinant expression vector in step (1) comprises pPIC9K.

[0020] Preferably, the n fragments are connected end to end in sequence, and n≥1, where n is 1-6.

[0021] Preferably, n is 1 to 6; more preferably, n is 3.

[0022] Preferably, in step (2), the sequence of the fragment includes the sequence shown in SEQ ID No: 23 to 34, or a degenerate sequence thereof.

[0023] Preferably, the co-expression factors in step (3) include PDI, Aft1 and Sec9.

[0024] Preferably, the connection order of the co-expression factors in the co-expression vector is PDI, Aft1 and Sec9.

[0025] The present invention also provides a lactoferrin peptide high-expression strain constructed by the above method.

[0026] Preferably, the lactoferrin peptide high-expressing strain is deposited in the General Microbiology Center of China Culture Collection Administration, with the deposit numbers: CGMCC No.29182, CGMCC No.29183, CGMCC No.29186, CGMCC No.29187, the deposit dates are all November 30, 2023, and the classification name is: Komagataell a phaffii.

[0027] The present invention also provides the use of the above lactoferrin peptide high-expression strain in efficiently expressing recombinant human lactoferrin peptide or increasing the yield / expression level of recombinant human lactoferrin peptide.

[0028] The present invention also provides a method for preparing recombinant human lactoferrin peptide, which comprises: subjecting the above-mentioned lactoferrin peptide high-expressing strain to fermentation induction, and purifying the expression product to obtain the recombinant human lactoferrin peptide.

[0029] Preferably, the recombinant human lactoferrin peptide comprises: an amino acid sequence shown in any one of SEQ ID Nos: 1 to 4, or an amino acid sequence having 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more identity thereto, and maintains the biological activity of human lactoferrin peptide.

[0030] The present invention also provides a nucleic acid encoding the recombinant human lactoferrin peptide.

[0031] Preferably, the nucleic acid comprises the sequence shown in SEQ ID No: 5 to 8, or a degenerate sequence thereof.

[0032] The present invention also provides a recombinant expression vector comprising the above nucleic acid.

[0033] The present invention also provides a recombinant engineered bacterium, which comprises the above-mentioned nucleic acid, or comprises the above-mentioned recombinant vector, or expresses the above-mentioned recombinant human lactoferrin peptide.

[0034] The present invention also provides a composition comprising the above-mentioned recombinant human lactoferrin peptide, or the above-mentioned nucleic acid encoding the recombinant human lactoferrin peptide, or the above-mentioned lactoferrin peptide high-expressing strain, or the recombinant human lactoferrin peptide expressed by the above-mentioned method; the composition includes drugs, medical devices, biomaterials, tissue engineering products, cosmetics, foods or health products.

[0035] The present invention also provides a product, which comprises the above-mentioned recombinant human lactoferrin peptide, or the above-mentioned nucleic acid encoding recombinant human lactoferrin peptide, or the above-mentioned lactoferrin peptide high-expressing strain, or the recombinant human lactoferrin peptide expressed by the above-mentioned method, or the above-mentioned composition; the composition includes medicines, medical devices, biomaterials, tissue engineering products, cosmetics, foods or health products.

[0036] The present invention also provides the use of the recombinant human lactoferrin peptide, or the nucleic acid encoding the recombinant human lactoferrin peptide, or the lactoferrin peptide high-expressing strain, or the recombinant human lactoferrin peptide expressed by the above method, or the above composition, or the above product in the preparation of medicines, medical devices, biomaterials, tissue engineering products, cosmetics, foods, or health products. Compared with the prior art, the present invention has the following advantages:

[0037] (1) The present invention first selects four segments of human lactoferrin peptide through spatial structure simulation and Average RMSF calculation. The recombinant human lactoferrin peptide is secreted and expressed extracellularly using the Pichia pastoris expression system, and a high-expression strain is screened. Then, a vector containing three copies is constructed, and the three-copy vector is transformed into a high-expression strain to obtain a high-expression, high-copy engineered strain. The method of the present invention selects four segments of amino acid sequences with good stability, different molecular weights, and different iron-binding abilities based on spatial structure simulation and Average RMSF calculation. By transforming the high-copy, high-expression engineered strain and co-expressing specific auxiliary factors, the yield of recombinant human lactoferrin peptide is greatly improved, the production cost is reduced, and the widespread application of recombinant human lactoferrin becomes possible.

[0038] (2) In view of the fact that lactoferrin peptide contains spatial structure, disulfide bonds and iron binding sites, the present invention co-expresses specific auxiliary factors PDI, Aft1 and Sec9. Through special design, the PDI, Aft1 and Sec9 expression frames are integrated into a vector and transformed into the yeast genome, which reduces the introduction of unnecessary gene sequences and reduces the burden on yeast cells. The design sequence described in the present invention can maximize the release of the production capacity of the engineered strain. If the auxiliary factors are introduced first and then the target protein gene is introduced, it may cause unnecessary burden on the cells when the cell production capacity has not reached the limit, resulting in the production of the engineered strain not being improved or even being reduced.

[0039] (3) The present invention mainly constructs and expresses four specific human lactoferrin peptides through engineering strains, but theoretically, similar effects can be achieved with any other lactoferrin peptide using similar methods and strategies. Pichia pastoris is used in the present invention, but theoretically, other yeast organisms can also achieve similar effects. The GoldenMOCS method is used to construct a high-copy engineered strain in the present invention, and other high-copy construction methods can also achieve similar effects. The spatial structure and Average RMSF value in the present invention are calculated and predicted using biocomputing technology, and other biocomputing tools can also achieve similar effects.

[0040] (4) The protein expression level in the supernatant of the lactoferrin peptide high-expressing strain obtained by the method of the present invention is about 6 times that of the initial strain, and the yield of the final freeze-dried product is about 4 times that of the initial strain, which greatly improves the yield. The recombinant human lactoferrin peptides of the present invention all have good whitening effects, and different recombinant lactoferrin peptides have different antibacterial activities. At the same time, 10 mg / mL of recombinant lactoferrin peptides are non-cytotoxic, and the survival rate of LF-7 and LF-9 cells exceeds that of the control group, which has a promoting effect on cell growth and has good applications in the fields of cosmetics, food, health products and medical treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 is a simulated diagram of the polypeptide structure of LF-2.

[0042] Figure 2 is a simulated diagram of the polypeptide structure of LF-4.

[0043] Figure 3 is a simulated diagram of the polypeptide structure of LF-7.

[0044] Figure 4 is a diagram of the polypeptide structure simulation of LF-9.

[0045] Figure 5 is a plasmid map of pPIC9K-LF-2.

[0046] Figure 6 is a plasmid map of pPIC9K-LF-4.

[0047] Figure 7 is a plasmid map of pPIC9K-LF-7.

[0048] Figure 8 is a plasmid map of pPIC9K-LF-9.

[0049] Figure 9 is a SDS-PAGE analysis of the supernatant of shake flasks expressing human lactoferrin peptides LF-2, LF-4, LF-7 and LF-9 after 48 hours of induction.

[0050] FIG10 is a diagram showing the mass spectrometry detection results of LF-2 according to the present invention.

[0051] FIG11 is a diagram showing the results of LF-4 mass spectrometry detection according to the present invention.

[0052] FIG12 is a diagram showing the mass spectrometry detection results of LF-7 according to the present invention.

[0053] FIG13 is a diagram showing the results of LF-9 mass spectrometry detection according to the present invention.

[0054] Figure 14 is a nucleic acid gel detection diagram of PCR amplification of LF-2, LF-4, LF-7 and LF-9 expression cassettes.

[0055] Figure 15 is a nucleic acid gel detection image of the three copy number expression vectors constructed by LF-2, LF-4, LF-7 and LF-9 after enzyme digestion and linearization.

[0056] FIG16 is an SDS-PAGE analysis of the supernatant of the high copy expression LF-2 strain after induction for 48 hours.

