Modulators of FAM118b protein for use in therapy
By targeting FAM118B to modulate the inflammatory response, the challenges of imprecise inflammation treatments are addressed, achieving tailored and effective therapies for chronic inflammation and cancer treatment.
Patent Information
- Application Number
- PCT/EP2025/059331
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-05
- Filing Date
- 2025-04-04
- Publication Date
- 2025-10-09
AI Technical Summary
Current inflammation modulation treatments lack precision in targeting specific inflammatory pathways, leading to broad immunosuppression and potential adverse effects, and there is a need for therapies that can selectively target pathological inflammation while preserving the normal immune response, particularly in conditions where inflammation is dysregulated or chronic.
Targeting FAM118B, a protein involved in the TLR4-derived inflammation pathway, to modulate the inflammatory response by either inhibiting or enhancing its activity, allowing for tailored therapeutic interventions based on the specific context of the patient.
This approach provides more precise modulation of inflammation, reducing off-target effects and addressing pathologies with dysregulated inflammation, such as chronic inflammatory conditions and infections, while enhancing anti-tumor immunity and improving the efficacy of immunotherapy.
Smart Images

Figure IMGF000051_0001 
Figure 00000061_0000 
Figure 00000062_0000
Abstract
Description
[0001] Modulators of FAM118B protein for use in therapy
[0002] Field of the invention
[0003] The invention relates to the human protein Family with sequence similarity 118 member B (FAM118B). In particular, the present invention relates to the activation, or the inhibition of the activity or effect provided by FAM118B, for modulating the inflammatory response. In particular, it is provided the use of an activator of FAM118B, or an activator of the biological effects provided by FAM118, for inducing, sustaining, or enhancing an inflammatory process, in particular an inflammatory process associated with a cancer, a bacterial infection, a viral infection, parasite infection, or fungal infection. In particular, it is also provided the use of an inhibitor of FAM118B, or an inhibitor of the biological effects provided by FAM118B, for inhibiting, or reducing an inflammatory process, more particularly for inducing the resolution of an inflammatory process.
[0004] Description of prior art
[0005] Inflammation is a vital protective response initiated by the immune system to combat harmful stimuli such as pathogens, tissue injury, or irritants. It is characterized by a cascade of events orchestrated by various cells, signaling molecules, and mediators aimed at containing and eliminating the threat while facilitating tissue repair. The process typically unfolds in a series of well- coordinated stages:
[0006] In response to an injury or an infection, immune cells, primarily macrophages and mast cells, release pro-inflammatory signals such as cytokines (e.g., interleukins and tumor necrosis factor) and chemical mediators (e.g., histamine). These signals trigger vasodilation and increased vascular permeability, leading to redness, heat, swelling, and pain - classic hallmarks of inflammation.
[0007] These pro-inflammatory signals lead to the recruitment of circulating leukocytes, in particular neutrophils and monocytes. These leukocytes are attracted to the site of inflammation by chemotactic factors. They migrate across the endothelium and accumulate in the affected tissue to phagocytose pathogens, clear cellular debris, and amplify the immune response.
[0008] As the threat subsides, the inflammatory response must be regulated and resolved to prevent tissue damage and maintain homeostasis. This phenomenon is called the resolution of the inflammation. To this end, specialized pro-resolving mediators, such as lipoxins, resolvins, and protectins, orchestrate the resolution phase. These molecules actively dampen inflammation, promote the clearance of apoptotic cells and debris, and stimulate tissue repair mechanisms.
[0009] Resolution of inflammation paves the way for tissue healing and regeneration. Fibroblasts produce extracellular matrix components, while angiogenesis restores blood supply to the damaged area. Macrophages transition from a pro- inflammatory to a reparative phenotype, promoting tissue remodelling and wound closure.
[0010] Understanding the intricacies of the inflammation process and its resolution holds significant implications for the development of novel therapeutic strategies, either by targeting inflammatory disorders, or by modulating inflammatory response.
[0011] Inflammation, while crucial for defending the body against pathogens and promoting tissue repair, can also contribute to the pathogenesis of various diseases. In conditions where inflammation becomes dysregulated or chronic, it can lead to tissue damage, organ dysfunction, and exacerbation of symptoms. Indeed, resolution failure can lead to chronic inflammatory conditions such as rheumatoid arthritis, inflammatory bowel disease, and atherosclerosis. In these diseases, the resolution phase is impaired, perpetuating tissue damage and exacerbating symptoms.
[0012] On the other hand, it may be useful to induce or maintain inflammation for treating a pathology wherein the inflammatory process is either deficient or inefficient. As an example, in recent years, new therapies against cancer involve the induction of inflammation within the tumor microenvironment as well as systemically. While inflammation is traditionally associated with tissue damage and disease, strategically inducing inflammation in the context of cancer therapy can have profound therapeutic implications.
[0013] Therefore, the resolution of inflammation emerges as a promising therapeutic strategy for mitigating the progression and severity of such pathologies. By understanding the underlying molecular mechanisms governing the resolution phase of inflammation, novel therapies can be developed to modulate the inflammatory response effectively.
