Method to prevent and treat cancer cachexia
A combination of JAK and TLR4 inhibitors effectively treats cancer cachexia by inhibiting JAK1, JAK2, and TLR4 activity, leading to weight gain and prolonged survival in cancer patients.
Patent Information
- Application Number
- PCT/US2025/018953
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-03-07
- Filing Date
- 2025-03-07
- Publication Date
- 2025-09-11
AI Technical Summary
Cancer cachexia, a common and deadly condition in patients with cancer, lacks widely available effective treatments.
Administering a combination of Janus Kinase (JAK) inhibitors, such as ruxolitinib, and Toll-like receptor 4 (TLR4) inhibitors, such as TAK-242, to subjects with various types of cancer to inhibit JAK1, JAK2, and TLR4 activity, thereby addressing the underlying inflammation and metabolic alterations associated with cachexia.
The combination therapy leads to weight gain, increased appetite, and prolonged survival in cancer patients by reversing the cachexic state, improving quality of life and survival time.
Smart Images

Figure IMGF000019_0001 
Figure IMGF000020_0001 
Figure 00000051_0000
Abstract
Description
[0001] METHOD TO PREVENT AND TREAT CANCER CACHEXIA
[0002] STATEMENT REGARDING FEDERALLY FUNDED RESEARCH
[0003] This invention was made with government support under grant number 1 0T2 CA278685-01 awarded by the National Cancer Institute. The government has certain rights in this invention.
[0004] INCORPORATION BY REFERENCE OF SEQUENCE LISTING
[0005] This application contains a Sequence Listing which has been submitted electronically in ST26 format and hereby incorporated by reference in its entirety. Said ST26 file, created on March 4, 2025, is named 1676207WO.xml and is 13,454 bytes in size.
[0006] BACKGROUND
[0007] Cancer cachexia is a common and deadly condition in patients with cancer with no widely available treatment.
[0008] SUMMARY
[0009] In one embodiment, the disclosure includes a method to prevent or treat cancer cachexia comprising administering to a subject in need thereof an effective amount of a composition comprising at least one Janus Kinase (JAK) inhibitor and at least one Toll-like receptor 4 (TLR4) inhibitor. In one embodiment, the at least one JAK inhibitor inhibits the activity of JAK1, JAK2, JAK3, or a combination thereof. In one embodiment, the at least one JAK inhibitor comprises ruxolitinib, tofacitinib, baricitinib, fedratinib, upadacitinib, oclacitinib, peficitinib, delgocitinib, filgotinib, abrocitinib, pacritinib, deucravacitinib, ritlecitinib, momelotinib, golidocitinib, deuruxolitinib, brepocitinib, cerdulatinib, decernotinib, izencitinib, gandotinib, gusacitinib, lestaurtinib, povorcitinib, ropsacitinib, zasocitinib, or cucurbitacin I, or a combination thereof. In one embodiment, the at least one TLR4 inhibitor comprising TAK- 242, FP-025 (aderamastat; 5-[3-[4-[(3-methylphenyl)methoxy]phenyl]sulfanylfuran-2- yl]imidazolidine-2, 4-dione), or IAXO-102. The method further includes administering a combination of ruxolitinib and TAK-242. In one embodiment, the subject has a carcinoma, such as breast cancer, lung cancer, prostate cancer, colorectal cancer, pancreatic cancer, liver cancer, stomach cancer, esophageal cancer, kidney cancer, bladder cancer, cervical cancer, ovarian cancer, endometrial cancer, or skin cancer (including melanoma and non-melanoma); a sarcoma, such as osteosarcoma (bone cancer), liposarcoma (fat tissue cancer), leiomyosarcoma (smooth muscle cancer), rhabdomyosarcoma (skeletal muscle cancer), or angiosarcoma (blood vessel cancer); a leukemia, such as acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), or chronic myeloid leukemia (CML); a lymphoma, such as Hodgkin lymphoma and Non-Hodgkin lymphoma; multiple myeloma; a central nervous system cancer, such as glioblastoma, astrocytoma, or meningioma; or other cancer types, such as thyroid cancer, testicular cancer, oral cancer, nasopharyngeal cancer, gallbladder cancer, or bile duct cancer. In one embodiment, there is a weight gain of at least about 2.5% or 5% over a period of four weeks.
[0010] In another embodiment, the disclosure includes a method to increase appetite, cause weight gain, and / or increase survival time of a subject with cancer comprising administering to the subject an effective amount of at least one IAK inhibitor and at least one TLR4 inhibitor. In one embodiment, the at least one JAK inhibitor inhibits the activity of JAK1, JAK2, JAK3, or a combination thereof. In one embodiment, the at least one JAK inhibitor comprises ruxolitinib, tofacitinib, baricitinib, fedratinib, upadacitinib, oclacitinib, peficitinib, delgocitinib, filgotinib, abrocitinib, pacritinib, deucravacitinib, ritlecitinib, momelotinib, golidocitinib, deuruxolitinib, brepocitinib, cerdulatinib, decernotinib, izencitinib, gandotinib, gusacitinib, lestaurtinib, povorcitinib, ropsacitinib, zasocitinib, or cucurbitacin I, or a combination thereof. In one embodiment, the at least one TLR4 inhibitor comprises TAK-242, FP-025, or IAXO-102. The method further includes administering a combination of ruxolitinib and TAK-242. In one embodiment, the subject has a carcinoma, such as breast cancer, lung cancer, prostate cancer, colorectal cancer, pancreatic cancer, liver cancer, stomach cancer, esophageal cancer, kidney cancer, bladder cancer, cervical cancer, ovarian cancer, endometrial cancer, or skin cancer (including melanoma and non-melanoma); a sarcoma, such as osteosarcoma (bone cancer), liposarcoma (fat tissue cancer), leiomyosarcoma (smooth muscle cancer), rhabdomyosarcoma (skeletal muscle cancer), or angiosarcoma (blood vessel cancer); a leukemia, such as acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), or chronic myeloid leukemia (CML): a lymphoma, such as Hodgkin lymphoma and Non-Hodgkin lymphoma; multiple myeloma; a central nervous system cancer, such as glioblastoma, astrocytoma, or meningioma; or other cancer types, such as thyroid cancer, testicular cancer, oral cancer, nasopharyngeal cancer, gallbladder cancer, or bile duct cancer. In one embodiment, there is a weight gain of at least about 2.5% or 5% over a period of four weeks.
[0011] These and other features will be more clearly understood from the following detailed description taken in conjunction with the accompanying drawings and claims.
[0012] DRAWINGS
[0013] The drawings illustrate generally, by way of example, but not by way of limitation, various embodiments discussed herein. FIGS. 1A-1O. Cachexia is associated with a pro-inflammatory tumor microenvironment. A. Progression of weights normalized to peak from male KL mice (A). B- C. Representative tissue weights of tibialis anterior (TA, B.) and white adipose tissue (WAT, C.) from CACS and NCACS KL male mice. D. Ingenuity Pathway Analysis (IPA) comparing tumor transcriptomics between CACS and NCACS mice. E. Venn-diagram showing the results from KL mice tumor transcriptomics Gene Set Enrichment Analysis (GSEA) comparing CACS to NCACS (blue) and tumor proteomics from patients with low and high body mass index (BMI) in the CPTAC cohort (red). F. Heatmap that shows the differential expression of cytokines relevant to cachexia in tumors from CACS and NCACS mice. G. Volcano plot comparing cytokine levels measured by Luminex in tumor lysates from CACS and NCACS. H. Immunohistochemistry (IHC) for p-STAT3 (Tyr705) in the KL tumors from CACS and NCACS mice. I. Quantification of the positive cells per square millimeter in the tumor p- STAT3 (Tyr705) IHC of CACS and NCACS KL mice. J. Percentage of Mac3 cells relative to weight loss. K. Percentage of N1 cells relative to weight loss. L. Relative expression of the cytokines from panel F in the myeloid cells of CACS tumors. M. LPS levels in normal lung (WT) and tumor lysates from CACS and NCACS measured by ELISA. N. GSEA comparing tumor transcriptomics from patients with low and high BMI in CPTAC, showing enrichment in the “Myd88 independent Tlr4 cascade” pathway. O. Prostaglandin E2 (PGE2) levels in normal lung (WT) and tumor lysates from CACS and NCACS mice measured by ELISA. Comparisons in B, C, G and I were done with Wilcoxon's test. Comparisons in M and O were performed with one-way ANOVA followed by Tukey’s multiple comparisons test. Individual data points are independent biological replicates unless otherwise stated.
[0014] FIGS. 2A-2I. Cachexia is associated with systemic JAK activation. A. Volcano plot comparing cytokine levels measured by Luminex in plasma from CACS and NCACS KL mice. B. Venn-diagram with common GSEA results of the Hallmark database for liver, tumor and muscle. C. GSEA comparing muscle transcriptomics between CACS and NCACS KL mice using the Hallmark database. D. Western Blot (WB) for p-STAT3 (Tyr705), Total STAT3 and Vinculin in the tibialis anterior (TA) of non-tumor-bearing (WT) mice and KL mice with different stages of weight loss. E. GSEA comparing between livers of CACS and NCACS mice. F. Western Blot (WB) for p-STAT3 (Tyr705), Total STAT3 and Vinculin in liver of non-tumor- bearing (WT) mice, WT mice with 15 hours of food restriction, and KL mice with different stages of weight loss G. GSEA of acute phase reactants (APR) when comparing the liver transcriptomics of CACS and NCACS KL mice. H. Relative concentration of APR proteins (C-reactive protein, Chitinase 3-like-l, Haptoglobin, S100A9 and TIMP1) in the serum of KL mice with different grades of weight loss. APR concentration was normalized to 1-100 to plot all the analytes in a single graph. I. Venn-diagram showing GSEA common results between liver transcriptomics from KL mice (CACS vs NCACS), C26 tumor-bearing mice (tumor vs PBS control), and mice implanted with IL-6 pumps (IL-6 pump vs PBS pump). Comparison in A was done with Wilcoxon's test. Individual data points are independent biological replicates unless otherwise stated.
[0015] FIGS. 3A-3F. Jakl / 2 inhibition prolongs survival in male mice with cachexia. A. Progression of weights normalized to peak from cachexic KL male mice treated with TAK- 242. B. Kaplan-Meier plot with the probability of survival from cachexic KL male mice treated with TAK-242. C. Progression of weights normalized to peak from cachexic KL male mice treated with pacritinib. D. Kaplan- Meier plot with the probability of survival from cachexic KL male mice treated with pacritinib. E. Progression of weights normalized to peak from cachexic KL male mice treated with ruxolitinib. D. Kaplan-Meier plot with the probability of survival from cachexic KL male mice treated with ruxolitinib. Comparisons for the KM plots in B, D and F were done with the Log-rank Mantel-Cox test. Individual data points are independent biological replicates unless otherwise stated.
[0016] FIGS. 4A-4I. Ruxolitinib preserves adipose tissue mass and reverses PPAR-a inhibition and inflammation in the liver of cachexic mice. A. Correlation analysis of total body weight change between weeks three and six post-tumor induction and survival in days. B. Fat mass percentage change in male mice treated or not with ruxolitinib for four weeks after tumor induction. C-D. Non-esterified fatty acids (NEFA, C), and glycerol(D) in the serum of KL mice treated or not with ruxolitinib. E. WB for p-STAT3 (Tyr705), Total STAT3 and Vinculin in the liver KL mice treated or not with ruxolitinib. F. p-STAT3 quantification for the WB shown in (E). G. GSEA in liver transcriptomics comparing Hallmark pathways between cachexic KL mice treated or not with ruxolitinib. H. BHB levels in the serum of KL mice treated or not with ruxolitinib. I. Serum Amyloid Protein measured by Luminex in the serum of KL male mice treated or not with ruxolitinib. Comparisons between control and ruxolitinib-treated mice in C, D, and H were done using two-tailed Student’s t-test. Comparisons in B and F were done with Wilcoxon’s test. Pearson correlation analysis was used in A, and I (R2, Linear regression, and p, P value). Individual data points are independent biological replicates unless otherwise stated.
[0017] FIGS. 5A-5G. Combining TAK-242 with ruxolitinib prolongs survival with no changes in lean mass. A. Progression of weights normalized to peak from cachexic KL male mice treated with TAK-242 in combination with ruxolitinib, ruxolitinib alone or vehicle. B. Kaplan- Meier plot with the probability of survival from cachexic KL male mice in A. C-D. Fat mass change (C), and lean mass change (D) expressed in percentage from the KL mice in A. Individual data points are independent biological replicates unless otherwise stated.
[0018] FIGS S1A-S1K. IL-6 family members are increased in the tumors of CACS mice and are associated with unfavorable prognosis in human lung cancer. A. Progression of weights normalized to peak from female KL mice. B-C. Representative tissue weights of tibialis anterior (TA, B.) and white adipose tissue (WAT, C.) from CACS and NCACS KL mice. D. GSEA comparing CACS to NCACS in tumor transcriptomics from the TracerX cohort, showing increased inflammatory response in the tumors of patients with cachexia. E-G. Protein concentration measured by Luminex of LIF(E), IL- 11(F) and IL-6(G) in the tumor lysates of WT, NCACS and CACS KL mice. H. Kaplan-Meier plots showing survival probability of patients with lung adenocarcinoma stratified by high or low IL6, LIF and IL 11. I. Immunohistochemistry (IHC) for p-STAT3 (Tyr705) in healthy lung from CACS and NCACS KL mice. J. Quantification of positive cells per square millimeter in the p-STAT3 (Tyr705) IHC shown in G. K. Relative expression of p-STAT3 (Tyr705) comparing tumor phosphoproteomics from patients with low and normal BMI in CPTAC cohort. Comparisons in B, C, J and K were done with Wilcoxon's test. Comparisons in E, F, and G were done with the Kruskal- Wallis test, followed by Dunn's test. Comparisons for the KM plots in H were done with the Log-rank Mantel-Cox test. Individual data points are independent biological replicates unless otherwise stated.
[0019] FIGS. S2A-S2M. Tumors from cachexic mice have a distinct cell composition. A. PaCMAP plots showing cell types in the lungs of non-tumor bearing mice (WT), and in the tumors of pre-CACS and CACS KL mice. B. Barplots of the cell types in A. C. DotPlot with the relative expression of the Hallmark pathways for each cell type in the tumors of CACS mice. D. AlluvialPlot showing the equivalency between the annotations of myeloid cells in the tumor. E. PaCMAP of the myeloid cells in the lungs of non-tumor bearing mice (WT), and in the tumors of pre-CACS and CACS. F. Barplots of the cell types in E. G. Bubble plot showing changes in cell type composition of the tumors with weight loss. H. Estimated number of neutrophils in the tumors of the CPTAC cohort stratified by normal and low BMI. I. CXCL8 protein levels in the proteomic dataset of the CPTAC cohort stratified by BMI. J. Enrichment of relevant Reactome pathways comparing myeloid cells from CACS to pre-CACS. K. 16S ribosomal RNA qPCR bacteria quantification in whole lung lysates from non-tumor-bearing mice (WT), and KL tumor-bearing mice with or without cachexia. L. Comparison of IRAKI gene expression between normal lung and lung cancer. M. Kaplan-Meier plot showing survival probability of lung cancer patients stratified by high or low IRAKI expression. Comparisons in H, I and L were done with Wilcoxon’s test. Comparison in K was done with one-way ANOVA followed by Tukey’s multiple comparisons test. Comparisons for the KM plot in M were done with the Log-rank Mantel-Cox test. Individual data points are independent biological replicates unless otherwise stated.
[0020] FIGS. S3A-S3F. IL-6 family members can be found in circulation in the serum of KL mice and plasma of lung cancer patients. Protein concentration measured by Luminex of IL-6 (A), IL-33 (D), LIF (E) and IL- 10 (F) in the serum of WT, NCACS and CACS KL mice. E-F. Protein concentration measured by Luminex of IL-6(B) and IL- 11(C) in the plasma of lung cancer patients with and without cachexia and control plasma samples. Comparisons in A, B, C, D, E and F were done with the Kruskal- Wallis test, followed by Dunn's test. Individual data points are independent biological replicates unless otherwise stated.