[0057] FIG17 is an SDS-PAGE analysis of the supernatant of the high copy expression LF-4 strain after induction for 48 hours.

[0058] FIG18 is an SDS-PAGE detection diagram of the supernatant of the high copy expression LF-7 strain after induction for 48 hours.

[0059] FIG19 is an SDS-PAGE analysis of the supernatant of the high copy expression LF-9 strain after induction for 48 hours.

[0060] FIG20 is a nucleic acid gel identification diagram of PCR fragments of PDI, Aft1, and Sec9 expression cassettes.

[0061] Figure 21 is a map of the BB3eH-PDI-Aft1-sec9 plasmid.

[0062] Figure 22 is an SDS-PAGE detection diagram of the supernatant after 48 hours of induction after LF-2-BB co-expressed auxiliary factors.

[0063] FIG23 is an SDS-PAGE detection diagram of the supernatant after 48 hours of induction after LF-4-BB co-expressed auxiliary factors.

[0064] FIG24 is an SDS-PAGE detection diagram of the supernatant after 48 hours of induction after LF-7-BB co-expressed auxiliary factors.

[0065] FIG25 is an SDS-PAGE detection diagram of the supernatant after 48 hours of induction after LF-9-BB co-expressed auxiliary factors.

[0066] Figure 26 is an SDS-PAGE detection graph of the supernatant of high-density fermentation of the lactoferrin peptide high-expressing strain in a 5L fermentation tank, in which a is an SDS-PAGE detection graph of the fermentation supernatant of the LF-2-BB-4 strain, b is an SDS-PAGE detection graph of the fermentation supernatant of the LF-4-BB-7 strain, c is an SDS-PAGE detection graph of the fermentation supernatant of the LF-7-BB-3 strain, and d is an SDS-PAGE detection graph of the fermentation supernatant of the LF-9-BB-1 strain.

[0067] FIG27 is an SDS-PAGE detection band diagram of the lyophilized product of recombinant human lactoferrin peptide.

[0068] FIG28 is a graph showing the cytotoxicity of LF-2 (a), LF-4 (b), LF-7 (c), and LF-9 (d) at different concentrations.

[0069] Figure 29 is a test graph showing the antibacterial rate of recombinant human lactoferrin peptide LF-2 against Staphylococcus aureus, Escherichia coli, Candida albicans, Pseudomonas aeruginosa, Klebsiella pneumoniae, Salmonella typhimurium, Propionibacterium acnes, and Aspergillus niger.

[0070] Figure 30 is a test graph showing the antibacterial rate of recombinant human lactoferrin peptide LF-4 against Staphylococcus aureus, Escherichia coli, Candida albicans, Pseudomonas aeruginosa, Klebsiella pneumoniae, Salmonella typhimurium, Propionibacterium acnes, and Aspergillus niger.

[0071] Figure 31 is a test graph showing the antibacterial rate of recombinant human lactoferrin peptide LF-7 against Staphylococcus aureus, Escherichia coli, Candida albicans, Pseudomonas aeruginosa, Klebsiella pneumoniae, Salmonella typhimurium, Propionibacterium acnes, and Aspergillus niger.

[0072] Figure 32 is a test graph showing the antibacterial rate of recombinant human lactoferrin peptide LF-9 against Staphylococcus aureus, Escherichia coli, Candida albicans, Pseudomonas aeruginosa, Klebsiella pneumoniae, Salmonella typhimurium, Propionibacterium acnes, and Aspergillus niger. DETAILED DESCRIPTION

[0073] In order to enable those skilled in the art to better understand the technical solutions of the present invention, preferred embodiments of the present invention are described in detail below. However, the following embodiments do not limit the scope of protection of the present invention.

[0074] In the embodiments of the present invention, those that are not described in detail are all completed using conventional experimental methods. Those processes involved in the embodiments that are not described in detail are all understandable and easily implemented by those skilled in the art based on the product instructions or basic knowledge in the field, and therefore are not described in detail.

[0075] The culture medium involved in the embodiments of the present invention is as follows:

[0076] Seed medium YPD: yeast extract 10 g / L, peptone 20 g / L, glycerol 10 g / L;

[0077] BSM basal medium: 85% H3PO4, 26.7 ml / L CaSO4·2H2O 0.93 g / L, K2SO4 18.2 g / L, MgSO4·7H2O 14.9 g / L, KO H 4.13 g / L, glycerol 40 g / L, PMT1 4.0 ml / L;

[0078] PTM1: standard formula provided by Invitrogen, sterilized by filtration using a 0.22 μm filter membrane, and stored at 4°C.

[0079] Example 1: Construction of recombinant engineered bacteria that highly express recombinant human lactoferrin peptide

[0080] (1) Amino acid sequence design, gene sequence optimization and expression vector synthesis:

[0081] This step was designed based on the amino acid sequence of human lactoferrin (Uniprot database P02788, https: / / www.uniprot.org / uniprotkb / P02788 / entry). Based on the predicted spatial structure and average RMSF value using biocomputing technology, four amino acid sequences with good stability, multiple active sites, different molecular weights, and different iron-binding abilities were selected.

[0082] The amino acid sequence at positions 20–67 (PRO_0000422770) was selected as a recombinant human lactoferrin peptide, named LF-2. It consists of 48 amino acids, has a theoretical molecular weight of 5700.72 Da, an isoelectric point of 11.19, an average RMSF value of 2.5468, and a stable molecular structure. The peptide structure simulation is shown in Figure 1, and the amino acid sequence is shown in SEQ ID No: 1:

[0083]

[0084] The amino acid sequence from position 134 to position 217, which contains Kaliocin-1, the iron binding site, and multiple disulfide bonds, was selected and named LF-4. It consists of 84 amino acids, has a theoretical molecular weight of 9060.34 Da, an isoelectric point of 6.87, and an Average RMSF value of 1.3513. The molecular structure is stable. The polypeptide structure simulation is shown in Figure 2. The amino acid sequence is shown in SEQ ID No: 2:

[0085]

[0086] The amino acid sequence from position 20 to position 109 was selected as part of N1 and contains multiple functional sites. It was named LF-7 and consists of 90 amino acids. The theoretical molecular weight is 10149.68 Da, the isoelectric point is 10, the average RMSF value is 1.8254, the molecular structure is stable, and the polypeptide structure simulation is shown in Figure 3. The amino acid sequence is shown in SEQ ID No: 3:

[0087]

[0088] The amino acid sequence from position 110 to position 269 was selected as the complete N2 lobe of human lactoferrin and named LF-9. It consists of 160 amino acids, has a theoretical molecular weight of 17646.97 Da, an isoelectric point of 6.12, an average RMSF value of 0.8481, and a stable molecular structure. The polypeptide structure simulation is shown in Figure 4. The amino acid sequence is shown in SEQ ID No: 4:

[0089]

[0090] Based on the amino acid sequences of LF-2, LF-4, LF-7, and LF-9, the preference of the DNA sequence and the relevant optimization parameters during transcription and translation were calculated, the splicing and recombination were optimized, the SpeⅠ and BsaⅠ restriction sites were avoided, and the TGATAA termination codon was added at the end. The DNA sequence encoding LF-2 was obtained as shown in SEQ ID No: 5:

[0091]

[0092] The DNA sequence encoding LF-4 is shown in SEQ ID No: 6:

[0093]

[0094] The DNA sequence encoding LF-7 is shown in SEQ ID No: 7:

[0095]

[0096] The DNA sequence encoding LF-9 is shown in SEQ ID No: 8:

[0097]

[0098] The optimized sequences SEQ ID No: 5, SEQ ID No: 6, SEQ ID No: 7, and SEQ ID No: 8 were commissioned to Nanjing GenScript Biotech Co., Ltd. for synthesis, and the synthesized gene fragments were directly cloned into the pPIC9K empty plasmid vector between TCTCTCGAGAAAAGAGAGGCTGAAGCT (SEQ ID No: 15) and TTCGCCTTAGACATGACTGTTCCT (SEQ ID No: 16). The expression plasmid was then amplified, and after amplification, the plasmid was extracted using a plasmid mini-extraction kit (purchased from Sangon Biotech (Shanghai) Co., Ltd.). The specific operation steps were carried out according to the kit instructions. The extracted plasmids were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing, which was verified to be correct, indicating that the recombinant expression vectors pPIC9K-LF-2, pPIC9K-LF-4, pPIC9K-LF-7, and pPIC9K-LF-9 were successfully constructed. The relevant plasmid maps are shown in Figures 5, 6, 7, and 8.

[0099] (2) Engineering strain construction and strain screening:

[0100] The recombinant expression vectors pPIC9K-LF-2, pPIC9K-LF-4, pPIC9K-LF-7, and pPIC9K-LF-9 plasmids prepared in step (1) were digested with SalⅠ (enzyme digestion kit purchased from Dalian TaKaRa Company, and the operation was carried out according to the kit instructions) at 37°C overnight to linearize them, and then a PCR product purification kit (purchased from Sangon Biotech (Shanghai) Co., Ltd.) was used to recover the linearized plasmids, and the recovered volume was controlled at about 15 μL.

[0101] 10 μL of the linearized plasmid was electroporated into Pichia pastoris GS115 competent cells (purchased from Invitrogen), and 200 μL of the electroporated bacterial solution was spread on MD plates and cultured upside down in a 30°C incubator for 2-3 days until single colonies appeared.

[0102] Add 2 mL of sterile double-distilled water to the surface of the MD plate, then use a sterile triangular applicator to gently scrape off the single colony on the surface of the plate and transfer it to a 2 mL sterile centrifuge tube. Dilute the bacterial suspension with sterile double-distilled water, and use 10 5 Each cell was spread on a YPD plate containing 0.5 mg / mL G418 and cultured upside down in a 30°C incubator for 3 to 4 days until a single colony (positive transformant) appeared.

[0103] Pick a single colony from the YPD plate containing 0.5 mg / mL G418 and transfer it to a 96-well plate containing 200 μL YPD medium. Mix well and incubate in a 30°C incubator for 48 hours. After mixing well, take 10 μL of the bacterial solution and transfer it to a new 96-well plate. Incubate at 30°C for 24 hours and repeat this operation to keep the bacterial density in the well plate relatively consistent. Take the bacterial solution from the third 96-well plate and dilute it a certain multiple with sterile water or culture medium in a new 96-well plate so that the final cell count on the plate is 10 3 ~10 4 Using a multichannel pipette, 1 μL of bacterial solution was spotted onto YPD plates containing 2 mg / mL and 4 mg / mL G418, respectively. The plates were then incubated at 30°C for 2-5 days. Pichia transformants were screened using G418-resistant plates. Growth on plates containing high concentrations of G418 indicated that the transformants had been electroporated with multiple expression vectors containing multiple copies of the recombinant human lactoferrin peptide gene. This indicates that multiple recombinant fragments had entered the yeast and integrated into the yeast chromosome via homologous recombination. This screening step yielded highly expressing recombinant engineered bacteria, which were designated 9K-LF-2, 9K-LF-4, 9K-LF-7, and 9K-LF-9, respectively.

[0104] (3) Induced expression and identification of recombinant human lactoferrin peptide:

[0105] Take the recombinant yeast engineering strain obtained in step (2), inoculate it into a 100mL Erlenmeyer flask containing 10mL BMGY medium, and culture it at 30℃ and 220rpm for 24h. Centrifuge at 4000rpm at room temperature for 5min, collect the bacteria, resuspend the bacteria with BMMY medium to an initial OD600 of 5, place it on a shaker at 30℃ and 220rpm for 48h of induction culture, and add 100μL of pure methanol to the culture medium every 24h. After 48h of induction culture, take 1mL of bacterial solution, place it in a 1.5mL EP tube, centrifuge at 10000rpm at 4℃ for 5min, and collect the expression supernatant. Add 2× loading buffer (purchased from Shanghai Wansheng Haotian Biotechnology Co., Ltd.) to the supernatant expressing LF-2, LF-4, and LF-7. The supernatant expressing LF-9 was added with 5× loading buffer (250 mM Tris-HCl, pH 6.8, 10% SDS, 0.5% bromophenol blue, 50% glycerol, 5% β-mercaptoethanol; all percentages are by weight to volume) and boiled in a metal bath at 90°C for 10 minutes. The samples were then analyzed by SDS-PAGE. The electrophoresis results are shown in Figure 9. As can be seen, LF-2, LF-4, LF-7, and LF-9 human lactoferrin peptides were efficiently expressed in the extracellular supernatant 48 hours after induction.

[0106] Reclaim the protein band of cutting induction expression, with trypsin by its enzymolysis, Nano-HPLC-MS / MS mass spectrometry detection recombinant collagen trypsin hydrolysis peptide (entrust Suzhou Putai Biotechnology Co., Ltd. to complete), and the peptide detected is carried out sequence alignment (Uniprot database), and the comparison result is as shown in Figure 10, Figure 11, Figure 12, and Figure 13. As seen in the figure, 4 kinds of recombinant human lactoferrin peptides are effectively secreted and expressed in the supernatant, and the electrophoretic band is single (there is certain electrophoretic migration delay during small molecule protein electrophoresis, so its apparent molecular weight has certain deviation during electrophoresis). The peptide detected all belongs to the human lactoferrin related region selected when the amino acid sequence is selected and designed, and illustrates that LF-2, LF-4, LF-7, LF-9 human lactoferrin peptides are successfully expressed.

[0107] Example 2: Construction of high-copy, high-expression strains

[0108] (1) Amplify the cloned fragment containing the promoter, CDS, and terminator:

[0109] Multicopy plasmids were constructed using the GoldenMOCS method (relevant vector plasmids and reagents were purchased from Addgene #39296). PCR amplification primers were designed using SnapGene software, using pPIC9K-LF-2, pPIC9K-LF-4, pPIC9K-LF-7, and pPIC9K-LF-9 as templates, according to primer design principles. Each template amplified three cloned fragments containing different overhang sequences (the overhang sequences are located at the beginning and end of the DNA fragment and are underlined in the primers) and the same promoter, α-signal peptide, CDS, and terminator. Bsa I restriction sites for the overhang sequences were added to the 5' and 3' ends of the primers, allowing each cloned fragment to be linked end to end and assembled into the Bsa I-digested plasmid BB3rN-AD.

[0110] The primers were synthesized by GenScript Biotech, and the specific sequences are shown below:

[0111] 1-A:GGTCTCAGATCAGATCTAACATCCAAAGACGAAAGGTT (SEQ ID No: 17)

[0112] 1-B:GGTCTCACCGGGCAATTTAACTGTGATAAACTACCGC (SEQ ID No: 18)

[0113] 2-B:GGTCTCACCGGAGATCTAACATCCAAAGACGAAAGGTT (SEQ ID No: 19)

[0114] 2-C:GGTCTCAAATTGCAATTTAACTGTGATAAACTACCGC (SEQ ID No: 20)

[0115] 3-C:GGTCTCAAATTAGATCTAACATCCAAAGACGAAAGGTT (SEQ ID No: 21)

[0116] 3-D:GGTCTCAAGCTGCAATTTAACTGTGATAAACTACCGC (SEQ ID No: 22)

[0117] The target gene, i.e., the cloned fragment containing the promoter, CDS, and terminator, was amplified using the aforementioned primers. Premix Taq (purchased from Bio-Ray Biotechnology Co., Ltd.) was used as the high-fidelity PCR enzyme. PCR conditions included one cycle of pre-denaturation at 94°C for 2 minutes, followed by 30 cycles of heat denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 2 minutes, followed by annealing at 72°C for 2 minutes and storage at 4°C.