[0021] FIGS. S4A-S4H. Liver inflammation in the KL mice is sterile. A. GSEA showing enrichment of the sepsis signature in the muscle of the CACS mice. B. GSEA for the Reactome MYD88 / TIRAP signaling pathway comparing between livers of CACS and NCACS mice. C. WB for p-STAT3 (Tyr705), Total STAT3 and Vinculin in the liver of Fed (WT, non-tumor bearing mice), CR (WT mice that underwent 30% caloric restriction for 18 days), CACS (KL tumor-bearing mice with more than 15% weight loss). D. Representative IHC for the panmacrophage marker F4 / 80 in the livers of CACS and NCACS KL mice. E. Quantification of the positive cells per square millimeter in the p-STAT3 (Tyr705) IHC shown in (D). F. LPS levels measured by EndoLISA in the liver lysates of WT and KL mice with and without cachexia. G.16S ribosomal RNA qPCR quantification of bacteria abundance in whole lung lysates from non-tumor-bearing mice (WT), and KL tumor-bearing mice (NCACS and CACS). H. Alanine Aminotransferase (ALT) activity assay in the serum of WT and KL mice with and without cachexia. Comparisons in B and D were done with Wilcoxon’s test. Individual data points are independent biological replicates unless otherwise stated.
[0022] FIGS. S5A-S5E. IL-6 family members inhibit PPAR-a in mouse isolated hepatocytes. A. qPCR for nascent transcripts of PPAR-a target genes in mouse primary hepatocytes incubated with IL-6 and the PPAR-a agonists Wy 14643, gw7647. B. qPCR for nascent transcripts of PPAR-a target genes in mouse primary hepatocytes incubated with IL-6, Lif and IL-11 and PPAR-a agonists Wyl4643, gw7647. C-E. Mouse primary hepatocytes were treated alone or in combination with IL-1, IL-6, and TNF-a for two hours, (D) mouse primary hepatocytes were incubated with or without IL-6 for Ohs (baseline), 6hs and 24hs, (E) human primary hepatocytes were incubated with or without IL-6 for Ohs (baseline), 6hs and 24hs. Comparisons in A and B were done with Student's t-test. Individual data points are independent biological replicates unless otherwise stated.
[0023] FIGS. S6A-S6H. IL-6 reproduces the liver phenotype of the KL CACS mice. A. Experimental design for non-tumor bearing mice implanted with IL-6 or PBS secreting pumps (“Fed” is unrestricted access to food, “TFR” is total food restriction for 18 hs). B. Whole-body weight of mice implanted with IL-6 secreting pumps and total food restriction for 24hs (TFR, red), mice with PBS pumps and 24hs TFR (blue), and PBS pumps with ad-libitum food (green). C. Beta-hydroxybutyrate (BHB) measured in the serum of the mice in A / B. D. WB for p- STAT3 (Tyr705), Total STAT3 and Vinculin in the liver of mice implanted with PBS or IL-6 pumps E. Unbiased principal component analysis (PCA) of liver transcriptomics from WT (non-tumor bearing) mice implanted with IL-6 secreting pumps and total food restriction for 24hs (TFR, red), mice with PBS pumps and 24hs TFR (blue), and with PBS pumps but with ad-libitum food (green). F. GSEA of liver transcriptomics comparing Hallmark pathways between mice implanted with IL-6 or PBS-secreting pumps and TFR for 24hs. G. Heatmap of APR-related genes in the liver transcriptomics of mice implanted with PBS or IL-6 pumps. H. qPCR for PPAR-a target genes in livers of mice implanted with PBS or IL-6 pumps. Comparisons in C and H were performed with one-way ANOVA followed by Tukey's multiple comparisons test. Comparisons in J were done using a two-tailed Student's t-test. Comparisons in B were done with two-way ANOVA followed by Tukey's multiple comparisons test (**=0.0008, ***=<0.0001 ). Individual data points are independent biological replicates unless otherwise stated. Model in (A) was made with Biorender.com.
[0024] FIGS. S7A-S7J. TAK-242 preserves muscle mass and reduces APR in cachexic male mice. A. Progression of weights normalized to peak from cachexic KL female mice treated with TAK-242. B. Kaplan-Meier plot with the probability of survival from cachexic KL female mice treated with TAK-242. C-F. Averaged tissue weights at endpoint from KL mice treated or not with TAK-242. G-J. Acute phase reactants (APR) measured by Luminex in the serum of KL male mice at endpoint treated or not with TAK-242. Comparison for the KM plot in B was done with the Log-rank Mantel-Cox test. Comparisons between control and TAK-242 treated mice in C, D, E and F were done using two-tailed Student's t-test. Pearson correlation analysis was used in G, H, I and I (R2, Linear regression, and p, P value). Individual data points are independent biological replicates unless otherwise stated.
[0025] FIGS. S8A-S8F. Pacritinib does not prolong survival nor preserve tissue mass in cachexia. A. Progression of weights normalized to peak from cachexic KL female mice treated with pacritinib. B. Kaplan-Meier plot with the probability of survival from cachexic KL female mice treated with pacritinib. C-E Averaged tissue weights from KL mice at endpoint treated or not with pacritinib. Comparison for the KM plot in B was done with the Log-rank Mantel-Cox test. Comparisons between control and pacritinib treated mice in C, D, E and F were done using two-tailed Student's t-test. Individual data points are independent biological replicates unless otherwise stated.
[0026] FIGS. S9A-S9K. Ruxolitinib-treated mice gain weight and adipose tissue mass by increasing caloric intake. A. Change in whole body weight expressed in percentage, in mice treated or not with ruxolitinib for 13 days. B. Percentage change in fat mass in mice treated or not with ruxolitinib for thirteen days. C. Averaged white adipose tissue mass at endpoint from mice treated or not with ruxolitinib. D-E. Cumulative food intake from male (H) and female (I) mice treated or not with ruxolitinib for thirteen days. F. Percentage change of lean mass in mice treated or not with ruxolitinib for thirteen days. G-L Spleen mass (G), gastrocnemius (H) and quadriceps (I) at endpoint from mice treated or not with ruxolitinib. J-K Cumulative activity of male (J) and female (K) mice treated or not with ruxolitinib for thirteen days. Comparisons between control and ruxolitinib-treated mice in A, B, C, F, G, H and I were done using two-tailed Student's t-test. Individual data points are independent biological replicates unless otherwise stated.
[0027] FIGS. S10A-S10G. Ruxolitinib does not improve survival in female mice. A. Progression of weights normalized to peak from cachexic KL female mice treated with ruxolitinib. B. Kaplan-Meier plot with the probability of survival from cachexic KL female mice treated with ruxolitinib. C-G. Averaged tissue weights from KL mice at endpoint treated or not with ruxolitinib. Comparison for the KM plot in B was done with the Log-rank Mantel- Cox test. Comparisons between control and ruxolitinib-treated mice in C, D, E, F and G were done using two-tailed Student’s t-test. Individual data points are independent biological replicates unless otherwise stated.
[0028] FIGS. S11A-S11E. Ruxolitinib reduces inflammation and restores PPAR-a in the liver of KL mice. A. qPCR of PPAR-a target genes in the liver of mice treated or not with ruxolitinib. B-D. APR proteins A2M, CRP and AGP are reduced with ruxolitinib treatment. E. Whole-slide quantification of F4 / 80 macrophages in the liver of NCACS, and CACS KL mice treated or not with ruxolitinib.
[0029] FIGS. S12A-S12G. Ruxolitinib reverses JAK activation in the muscle but reduces its mass. A. WB for p-STAT3 (Tyr705), Total STAT3 and Vinculin in the tibialis anterior of KL male mice treated or not with ruxolitinib. B. Quantification by densitometry of the p-STAT3 WB shown in (A). C. GSEA using the "IL6 JAK STAT3 Signaling" data set from the Hallmark database to compare muscle from cachexic KL mice treated with ruxolitinib to untreated cachexic muscle. D. GSEA using the Kyoto Encyclopedia of Genes and Genomes (KEGG) database to compare muscle from cachexic mice treated or not with ruxolitinib. E. Lean mass percentage change in male mice treated or not with ruxolitinib for four weeks after tumor induction. F-G. Averaged muscle weight of tibialis anterior (F) and gastrocnemius (G) in male mice treated or not with ruxolitinib relative to weight loss. Comparisons between control and ruxolitinib- treated mice in B, and E were done with Wilcoxon’s test. Individual data points are independent biological replicates unless otherwise stated.
[0030] FIGS. S13A-S13C. Fat mass gain and lean mass loss occur during the first five weeks of treatment. A-B. Percentage of change in fat mass (A) and lean mass (B) by body composition in non-tumor bearing mice. C. Averaged mass of gastrocnemius, quadriceps and tibialis anterior in non-tumor bearing mice of A / B. Individual data points are independent biological replicates unless otherwise stated.
[0031] DESCRIPTION
[0032] Reference will now be made in detail to certain embodiments of the disclosed subject matter. While the disclosed subject matter will be described in conjunction with the enumerated claims, it will be understood that the exemplified subject matter is not intended to limit the claims to the disclosed subject matter.
[0033] Definitions
[0034] The following definitions are included to provide a clear and consistent understanding of the specification and claims. As used herein, the recited terms have the following meanings. All other terms and phrases used in this specification have their ordinary meanings as one of skill in the art would understand. Such ordinary meanings may be obtained by reference to technical dictionaries, such as Hawley's Condensed Chemical Dictionary 16th Edition, by M. Larranga, R Lewis Sr., and R Lewis, New York, N.Y., 2016.
[0035] References in the specification to "one embodiment," "an embodiment," etc., indicate that the embodiment described may include a particular aspect, feature, structure, moiety, or characteristic, but not every embodiment necessarily includes that aspect, feature, structure, moiety, or characteristic. Moreover, such phrases may, but do not necessarily, refer to the same embodiment referred to in other portions of the specification. Further, when a particular aspect, feature, structure, moiety, or characteristic is described in connection with an embodiment, it is within the knowledge of one skilled in the art to affect or connect such aspect, feature, structure, moiety, or characteristic with other embodiments, whether or not explicitly described. As used herein, the term "in some embodiments" refers to embodiments of all aspects of the disclosure, unless the context clearly indicates otherwise.
[0036] The singular forms "a," "an," and "the" include plural reference unless the context clearly dictates otherwise. Thus, for example, a reference to "a compound" includes a plurality of such compounds, so that a compound X includes a plurality of compounds X. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for the use of exclusive terminology, such as "solely," "only," and the like, in connection with any element described herein, and / or the recitation of claim elements or use of "negative" limitations.
[0037] The term "and / or" means any one of the items, any combination of the items, or all of the items with which this term is associated. The phrase "one or more" is readily understood by one of skill in the art, particularly when read in context of its usage. For example, one or more substituents on a phenyl ring refers to one to five, or one to four, for example if the phenyl ring is di- substituted.
[0038] As used herein, “or” should be understood to have the same meaning as “and / or” as defined above. For example, when separating a listing of items, “and / or” or “or” shall be interpreted as being inclusive, e.g., the inclusion of at least one, but also including more than one of a number of items, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as “only one of’ or “exactly one of,” or, when used in the claims, “consisting of,” will refer to the inclusion of exactly one element of a number or list of elements. In general, the term “or” as used herein shall only be interpreted as indicating exclusive alternatives (i.e., “one or the other but not both”) when preceded by terms of exclusivity, such as “either,” “one of,” “only one of,” or “exactly one of.”
[0039] As used herein, the terms “including,” “includes,” “having,” “has,” “with,” or variants thereof, are intended to be inclusive similar to the term “comprising.”
[0040] The term "about" can refer to a variation of ± 5%, ± 10%, ± 20%, or + 25% of the value specified. For example, "about 50" percent can in some embodiments carry a variation from 45 to 55 percent. For integer ranges, the term "about" can include one or two integers greater than and / or less than a recited integer at each end of the range. Unless indicated otherwise herein, the term "about" is intended to include values, e.g., weight percentages, proximate to the recited range that are equivalent in terms of the functionality of the individual ingredient, the composition, or the embodiment. The term about can also modify the endpoints of a recited range as discuss above in this paragraph. As will be understood by the skilled artisan, all numbers, including those expressing quantities of ingredients, properties such as molecular weight, reaction conditions, and so forth, are approximations and are understood as being optionally modified in all instances by the term "about." These values can vary depending upon the desired properties sought to be obtained by those skilled in the art utilizing the teachings of the descriptions herein. It is also understood that such values inherently contain variability necessarily resulting from the standard deviations found in their respective testing measurements.
[0041] As will be understood by one skilled in the art, for any and all purposes, particularly in terms of providing a written description, all ranges recited herein also encompass any and all possible sub-ranges and combinations of sub-ranges thereof, as well as the individual values making up the range, particularly integer values. A recited range (e.g., weight percentages or carbon groups) includes each specific value, integer, decimal, or identity within the range. Any listed range can be easily recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, or tenths. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, etc. As will also be understood by one skilled in the art, all language such as "up to," "at least," "greater than," "less than," "more than," "or more," and the like, include the number recited and such terms refer to ranges that can be subsequently broken down into sub-ranges as discussed above. In the same manner, all ratios recited herein also include all sub-ratios falling within the broader ratio. Accordingly, specific values recited for radicals, substituents, and ranges, are for illustration only; they do not exclude other defined values or other values within defined ranges for radicals and substituents.
[0042] One skilled in the art will also readily recognize that where members are grouped together in a common manner, such as in a Markush group, the invention encompasses not only the entire group listed as a whole, but each member of the group individually and all possible subgroups of the main group.
[0043] Additionally, for all purposes, the invention encompasses not only the main group, but also the main group absent one or more of the group members. The invention therefore envisages the explicit exclusion of any one or more of members of a recited group. Accordingly, provisos may apply to any of the disclosed categories or embodiments whereby any one or more of the recited elements, species, or embodiments, may be excluded from such categories or embodiments, for example, for use in an explicit negative limitation.
[0044] The term "at least" prior to a number or series of numbers (e.g., "at least two") is understood to include the number adjacent to the term "at least," and all subsequent numbers or integers that could logically be included, as clear from context. When "at least" is present before a series of numbers or a range, it is understood that "at least" can modify each of the numbers in the series or range.
[0045] The term “standard,” as used herein, refers to something used for comparison. For example, it can be a known standard agent or compound which is administered and used for comparing results when administering a test compound, or it can be a standard parameter or function which is measured to obtain a control value when measuring an effect of an agent or compound on a parameter or function. Standard can also refer to an “internal standard”, such as an agent or compound which is added at known amounts to a sample and is useful in determining such things as purification or recovery rates when a sample is processed or subjected to purification or extraction procedures before a marker of interest is measured. Internal standards are often a purified marker of interest which has been labeled, such as with a radioactive isotope, allowing it to be distinguished from an endogenous marker.
[0046] As used herein, an “effective amount” or “therapeutically effective amount” (terms can be used interchangeably) means an amount sufficient to produce a selected effect, such as alleviating symptoms of a disease or disorder. A "therapeutically effective amount" of a treatment is a predetermined amount calculated to achieve the desired effect, i.e., to treat, combat, ameliorate, prevent, or improve one or more symptoms of, for example, a viral infection. The activity contemplated by the present methods includes both medical therapeutic and / or prophylactic treatment, as appropriate. The specific dose of a compound administered according to the present disclosure to obtain therapeutic and / or prophylactic effects will, of course, be determined by the circumstances surrounding the case, including, for example, the compound / composition / agent / fusion protein administered, the route of administration, and the condition being treated or prevented. It will be understood that the effective amount administered will be determined by the physician in the light of the relevant circumstances including the condition to be treated, the choice of compound to be administered, and the chosen route of administration, and therefore any dosage ranges provided herein are not intended to limit the scope of the present disclosure in any way. A therapeutically effective amount of the agents disclosed herein, such the fusion protein, for treating and / or preventing a pathogenic infection according to the disclosure is typically an amount such that when it is administered in a physiologically tolerable excipient composition, it is sufficient to achieve an effective concentration in the tissue subject.