[0118] Three PCR fragments were amplified from pPIC9K-LF-2, pPIC9K-LF-4, pPIC9K-LF-7, and pPIC9K-LF-9, respectively. The three PCR fragments of LF-2 were 1767 bp in size, the three PCR fragments of LF-4 were 1875 bp in size, the three PCR fragments of LF-7 were 1893 bp in size, and the three PCR fragments of LF-9 were 2103 bp in size. The sizes were confirmed to be correct by nucleic acid gel identification, as shown in Figure 14.

[0119] The DNA sequence of the first PCR fragment of LF-2 is shown in SEQ ID No: 23:

[0120]

[0121] The DNA sequence of the second PCR fragment of LF-2 is shown in SEQ ID No: 24:

[0122]

[0123] The DNA sequence of the third PCR fragment of LF-2 is shown in SEQ ID No: 25:

[0124]

[0125] The DNA sequence of the first PCR fragment of LF-4 is shown in SEQ ID No: 26:

[0126]

[0127] The DNA sequence of the second PCR fragment of LF-4 is shown in SEQ ID No: 27:

[0128]

[0129] The DNA sequence of the third PCR fragment of LF-4 is shown in SEQ ID No: 28:

[0130]

[0131] The DNA sequence of the first PCR fragment of LF-7 is shown in SEQ ID No: 29:

[0132]

[0133] The DNA sequence of the second PCR fragment of LF-7 is shown in SEQ ID No: 30:

[0134]

[0135] The DNA sequence of the third PCR fragment of LF-7 is shown in SEQ ID No: 31:

[0136]

[0137] The DNA sequence of the first PCR fragment of LF-9 is shown in SEQ ID No: 32:

[0138]

[0139] The DNA sequence of the second PCR fragment of LF-9 is shown in SEQ ID No: 33:

[0140]

[0141]

[0142]

[0143]

[0144]

[0145]

[0146]

[0147]

[0148]

[0149]

[0150]

[0151]

[0152]

[0153]

[0154]

[0155]

[0156]

[0157]

[0158]

[0159]

[0160]

[0161]

[0162]

[0163]

[0164]

[0165]

[0166]

[0167]

[0168]

[0169]

[0170]

[0171]

[0172]

[0173] The DNA sequence of the third PCR fragment of LF-9 is shown in SEQ ID No: 34:

[0174]

[0175] Purification was performed using a PCR product purification kit (purchased from Sangon Biotech (Shanghai) Co., Ltd.), following the kit instructions. The recovered PCR product was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing and verification.

[0176] (2) Construction of 3-copy expression vector:

[0177] The three PCR fragments amplified from pPIC9K-LF-2, pPIC9K-LF-4, pPIC9K-LF-7, and pPIC9K-LF-9 obtained in step (1) were assembled into the BB3rN-AD plasmid. Taking BB3rN-3LF2 as an example, three copy number expression vectors were constructed. BB3rN-3LF4, BB3rN-3LF7, and BB3rN-3LF9 were constructed in the same manner as BB3rN-3LF2, except for the CDS region. The assembly reaction system is shown in Table 1:

[0178] Table 1. Assembly reaction system of BB3rN-3LF2

[0179]

[0180] The assembly reaction conditions were 37°C for 1 min, 16°C for 1 min, 30 cycles, and 60°C for 5 min. The ligation product was transformed into competent Escherichia coli Stb13 (purchased from Invitrogen), and positive clones were screened on LB resistance plates containing 50 μg / mL Nat. Colony PCR verification was performed using universal primers 5AOX and 3AOX. The binding sites of the universal primers for 5AOX and 3AOX are located on the PCR fragments. If the three PCR fragments were successfully assembled into the BB3rN-AD plasmid and transformed into competent E. coli Stb13, the colony PCR product would show bands.

[0181] After screening for positive E. coli transformants, they were inoculated into 100 mL Erlenmeyer flasks containing 10 mL of LB medium (containing 50 μg / mL Nat) and cultured at 37°C and 220 rpm for 24 h. Plasmids were extracted using a column-based plasmid DNA mini-extraction kit (purchased from Sangon Biotech (Shanghai) Co., Ltd.) and named BB3rN-3LF2, BB3rN-3LF4, BB3rN-3LF7, and BB3rN-3LF9. 10 μg of each plasmid was digested with Spe I (enzyme digestion kit purchased from Dalian TaKaRa Company, according to the kit instructions) at 37°C for 30 min to linearize it. The reaction system is shown in Table 2:

[0182] Table 2. Linearization reaction system

[0183]

[0184] Verification by nucleic acid gel was correct, as shown in Figure 15. The BB3rN empty vector is 2893 base pairs, appearing around 2500 bp, while the successfully constructed BB3rN-3LF2, BB3rN-3LF4, BB3rN-3LF7, and BB3rN-3LF9 all appear above 5000 bp. The linearized plasmid was then recovered using a PCR product purification kit (purchased from Sangon Biotech (Shanghai) Co., Ltd.), with the recovered volume controlled at approximately 15 μL.

[0185] (3) Construction and screening of high-copy, high-expression engineered bacteria:

[0186] The four highly expressed recombinant engineered bacteria 9K-LF-2, 9K-LF-4, 9K-LF-7, and 9K-LF-9 obtained in Example 1 were prepared into competent cells and inoculated into 100 mL Erlenmeyer flasks containing 5 mL YPD, and cultured overnight at 30°C and 220 rpm. The overnight culture was transferred to 50 mL YPD medium to an OD600 of 0.15-0.20 and placed in a flask large enough to provide good aeration. The yeast was cultured at 30°C and 220 rpm until the OD600 reached 0.8-1.0. Based on a doubling time of 100-120 minutes, the OD600 of the yeast reached 0.8-1.0 within 4-5 hours. The bacterial solution was collected, centrifuged at 500 x g at room temperature for 5 minutes, and the supernatant was discarded. The cell treatment solution was then prepared. The formula of the cell treatment solution is shown in Table 3.

[0187] Table 3. Recipe of cell treatment solution

[0188]

[0189] After resuspending in cell treatment buffer, incubate the cell suspension at 30°C, 100 rpm for 5 minutes. Centrifuge again at 500 × g for 5 minutes at room temperature and resuspend the cells in 1 mL of BEDS solution. Aliquot and freeze at -80°C until the competent cell preparation is complete.

[0190] Insert a 0.2 cm electroporation cuvette into an ice box and pre-cool for 5 minutes. Add 10 μg of the linearized plasmid prepared in step (1) to the corresponding yeast competent cells. Transfer about 80 μL of the plasmid-yeast mixture to the electroporation cuvette and place it on ice for 5 minutes. Wipe the outside of the electroporation cuvette dry and perform electric shock at v = 1.5 kV for about 5.8 seconds. After the electric shock is completed, immediately add 800 μL of pre-cooled 1 mol sorbitol solution, mix the bacteria, and transfer them to a 1.5 mL centrifuge tube. Incubate in an incubator at 30°C for 2 hours. After mixing evenly, take 200 μL of the bacterial solution and spread it on a YPD plate containing 200 μg / mL Nat. Incubate it upside down at 30°C for 3 days until a single colony (positive transformant) appears.

[0191] Large, plump colonies were picked from YPD plates containing 200 μg / mL Nat and inoculated into 100 mL Erlenmeyer flasks containing 10 mL of LBMGY medium. The cells were cultured at 30°C and 220 rpm for 24 hours. The cells were harvested by centrifugation at 4000 rpm for 5 minutes at room temperature. The cells were resuspended in BMMY medium to an initial OD600 of 5 and incubated on a shaker at 30°C and 220 rpm for 48 hours. 100 μL of pure methanol was added to the culture medium every 24 hours. After 48 hours of induction, 1 mL of the culture medium was transferred to a 1.5 mL EP tube and centrifuged at 10,000 rpm for 5 minutes at 4°C to collect the expression supernatant. The supernatants expressing LF-2, LF-4, and LF-7 were added with 2× loading buffer (purchased from Shanghai Wansheng Haotian Biotechnology Co., Ltd.). The supernatant expressing LF-9 was added with 5× loading buffer (250 mM Tris-HCl, pH 6.8, 10% SDS, 0.5% bromophenol blue, 50% glycerol, 5% β-mercaptoethanol) and boiled in a metal bath at 90°C for 10 min. SDS-PAGE detection and screening were performed, and the strains with the highest expression levels were selected and named LF-2-BB, LF-4-BB, LF-7-BB, and LF-9-BB.

[0192] As shown in Figures 16, 17, 18 and 19, 1, 2, and 3 in the figure are selected high-copy strains, and 0 is the supernatant of the initial strain expression. It can be seen that there are strains with significantly improved expression levels among the high-copy strains, but increasing the copy number does not necessarily increase the expression level.

[0193] Example 3: Modifying cells to co-express auxiliary factors

[0194] Lactoferrin peptides contain a spatial structure, disulfide bonds, and iron-binding sites. Disulfide bond formation and protein folding in the endoplasmic reticulum are the major rate-limiting steps in protein secretion. Endoplasmic reticulum protein disulfide isomerase (PDI) is a multifunctional protein from the thioredoxin superfamily that catalyzes disulfide bond formation and facilitates proper protein folding. The transcription factor Aft1 activates the FRE1, FRE2, and FET3 genes in response to iron deprivation, thus playing a central role in iron homeostasis. SEC9 is a protein transporter that initiates COPII vesicle formation and is a component of the SNAREs, involved in intracellular protein trafficking.

[0195] This example builds on the established high-copy, high-expression engineered bacteria to co-express specific auxiliary factors, PDI, Aft1, and Sec9. Furthermore, through specialized design, the PDI, Aft1, and Sec9 expression cassettes are integrated into a single vector and transformed into the yeast genome, reducing the introduction of unnecessary gene sequences and alleviating the burden on yeast cells. While PDI, Aft1, and Sec9 can be derived from any species, yeast cells are preferred in this invention.

[0196] (1) Amino acid sequence design, gene sequence optimization and expression vector synthesis:

[0197] The amino acid sequence of PDI in this example is referenced from the UniPort database P17967 (https: / / www.uniprot.org / uniprotkb / P17967 / entry), and the amino acid sequence is shown in SEQ ID No: 9:

[0198]

[0199] The amino acid sequence of Aft1 in this example is referenced from the UniPort database P22149 (https: / / www.uniprot.org / uniprotkb / P22149 / entry), and the amino acid sequence is shown in SEQ ID No: 10:

[0200]

[0201] The amino acid sequence of Sec9 in this example is referenced from the UniPort database P40357 (https: / / www.uniprot.org / uniprotkb / P40357 / entry), and the amino acid sequence is shown in SEQ ID No: 11:

[0202]

[0203] Based on the amino acid sequences of PDI, Aft1, and Sec9, the DNA sequence was optimized to avoid the SpeⅠ, BsaⅠ, and XbaⅠ restriction enzyme cleavage sites, and the DNA sequence encoding PDI was obtained as shown in SEQ ID No: 12:

[0204]

[0205]

[0206] The DNA sequence encoding Sec9 is shown in SEQ ID No: 14:

[0207]

[0208]

[0209]

[0210]

[0211]

[0212]

[0213]

[0214]

[0215]

[0216]

[0217]

[0218]

[0219]

[0220]

[0221]

[0222]

[0223]

[0224]

[0225]

[0226]

[0227]

[0228]

[0229]

[0230]

[0231]

[0232]

[0233]

[0234]

[0235]

[0236]

[0237]

[0238]

[0239]

[0240] The optimized sequences SEQ ID No: 12, SEQ ID No: 13, and SEQ ID No: 14 were synthesized by Nanjing GenScript Biotech Co., Ltd., and the synthesized gene fragments were directly cloned into the pPICZA empty plasmid between GCGGCCGCCAGCTTGGGCCC (SEQ ID No: 35) and TGAGTTTTAGCCTTAGACAT (SEQ ID No: 36). The expression plasmids were then amplified and extracted using a plasmid extraction kit (purchased from Sangon Biotech (Shanghai) Co., Ltd.), following the kit instructions. The extracted plasmids were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing, which confirmed their correctness, indicating the successful construction of the auxiliary factor expression vectors pPICZA-PDI, pPICZA-Aft1, and pPICZA-sec9.

[0241] (2) Construction of auxiliary factor co-expression vector:

[0242] The GoldenMOCS method was used for construction (relevant vector plasmids and reagents were purchased from Addgene #39296). PCR amplification primers were designed using SnapGene software, using pPICZA-PDI, pPICZA-Aft1, and pPICZA-sec9 as templates, according to primer design principles. Cloned fragments containing the promoter, CDS, and terminator of each vector were amplified. Overhanging Bsa I restriction sites were added to the 5' and 3' ends of the primers, allowing each cloned fragment to be ligated end-to-end and assembled into the Bsa I-digested plasmid BB3eN-AD. Primers were synthesized by GenScript Biotech.

[0243] PDI-A: GGTCTCAGATCGATCTAACATCCAAAGACGAAAGG (SEQ ID No: 37)

[0244] PDI-B: GGTCTCACCGGAATCTCACTTAATCTCTGTACTCTGA (SEQ ID No: 38)

[0245] Aft1-B:GGTCTCACCGGGATCTAACATCCAAAGACGAAAGG (SEQ ID No: 39)

[0246] Aft1-C:GGTCTCAAATTTCTCACTTAATCTTCTGTACTCTGA (SEQ ID No: 40)

[0247] Sec9-C:GGTCTCAAATTGATCTAACATCCAAAGACGAAAGG (SEQ ID No: 41)

[0248] Sec9-D:GGTCTCAAGCTTCTCACTTAATCTCTGTACTCTGA (SEQ ID No: 42)

[0249] The target genes, i.e., cloned fragments containing the promoter, CDS, and terminator of each vector, were amplified using the aforementioned primers to obtain the PDI, Aft1, and Sec9 expression cassettes. The high-fidelity PCR enzyme used was Premix Taq (purchased from Bio-Rad Biotechnology Co., Ltd.). PCR conditions included one cycle of pre-denaturation at 94°C for 2 minutes, followed by 30 cycles of heat denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 3.5 minutes, followed by annealing at 72°C for 2 minutes and storage at 4°C.

[0250] The amplified PCR fragments for the PDI expression cassette were 2925 bp, the Aft1 expression cassette was 3427 bp, and the Sec9 expression cassette were 3310 bp. The sizes were confirmed by gel analysis, as shown in Figure 20 . The PCR product bands for PDI, Aft1, and Sec9 appeared between 3000 and 5000 bp, indicating the correct sizes. Purification was performed using a PCR product purification kit (purchased from Sangon Biotech (Shanghai) Co., Ltd.) according to the kit's instructions. The recovered PCR products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing and verification.

[0251] The three PCR products were sequentially ligated to BB3eH-AD. The ligation product, the auxiliary factor plasmid BB3eH-PDI-Aft1-sec9, was transformed into competent Escherichia coli Stb13 and plated on LB plates containing 50 μg / mL HYG. After screening for positive transformants, the plasmid was amplified and extracted using a column-based plasmid DNA miniprep kit to obtain at least 10 μg of BB3eH-PDI-Aft1-sec9 plasmid. The BB3eH-PDI-Aft1-sec9 plasmid map is shown in Figure 21.

[0252] (2) Transformation of high-copy Pichia yeast cells:

[0253] The LF-2-BB, LF-4-BB, LF-7-BB, and LF-9-BB recombinant engineering strains were prepared into competent cells.