[0047] The term “delivery vehicle” or “carrier” refers to any kind of device or material which can be used to deliver the invention in vivo. The term "treat," "treated," or "treating" refers to therapeutic treatment and / or prophylactic or preventative measures wherein the object is to prevent or slow down (lessen) an undesired physiological condition, disorder, or disease, or obtain beneficial or desired clinical results. For purposes of the embodiments described herein, beneficial or desired clinical results include, but are not limited to, alleviation of symptoms; diminishment of extent of condition, disorder or disease; stabilized (i.e.. not worsening) state of condition, disorder or disease; delay in onset or slowing of condition, disorder or disease progression; amelioration of the condition, disorder or disease state or remission (whether partial or total), whether detectable or undetectable; an amelioration of at least one measurable physical parameter, not necessarily discernible by the patient; or enhancement or improvement of condition, disorder or disease. Treatment can also include eliciting a clinically significant response without excessive levels of side effects. Treatment also includes prolonging survival as compared to expected survival if not receiving treatment.
[0048] A "preventive" or "prophylactic" treatment is a treatment administered to a subject who does not exhibit signs, or exhibits only early signs, of a disease or disorder. A prophylactic or preventative treatment is administered for the purpose of decreasing the risk of developing pathology associated with developing the disease or disorder.
[0049] As used herein, the term "therapeutic" means an agent utilized to treat, combat, ameliorate, prevent, or improve an unwanted condition or disease of a patient.
[0050] The term "in need thereof means that the subject has been identified or suspected as having a need for the particular method or treatment. In some embodiments, the identification can be by any means of diagnosis or observation. In any of the methods described herein, the subject can be in need thereof.
[0051] As used herein “injecting, administering or applying” includes administration of the invention by any number of routes and means including, but not limited to, topical, oral, buccal, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, ophthalmic, or pulmonary.
[0052] As used herein, a “subject in need thereof” is a patient, animal (domestic (cat, dog) or farm animal (livestock, horse, cow), mammal, or human, who will benefit from the method of this invention. The terms "subject" refers to an animal, such as a mammalian species (e.g., human). More specifically, a subject can be a vertebrate, e.g., a mammal such as a mouse, a primate, a simian, or a human. Animals include farm animals (e.g., production cattle, dairy cattle, poultry, horses, pigs, and the like), sport animals, and companion animals (e.g., pets or support animals). A subject can be a healthy individual, an individual that has or is suspected of having a disease or a predisposition to the disease, or an individual that needs therapy or suspected of needing therapy. The terms "individual" or "patient" are intended to be interchangeable with "subject."
[0053] A disease, condition, or disorder is “alleviated” if the severity of a symptom of the disease or disorder, the frequency with which such a symptom is experienced by a subject, or both, are reduced.
[0054] The term "kit" refers to a combination of reagents and / or apparatus for administering the compositions provide herein. In some embodiments, a kit may further include one or more apparatus to facilitate sample harvesting. In some embodiments, a kit may further include one or more reagents for sample processing. In some embodiment s, a kit may further include one or more written instructions.
[0055] The term "sample" is used herein in the broadest sense and can be obtained from any source in the body. A sample can encompass fluids, solids and / or tissues. In some embodiments, a sample can include one or more of the following fluids: oral fluid, nasal fluid, or ear drainage. A sample can also include other fluids, such as serous fluid, urine, saliva, tears, blood, plasma, and serum. In some embodiments, the sample is an oral fluid, nasal fluid, saliva, blood, plasma, or serum.
[0056] The terms “comprises,” “comprising,” and the like can have the meaning ascribed to them in U.S. Patent Law and can mean “includes,” “including” and the like. As used herein, “including” or “includes” or the like means including, without limitation.
[0057] Methods involving conventional molecular biology techniques are described herein. Such techniques are generally known in the art and are described in detail in methodology treatises, such as Molecular Cloning: A Laboratory Manual, 4th ed., Green and Sambrook, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y, 2014; and Current Protocols in Molecular Biology, ed. Ausubel et al., Greene Publishing and Wiley-Interscience, New York, 1992 (with periodic updates). Methods for chemical synthesis of nucleic acids are discussed, for example, in Beaucage and Carruthers, Tetra. Letts. 22: 1859-1862, 1981, and Matteucci et al., J. Am. Chem. Soc. 103:3185, 1981.
[0058] Cancer and Cachexia
[0059] Cachexia is a syndrome characterized by body weight loss, muscle wasting, and fatigue, often associated with chronic illnesses such as cancer, heart failure, autoimmune disease, and chronic obstructive pulmonary disease. It involves a multifactorial pathophysiology, including metabolic alterations, inflammation, and reduced food intake, leading to a negative energy balance and catabolic state. Cachexia significantly impacts the quality of life and survival of affected individuals, and it is distinct from starvation or malnutrition due to its resistance to nutritional interventions alone.
[0060] Cancer cachexia is associate with numerous cancers, including, but not limited to, carcinomas, such as breast cancer, lung cancer, prostate cancer, colorectal cancer, pancreatic cancer, liver cancer, stomach cancer, esophageal cancer, kidney cancer, bladder cancer, cervical cancer, ovarian cancer, endometrial cancer and skin cancer (including melanoma and non-melanoma); sarcomas, such as osteosarcoma (bone cancer), liposarcoma (fat tissue cancer), leiomyosarcoma (smooth muscle cancer), rhabdomyosarcoma (skeletal muscle cancer), and angiosarcoma (blood vessel cancer); leukemias, such as, acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), and chronic myeloid leukemia (CML); lymphomas, such as Hodgkin lymphoma and Non-Hodgkin lymphoma; multiple myeloma; central nervous system cancers, including glioblastoma, astrocytoma, and meningioma; and other cancer types, including, thyroid cancer, testicular cancer, oral cancer, nasopharyngeal cancer, gallbladder cancer and bile duct cancer.
[0061] Lung cancer is the primary cause of cancer-related mortality. It is frequently accompanied by anorexia and cachexia, a syndrome characterized by weight loss and skeletal muscle wasting. Provided herein is the investigated of the contribution of inflammatory signaling to cachexia in a murine model of lung cancer. Transcriptomic analysis revealed increased inflammatory pathways in cachexic tumor tissues. Notably, IL-6 superfamily members were elevated in the tumor and plasma of mice and patients with cachexia. The JAK- STAT pathway was activated in the liver and skeletal muscle, influencing the acute phase response and lipid metabolism. Inhibition of JAK1 / 2 with ruxolitinib improved body weight, survival, and reversed hepatic metabolic alterations. The combination of ruxolitinib with TAK- 242 delayed weight loss, extended survival, and increased fat mass similarly to ruxolitinib alone, with an additional benefit of preserving skeletal muscle mass. These results suggest JAK inhibition as a treatment for cachexia in cancer, including lung cancer.
[0062] JAK and JAK Inhibitors
[0063] Janus kinase (JAK) is a family of intracellular, non-receptor tyrosine kinases that transduce cytokine-mediated signals via the JAK-STAT pathway. They were initially named "just another kinase" 1 and 2 (since they were just two of many discoveries in a PCR-based screen of kinases) but were ultimately published as "Janus kinase". The name is taken from the two-faced Roman god of beginnings, endings and duality, Janus, because the JAKs possess two near-identical phosphate-transferring domains. One domain exhibits the kinase activity, while the other negatively regulates the kinase activity of the first.
[0064] The four JAK family members are: Janus kinase 1 (JAK1; accession numbers NM_002227, NM_001320923, NM_001321852, NM_001321853, and NM_001321854 for human mRNA and NP_001307852, NP_001308781, NP_001308782, NP_001308783 and NP_001308784 for human protein sequence), Janus kinase 2 (JAK2; accession numbers NM_004972, NM_001322194, NM_001322195, NM_001322196, and NM_001322198 for human mRNA and NP_001309123, NP_001309124, NP_001309125, NP_001309127, and NP_001309128 for human protein sequence), Janus kinase 3 (JAK3; accession numbers NM_000215 for human mRNA and NP_000206 for human protein sequence), or Tyrosine kinase 2 (TYK2; accession numbers NM_003331 for human mRNA and NP_003322 for human protein sequence).
[0065] A Janus kinase inhibitor, also known as JAK inhibitor or jakinib, is a type of immune modulating medication, which inhibits the activity of one or more of the Janus kinase family of enzymes (JAK1, JAK2, JAK3, TYK2), thereby interfering with the JAK-STAT signaling pathway in lymphocytes.
[0066] Examples of JAK inhibitors include, but are not limited to, Ruxolitinib (Jakafi), Tofacitinib (Xelj anz; 3 -((3R,4R)-4-methyl-3 -(methyl(7H-pyrrolo [2,3 -d]pyrimidin-4- yl)amino)piperidin-l-yl)-3-oxopropanenitrile), Baricitinib (Olumiant; 2-[l-ethylsulfonyl-3- [4-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)pyrazol-l-yl]azetidin-3-yl]acetonitrile), Fedratinib (Inrebic ; N -tert-butyl-3- [ [5-methyl-2- [4-(2-pyrrolidin- 1 -ylethoxy)anilino]pyrimidin-4- yl]amino]benzenesulfonamide), Upadacitinib (Rinvoq; (3S,4R)-3-Ethyl-4-(3H-imidazo[l,2- a]pyrrolo[2,3-e]pyrazin-8-yl)-N-(2,2,2-trifluoroethyl)pyrrolidine-l-carboxamide), Oclacitinib (Apoquel; N-methyl[trans-4-(methyl-7H-pyrrolo[2,3-d]pyrimidin-4-ylamino) cyclohexyl] methanesulfonamide (2Z)-2-butenedioate), Peficitinib, Delgocitinib (3-[(3S,4R)- 3-methyl-7-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)-l,7-diazaspiro[3.4]octan-l-yl]-3- oxopropanenitrile), Filgotinib (Jyseleca), Abrocitinib (Cibinqo; N-{cis-3-[Methyl(7H- pyrrolo[2,3-d]pyrimidin-4-yl)amino]cyclobutyl}propane-l -sulfonamide), Pacritinib (Vonjo; 2-hydroxypropane-l,2,3-tricarboxylic acid;(16E)-l l-(2-pyrrolidin-l-ylethoxy)-14,19-dioxa- 5,7,27-triazatetracyclo[ 19.3.1.12,6.18,12]heptacosa- l(24),2(27),3,5,8(26),9,ll,16,21(25),22-decaene), Deucravacitinib (Sotyktu; 6- (cyclopropanecarbonylamino)-4-|2-methoxy-3-( l -methyl- 1 ,2, 4-tri azol -3-yl )anilino|-Y- (trideuteriomethyl)pyridazine-3-carboxamide), Ritlecitinib (Litfulo; 4- methylbenzenesulfonic acid;l-[(2S,5R)-2-methyl-5-(7H-pyrrolo[2,3-d]pyrimidin-4- ylamino)piperidin-l-yl]prop-2-en- 1-one), Momelotinib (Ojjaara; N-(cyanomethyl)-4-[2-(4- morpholin-4-ylanilino)pyrimidin-4-yl]benzamide), Golidocitinib (Gao Ruizhe; (2R)-N-[3- [2- [(3-methoxy- 1 -methylpyrazol-4-y l)amino]pyrimidin-4-yl] - 1 H-indol-7 -yl] -2-(4- methylpiperazin-l-yl)propanamide), Deuruxolitinib (Leqselvi; (3R)-3-(2,2,3,3,4,4,5,5- octadeuteriocyclopentyl)-3-[4-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)pyrazol-l- yl]propanenitrile), Brepocitinib (PF-06700841; [(lS)-2,2-difluorocyclopropyl]-[(lR,5S)-3- [2-[(l-methylpyrazol-4-yl)amino]pyrimidin-4-yl]-3,8-diazabicyclo[3.2. l]octan-8- yl]methanone;4-methylbenzenesulfonic acid), Cerdulatinib (PRT062070; 4-
[0067] (cyclopropylamino)-2-[4-(4-ethylsulfonylpiperazin-l-yl)anilino]pyrimidine-5- carboxamide), Decernotinib (VX-509; (2R)-2-methyl-2-[[2-(lH-pyrrolo[2,3-b]pyridin-3- yl)pyrimidin-4-yl]amino]-N-(2,2,2-trifluoroethyl)butanamide), Izencitinib (TD-1473; 3- [(lR,5S)-3-[[7-[(5-methyl-lH-pyrazol-3-yl)amino]-l,6-naphthyridin-5-yl]amino]-8- azabicyclo[3.2.1]octan-8-yl]propanenitrile), Gandotinib (LY-2784544; 3-[(4-chloro-2- fluorophenyl)methyl]-2-methyl-N-(5-methyl-lH-pyrazol-3-yl)-8-(morpholin-4- ylmethyl)imidazo[l,2-b]pyridazin-6-amine), Gusacitinib (ASN002; 2-[l-[4-[4-(4- hydroxypiperidin-l-yl)anilino]-5-oxo-6H-pyrimido[4,5-d]pyridazin-2-yl]piperidin-4- yl] acetonitrile), Lestaurtinib (CEP-701; (155,165,187?)-16-hydroxy-16-(hydroxymethyl)-15- methyl-28-oxa-4,14,19-triazaoctacyclo[12. 11.2. l15’18.02'6.07'27.08’13.019'26.020'25]octacosa- l,6,8,10,12,20,22,24,26-nonaen-3-one), Povorcitinib (INCB054707; 4-[3-(cyanomethyl)-3- [4-(3,5-dimethyl-lH-pyrazol-4-yl)pyrazol-l-yl]azetidin-l-yl]-2,5-difluoro-A-[(25)- 1,1,1- trifluoropropan-2-yl]benzamide), Ropsacitinib (PF-06826647; 3-(cyanomethyl)-3-[4-[6-(l- methylpyrazol-4-yl)pyrazolo[l,5-a]pyrazin-4-yl]pyrazol-l-yl]cyclobutane-l -carbonitrile), Zasocitinib (YAK-279; A-[(17?,2R)-2-methoxycyclobutyl]-7-(methylamino)-5-[(2-oxo-l- pyridin-2-ylpyridin-3-yl)amino]pyrazolo[l,5-a]pyrimidine-3-carboxamide) or Cucurbitacin I (JSI-124; (85,97?, 107?, 137?, 145,167?, 177?)-17-[(E,27?)-2, 6-dihydroxy-6-methyl-3-oxohept-4- en-2-yl] -2, 16-dihydroxy-4,4,9, 13,14-pentamethyl-8, 10, 12, 15, 16, 17 -hexahydro-777- cyclopenta[a]phenanthrene-3, 11 -dione) .
[0068] Ruxolitinib:
[0069] Y1
[0070]
[0071] TLR4 and TLR4 inhibitors
[0072] TLR4, or Toll-like receptor 4, is a protein that plays a role in the immune system by recognizing and responding to specific molecular patterns associated with microbial pathogens and damaged cells. It is a member of the Toll-like receptor family, which is involved in the innate immune response.
[0073] TLR4 is a transmembrane protein composed of an extracellular domain that recognizes ligands, a transmembrane domain, and an intracellular domain that transduces signals to downstream pathways. The activation of TLR4 triggers the MyD88-dependent and TRIF- dependent signaling pathways, leading to the activation of transcription factors such as NF- KB and IRF3. This results in the expression of genes involved in inflammation, immune regulation, and antiviral responses. Dysregulation of TLR4 signaling has been implicated in various diseases, including sepsis, autoimmune disorders, and chronic inflammatory conditions.