[0254] The BB3eH-PDI-Aft1-sec9 plasmid was digested with XbaⅠ enzyme (purchased from Dalian TaKaRa Company) at 37℃ for 1 h to linearize it, and then the linearized plasmid was recovered using a PCR product purification kit (purchased from Sangon Biotech (Shanghai) Co., Ltd.) to control the volume to about 15 μL. The linearized plasmids were electroporated into LF-2-BB, LF-4-BB, LF-7-BB, and LF-9-BB competent cells, respectively, and plated onto YPD plates containing 50 μg / mL HYG. After single colonies grew, single colonies were picked with a toothpick and inoculated into 96-well plates. After incubation at 30°C for 48 h, they were spotted onto YPD plates containing 100 μg / mL and 200 μg / mL HYG, respectively. Large, plump single colonies were selected and inoculated into 10 mL of BMGY medium shake flasks. After overnight incubation at 30°C and 220 rpm, the medium was replaced with 10 mL of BMMY medium for induction of expression. 100 μL of pure methanol was added every 24 h. After incubation for 48 h, the culture supernatant was collected and samples were prepared for SDS-PAGE analysis. The supernatants obtained under the same culture conditions of LF-2-BB, LF-4-BB, LF-7-BB, and LF-9-BB were used as controls to compare the expression of recombinant human lactoferrin peptide.

[0255] The results are shown in Figures 22, 23, 24, and 25. Lane 0 in the figure represents the initial high-copy strain, and the other lanes represent single clones selected from the modified high-copy Pichia pastoris co-expressing the auxiliary factor. In Figure 22, lane 4 showed the highest expression of the target protein, and the strain in lane 4 was selected as the final engineered strain, named LF-2-BB-4; in Figure 23, lane 7 showed the highest expression of the target protein, and the strain in lane 7 was selected as the final engineered strain, named LF-4-BB-7; in Figure 24, lane 3 showed the highest expression of the target protein, and the strain in lane 3 was selected as the final engineered strain, named LF-7-BB-3; in Figure 25, lane 1 showed the highest expression of the target protein, and the strain in lane 1 was selected as the final engineered strain, named LF-9-BB-1. Because lactoferrin peptide has antibacterial activity, increased expression will kill yeast cells, leading to the release of intracellular proteins.

[0256] The modified lactoferrin peptide high-expressing strains LF-2-BB-4, LF-4-BB-7, LF-7-BB-3, and LF-9-BB-1 were all sent to the General Microbiology Center of China Culture Collection Administration, address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The culture collection numbers are: CGMCC No. 29182, CGMCC No. 29183, CGMCC No. 29186, and CGMCC No. 29187. The preservation dates are all November 30, 2023, and the classification name is: Komagataell a phaffii.

[0257] Example 4: Verification of expression effect of lactoferrin peptide high-expressing strain and purification and freeze-drying

[0258] The recombinant engineered strain obtained in Example 1, which was only electroporated with the expression vector, and the lactoferrin peptide-high-expressing strain obtained in Example 3 were fermented at high density in a 5L fermentor, followed by purification and freeze-drying. The fermentation and purification conditions were kept consistent. The yields of the two engineered strains were verified.

[0259] (1) Preparation of seed solution: The recombinant yeast engineered strain was inoculated into a 1 L shake flask containing 200 mL of seed medium YPD, cultured at 220 rpm and 30°C for 18-20 h to OD600 = 2-8.

[0260] A 5L fermenter (Baoxing Biotechnology) was filled with 2L of BSM basal medium. Before inoculation, the fermenter was maintained at 300 rpm, aeration at 4 L / min, and a temperature of 30°C. The pH was adjusted to 4.0 using an alkaline solution prepared with concentrated ammonia. 200mL of the prepared seed solution was added to the fermenter (using a flame ring for inoculation). The dissolved oxygen electrode was then calibrated and fermentation began. When the dissolved oxygen level dropped to 30% for the first time during growth, the dissolved oxygen cascade function was used to maintain the level around 30%. After the glycerol was depleted and the dissolved oxygen level rebounded to above 60%, the cascade function was discontinued, the stirring increased to 650 rpm, and glycerol was fed at a rate of 40 mL / h. Once the OD600 of the cells reached 150, the glycerol feed was discontinued and methanol was fed at a constant rate of 7 mL / h for induction. After 80 hours of induction, the fermenter was released when the cell concentration showed no significant increase. After completion of fermentation, the cells were centrifuged at 5000 rpm at 4°C for 30 minutes, and the supernatant was collected. The SDS-PAGE of the fermentation supernatants of the two types of engineered strains is shown in FIG26 .

[0261] (2) The supernatant collected in step (1) was purified using a Bio Lab-100 chromatograph (purchased from Hanbang Technology) and a chromatographic filler material, UniGel-80sp produced by Suzhou NanoMicro, loaded on a GCC-50-400 chromatographic column produced by Lisui Technology.

[0262] Prepare Buffer A: 20mM KH2PO4, pH4.0; Buffer B: 20mM KH2PO4, 1M NaCl, pH4.0.

[0263] The column was rinsed with Solution B for 2 column volumes and Solution A for 5 column volumes. The pH of the supernatant was adjusted to 4.0, and 200 mL of the sample was loaded. The sample was equilibrated with Solution A for 5 column volumes, and eluted with 100% Solution B. A 2-L sample was collected and ultrafiltered to lyophilize. SDS-PAGE analysis of the lyophilized product revealed a single band with the correct size and position, as shown in Figure 27.

[0264] As shown in Table 4, comparing the expression level of recombinant human lactoferrin peptide in the fermentation supernatant (UV quantitative method, protein concentration C (mg / mL) = 1.45×A280-0.74×A260) and the yield of the final lyophilized product, the protein expression level in the supernatant of the modified engineered strain was about 6 times that of the initial strain (the UV quantitative method was affected by yeast host proteins and pigments, resulting in large errors), and the yield of the final lyophilized product was about 4 times that of the initial strain (weighed), which greatly improved the yield.

[0265] Table 4. Expression levels of recombinant human lactoferrin peptide in fermentation supernatants of different strains

[0266]

[0267]

[0268] Example 5: Detection of biological activity of recombinant human lactoferrin peptide

[0269] (1) Cytotoxicity test:

[0270] According to the method requirements of GB / T 16886.5-2017, the potential cytotoxic effects of 10 mg / mL LF-2, LF-4, LF-7, and LF-9 were tested using in vitro cultured mammalian L-929 cells.

[0271] The samples were extracted using MEM medium containing 10% fetal bovine serum according to the ratio (sample: extract volume) in Table 5. The extraction was carried out in a 37°C incubator for 24 hours. A blank control was MEM medium containing 10% fetal bovine serum, a negative control was high-density polyethylene, and a positive control was DMSO.

[0272] Table 5. Extraction conditions of different samples

[0273]

[0274] Visually inspect the leached solution before and after extraction. Use the extract immediately after extraction. Do not adjust the pH, filter, centrifuge, or dilute the extract before use. Prepare a blank control (MEM medium supplemented with 10% FBS) and negative / positive controls under the same conditions.

[0275] The entire process was performed in a clean bench to ensure aseptic operation. L-929 cells were cultured in MEM medium (containing 10% FBS and 1% penicillin-streptomycin) at 37°C and 5% CO2. Cells grown to the logarithmic growth phase were digested with 0.25% trypsin (containing EDTA). After digestion, the cell suspension was centrifuged (1000 rpm, 5 minutes), the supernatant discarded, and the cells were resuspended in MEM medium and counted to obtain a cell suspension of 1×105 cells / mL.