[0074] Examples of TLR4 inhibitors include, but are not limited to, TAK-242 (also known as CLI-095 or Resatorvid; a small-molecule inhibitor that selectively binds to TLR4 and interferes with its signaling pathways; eritoran (a synthetic lipid A analog that acts as a TLR4 antagonist); FP-025 (a selective TLR4 inhibitor); IAXO-102 (a small-molecule inhibitor that targets TLR4; chemical structure: (2R,3R,4S,5R,6S)-2-(aminomethyl)-6-methoxy-4,5- di(tetradecoxy)oxan-3-ol); and monoclonal antibodies.
[0075] TAK-242 (Ethyl-(6 R )-6-( N-(2-ch loro-4- fl uorophen yl )su 11 amoy I (cyclohex - 1 -ene- 1 - carboxylate, Ethyl-(6R)-6-(N-(2-chloro-4-fluorophenyl)sulfamoyl)cyclohex-l-ene-l- carboxylate):
[0076] Compositions / Administration
[0077] Pharmaceutical compositions for use in accordance with the invention can be formulated in conventional manner using one or more physiologically acceptable carriers or excipients. The therapeutic compositions of the invention can be formulated for a variety of routes of administration, including systemic, oral, topical or localized administration. Techniques and formulations generally can be found in Remmington's Pharmaceutical Sciences, Meade Publishing Co., Easton, Pa. (20thEd., 2000), the entire disclosure of which is herein incorporated by reference. For systemic administration, an injection is useful, including intramuscular, intravenous, intraperitoneal, intratympanic, and subcutaneous. For injection, the therapeutic compositions of the invention can be formulated in liquid solutions, for example in physiologically compatible buffers such as Hank’s solution or Ringer's solution. In addition, the therapeutic compositions can be formulated in solid form and redissolved or suspended immediately prior to use. Lyophilized forms are also included. Pharmaceutical compositions of the present invention are characterized as being at least sterile and pyrogen-free. These pharmaceutical formulations include formulations for human and veterinary use.
[0078] Oral compositions generally include an inert diluent or an edible carrier. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules, e.g., gelatin capsules.
[0079] Oral compositions can also be prepared using a fluid carrier for use as a mouthwash. Pharmaceutically compatible binding agents, and / or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
[0080] According to the invention, a pharmaceutically acceptable carrier can comprise any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Any conventional media or agent that is compatible with the active compound can be used. Supplementary active compounds can also be incorporated into the compositions.
[0081] EXAMPLE
[0082] The disclosure can be better understood by reference to the following examples which are offered by way of illustration. The disclosure is not limited to the examples given herein. EXAMPLE I
[0083] Introduction
[0084] Lung cancer is the leading cause of cancer death among both men and women1. Most patients with lung cancer die with anorexia and cachexia, a systemic wasting syndrome characterized by the loss of body weight and skeletal muscle mass2. Cachexia is diagnosed when patients experience loss of 5% or more of their body weight over 6 months, or loss of >2% of body weight over 6 months when the body mass index (BMI) is already low (<20 kg / m2)3. This degree of weight loss is common in patients with lung cancer and correlates with reduced quality of life, increased treatment complications, and worsened mortality4-6-7. Treating or preventing cachexia is predicted to improve quality of life, prolong the duration of anticancer therapy, and elongate overall survival. Tumor molecular features contribute to clinical outcomes and the development of cachexia. Loss of STK11 / LKB 1 activity is prevalent in KRAS-mutant lung cancer and promotes aggressive and treatment-resistant tumors8,9. Somatic loss of function mutations in LKB1 correlate with the presence of cachexia in newly diagnosed patients with lung cancer10. These phenotypes are recapitulated in mice with tumors induced by Kras activating mutations and loss of function Lkbl alleles in the lung (KL mice)11 12. KL mice develop aggressive, adenocarcinoma and adenosquamous tumors that are resistant to chemotherapy and immunotherapy11 13. These mice also develop a cancer-induced anorexia and cachexia syndrome (CACS) with features consistent with the human condition such as weight loss, skeletal muscle and adipose atrophy, anorexia, and reduced physical performance12 14.
[0085] Mouse models have greatly aided in the identification of cachexia mediators. Several groups have found that tumor-secreted factors play pathophysiologic roles in weight loss. For example, inhibition of IL-6 and PTHrP can prevent cachexia in mice bearing C26- and LLC- allografts, respectively, which secrete these factors15 16. Treating cachexia in autochthonous genetic mouse models has proven to be more challenging; however, we recently showed that a combination of therapies targeting appetite stimulation and Activin A signaling can reverse CACS in female KL mice14. Interestingly, this approach was not effective in male mice of the same background despite a similar degree of anorexia and equivalent levels of Activin A. The specific drivers of CACS in these male mice remain unknown.
[0086] In both humans and mice with cancer, cachexia correlates with elevated markers of chronic inflammation, including C-reactive protein (CRP) and cytokines such as tumor necrosis factor-alpha (TNF-a), interleukin- 1 (IL-1), and IL-617. Other circulating immune factors like GDF-15, Activin A, CCL2, and Lipocalin 2 are also upregulated and likely contribute to the systemic metabolic dysfunction that promotes cachexia. However, clinical studies using therapeutic antibodies against pro-inflammatory cytokines, like TNF-a or IL-6, have not shown significant benefit18-21, and studies targeting GDF-15 are ongoing22,23. Therefore, there is an urgent need to further understand the contribution of inflammation to cachexia during cancer development and progression.
[0087] Pro-inflammatory cytokines promote CACS in several ways. They act centrally in the brain to alter neurotransmitter systems, disrupt normal appetite regulation, and contribute to negative energy balance17. In the periphery, cytokines can bind directly to skeletal muscle and adipose tissue to initiate catabolic processes like proteolysis and lipolysis, respectively. Furthermore, some cytokines like IL-6, IL-ip, and TNFa are known to induce the acute phase response (APR) in the liver, which enhances immunity, aids in pathogen clearance, and promotes tissue repair24,25. Activation of the APR is a poor prognostic factor in human cancer26 29, especially in patients with lung cancer30. The APR requires a significant change in hepatic metabolism to accommodate the large increase in de novo protein production and release by the liver31,32. For example, many genes involved in redox processes and fatty acid oxidation (FAO) are downregulated in response to inflammatory stimuli like IL-6 and bacterial lipopolysaccharide (LPS)3334. Therefore, we sought to examine if these metabolic derangements may contribute to the tissue wasting observed during cachexia.
[0088] CACS is associated with the upregulation of tumor myeloid cells that produce pro- inflammatory factors, which subsequently accumulate in the serum and activate inflammatory pathways in peripheral tissues. In the liver, JAK signaling triggers the APR and inhibits FAO via PPAR-a interactions, a pattern consistent with cachexia across various animal models and human samples. Notably, systemic inhibition of JAK not only suppresses the APR and reactivates FAO but also enhances food intake and fat mass, thereby extending survival independently of tumor progression. These effects, however, are exclusive to male mice and occur concurrently with a TLR4-dependent loss of muscle mass. Thus, combining JAK and TLR4 inhibition is an approach to mitigate CACS in males with lung cancer.
[0089] Materials and Methods
[0090] Mouse Model and Tissue collection
[0091] For this study, the Kras1 SL'G12D / +; Lkblf / fmouse model of lung cancer11was used. The mice were kept under a 12-hour light / dark cycle at a temperature of 22 °C, with unrestricted access to rodent chow (PicoLab Rodent 20, 5053, Lab Diet) and water. Lung tumors were induced in adult male and female mice, aged 12-20 weeks, using 2.5xl07plaque-forming units of Adenovirus CMV-Cre (Ad5CMV-Cre) acquired from the University of Iowa Gene Transfer Vector Core (Iowa City, IA). Mice were humanely euthanized using CO2, upon exhibiting either a 30% weight reduction or a deteriorated body condition score of 2 or less. Tissues were dissected, weighed, and flash-frozen in liquid nitrogen and subsequently stored at -80 °C for further use.
[0092] Body Composition and Metabolic Cage Analyses
[0093] Fat mass and lean mass were measured using an EchoMRI-lOOH 2nl with a horizontal probe configuration (EchoMRI, Houston, TX). For the metabolic cage experiments, mice were single housed a week prior to the initiation of the experiments. Mice were then placed in the Promethion Metabolic Cage system (Sable Systems, USA), with a 12h light-dark cycles at 22°C. Data from the first 24 h was not used for analysis as it represents an acclimatation period. In the metabolic cages, food and water intake, spontaneous activity, total volume of oxygen consumed, and carbon dioxide liberated are measured every 5 minutes. Mice had access to food and water ad libitum.
[0094] Therapeutic trials.
[0095] Pacritinib was compounded into the chow at a concentration of 0.3% by TestDiet (St. Louis, MO). Similarly, ruxolitinib was obtained from MedChemExpress (Monmouth Junction, NJ) and compounded to the chow at a concentration of 0.2% as previously published51. For antibiotic treatment, KL mice were randomized at week 4 to receive a cocktail of ampicillin (Ig / L, GoldBio), neomycin trisulfate (Ig / L, GoldBio), metronidazole (Ig / L, Sagent) and vancomycin (500 mg / L, GoldBio) (4Abx) in the drinking water, as previously published43. TAK-242 was purchased from MedChemExpress, dissolved in ethanol, and then diluted with saline to a final ethanol concentration of 0.56%. Mice received a daily intraperitoneal injection of TAK-242 (3 mg / kg) as previously published47. Mice were stratified by sex and randomly assigned to the compounded food at week four following tumor induction. The placebo control groups either received IP injections of vehicle solution or normal chow. There was no blinding. The primary outcome was overall survival unless otherwise stated. Secondary outcomes included body weight changes, body composition measures (fat / lean mass), tumor burden (lung mass), food intake, and organ weights. For pacritinib, ruxolitnib, and TAK-242 cohorts, NCACS mice were excluded from survival or weight loss analysis to allow for evaluating treatment effect on cachexic mice only.
[0096] Cytokine Analysis
[0097] Immediately following euthanasia, mouse blood was obtained via cardiac puncture, centrifuged at 10,000xg for 10 minutes at 4 °C, and the serum was then frozen at -20 °C for subsequent testing. During necropsy, some lungs were excised for tumor isolation immediately frozen in liquid nitrogen, and stored at -80°C. Tumors were lysed to measure cytokines using a specialized lysis buffer (200mM EDTA, 5M NaCl, 1% NP-40, 0.5% Triton X-100, 10% Glycerol, and IM Tris-base), and then diluted to a concentration of 1 mg / ml with PBS. Eve Technologies (Calgary, AB) conducted the initial cytokine screening for both serum and tumor lysates. Mouse cytokines not included in Eve technologies panel were evaluated using Mouse Luminex Discovery Assay from R&D (IL-33, S100A9, IL-6, LIF, Tweak, IL-27, IL6Ra and FGF21) or Milliplex Mouse Cytokine / Chemokine Magnetic Bead Panel II (IL-11). AGP, A2M, CRP, Haptoglobin and SAP, in mouse serum were measured with Milliplex MAP Mouse Acute Phase Magnetic Bead Panel 2. Cytokines in human plasma were measured using Human Magnetic Luminex Assays from R&D.
[0098] Western Blots and Antibodies Gastrocnemius, TA, and liver were lysed using a tissue lysis buffer containing 50 mM Tris HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, 10% glycerol, 1% Nonidet P-40, 0.5% Triton X-100, and protease and phosphatase inhibitor (Pierce, A32959). Samples were then denaturalized at 70°C for 20 min and loaded onto 4-12% NuPAGE Bis-Tris gels at a concentration of 30-50 pg and transferred to 0.45-pm PVDF membranes with wet transfer cells (Bio-Rad Laboratories). After 1 h of blocking with Tris-buffered saline with 0.1%, Tween 20 containing 5% BSA (TBST), membranes were incubated overnight at 4 °C with antibodies against p-STAT3 (Tyr705, CST #9145), Total STAT3 (Sc-8019), and vinculin (CST #4650). Membranes were incubated with either anti-mouse (CST# 7076) or anti-rabbit (CST# 7074) secondary IgG-HRP linked antibodies. Membranes were revealed using either HyBlot CL Autoradiography Film (Denville Scientific) with SuperSignal Western Blot enhancer solution (Thermo Fisher), or with a ChemiDoc (BioRad).
[0099] ELISA and other colorimetric assays
[0100] LPS concentration in mouse tumor lysates was measured by ELISA (LSBio, LS- F17912-1), per the manufacturer's instructions. LPS concentration in mouse liver lysates was done with ENDOLISA (Biomerieux, Cat. No. 609033), per the manufacturer's instructions. Prostaglandin E2 was measured in mouse tumor lysates with an ELISA from R&D (cat. No. KGE004B), per the manufacturer's instructions. Alanine Aminotransferase Activity Assay Kit (Sigma, MAK052). Glycerol Colorimetric Assay Kit was purchased from Cayman (10010755). B-Hydroxybutyrate Liquicolor Assay, Stanbio 2440. NEFA was purchased from Fujifilm (997- 76491, 276-76491,993-35191, 991-34891, 995-34791, 999-34691).
[0101] Histological and Immunohistochemical Procedures
[0102] Mice tissues were fixed in 4% paraformaldehyde (PFA) overnight, followed by preservation in 70% ethanol. Paraffin-embedding, sectioning (4pm), H&E staining and slide scanning were done at Histowiz (Long Island City, NYC, USA). Slides for IHC and IF were deparaffinized in Histoclear (National Diagnostics), rehydrated, and subjected to antigen unmasking using either citrate buffer (10 mM Citrate, 0.05% Tween 20, pH 6.0) for F4-80 CST #70076 or Tris-EDTA buffer, pH 9.0 (10 mM Tris Base, ImM EDTA, 0.05% tween 20) for p- STAT3, CST #9145 in a pressure cooker for 13 minutes. To inhibit endogenous peroxidase, a 3% hydrogen peroxide solution in PBS was used for 5 minutes. Blocking was achieved with 5% rabbit or donkey serum. The slides were then incubated with primary antibodies overnight. Following steps included the application of secondary antibodies such as Goat Anti-Rabbit IgG Antibody (H+L), Biotinylated, R.T.U. (BP-9100-50, Vector) or HRP Goat Anti-Rat IgG Polymer Detection Kit, Peroxidase (MP-7404-50, Vector), avidin / biotin reagents (PK-4100) and DAB peroxidase substrate from Vector Laboratories (SK-4100). Imaging was done using either an Aperio AT2 (Leica Biosystems) or a Zeiss Axioscope Imager at Histowiz. IHC quantifications were automated using whole slide scans and QuPath software (0.4.2)78.
[0103] Patient Sample Collection
[0104] Plasma samples were collected in K2 EDTA tubes from lung cancer patients at New York Presbyterian Hospital / Weill Cornell Medical College, in compliance with an IRB- approved protocol (IRB#19- 11021135). Plasma samples (K2 EDTA) from healthy individuals were sourced from Innovative Research (www.innov-research.com / ). Demographics of patients and healthy controls are detailed in Table.1.
[0105] Tablel
[0106] Features Total
[0107] Gender
[0108] Male 33
[0109] Female 51
[0110] Age Median:70.5
[0111] (SD=9.82)
[0112] Clinical Stage
[0113] 0 1
[0114] IA 26
[0115] IB 17
[0116] II A 13
[0117] IIB 9
[0118] III A 18
[0119] TNM
[0120] T
[0121] TO 1
[0122] T1A 30
[0123] TIB 5
[0124] T2A 29
[0125] T2B 6
[0126] T3 12
[0127] T4 1 N
[0128] NO 55
[0129] N1 14
[0130] N2 15
[0131] M
[0132] MO 79
[0133] MX 5
[0134] Histological Subtype
[0135] Adenocarcinoma 66
[0136] Adenosquamous 3
[0137] Squamous 6
[0138] Atypical carcinoid 1
[0139] Typical carcinoid 2
[0140] Large cell tumor 2
[0141] Small cell lung cancer 1
[0142] Other 3
[0143] Differentiation
[0144] Well 10
[0145] Moderate 40
[0146] Poor 24
[0147] Undifferentiated 3
[0148] Other 7
[0149] Tablet. Demographic and clinical details of patients with lung cancer in this study.