[0276] The cell suspension was inoculated into a 96-well plate at 100 μL per well and cultured in a cell culture incubator (37°C, 5% CO2, >90% humidity). Cell morphology was observed under a microscope. After incubation for 24 hours, the cells grew to about 70% adherent to the wall. The original culture medium in the 96-well plate was discarded, and 100 μL of the extract (final concentration of 100% and 50%), blank control sample, negative control sample and positive control sample were added to the corresponding wells of the 96-well plate. The 96-well plate was placed in a cell culture incubator (37°C, 5% CO2, >90% humidity) and cultured for 24 hours. Six replicates were set for each group.

[0277] After 24 hours of incubation, the 96-well plates were removed and cell morphology was observed under a microscope. 20 μL of MTT was added to each well, and the cells were incubated in a 37°C, 5% CO2 incubator. After 4 hours, the supernatant was removed, and 150 μL of DMSO was added to each well. The absorbance at 570 nm was measured on a microplate reader, and the cytotoxicity was calculated and recorded. The results are shown in Tables 6, 7, 8, and 9.

[0278] Table 6. LF-2 cytotoxicity test results

[0279]

[0280] Table 7. LF-4 cytotoxicity test results

[0281]

[0282] Table 8. LF-7 cytotoxicity test results

[0283]

[0284] Table 9. LF-9 cytotoxicity test results

[0285]

[0286] The cells in the blank control group and the negative control group (high-density polyethylene) maintained normal morphology throughout the experiment and showed no cytotoxic reactions. The positive control group (ZDEC) showed severe cytotoxic reactions. After incubating the cells with the 100% concentration extract of the test sample for 24 hours, there was no cell layer damage or cell lysis, the cells grew morphologically normally, and the cell viability value was 76.57%. All data groups met the acceptance criteria, and the results of this experiment were valid. The results were analyzed using origin2022 software. As shown in Figure 28, the cell viability rates were all above 70%, with the 100% LF-7 cell viability reaching 107.82% and the 100% LF-9 cell viability reaching 108.16%. Based on these results, it can be concluded that under the conditions of this experiment, LF-2, LF-4, LF-7, and LF-9 did not have potential cytotoxic effects in the MTT cytotoxicity test, and LF-7 and LF-9 had a certain promoting effect on cell growth.

[0287] (2) Whitening test:

[0288] The whitening effects of LF-2, LF-4, LF-7, and LF-9 were evaluated using a biochemical tyrosinase inhibition test model to measure the tyrosinase inhibition activity of the samples. Method: NIT / NMD / SOP(TW)-019, "Whitening (Tyrosinase Inhibition Rate) Test Operating Instructions."

[0289] The samples were diluted with PBS buffer according to the specified ratio. The components were then added as shown in Table 10, including the solvent background group, solvent reaction group, sample / positive control background group, and sample / positive control reaction group. At the end of the test, each reaction solution was transferred to the corresponding 96-well plate, with three replicates per group. The OD value was read at 475 nm using a microplate reader. The whitening test was performed by Noah Testing Technology Co., Ltd.

[0290] Table 10. Composition of different groups

[0291]

[0292] Note: “+” stands for “added”, “-” stands for “not added”

[0293] Tyrosinase inhibition rate = [1-(Td-Tc) / (Tb-Ta)] × 100%

[0294] Td: OD value of sample / positive control reaction group;

[0295] Tc: OD value of sample / positive control background group;

[0296] Tb: OD value of solvent reaction well group;

[0297] Ta: OD value of solvent background group;

[0298] After testing, the tyrosinase inhibition rate of LF-2 (3 mg / mL concentration) was: 60.7% ± 0.7%, P < 0.05, with a significant difference. It is believed that the sample has inhibitory effect on tyrosinase activity, indicating that the product has whitening effect.

[0299] The tyrosinase inhibition rate of LF-4 (3 mg / mL concentration) was 65.5% ± 0.4%, with a significant difference of P < 0.05. It was considered that the sample had inhibitory effect on tyrosinase activity, indicating that the product had whitening effect.

[0300] The tyrosinase inhibition rate of LF-7 (3 mg / mL concentration) was 62.5% ± 0.7%, with a significant difference of P < 0.05. It was considered that the sample had inhibitory effect on tyrosinase activity, indicating that the product had whitening effect.

[0301] The tyrosinase inhibition rate of LF-9 (3 mg / mL concentration) was 60.1% ± 1.1%, with a significant difference at P < 0.05. This indicates that the sample has inhibitory effect on tyrosinase activity, indicating that the product has whitening effect.

[0302] (3) Antibacterial rate test:

[0303] In this step, the antibacterial effect test method described in 7.3 Daily Chemical Products of QB / T 2738-2023 "Evaluation Method for Antibacterial and Antibacterial Effects of Daily Chemical Products" is used to detect the antibacterial rate of the recombinant human lactoferrin peptide of the present invention against common pathogens. The common pathogens include: Staphylococcus aureus (ATCC 6538), Escherichia coli (ATCC 8099), Candida albicans (ATCC 10231), Pseudomonas aeruginosa (ATCC 9027), Klebsiella pneumoniae (ATCC 4352), Salmonella typhimurium (ATC C 14028), Propionibacterium acnes (ATC C 6919) and Aspergillus niger (ATC C 16404).

[0304] Specifically, 2 mg / mL of recombinant human lactoferrin peptide was added to each bacterial solution using the suspension quantitative method, and the antibacterial rate of the recombinant human lactoferrin peptide was investigated at 20.4° C. and 52% RH (tested by Noah Testing Technology Co., Ltd.). The results are shown in Table 11:

[0305] Table 11. Inhibitory effect of recombinant human lactoferrin peptide on different pathogenic bacteria

[0306]

[0307] As can be seen from Table 11 and Figure 29, after 24 hours of treatment with LF-2 (2 mg / mL concentration), the inhibition rates of LF-2 against Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, Klebsiella pneumoniae, and Salmonella typhimurium were all ≥90%, indicating a strong antibacterial effect. The inhibition rate against Propionibacterium acnes was ≥50% and less than 90%, indicating an antibacterial effect, which meets the requirements of QB / T 2738-2023 "Evaluation Method for Antibacterial and Antibacterial Effects of Daily Chemical Products". The inhibition rates against Candida albicans and Aspergillus niger were both <50%, indicating no antibacterial effect.

[0308] As can be seen from Table 11 and Figure 30, after 24 hours of treatment with LF-4 (2 mg / mL concentration), the inhibition rates of LF-4 against Staphylococcus aureus, Pseudomonas aeruginosa, Klebsiella pneumoniae, and Propionibacterium acnes were all ≥90%, indicating a strong antibacterial effect. The inhibition rates against Escherichia coli and Salmonella typhimurium were both ≥50% and less than 90%, indicating an antibacterial effect, which meets the standard requirements of QB / T 2738-2023 "Evaluation Method for Antibacterial and Antibacterial Effects of Daily Chemical Products". The inhibition rates against Candida albicans and Aspergillus niger were both <50%, indicating no antibacterial effect.

[0309] As can be seen from Table 11 and Figure 31, after 24 hours of treatment with LF-7 (2 mg / mL concentration), the inhibition rates against Escherichia coli and Klebsiella pneumoniae were ≥90%, indicating a strong antibacterial effect. The inhibition rates against Staphylococcus aureus, Pseudomonas aeruginosa, and Salmonella typhimurium were ≥50% and less than 90%, indicating an antibacterial effect, which meets the standard requirements of QB / T 2738-2023 "Evaluation Method for Antibacterial and Antibacterial Effects of Daily Chemical Products". The inhibition rates against Propionibacterium acnes, Candida albicans, and Aspergillus niger were all <50%, indicating no antibacterial effect.