[0150] Table2
[0151] Features Total
[0152] Gender
[0153] Male 17
[0154] Female 18 Age Median: 37 (SD=16.42)
[0155] Table 2. Demographics of healthy control plasma donors used for this study.
[0156] Primary hepatocyte isolation.
[0157] Mouse primary hepatocytes were isolated from 8-10-week-old C57BL / 6 male mice as previously published79. Briefly, mice were anesthetized with ketamine (100 mg / kg), xylazine (10 mg / kg) followed by laparotomy and liver perfusion in situ through the inferior vena cava with 10 mL of warm liver perfusion medium (Gibco, 17701-038) followed by 35 mL of warm liver digest medium (Gibco, 17703-034). After 6-10 minutes of perfusion, the liver was dissected and placed in ice-cold hepatocyte wash medium (Gibco, 17704-024). The Glisson capsule was then gently peeled off to allow for hepatocyte release. The cell suspension was filtered with a 70um cell strainer (Falcon, Ref. 352350), and cells were then washed once (80 G, 5 min, 4°C). Then, hepatocytes were further purified using a Percoll solution of 18ml Percoll (Sigma, P1644-500ML) and 2 ml of Hanks base lOx (Sigma, H4641-100ML) and centrifuged 10 min at 150g at 4°C. Cells were then washed and resuspended in Williams E media (Life Technologies, 12551032) with 10%FBS. Cells were then platted on six- well collagen-coated Primaria plates (Corning) at a density of 5xl05per well. After 4 hours, cells were washed with warm PBS and replaced with Williams E media with no FBS for 16 hs, when experiments were performed.
[0158] Osmotic pumps implantation
[0159] Osmotic pumps were purchased from Alzet (model 2001). Implantation of osmotic pumps was performed following the manufacturer’s guidelines. Briefly, after anesthetizing the animal, the skin over the mid-scapular region is shaved and washed. Next, the subcutaneous tissue is dissected with a hemostat to create a pocket large enough to accommodate the pump. The pump filled with either IL-6 (cat. No 575708) or PBS is then inserted into the pocket, with the delivery portal oriented caudally. Lastly, the wound is closed with wound clips. The rate of IL-6 infusion was l|iL / hour at a concentration of 0.3 mg / mL.
[0160] Drugs and Cytokines
[0161] PPARa agonists WY-14643 and GW7647, ruxolitinib phosphate (HY-50858), and TAK 242 were purchased from MedChemExpress. Pacritinib was kindly provided by CTI Biopharma. Murine cytokines (IL6, IL- 11 and LIF) were purchased from Biolegend.
[0162] Real-Time PCR RNA was extracted from primary mouse hepatocytes and tissues using TRIzol (Thermo Fisher) and in the case of tissues, it was further purified using the RNeasy kit (Qiagen). cDNA synthesis was done with SuperScript VILO Master Mix (Thermo Fisher). Real-time quantitative PCR (qPCR) for nascent transcripts of PPAR- alpha target genes in primary hepatocytes was done using Applied Biosystems SYBR™ Select Master Mix (Thermo Fisher) using the following nascent primers: Hmgcs2 (Fwd: CACTCTACTCTGGATTTGGCAGT (SEQ ID NO: 1); Rev:CCACTCGGGTAGACTGCAATG (SEQ ID NO: 2)), Cyp4al4
[0163] (Fwd:TAGCGGCTATGCTGTTGAGTG (SEQ ID NO: 3);
[0164] Rev:TCATGGCGGACTCTGTCAAT (SEQ ID NO: 4)), Ehhadh
[0165] (Fwd:AAACACTGTCCATGTTGGGC (SEQ ID NO: 5);
[0166] Rev:CACCGCACTGTCGTTTTGTTT (SEQ ID NO: 6)), Pdk4
[0167] (Fwd:GATTGACATCCTGCCTGACC (SEQ ID NO: 7); TTCAAAACCGTGTGTCCTCA (SEQ ID NO: 8)); and loading controls RplpO (Fwd: TTCCAGGCTTTGGGCATCA (SEQ ID NO: 9); Rev: ATGTTCAGCATGTTCAGCAGTGTG (SEQ ID NO: 10)), Tbp (Fwd: CCCTATCACTCCTGCCACACCAGC (SEQ ID NO: 11); Rev:
[0168] GTGCAATGGTCTTTAGGTCAAGTTTACAGCC (SEQ ID NO: 12)) and Rpll3 (Fwd: AGCCTACCAGAAAGTTTGCTTAC (SEQ ID NO: 13), Rev:
[0169] GCTTCTTCTTCCGATAGTGCATC (SEQ ID NO: 14)). PPAR-alpha target genes in the liver were quantified with Applied Biosystems TaqMan Gene Expression Assays using the following assays: RplpO (Mm00725448_sl), Actb (Mm00607939_sl), Ehhadh (Mm00619685_ml), Cyp4al4 (Mm00484135_ml), Fgf21 (Mm07297622_gl), Pdk4 (Mm01166879_ml). 16S rRNA qPCR was done following a previously published protocol38. mRNA levels were quantified using the 2A-AACt method.
[0170] Bulk RNA-sequencing.
[0171] Tumor, liver and gastrocnemius RNA-sequencing of the KL mice were previously published and are available at the GEO Database (GSE107470, GSE165856)12'80. Liver and gastrocnemius RNA-sequencing of the KrasG12D / +;Lkblf / f, treated or not with ruxolitinib were done by GENEWIZ, LLC. Azenta US, Inc. (South Plainfield, NJ, USA). Briefly, RNA sequencing library was prepared using the NEBNext Ultra II RNA Library Prep Kit for Illumina using manufacturer’s instructions (New England Biolabs, Ipswich, MA, USA). The sequencing library was validated on the Agilent TapeStation (Agilent Technologies, Palo Alto, CA, USA), and quantified by using Qubit 2.0 Fluorometer (ThermoFisher Scientific, Waltham, MA, USA) as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). Reads were aligned using Galaxy (https: / / usegalaxy.org / ). Briefly, paired-end fastq files were processed with Cutadapt for adapter removal. Raw reads were mapped using STAR (2-pass mapping) with the GENCODE M25 annotation on the mm 10 genome assembly. Counts were obtained with featureCounts, and quality control was performed with FastQC and MultiQC. Differential expression analysis was done in R Studio (2023.03.0+386), with R (4.2.3) and DESeq2 (v.1.38.3). Gene set enrichment analysis (GSEA) was performed using the GSEA (v4.3.2) JAVA-based application and mouse Molecular Signatures Databases published by the BROAD Institute and the UC San Diego (https: / / www.gsea-msigdb.org / gsea / index.jsp). Mouse KEGG pathways were obtained from easyGSEA (https: / / tau.cmmt.ubc.ca / ). Tumor pathways analysis in Fig. IE was done with Qiagen's Ingenuity Pathway Analysis (IPA, v. 01- 21-03). Heatmaps were done using heatmap (v. 1.0.12) and volcano plots with EnhancedVolcano (v. 1.16.0). GSVA was performed using the GSVA R package (v. 1.46.0). Venn diagrams were done using the R package given (v. 0.1.10). TracerX and CPTAC datasets are publicly available.
[0172] Single Cell RNA-seq
[0173] Tumor dissociation and cell suspension.
[0174] After euthanasia, mice were dissected, and the thoracic cavity was accessed by cutting the diaphragm and rib cage to expose the right ventricle, which was perfused with 3 mL of S- MEM twice using a 26G Vi needle. After a successful perfusion, the lungs should become white. The lungs were then removed from the thorax, and the tumors were micro dissected under a surgical microscope. Tumors were digested using the lung dissociation kit (130-095-927) from Miltenyi Biotec following the manufacturer's instructions. Briefly, isolated tumors were minced into 1-2 mm pieces and added to a Miltenyi C-Tube containing buffer S and enzymes D and A and processed in a gentleMACS Octo-Dissociator with heaters running the 37C_m_LDK_l program. After the program has finished, the cell suspension was passed through a 70 uM filter and then washed for 10 min at 200G in wash buffer (HBSS no Ca2+, no Mg2+, with 0.04% BSA). Contaminant red blood cells were lysed with ACK buffer. After two washes with wash buffer, cells were resuspended in wash buffer and handed over to the Epigenomics Core at Weill Cornell Medicine to prepare the library for Single Cell 3' RNA-seq v3.1, sequencing, and post-processing.
[0175] Library preparation
[0176] Single-cell RNA-seq libraries were prepared following lOx Genomics specifications (Single Cell 3' Reagent Kits v3.1 User Guide CG000204, lOx Genomics, Pleasanton, California, USA). Briefly, suspensions of 600-1000 cells / ul with at least 90% viable cells, were loaded onto the Chromium Controller to generate barcoded single-cell GEMs, targeting about 10000 single cells per sample. Reverse transcription of GEMs was performed in a Cl 000 Touch Thermal cycler with 96-Deep Well Reaction Module (Bio-Rad, Hercules. 53 °C for 45 min, 85 °C for 5 min; held at 4 °C). After RT reaction and dissociation of GEM, the single-strand cDNA was cleaned up with DynaBeads MyOne Silane Beads (Thermo Fisher Scientific, Waltham, MA). The cDNA was amplified for 11 cycles (98 °C for 3 min; 98 °C for 15 s, 63°C for 20 s, 72 °C for 1). Quality of the cDNA was assessed using an Agilent Bioanalyzer 2100 (Santa Clara, CA). This cDNA was enzymatically fragmented, end-repaired, A-tailed, subjected to a double-sided size selection with SPRIselect beads (Beckman Coulter, Indianapolis, IN) and ligated to adaptors provided in the kit. For each library, a unique sample index from the kit was introduced through 13 cycles of PCR amplification (98 °C for 45 s; 98 °C for 20 s, 54 °C for 30 s, and 72 °C for 20 s x 14 cycles; 72 °C for 1 min; held at 4 °C). Indexed libraries were subjected to a second double-sided size selection and then quantified using Qubit fluorometric quantification (Thermo Fisher Scientific, Waltham, MA). Quality control was performed on an Agilent Bioanalyzer 2100, obtaining an average library size of 455bp.
[0177] Sequencing and post-processing of data
[0178] Libraries were diluted to lOnM and clustered on an Illumina NovaSeq 6000 on a pairend read flow cell and sequenced for 28 cycles on R1 (lOx barcode and the UMIs), followed by 10 cycles of 17 Index (sample index), and 91 bases on R2 (transcript), with a coverage of around 250M reads per sample. Primary processing of sequencing images was done using Illumina’s Real Time Analysis software (RTA). Sample demultiplexing, alignment (mm 10), filtering, UMI counting, single-cell 3 ’end gene counting and quality control was performed in 10X Genomics Cell Ranger Single Cell Software suite v7.1.0 following the manufacturer's parameters (www.10xgenomics.com / support / software / cell-ranger / latest / analysis / running- pipelines / cr-choosing- a-pipeline) .
[0179] Single-Cell RNA seq analysis.
[0180] Approximately 10000 lung / tumor derived cells from 15 mice (7 CACS, 4 pre-CACS and 4 non-tumor bearing mice) passed quality control. UMI counts matrices for each sample were imported separately to Seurat (5.0.1). Viable cells were filtered based on having more than 400 genes detected and less than 20% of total UMIs accounted from mitochondrial transcripts and less than 1.5% from hemoglobin. Counts were transformed using Seurat: :SCTransform (method =glmGamPoi and vst.flavor = “v2”) regressing for mitochondrial mapping percentage. All samples were then merged on a single Seurat object without integration and principal component analysis (PCA) was ran. With the first 30 principal components (PCs) a shared nearest neighbor graph was built followed by cluster finding using the Leiden algorithm. Differential expression of genes between clusters was found with Seurat: :FindAllMarkers. Cell annotations and cluster identity were based on Azimuth Mouse Lung CellRef (lungmap.net) and confirmed with https: / / panglaodb.se / and MyGeneSet tool from immgen.org. Myeloid cells annotations from Klein et al. were imported from the scRNAseq package (2.16.0, doi: 10.18129 / B9.bioc.scRNAseq) and transferred using SingleR package(2.0.0). Cells were classified as tumor based on high expression of Krt8 and Krtl881,82. For dimensional reduction PaCMAP (Pairwise Controlled Manifold Approximation) with default settings was chosen(Wang, Y., Huang, H., Rudin, C. & Shaposhnik, Y. Understanding how dimension reduction tools work: an empirical approach to deciphering t-SNE, UMAP, TriMAP and PaCMAP for data visualization83.
[0181] To assess the changes in cell populations with weight loss in KL mice, cell proportions were calculated using the R package Speckle (0.99.7) a linear model was fitted with limma (3.54.2) on the transformed cell proportions.
[0182] Enrichment scores in Supp. Fig. 1C were calculated with the R package VISION (3.0. 1) and plotted with scCustomize(2.0.1). Mouse pathways were obtained from gsea-msigdb.org. The pathway comparison between CACS and pre-CACS myeloid cells in Supp. Figi J was performed with the R package SCPA (1.5.4). Alluvial plot in Supp Fig2 D was done using the package ggalluvial in the implemented in SCpubr(2.0.2). Barplots with cell proportions in Supp Fig2B and F were done with dittoSeq84.
[0183] Software and Statistical Analysis
[0184] Data analysis was primarily conducted using RStudio (2023.03.0+386) on R (v. 4.2.3) using the statistical packages ggpubr (0.6.0), rstatix (v.0.7.2) and ggplot2 (v. 3.4.4) and GraphPad Prism 9. Mouse Kaplan-Meier survival curves were compared using Log-Rank tests within the R packages “survival” and “surviminer” which also utilizes “maxstat” for dichotomizing continuous data using maximally selected rank statistics. Kaplan-Meier survival curves for the Pan-Cancer combined caBIG, GEO and TCGA databases were plotted and analyzed using the default parameters in (https: / / kmplot.com / analysis / ).
[0185] Results
[0186] Following exposure to inhaled adenovirus carrying Cre recombinase, KL mice develop the CACS phenotype characterized by the loss of body weight (Fig 1A, Supp Fig 1 A), skeletal muscle (Fig IB, Supp. Figi B), and adipose tissue (Fig 1C, Supp. Fig 1C). Both male and female mice develop similar patterns of weight and tissue loss. About 20% of KL mice do not develop CACS (NCACS) despite achieving similar amounts of tumor burden14. This incomplete penetrance offers us a unique opportunity to compare mice with and without CACS in a setting controlled for genetic and environmental exposures.
[0187] Tumors were isolated from mice with and without CACS and transcriptome analysis was performed using RNA-Seq to identify potential mediators of weight loss. Using Ingenuity Pathway Analysis, it was found that tumors isolated from mice with CACS had significant enrichment in pathways related to inflammation like “Neutrophil Extracellular Trap Signaling”, “Macrophage Alternative Activation Signaling”, “Toll-like Receptor Signaling” and IL-6, IL- 17 and IL-33 Signaling (Fig ID). To validate these results in patients with lung cancer, the National Cancer Institute's Clinical Proteomic Tumor Analysis Consortium (CPTAC) lung adenocarcinoma (LUAD) dataset35, for which there is RNA-Seq, proteomics, phospho-proteomics and body mass index (BMI) available, was mined. This allowed one to stratify patients by “low BMI” (<20 kg*m-2), a surrogate for cachexia3, or “high BMI” (>20 kg*m-2) to compare the tumor proteomic signature. It was found that patients with low BMI have tumors enriched in pathways related to inflammation, IL6 / STAT3, TNF-alpha / NFKB, and interferon- alpha response (Fig. IE) in agreement with the KL mice. Similarly, a gene set enrichment analysis (GSEA) of tumor RNA-Seq data from the TRAcking Cancer Evolution through treatment (TRACERx) study showed that patients with cachexia have enrichment in “Inflammatory response pathway” (Supp. Figi. D)36.
[0188] The genes driving the inflammatory GSEA in mice included many of those coding for cytokines and immune-related factors that have previously been linked to cachexia (Fig IF)17. Therefore, multi-analyte profiling of tumor lysates was performed to assess the abundance of 45 cytokines and chemokines. This analysis identified significant enrichment in three IL-6 superfamily members (IL-6, LIF, IL-11) in the tumors of mice with CACS (Fig 1G and Suppl. Fig. IE, F, G). High expression of these IL-6 superfamily members in the tumors of patients with lung cancer correlates with poor overall survival, a feature consistent with cachexia (Supp. Fig 1H). In agreement with the elevated gene expression and increased abundance of IL-6 superfamily members, histologic evidence of increased JAK signaling was found in the tumors (Fig. l H-I), and the adjacent normal lung (Supp.Fig.l I- J) of mice with CACS as compared to NCACS. Similarly, the phosphorylation of STAT3 at Tyr705 was found to be higher in the tumors from patients with low BMI from the CPTAC dataset (Supp. Fig IK). These data support the correlation among inflammation, JAK signaling, and cachexia.
[0189] In order to understand which cells might contribute to the secretion of these cytokines in the tumor environment of the KL mice, Single-Cell RNA-Sequencing of the tumors was performed. Tumors were microdissected from mice with different degrees of weight loss and non-tumor bearing mice (WT) as controls. If mice had lost more than 15% of their body weight, they were considered CACS and if not, a classification of “pre-CACS” was used since most mice will go on to develop CACS (Supp Fig 2A-B). By performing pathway analysis using the Hallmark database at the single-cell level in the tumor of the CACS mice, it was identified that regulatory T-cells (Tregs), platelets, neutrophils, basophils and myeloid cells such as alveolar macrophages (AM), interstitial macrophages (IM), inflammatory monocytes (iMON), classical dendritic cells subsets 1 and 2 (cDC-1, cDC-2) and mature dendritic cells (maDC), were the predominant cells contributing the most to inflammation in the tumor (Supp. Fig2 C). Myeloid cells were further classified following the annotation proposed by Klein et al. (Supp. Fig. 2E and F) to understand if these populations changed with weight loss37. Noticeably, it was found that there is an increase in macrophages-3 (Mac3) and neutrophils- 1 (Nl) with weight loss, as opposed to a decrease in monocytes-2 (Mono2) and monocyte-derived dendritic cells (MonoDC, Supp. Fig. 2G, and Fig. 1J-K). In agreement, increased infiltration of neutrophils in the tumors of patients with low BMI was found using in silico prediction models and data from the CPTAC cohort (Supp. Fig 2H)35. Consistent with these findings, the protein levels of the neutrophil chemoattractant CXCL8 were increased in the proteomics of the patients with low BMI (Supp. Fig2 I).
[0190] The Mac3 macrophages are one of the largest producers of proinflammatory cytokines such as IL-6, oncostatin M (OSM) and Leukemia inhibitory factor (LIF) in the myeloid compartment of the KL mice (Fig. IL). Furthermore, pathway analysis using the Reactome database at the single-cell level, curated for immune-related signatures, shows enrichment in pro-inflammatory pathways in the Mac3, Monol, and N4 neutrophils when comparing CACS to NCACS tumors (Supp. Fig. 2J). Interestingly, several of the highest- scoring pathways are related to Toll-like receptors (TLR) and bacteria sensing. Thus, it was hypothesized that the secretion of pro-inflammatory cytokines could be stimulated by sensing of bacterial pathogen- associated molecular pattern molecules (PAMPs) such as LPS by the TLR4 / MYD88 pathway. Bacteria load was measured by qPCR of the 16S ribosomal RNA as previously described and found that whole lungs with tumors either from NCACS or CACS mice had significantly higher bacterial load than their non-tumor bearing counterparts (WT Supp Fig. 2K)38. Bacteria presence in the tumors was confirmed by measuring LPS by ELISA (Fig. IM). Similarly, GSEA of the CPTAC transcrip tomic data set shows enrichment for MYD88 independent TLR4 cascade in tumors from patients with low BMI (Fig. IN). LPS stimulates the induction of COX- 2 and subsequent production of the prostaglandin, PGE2, as part of the immune response to Gram-negative bacteria which can be anorexigenic39. Therefore, PGE2 was measured in WT lung and tumor lysates and it was found that it was significantly increased in mice with CACS in comparison to both WT and NCACS (Fig 1 O). Furthermore, the expression of IRAKI, a key kinase required for TLR4 / MYD88 dependent pathway, is increased in human lung adenocarcinoma when compared to healthy tissue from the Genotype-Tissue Expression (GTEx) repository. The expression of IRAKI in adenocarcinoma is markedly associated with unfavorable prognosis (Supp. Fig2M). Together, these data suggest that tumor-derived LPS and the IL-6 superfamily may contribute to the cachexia phenotype in both mice and humans with lung cancer.
[0191] It is commonly believed that tumor-derived factors induce cachexia by exiting the tumor, circulating in the blood, and signaling to end-organs like skeletal muscle and liver. Therefore, the analyte profiling was repeated using serum from mice with and without CACS. Of the IL-6 family members found differentially expressed in the tumor, only IL-6 was significantly enriched in the serum albeit at a relatively low absolute concentration (Fig 2A and Supp. Fig. 3A). Similar results were found in the plasma of patients with lung cancer and cachexia (p=0.06, Supp Fig. 3B). Of note, IL- 11 was also elevated in the plasma of patients with cancer but the comparison between CACS and NCACS did not reach statistical significance (Supp. Fig 3.C). Additionally, IL-33, LIF and IL- 10, which can activate JAK were also found increased in the serum of CACS mice (Fig2 A, Supp. Fig.3 D-F).
[0192] In agreement with elevated levels of IL-6 superfamily members, evidence was found for systemic JAK activation in several tissues from the KL mice with CACS. GSEAs of the tumor, liver, and skeletal muscle transcriptomics shared an enriched activation of the IL6 / JAK / STAT3 pathway in mice with CACS (Fig 2B). In the muscle, this pathway is one of the most differentially expressed in the mice with CACS, as compared to NCACS (Fig. 2 C). A GSEA was performed using a muscle- specific curated database of gene sets for muscle perturbations and conditions and found that the CACS muscle significantly overlaps with the signature of muscle during bacterial sepsis (Supp. Fig 4A)40. The activation of the JAK pathway in the muscle was confirmed using western blot, which showed a clear positive correlation between STAT3 phosphorylation and weight loss (Fig. 2D). These data support the hypothesis that tumor-derived LPS and the IL-6 superfamily contribute to inflammatory signaling and metabolic dysfunction in the muscles of mice with CACS.
[0193] The liver plays a key role in the innate immune response and liver cells express the IL- 6 receptor and TLR-4, so the liver’s response during CACS was evaluated. In agreement with the results from skeletal muscle, a clear positive correlation was found between hepatic STAT3 phosphorylation and weight loss in tumor-bearing mice, which did not occur in non-tumor- bearing mice with weight loss from a 30% calorie restriction (Supp. Fig. 4A) or an overnight fast (Fig 2F). Similarly, a marked enrichment of inflammatory pathways was observed in the cachexic transcriptome, including the TGF-beta, TNF-alpha, and STAT3 signaling pathways (Fig 2E), and a large increase in hepatic macrophage infiltration, as assessed using the panmacrophage marker F4 / 80 (Supp. Fig 4D and E). The rise in LPS in the tumor led us to hypothesize that the liver is sensing bacterial PAMPs by the Myd88 / Tlr4 pathway. Indeed, a GSEA identified MYD88 / TIRAP signaling in the livers of mice with CACS (Fig 2E); however, LPS was not detected in liver lysates nor bacteria load by qPCR of 16S bacterial ribosomal RNA (Supp. Fig. 4F / G). Also, no signs of liver injury were found by measuring circulating le vels of ALT (Supp Fig 4H). However, LPS is not the only ligand for Tlr4, and other molecules such as S 100A9 and non-esterified fatty acids (NEFA), can signal through Tlr412,41,42. These results suggest that the phenotype of the cachexic liver is markedly influenced by tumor secreted inflammatory factors.
[0194] The hepatic response to inflammation includes marked changes to protein and lipid metabolism. For example, pro-inflammatory stimuli are known to induce the APR in hepatocytes, which enhances the production of proteins that support immunity, aids in pathogen clearance, and promote tissue repair24,23. Indeed, the livers of mice with CACS showed a marked increase in the transcription of genes related to the APR response (Fig. 2G), and there was a rise in the serum concentration of APR proteins (e.g., S100A9) during weight loss (Fig. 2H). Hepatic fat metabolism is also perturbed by inflammation, and a suppression of several lipid metabolism pathways was observed in the liver of mice with CACS (Fig. 2E), which agrees with previous reports of reduced peroxisome proliferator-activated receptor-a (PPAR- a) activity and ketogenesis in the cachexic liver12,34. These data led to the hypothesis that the rise in APR and suppression of PPAR-a related pathways are mechanistically linked to a common upstream mediator.
[0195] To examine the interaction between JAK signaling and PPAR-a, mouse primary hepatocytes were isolated and incubated with the PPAR-a agonists, Wyl4643 and Gw7647, in the presence or absence of IL-6. Both agonists led to a robust increase in the expression of nascent transcripts controlled by PPAR-a, and exposure to IL- 6 and other IL- 6 family members, like LIF and IL-11, significantly reduced the effectiveness of the PPAR-a agonists (Supp. Fig 5 A-B). Similarly, evidence for an inhibitory effect of IL-6 on PPAR-a was found using previously published RNA-Seq data sets from mouse and human primary hepatocytes (Supp. Fig. 5C-E)43,44. Therefore, it was concluded that the IL-6 superfamily members can directly suppress PPAR-a in hepatocytes. To investigate whether the metabolic changes observed in the cachexic liver are mediated by IL-6 superfamily members, mice were implanted with osmotic pumps containing IL-6 or PBS, as controls. The mice were allowed ad-libitum food intake for the first five days and then food was withheld for 24 hours to induce PPAR-a and ketogenesis (Supp. Fig 6A). In control mice, the fasting period reduced body weight (Supp. Fig 6B) and increased ketogenesis, as measured by a rise in serum levels of beta hydroxybutyrate (BHB, Supp. Fig.6C). Exposure to IL-6 significantly induced JAK activity in the liver (Supp. Fig.6D) and suppressed fasting ketogenesis, without altering the degree of weight loss (Supp. Fig.6B). Next, RNA-Seq was performed on the IL-6 and PBS-exposed liver tissue. The mice exposed to both IL-6 and fasting clustered independently from the fed and fasted mice exposed to PBS using unbiased principal component analysis (PCA) (Supp Fig. 6E), suggesting that IL-6 produces distinct transcriptomic changes compared to fasting alone. Using GSEA, it was found that IL-6 enriched the liver in IL-6 / JAK / STAT signaling and inflammation pathways, as compared to fasted PBS control mice (Supp. Fig.6F). IL-6 treatment was also sufficient to activate the expression of genes related to the APR (Supp. Fig. 6G) and suppress the expression of transcripts and pathways related to PPAR-a activity (Supp. Fig. 6H). To delineate the contribution of IL-6 family members to cachexia, the GSEA results from the IL-6 pumps were compared to those from the liver of KL mice and the liver of mice bearing allografts of the C26 cell lines, another commonly utilized cachexia model. Activation of JAK and suppression of PPAR-a-related pathways were conserved amongst all data sets (Fig 2 I). Together, these data suggest that tumor-induced cytokines promote JAK activity in the liver, which facilitates a metabolic rewiring characterized by an increase in the APR and suppression of PPAR-a activity.
[0196] Next it was sought to determine the contribution of inflammatory signaling to the CACS phenotype. The increase in tumor LPS and enrichment in TLR4 / MYD88 signaling in host tissues led to the hypothesis that LPS is contributing to JAK activation and cachexia. Therefore, a prospective, randomized, controlled, intervention trial in KL mice was planned using a combination of 4 antibiotics in the drinking water as previously described45. However, this antibiotic treatment profoundly induced anorexia, exacerbated weight loss, and led to early termination of the experiment soon after randomization (data not shown). Therefore, it was next sought to inhibit LPS sensing by Tlr4 in KL mice using the TLR4 inhibitor, TAK-24246. Mice were dosed daily with TAK-242 or vehicle control starting at week four after tumor induction47. At this timepoint, KL mice have established tumors but have not yet developed significant weight loss. The primary outcome was overall survival. Treatment with TAK-242 delayed the onset of weight loss but did not significantly improve overall survival, as compared to placebo (Fig. 3A / B). There was a significant preservation of muscle mass, as demonstrated by the mass of the tibialis anterior (TA), extensor digitorum longus (EDL), and gastrocnemius (Gastroc) muscles at endpoint - thus evidence of blocking / preventing catabolic wasting (Supp. Fig 7C-E). The effect of TAK-242 on the liver was explored and it was found effective in reducing the concentration of APR proteins produced by the liver, suggesting potent suppression of hepatic JAK activity (Supp. Fig 7G-J). These positive effects on weight loss, muscle mass, and the hepatic APR were limited to male mice (Supp. Fig. 7A-F), and occurred independently from changes in lung mass, a surrogate for total tumor burden in this model (Supp. Fig. 7F)48.
[0197] While TLR4 inhibition had some beneficial effects on the mice, it did not improve overall survival. Therefore, it was next sought to target JAK activity directly with pacritinib, an FDA-approved multi-kinase inhibitor that targets JAK2 concomitantly with IRAK-1, an important kinase for TLR4 signaling. Pacritinib was compounded into the chow at a concentration of 0.3%, per the manufacturer’s suggestion, and studies were performed in non- tumor-bearing mice to confirm that this approach is safe (no change in food intake, activity, grooming habits, and weight) and yields similar drug exposures as a previously published dose of 100 mg / kg twice daily49. Mice were randomized to receive pacritinib or control at 4 weeks after induction and overall survival was our primary outcome. Pacritinib tended to delay weight loss and improve the overall survival of male and female mice; however, the effect was not statistically significant and there was no preservation of muscle mass (Supp Fig 8).
[0198] The partial response to pacritinib encouraged the pursuit of additional an study using the FDA-approved drug, ruxolitinib, which inhibits both JAK1 and JAK2. Ruxolitinib was compounded into the chow at 0.2%, as previously described50-51. This intervention was first studied in non-tumor-bearing mice for safety and efficacy. After 13 days of feeding, the ruxolitinib exposed mice gained significant amounts of body weight (Supp Fig 9 A), which was due to an accumulation of fat mass (Supp. Fig 9 B and C). The rise in weight was due to increased food intake, which is due to inhibition of leptin signaling in the hypothalamus (Supp. Fig 9D / E)52. Whole body lean mass tended to decrease with ruxolitinib treatment, which was attributed to reductions in spleen size (a physiologic biomarker of ruxolitinib activity) and muscle mass, which was unexpected (Supp. Fig 9 H and I). This reduction in muscle mass did not reduce spontaneous activity (Supp. Fig 9 J and K). A prospective, controlled trial was carried out in the KL mice as previously described for the other compounds. Exposure to ruxolitinib led to an early rise in body weight, which delayed the onset of weight loss and led to a large increase in overall survival in male (Fig. 3E / F), but not female mice (Supp. Fig. 10A and B). Ruxolitinib had no effect on tumor burden, as assessed by lung mass (Supp. Fig 10 C), no effect on muscle mass at endpoint (Supp Fig. 10D and E). These data suggest that systemic inhibition of both JAK1 and JAK2 can increase / improve food intake, promote weight gain, and extend survival in mice with lung cancer.