[0310] As can be seen from Table 11 and Figure 32, after 24 hours of treatment with LF-7 (2 mg / mL concentration), the inhibition rates against Staphylococcus aureus, Escherichia coli, and Klebsiella pneumoniae were all ≥90%, indicating a strong antibacterial effect. The inhibition rates against Pseudomonas aeruginosa and Salmonella typhimurium were both ≥50% and less than 90%, indicating an antibacterial effect, which meets the standard requirements of QB / T 2738-2023 "Evaluation Method for Antibacterial and Antibacterial Effects of Daily Chemical Products". The inhibition rates against Propionibacterium acnes, Candida albicans, and Aspergillus niger were all <50%, indicating no antibacterial effect.

[0311] It can be seen that LF-2, LF-4, LF-7, and LF-9 exhibit different antibacterial activities due to their different designed amino acid sequences and structures.

[0312] In summary, this example demonstrates that recombinant human lactoferrin peptide has good whitening and antibacterial activities with different focuses. At the same time, 10 mg / mL of recombinant lactoferrin peptide has no cytotoxicity, and the survival rates of LF-7 and LF-9 cells significantly exceed those of the control group, indicating a promoting effect on cell growth.

[0313] In summary, the present invention significantly increases the yield of recombinant human lactoferrin peptide by engineering a high-copy, high-expression strain and co-expressing specific cofactors, reducing production costs and enabling widespread application of recombinant human lactoferrin. The recombinant human lactoferrin peptide has extremely broad and attractive application prospects, including in cosmetics, food, health products, and medical applications.

[0314] The embodiments described are preferred implementations of the present invention, but the present invention is not limited to the above implementations. Any obvious improvements, substitutions or modifications that can be made by those skilled in the art without departing from the essence of the present invention are within the scope of protection of the present invention.

Claims

1. A method for constructing a lactoferrin peptide high-expressing strain, characterized in that: The construction method comprises: (1) Construction of high-expression recombinant engineering bacteria: Designing and selecting the amino acid sequence of a target recombinant human lactoferrin peptide, constructing a recombinant expression vector containing the recombinant human lactoferrin peptide nucleic acid sequence; linearizing the recombinant expression vector and then transferring it into a host bacterium to obtain a high-expression recombinant engineered bacterium; the target recombinant human lactoferrin peptide comprises the amino acid sequence shown in any one of SEQ ID Nos: 1 to 4; (2) Construction of high-copy, high-expression recombinant engineering bacteria: Amplifying the fragment containing the promoter, α signal peptide, CDS, and terminator in the recombinant expression vector in step (1), constructing a multi-copy recombinant expression vector containing n pieces of the fragment, and transferring the multi-copy recombinant expression vector into the high-expression recombinant engineered bacteria obtained in step (1) to obtain a high-copy, high-expression recombinant engineered bacteria; (3) Construction of a lactoferrin peptide high-expression strain: Constructing an auxiliary factor co-expression vector; the co-expression factors include PDI, Aft1 and Sec9, and the connection order of the co-expression factors in the co-expression vector is PDI, Aft1 and Sec9; The auxiliary factor co-expression vector is linearized and then transferred into the high-copy, high-expression recombinant engineered bacteria obtained in step (2) to obtain a high-copy strain co-expressing the auxiliary factor, that is, the lactoferrin peptide high-expression strain.

2. The method for constructing a lactoferrin peptide high-expressing strain according to claim 1, characterized in that: The nucleic acid sequence encoding the target recombinant human lactoferrin peptide includes the sequences shown in SEQ ID Nos: 5 to 8, or their degenerate sequences.

3. The method for constructing a lactoferrin peptide high-expressing strain according to claim 1, characterized in that: The host bacteria in step (1) include yeast.

4. The method for constructing a lactoferrin peptide high-expressing strain according to claim 3, characterized in that: The host bacteria is Pichia pastoris.

5. The method for constructing a lactoferrin peptide high-expressing strain according to claim 1, characterized in that: The recombinant expression vector in step (1) includes pPIC9K.

6. The method for constructing a lactoferrin peptide high-expressing strain according to claim 1, characterized in that: The n segments are connected end to end in sequence, and n>1.

7. The method for constructing a lactoferrin peptide high-expressing strain according to claim 6, characterized in that: The n is 3.

8. The method for constructing a lactoferrin peptide high-expressing strain according to claim 1, characterized in that: In step (2), the sequence of the fragment includes any one of SEQ ID Nos: 23 to 25, SEQ ID Nos: 26 to 28, SEQ ID Nos: 29 to 31 or SEQ ID Nos: 32 to 34, or a degenerate sequence thereof.

9. The lactoferrin peptide high-expressing strain constructed by the method according to any one of claims 1 to 8.

10. A lactoferrin peptide high expression strain, characterized in that: The lactoferrin peptide high-expressing strain is deposited in the General Microbiology Center of the China Culture Collection Administration, with the deposit numbers: CGMCC No.29182, CGMCC No.29183, CGMCC No.29186, CGMCC No.29187, all deposited on November 30, 2023, and the classification name: Komagataella phaffii.

11. Use of the lactoferrin peptide high-expressing strain according to any one of claims 9 or 10 in efficiently expressing recombinant human lactoferrin peptide or increasing the production / expression level of recombinant human lactoferrin peptide.

12. A method for preparing recombinant human lactoferrin peptide, characterized in that: The method comprises the following steps: subjecting the lactoferrin peptide high-expressing strain according to any one of claims 9 or 10 to fermentation induction, and purifying the expression product to obtain the recombinant human lactoferrin peptide.

13. The method of claim 12 for obtaining recombinant human lactoferrin peptide, characterized in that: The recombinant human lactoferrin peptide comprises: an amino acid sequence shown in any one of SEQ ID Nos: 2 to 4.

14. A nucleic acid encoding the recombinant human lactoferrin peptide according to claim 13.

15. The nucleic acid according to claim 14, characterized in that The nucleic acid includes the sequences shown in SEQ ID Nos: 6 to 8, or degenerate sequences thereof.

16. A recombinant expression vector, characterized in that: The recombinant expression vector comprises the nucleic acid according to any one of claims 14 or 15.

17. A recombinant engineered bacterium, characterized in that The recombinant engineered bacteria comprises the nucleic acid according to any one of claims 14 to 15, or comprises the recombinant vector according to claim 16, or expresses the recombinant human lactoferrin peptide according to claim 13.

18. A composition characterized in that The composition comprises the recombinant human lactoferrin peptide according to claim 13, or the nucleic acid encoding the recombinant human lactoferrin peptide according to any one of claims 14 to 15, or the lactoferrin peptide high-expressing strain according to claim 10, or the recombinant human lactoferrin peptide expressed by the method according to claim 12; the composition includes drugs, medical devices, biomaterials, tissue engineering products, cosmetics, foods or health products.

19. A product, characterized in that The product comprises the recombinant human lactoferrin peptide according to claim 13, or the nucleic acid encoding the recombinant human lactoferrin peptide according to any one of claims 14 to 15, or the lactoferrin peptide high-expressing strain according to claim 10, or the recombinant human lactoferrin peptide expressed by the method according to claim 12, or the composition according to claim 18; the composition includes drugs, medical devices, biomaterials, tissue engineering products, cosmetics, foods or health products.

20. Use of the recombinant human lactoferrin peptide according to claim 13, or the nucleic acid encoding the recombinant human lactoferrin peptide according to any one of claims 17 to 18, or the lactoferrin peptide high-expressing strain according to claim 10, or the recombinant human lactoferrin peptide expressed by the method according to claim 12, or the composition according to claim 18, or the product according to claim 19 in the preparation of drugs, medical devices, biomaterials, tissue engineering products, cosmetics, foods, or health products.

Citation Information

Patent Citations

  • Heterologous expression and antibacterial activity research of bovine lactoferrin in pichia pastoris

    CN116286418A

  • Recombinant expression vector for expressing bovine lactoferrin as well as construction method and application of recombinant expression vector

    CN116479027A

  • Lactoferrin peptide high-expression strain, construction method thereof and application of lactoferrin peptide high-expression strain in preparation of recombinant human lactoferrin peptide

    CN118256543A