[0199] The effect of ruxolitinib on overall survival appeared to be dependent on the amount of weight gained in the initial few weeks of starting the drug. In other words, the mice that gained the most weight during the trial also lived the longest (Fig. 4A). Body composition analysis showed that even as early as week 5 post-tumor induction, male mice already showed significant gains in fat mass as opposed to control mice (Fig 4B). It was hypothesized that the higher fat mass would enable the ruxolitinib-treated mice to better maintain the supply of lipolytic metabolites in the serum. Indeed, it was observed that there were higher levels of NEFA and glycerol in the circulation of ruxolitinib-treated mice (Fig. 4 C and D). In the liver, ruxolitinib suppressed JAK signaling (Fig.4 E-G) and reversed the transcriptomic signatures previously identified during cachexia. For example, cachexic mice treated with ruxolitinib showed a positive enrichment for pathways related to peroxisomes and fatty acid metabolism and a negative enrichment for inflammation, complement, and JAK / STAT3 signaling pathways (Fig. 4G). It was confirmed that ruxolitinib increased the expression of PPAR-a target genes in the liver across all degrees of weight loss (Supp. Fig HA) and a trend was observed for improved ketogenesis as measured by serum BHB levels (Fig 4H). Furthermore, inhibition of IAK activity by ruxolitinib reduced the production of APR proteins (Fig 41 and Supp. Fig. 11B-
[0200] D) and suppressed the number of macrophages in the livers of mice with CACS (Supp. Fig. 11
[0201] E). These data suggest that ruxolitinib can reverse the metabolic rewiring that occurs in the liver during CACS.
[0202] Ruxolitinib also reversed several features observed in the cachexic skeletal muscle. For example, IAK activity was suppressed at the protein (Supp. Fig. 12 A, B) and transcriptome (Supp. Fig. 12C) levels. A GSEA comparing muscles taken from cachexic mice treated with or without ruxolitinib identified broad reversal of the transcriptomic signatures associated with CACS (Supp. Fig. 12D). Specifically, ruxolitinib increased pathways related to oxidative phosphorylation, ribosomal and proteosome activity, and reduced inflammatory pathways, such as JAK / STAT, NFKB, chemokines and toll-like receptor signaling. Despite these changes, ruxolitinib had no protective effect on muscle mass (Supp. Fig. 12E, F). In fact, it worsened the severity of muscle mass loss in mice (Supp. Fig. 10G, H). Given the improvements in body weight and survival with ruxolitinib and the positive effects of TAK-242 on muscle mass, it was hypothesized that the combination would synergize as an anti-cachexia therapy. Pilot experiments with non-tumor bearing mice showed that the combination of ruxolitinib with TAK-242 was safe and led to similar improvements in fat mass, and tissue weights after 42 days of treatment (Supp Fig 13. A- C). In KL mice, the combination of ruxolitinib with TAK-242 delayed weight loss, extended survival, and increased fat mass to a similar degree as ruxolitinib alone (the combination provides both increase in food intake and protection from catabolic wasting) (Figs. 5A-C). Moreover, the addition of TAK-242 partially reduced the loss of muscle mass observed in KL mice treated with ruxolitinib (Fig 5E, F and G).
[0203] Discussion
[0204] Cachexia is a systemic syndrome where maladaptive changes in metabolic organs lead to the loss of tissue mass and body weight. In both clinical studies and pre-clinical models, body weight loss is associated with markers of systemic inflammation. However, the upstream mediators of the inflammatory signal remain unclear. Here, it was shown that lung cancer- induced cachexia is associated with a more pro-inflammatory tumor microenvironment, characterized by high expression and secretion of IL-6 family members and infiltration of N1 neutrophils and Mac3 macrophages. It has been previously shown that LPS attracts neutrophils to the lung, which produce monocyte chemokines, pro-inflammatory cytokines, and prostaglandins33. It was found that KL tumors have high amounts of LPS in the tumor, which is likely arising from low airway dysbiosis. Dysbiosis in the airway is known to contribute to inflammation, carcinogenesis, and an unfavorable prognosis in mice and patients with lung cancer34. The data suggest that cachexia may contribute to this poor prognosis. LPS can also activate Mac3 cells, which have high expression of Argl, and are considered immunosuppressive myeloid cells35’58. Recently, these Argl-i- macrophages were identified as drivers of JAK-mediated inflammation and tumorigenesis in the KL mice59, suggesting that they could be a therapeutic target for both cachexia and tumorigenesis.
[0205] IL-6 was identified as a cachexic factor approximately 30 years ago and continues to be a prominent focus of cachexia research16 17. IL-6 superfamily members trigger a systemic response that releases stored nutrients and enhances pathogen clearance. Several pieces of data from pre-clinical models suggest that IL-6 and related superfamily members induce atrophy in skeletal muscle during cachexia. For example, genetic deletion or pharmacologic targeting of IL-6 and its signaling components suppress the loss of muscle mass and adipose tissue in mice with cachexia induced by C26 tumors16’60-63. However, this model produces levels of circulating IL-6 that are higher than what is commonly observed in patients with lung cancer66. The abundance of circulating IL- 6, LIF, and IL- 11 in the KL mice is modest and more representative of human patients (Supp Fig 3). In this setting, muscle loss was not able to be suppressed by blocking JAK signaling with ruxolitinib. These data are in line with the results of clinical intervention studies targeting IL-6 and challenge the notion that tumor-derived IL-6 superfamily members are sufficient to induce skeletal muscle atrophy in mice and humans with lung cancer18,19,67.
[0206] This study highlights a set of linked metabolic changes that occurs in the liver following activation of JAK signaling. In mice with CACS, the activation of the APR occurs at the expense of PPAR-a-driven fat oxidation pathways12,34,68. This phenomenon mirrors the response to bacterial sepsis, where fat oxidation and ketogenesis are also suppressed69,70. Suppressing fat oxidation in this setting may shunt adipocyte-derived fatty acids toward reesterification and incorporation into lipoproteins, which are secreted and can neutralize the toxic effects of LPS via direct binding71. Furthermore, the loss of oxidative processes in hepatocytes may help create a more reduced environment that facilitates synthesis of triglycerides and APR proteins. It is widely believed that the skeletal muscle supplies the liver with the amino acids necessary to support the APR via JAK signaling64,72. Our data from mice treated with TAK-242 support this theory. TAK-242 potently suppressed APR production in the liver and this suppression correlated with preservation of skeletal muscle mass. However, these effects did not improve overall survival. Therefore, we conclude that the suppression of the APR and inhibition of muscle proteolysis is not necessary for improving survival in mice with lung cancer.
[0207] The data suggest that ruxolitinib can delay the onset of cachexia and improve overall survival by increasing food intake, expanding adipose tissue mass, and reducing inflammatory signaling in metabolic organs. It is not possible to elucidate the relative contribution of each of these physiologic effects to the overall improvement in survival with the current experimental design. However, we suspect that the increase in food intake is a primary driver. It has been previously reported that ruxolitinib blocks leptin signaling in the hypothalamus, which increases appetite and promotes weight gain in mice and humans52,73. In our study, the mice that gained the most weight in the first two weeks of ruxolitinib treatment also experienced the largest survival benefit. Since adipose tissue is a depot for high density nutrients, our findings suggest that excess adiposity is beneficial for survival when organisms are facing conditions associated with dietary nutrient restriction like tumor-induced anorexia. This conclusion is in line with observations from human patients with lung cancer where higher excess adiposity leads to longer survival74. Whether or not ruxolitinib can improve fat mass in patients with lung cancer is currently being evaluated (NCT04906746).
[0208] Lastly, the study highlights the importance of sex as a biological variable in cachexia research. We found that male, but not female, mice benefit from inhibition of TLR4 and JAK pathways. Ruxolitinib did not increase food intake, fat mass, body weight, and overall survival in female KL mice. Of note, we previously described a combination of therapies that effectively reversed cachexia in female, but not male, KL mice14. The combination of anamorelin, an orexigenic compound, with ActRIIB-Fc, a molecule that blocks Activin A activity, improved food intake, fat mass, muscle mass, body weight, and overall survival. Despite having similar levels of circulating Activin A and a similar degree of anorexia, male mice do not respond to this therapy. Sex-dependent effects have been observed in many pre-clinical models of cachexia and further research is needed to identify molecular mechanisms75-77.
[0209] Bibliography
[0210] 1 Fearon, K. et al. Definition and classification of cancer cachexia: an international consensus. Lancet Oncol 12, 489-495 (2011).
[0211] 2 von Haehling, S., Anker, M. S. & Anker, S. D. Prevalence and clinical impact of cachexia in chronic illness in Europe, USA, and Japan: facts and numbers update 2016. Journal of Cachexia, Sarcopenia and Muscle 7, 507-509 (2016).
[0212] 3 Fearon, K. et al. Definition and classification of cancer cachexia: an international consensus. The Lancet Oncology 12, 489-495 (2011).
[0213] 4 Morita-Tanaka, S., Yamada, T. & Takayama, K. The landscape of cancer cachexia in advanced non-small cell lung cancer: a narrative review. Translational Lung Cancer Research 12, 168-180 (2023).
[0214] 5 Ross, P. J. et al. Do patients with weight loss have a worse outcome when undergoing chemotherapy for lung cancers? Br J Cancer 90, 1905-1911 (2004).
[0215] 6 Lau, S. K. M. et al. Impact of Socioeconomic Status on Pretreatment Weight Loss and Survival in Non-Small-Cell Lung Cancer. J Oncol Pract 14, e211-e220 (2018).
[0216] 7 Takayama, K. el al. Quality of life and survival survey of cancer cachexia in advanced non-small cell lung cancer patients — Japan nutrition and QOL survey in patients with advanced non-small cell lung cancer study. Supportive Care in Cancer 24, 3473-3480 (2016).
[0217] 8 Matsumoto, S. et al. Prevalence and specificity of LKB1 genetic alterations in lung cancers. Oncogene 26, 5911-5918 (2007).
[0218] 9 Skoulidis, F. et al. STK11 / LKB1 Mutations and PD-1 Inhibitor Resistance in KRAS- Mutant Lung Adenocarcinoma. Cancer Discov 8, 822-835 (2018). 10 Iyengar, P. el al. Tumor loss-of- function mutations in STK11 / LKB1 induce cachexia.
[0219] JCI Insight 8 (2023).
[0220] 11 Ji, H. et al. LKB1 modulates lung cancer differentiation and metastasis. Nature 448, 807-810 (2007).
[0221] 12 Goncalves, M. D. et al. Fenofibrate prevents skeletal muscle loss in mice with lung cancer. Proceedings of the National Academy of Sciences of the United States of America 115, E743-E752 (2018).
[0222] 13 Chen, Z. et al. A murine lung cancer co-clinical trial identifies genetic modifiers of therapeutic response. Nature 483, 613-617 (2012).
[0223] 14 Queiroz, A. L. et al. Blocking ActRIIB and restoring appetite reverses cachexia and improves survival in mice with lung cancer. Nat Commun 13, 4633 (2022).
[0224] 15 Kir, S. et al. Tumour-derived PTH-related protein triggers adipose tissue browning and cancer cachexia. Nature 513, 100-104 (2014).
[0225] 16 Strassmann, G., Fong, M., Kenney, J. S. & Jacob, C. O. Evidence for the involvement of interleukin 6 in experimental cancer cachexia. The Journal of Clinical Investigation 89, 1681-1684 (1992).
[0226] 17 Ferrer, M. et al. Cachexia: A systemic consequence of progressive, unresolved disease. Cell 186, 1824-1845 (2023).
[0227] 18 Bayliss, T. J., Smith, J. T, Schuster, M., Dragnev, K. H. & Rigas, J. R. A humanized anti-IL-6 antibody (ALD518) in non-small cell lung cancer. Expert Opinion on Biological Therapy 11, 1663-1668 (2011).
[0228] 19 Rigas, J. R. et al. Efect of ALD518, a humanized anti-IL-6 antibody, on lean body mass loss and symptoms in patients with advanced non-small cell lung cancer (NSCLC): Results of a phase II randomized, double-blind safety and efficacy trial. Journal of Clinical Oncology 28, 7622-7622 (2010).
[0229] 20 Jatoi, A. et al. A placebo-controlled double-blind trial of etanercept for the cancer anorexia / weight loss syndrome: results from N00C1 from the North Central Cancer Treatment Group. Cancer 110, 1396-1403 (2007).
[0230] 21 Jatoi, A. et al. A placebo-controlled, double-blind trial of infliximab for cancer- associated weight loss in elderly and / or poor performance non-small cell lung cancer patients (N01C9). Lung Cancer 68, 234-239 (2010).
[0231] 22 Crawford, J. et al. A Phase lb First-In-Patient Study Assessing the Safety, Tolerability, Pharmacokinetics and Pharmacodynamics of Ponsegromab in Participants with Cancer and Cachexia. Clin Cancer Res (2023). 23 Crawford, J. el al. Phase 2 study to assess the efficacy, safety, and tolerability of the GDF- 15 inhibitor ponsegromab in patients with cancer cachexia. Journal of Clinical Oncology 41, TPS12147-TPS12147 (2023).
[0232] 24 Geiger, T. et al. Induction of rat acute-phase proteins by interleukin 6 in vivo. European Journal of Immunology 18, 717-721 (1988).
[0233] 25 Castell, J. V. et al. Recombinant human interleukin-6 (IL-6 / BSF-2 / HSF) regulates the synthesis of acute phase proteins in human hepatocytes. FEBS Letters 232, 347-350 (1988).
[0234] 26 Kemik, O. et al. The relationship among acute-phase response proteins, cytokines and hormones in cachectic patients with colon cancer. World J Surg Oncol 8, 85 (2010).
[0235] 27 Krzystek-Korpacka, M. et al. Acute-phase response proteins are related to cachexia and accelerated angiogenesis in gastroesophageal cancers. Clin Chem Lab Med 46, 359-364 (2008).
[0236] 28 Merlini, G. et al. Acute phase proteins and prognosis in multiple myeloma. Br J Haematol 83, 595-601 (1993).
[0237] 29 Wigmore, S. J., McMahon, A. J., Sturgeon, C. M. & Fearon, K. C. Acute-phase protein response, survival and tumour recurrence in patients with colorectal cancer. Br J Surg 88, 255- 260 (2001).
[0238] 30 Tolia, M. et al. Prognostic Significance of Serum Inflammatory Response Markers in Newly Diagnosed Non-Small Cell Lung Cancer before Chemoirradiation. Biomed Res Int 2015, 485732 (2015).
[0239] 31 Goldman, O. et al. Early Infiltration of Innate Immune Cells to the Liver Depletes HNF4a and Promotes Extrahepatic Carcinogenesis. Cancer Discovery 13, 1616-1635 (2023).
[0240] 32 Dai, D. et al. Time-resolved metabolomics analysis of individual differences during the early stage of lipopolysaccharide-treated rats. Scientific Reports 6, 34136 (2016).
[0241] 33 Fang, C. et al. Hepatic expression of multiple acute phase proteins and down-regulation of nuclear receptors after acute endotoxin exposure. Biochemical Pharmacology 67, 1389-1397 (2004).
[0242] 34 Flint, Thomas R. et al. Tumor-Induced IL-6 Reprograms Host Metabolism to Suppress Anti-tumor Immunity. Cell Metabolism 24, 672-684 (2016).
[0243] 35 Gillette, M. A. et al. Proteogenomic Characterization Reveals Therapeutic Vulnerabilities in Lung Adenocarcinoma. Cell 182, 200-225 e235 (2020).
[0244] 36 ALSawaf, O. et al. Body composition and lung cancer-associated cachexia in
[0245] TRACERx. Nat Med 29, 846-858 (2023). 37 Zilionis, R. et al. Single-Cell Transcriptomics of Human and Mouse Lung Cancers Reveals Conserved Myeloid Populations across Individuals and Species. Immunity 50, 1317- 1334 el310 (2019).
[0246] 38 Nejman, D. et al. The human tumor microbiome is composed of tumor type-specific intracellular bacteria. Science 368, 973-980 (2020).
[0247] 39 Bin, N. R. et al. An airway-to-brain sensory pathway mediates influenza-induced sickness. Nature 615, 660-667 (2023).
[0248] 40 Malatras, A., Duguez, S. & Duddy, W. Muscle Gene Sets: a versatile methodological aid to functional genomics in the neuromuscular field. Skelet Muscle 9, 10 (2019).
[0249] 41 Ursino, G. et al. S 100A9 exerts insulin-independent antidiabetic and anti-inflammatory effects. Sci Adv 10, eadj4686 (2024).
[0250] 42 Shi, H. et al. TLR4 links innate immunity and fatty acid-induced insulin resistance. J Clin Invest 116, 3015-3025 (2006).
[0251] 43 Goldstein, I., Paakinaho, V., Baek, S., Sung, M. H. & Hager, G. L. Synergistic gene expression during the acute phase response is characterized by transcription factor assisted loading. Nat Commun 8, 1849 (2017).
[0252] 44 Lukowski, S. W. et al. Integrated analysis of mRNA and miRNA expression in response to interleukin-6 in hepatocytes. Genomics 106, 107-115 (2015).
[0253] 45 Jin, C. et al. Commensal Microbiota Promote Lung Cancer Development via gammadelta T Cells. Cell 176, 998-1013 el016 (2019).
[0254] 46 Matsunaga, N., Tsuchimori, N., Matsumoto, T. & li, M. TAK-242 (resatorvid), a smallmolecule inhibitor of Toll-like receptor (TLR) 4 signaling, binds selectively to TLR4 and interferes with interactions between TLR4 and its adaptor molecules. Mol Pharmacol 79, 34- 41 (2011).
[0255] 47 Ono, Y. et al. TAK-242, a specific inhibitor of Toll-like receptor 4 signalling, prevents endotoxemia-induced skeletal muscle wasting in mice. Sci Rep 10, 694 (2020).
[0256] 48 Dantas, E. et al. TIMP1 is an early biomarker for detection and prognosis of lung cancer. Clin Transl Med 13, el391 (2023).
[0257] 49 Betts, B. C. et al. Targeting JAK2 reduces GVHD and xenograft rejection through regulation of T cell differentiation. Proc Natl Acad Sci U SA 115, 1582-1587 (2018).
[0258] 50 Han, E. S. et al. Ruxolitinib synergistically enhances the anti-tumor activity of paclitaxel in human ovarian cancer. Oncotarget 9, 24304-24319 (2018).
[0259] 51 Ollila, S. et al. Stromal Lkbl deficiency leads to gastrointestinal tumorigenesis involving the IL-11-JAK / STAT3 pathway. J Clin Invest 128, 402-414 (2018). 52 Molle, N. et al. Ruxolitinib can cause weight gain by blocking leptin signaling in the brain via JAK2 / STAT3. Blood 135, 1062-1066 (2020).
[0260] 53 El Rayes, T. et al. Lung inflammation promotes metastasis through neutrophil protease- mediated degradation of Tsp- 1. Proceedings of the National Academy of Sciences 112, 16000- 16005 (2015).
[0261] 54 Tsay, J. J. et al. Lower Airway Dysbiosis Affects Lung Cancer Progression. Cancer Discov 11, 293-307 (2021).
[0262] 55 Rodriguez, P. C. et al. Arginase I production in the tumor microenvironment by mature myeloid cells inhibits T-cell receptor expression and antigen- specific T-cell responses. Cancer Res 64, 5839-5849 (2004).
[0263] 56 Geiger, R. et al. L- Arginine Modulates T Cell Metabolism and Enhances Survival and Anti-tumor Activity. Cell 167, 829-842 e813 (2016).
[0264] 57 Miret, J. J. et al. Suppression of Myeloid Cell Arginase Activity leads to Therapeutic Response in a NSCLC Mouse Model by Activating Anti-Tumor Immunity. J Immunother Cancer 7, 32 (2019).
[0265] 58 Katzenelenbogen, Y. et al. Coupled scRNA-Seq and Intracellular Protein Activity Reveal an Immunosuppressive Role of TREM2 in Cancer. Cell 182, 872-885 e819 (2020).
[0266] 59 Rashidfarrokhi, A. et al. Tumor- intrinsic LKB1-LIF signaling axis establishes a myeloid niche to promote immune evasion and tumor growth. bioRxiv (2023).
[0267] 60 Fujita, J. et al. Anti-interleukin-6 receptor antibody prevents muscle atrophy in colon-
[0268] 26 adenocarcinoma-bearing mice with modulation of lysosomal and ATP-ubiquitin-dependent proteolytic pathways. Int J Cancer 68, 637-643 (1996).
[0269] 61 Puppa, M. J., Gao, S., Narsale, A. A. & Carson, J. A. Skeletal muscle glycoprotein 130's role in Lewis lung carcinoma-induced cachexia. Fasebj 28, 998-1009 (2014).
[0270] 62 Silva, K. A. et al. Inhibition of Stat3 activation suppresses caspase-3 and the ubiquitin- proteasome system, leading to preservation of muscle mass in cancer cachexia. J Biol Chem 290, 11177-11187 (2015).
[0271] 63 Bonetto, A. el al. JAK / STAT3 pathway inhibition blocks skeletal muscle wasting downstream of IL-6 and in experimental cancer cachexia. Am J Physiol Endocrinol Metab 303, E410-421 (2012).
[0272] 64 Bonetto, A. et cd. STAT3 activation in skeletal muscle links muscle wasting and the acute phase response in cancer cachexia. PLoS One 6, e22538 (2011).
[0273] 65 Arora, G. K. et al. Janus kinase inhibitors suppress cancer cachexia-associated anorexia and adipose wasting in mice. JCSM Rapid Communications 3, 115-128 (2020). 66 Kang, D. H. et al. Baseline Serum Interleukin-6 Levels Predict the Response of Patients with Advanced Non-small Cell Lung Cancer to PD-1 / PD-L1 Inhibitors. Immune Netw 20, e27 (2020).
[0274] 67 Berti, A., Boccalatte, F., Sabbadini, M. G. & Dagna, L. Assessment of tocilizumab in the treatment of cancer cachexia. J Clin Oncol 31, 2970 (2013).
[0275] 68 Yang, X. et al. Leukemia inhibitory factor suppresses hepatic de novo lipogenesis and induces cachexia in mice. Nature Communications 15, 627 (2024).
[0276] 69 Beylot, M., Guiraud, M., Grau, G. & Bouletreau, P. Regulation of ketone body flux in septic patients. American Journal of Physiology-Endocrinology and Metabolism 257, E665- E674 (1989).
[0277] 70 Takeyama, N., Itoh, Y, Kitazawa, Y. & Tanaka, T. Altered hepatic mitochondrial fatty acid oxidation and ketogenesis in endotoxic rats. American Journal of Physiology- Endocrinology and Metabolism 259, E498-E505 (1990).
[0278] 71 Van Lenten, B. J., Fogelman, A. M., Haberland, M. E. & Edwards, P. A. The role of lipoproteins and receptor- mediated endocytosis in the transport of bacterial lipopolysaccharide. Proceedings of the National Academy of Sciences 83, 2704-2708 (1986).
[0279] 72 Reeds, P. J. & lahoor, F. The amino acid requirements of disease. Clinical Nutrition 20, 15-22 (2001).
[0280] 73 Zeiser, R. et al. Ruxolitinib for Glucocorticoid- Refractory Chronic Graft- versus-Host Disease. N Engl J Med 385, 228-238 (2021).
[0281] 74 Dahlberg, S. E. et al. Body mass index and its association with clinical outcomes for advanced non-small-cell lung cancer patients enrolled on Eastern Cooperative Oncology Group clinical trials. J Thorac Oncol 8, 1121-1127 (2013).
[0282] 75 Zhong, X. et al. Sex specificity of pancreatic cancer cachexia phenotypes, mechanisms, and treatment in mice and humans: role of Activin. J Cachexia Sarcopenia Muscle 13, 2146- 2161 (2022).
[0283] 76 Hetzler, K. L. et al. Sex differences in the relationship of IL-6 signaling to cancer cachexia progression. Biochimica et Biophysica Ada (BBA) - Molecular Basis of Disease 1852, 816-825 (2015).
[0284] 77 Greenman, A. C., Albrecht, D. M., Halberg, R. B. & Diffee, G. M. Sex differences in skeletal muscle alterations in a model of colorectal cancer. Physiol Rep 8, el4391 (2020).
[0285] 78 Bankhead, P. et al. QuPath: Open-source software for digital pathology image analysis. Sci Rep l, 16878 (2017). 79 Ersoy, B. A., Maner-Smith, K. M., Li, Y., Alpertunga, I. & Cohen, D. E. Thioesterase- mediated control of cellular calcium homeostasis enables hepatic ER stress. J Clin Invest 128, 141-156 (2018).
[0286] 80 Goncalves, M. D. et al. Fenofibrate prevents skeletal muscle loss in mice with lung cancer. Proc Natl Acad Sei U SA 115, E743-E752 (2018).
[0287] 81 Chen, H. et al. KRT8 Serves as a Novel Biomarker for LU AD and Promotes Metastasis and EMT via NF-kappaB Signaling. Front Oncol 12, 875146 (2022).
[0288] 82 Bai, X. et al. CDK4 / 6 inhibition triggers ICAM1 -driven immune response and sensitizes LKB1 mutant lung cancer to immunotherapy. Nat Commun 14, 1247 (2023).
[0289] 83 Huang, H., Wang, Y, Rudin, C. & Browne, E. P Towards a comprehensive evaluation of dimension reduction methods for transcriptomic data visualization. Commun Biol 5, 719 (2022).
[0290] 84 Bunis, D. G., Andrews, J., Fragiadakis, G. K., Burt, T. D. & Sirota, M. dittoSeq: universal user-friendly single-cell and bulk RNA sequencing visualization toolkit. Bioinformatics 36, 5535-5536 (2021).
[0291] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Exemplary methods and materials are described herein, although methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention.
[0292] Those skilled in the art will recognize, or be able to ascertain, using no more than routine experimentation, numerous equivalents to the specific substances and procedures described herein. Such equivalents are considered to be within the scope of this invention.
[0293] All publications, patents, and patent applications, Genbank sequences, websites and other published materials referred to throughout the disclosure herein are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application, Genbank sequences, websites and other published materials was specifically and individually indicated to be incorporated by reference. In the event that the definition of a term incorporated by reference conflicts with a term defined herein, this specification shall control.
Claims
WHAT IS CLAIMED IS:
1. A method to prevent or treat cancer cachexia comprising administering to a subject in need thereof an effective amount of a composition comprising at least one Janus Kinas (JAK) inhibitor and at least one Toll-like receptor 4 (TLR4) inhibitor.
2. The method of claim 1, wherein the at least one JAK inhibitor inhibits the activity of JAK1, JAK2, JAK3 or a combination thereof.
3. The method of claim 1, wherein the at least one JAK inhibitor inhibits the activity of JAK1.
4. The method of claim 1 or 2, wherein the at least one JAK inhibitor comprises ruxolitinib, tofacitinib, baricitinib, fedratinib, upadacitinib, oclacitinib, peficitinib, delgocitinib, filgotinib, abrocitinib, pacritinib, deucravacitinib, ritlecitinib, momelotinib, golidocitinib, deuruxolitinib, brepocitinib, cerdulatinib, decernotinib, izencitinib, gandotinib, gusacitinib, lestaurtinib, povorcitinib, ropsacitinib, zasocitinib or cucurbitacin I or a combination thereof.
5. The method of claim 1, wherein the at least one JAK inhibitor comprises ruxolitinib.
6. The method of claim 1 or 2, wherein the at least one TLR4 inhibitor comprises TAK- 242, FP-025 or IAXO-102.
7. The method of claim 1, wherein the at least one TLR4 inhibitor comprises TAK-242.
8. The method of claims 1 or 2, wherein a combination of ruxolitinib and TAK-242 is administered.
9. The method of claim 1 or 2, wherein the subject has a carcinomas, such as breast cancer, lung cancer, prostate cancer, colorectal cancer, pancreatic cancer, liver cancer, stomach cancer, esophageal cancer, kidney cancer, bladder cancer, cervical cancer, ovarian cancer, endometrial cancer or skin cancer (including melanoma and non-melanoma); a sarcoma, such as osteosarcoma (bone cancer), liposarcoma (fat tissue cancer),leiomyosarcoma (smooth muscle cancer), rhabdomyosarcoma (skeletal muscle cancer), or angiosarcoma (blood vessel cancer); a leukemia, such as, acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), or chronic myeloid leukemia (CML); a lymphoma, such as Hodgkin lymphoma and Non-Hodgkin lymphoma; multiple myeloma; a central nervous system cancer, such as glioblastoma, astrocytoma, or meningioma; or other cancer type, such, thyroid cancer, testicular cancer, oral cancer, nasopharyngeal cancer, gallbladder cancer or bile duct cancer.
10. The method of claim 1, wherein the subject has lung cancer.
11. The method of claim 1, wherein the administration results in a weight gain of at least about 2.5% over a period of four weeks.
12. The method of claim 1, wherein the administration results in a weight gain of at least about 5% over a period of four weeks.
13. A method to increase appetite, cause weight gain and / or increase survival time of a male subject with cancer comprising administering to the subject an effective amount of at least one Janus Kinas (JAK) inhibitor and at least one Toll-like receptor 4 (TLR4) inhibitor.
14. The method of claim 13, wherein the at least one JAK inhibitor inhibits the activity of JAK1, JAK2, JAK3 or a combination thereof.
15. The method of claim 13, wherein the at least one JAK inhibitor inhibits the activity of JAK1.
16. The method of any one of claims 13 to 15, wherein the at least one JAK inhibitor comprises ruxolitinib, tofacitinib, baricitinib, fedratinib, upadacitinib, oclacitinib, peficitinib, delgocitinib, filgotinib, abrocitinib, pacritinib, deucravacitinib, ritlecitinib, momelotinib, golidocitinib, deuruxolitinib, brepocitinib, cerdulatinib, decernotinib, izencitinib, gandotinib, gusacitinib, lestaurtinib, povorcitinib, ropsacitinib, zasocitinib or cucurbitacin I or a combination thereof.
17. The method of any one of claims 13 to 15, wherein the at least one JAK inhibitor comprises ruxolitinib.
18. The method of any one of claims 13 to 15, wherein the at least one TLR4 inhibitor comprises TAK-242, FP-025 or IAXO-102.
19. The method of any one of claims 13 to 15, wherein the at least one TLR4 inhibitor comprises TAK-242.
20. The method of any one of claims 13 to 15, wherein a combination of ruxolitinib and TAK-242 is administered.
21. The method of any one of claims 13 to 15, wherein the subject has a carcinomas, such as breast cancer, lung cancer, prostate cancer, colorectal cancer, pancreatic cancer, liver cancer, stomach cancer, esophageal cancer, kidney cancer, bladder cancer, cervical cancer, ovarian cancer, endometrial cancer or skin cancer (including melanoma and non-melanoma): a sarcoma, such as osteosarcoma (bone cancer), liposarcoma (fat tissue cancer), leiomyosarcoma (smooth muscle cancer), rhabdomyosarcoma (skeletal muscle cancer), or angiosarcoma (blood vessel cancer); a leukemia, such as, acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), or chronic myeloid leukemia (CML); a lymphoma, such as Hodgkin lymphoma and Non-Hodgkin lymphoma; multiple myeloma; a central nervous system cancer, such as glioblastoma, astrocytoma, or meningioma; or other cancer type, such, thyroid cancer, testicular cancer, oral cancer, nasopharyngeal cancer, gallbladder cancer or bile duct cancer.
22. The method of any one of claims 13 to 15, wherein the subject has lung cancer.
23. The method of any one of claims 13 to 15, wherein the subject has cachexia.
24. The method of any one of claims 13 to 15, wherein the administration results in a weight gain of at least about 2.5% over a period of four weeks.
25. The method of any one of claims 13 to 15, wherein the administration results in a weight gain of at least about 5% over a period of four weeks.