[0014] Current inflammation modulation treatments often lack precision in targeting specific inflammatory pathways or cells, resulting in broad immunosuppression and potential adverse effects. There is a need for therapies that can selectively target pathological inflammation while preserving the normal immune response. While much attention has been focused on inhibiting pro-inflammatory pathways, there is a deficiency in therapies that actively promote the resolution of inflammation. Enhancing resolution mechanisms could prevent chronic inflammation and tissue damage, offering a more comprehensive approach to treatment.
[0015] There is a growing recognition of inter-individual variability in inflammatory responses, necessitating personalized treatment strategies tailored to patients' unique immune profiles and disease characteristics. Current approaches often adopt a one-size-fits-all approach, leading to suboptimal outcomes in some individuals.
[0016] Given the complexity of inflammatory pathways and the heterogeneity of inflammatory diseases, single-target therapies may be insufficient to achieve optimal outcomes. There is a need for the development of combination therapies that target multiple points within the inflammatory cascade to achieve synergistic effects and improve efficacy.
[0017] Addressing these needs and deficiencies presents opportunities for providing inflammation modulation therapies, with the potential to bring new treatment allowing the management of inflammation processes and improve patient outcomes.
[0018] TLR4, or Toll-like receptor 4, plays a pivotal role in the initiation and regulation of inflammation. It is a key component of the innate immune system, primarily recognizing and responding to molecular patterns associated with pathogens, particularly lipopolysaccharide (LPS) from gram-negative bacteria. TLR4 serves as a pattern recognition receptor, detecting microbial components such as LPS, which trigger the activation of downstream signaling pathways upon binding. Upon ligand binding, TLR4 activates signaling cascades that lead to the production of pro-inflammatory cytokines, chemokines, and antimicrobial peptides. This initiates the recruitment and activation of immune cells, including macrophages, dendritic cells, and neutrophils, to the site of infection or tissue damage. TLR4 engagement triggers intracellular signaling pathways, notably involving nuclear factor-KB (NF-KB) and mitogen-activated protein kinases (MAPKs). These pathways culminate in the transcriptional activation of genes encoding pro-inflammatory mediators, amplifying the inflammatory response. TLR4 activation not only elicits immediate innate immune responses but also plays a role in shaping adaptive immunity. By promoting the maturation and activation of antigen-presenting cells, TLR4 contributes to the initiation of adaptive immune responses, including the activation of T cells and the production of antigen-specific antibodies. Overall, TLR4 serves as a crucial sensor of infection and tissue damage, orchestrating the inflammatory response to combat pathogens and maintain tissue homeostasis. Understanding its functions and regulatory mechanisms is essential for developing therapeutic interventions to modulate inflammation and treat associated diseases.
[0019] FAM118B (Family with Sequence Similarity 118 Member B) is encoded by the FAM118B gene located on human chromosome 11. It typically consists of 351 amino acids, though there may be variations depending on alternative splicing or post-translational modifications. The precise function of FAM118B is not fully understood, and research on this protein is ongoing. FAM118B could be implicated in cancer biology, with altered expression patterns observed in certain cancer types. FAM118B may interact with other proteins within cellular pathways or complexes, influencing its function. Some studies have reported interactions with proteins involved in DNA damage response and repair mechanisms. While the exact implications of FAM118B in human health and disease are still being elucidated, the present application disclosed its role in the inflammatory response, in particular as a downstream actor of activated TLR4. Its targeting is associated with modulation of the inflammatory response. Thus, modulating FAM118B function may provide valuable therapeutic applications.
[0020] The present invention provides a new way of targeting inflammation resolution pathways by targeting FAM118B, or a biological effect provided by FAM118B, in particular in the treatment of inflammation-associated pathologies, or for resolving the inflammatory process, or for initiating or sustaining an inflammatory process.
[0021] The present application provides the rationale behind inducing inflammation as a therapeutic strategy for treating cancer, outlining its potential benefits, and providing innovative methods for achieving tumor-specific inflammatory responses. By leveraging the immune-stimulatory properties of inflammation, this approach aims to enhance the efficacy of existing cancer therapies and pave the way for the development of novel immunotherapeutic treatments.
[0022] Summary of the invention
[0023] It is an object of the invention to provide compounds that modulate the activity of FAM1 18B, either by reducing or increasing at least one biological effect provided by FAM118B, for modulating an inflammatory response.
[0024] It is also an object of the invention to provide compounds that are antagonists or agonists of FAM118B, thereby either inhibiting, activating, or enhancing FAM1 18B, for modulating an inflammatory response.
[0025] It is also an object of the invention to provide a compound that is an antagonist of FAM118B, for inhibiting and / or reducing the inflammatory response in a patient in need thereof.
[0026] It is also an object of the invention to provide a compound that is an agonist of FAM118B, for activating and / or enhancing and / or sustaining the inflammatory response in a patient in need thereof, in particular in a patient suffering from a cancer.
[0027] The inventors have found that FAM118B is involved in the TLR4-derived inflammation. Thereby, by preventing or activating the biological effects provided by FAM118B, it is possible to modulate the inflammation process, in particular when it is driven by TLR4. Depending on the pathology to be treated, it is possible to reduce the inflammatory process by preventing FAM118B to exert its normal function, or to induce an inflammatory response by sustaining FAM118B activity. TLR4 stimulation by LPS results in receptor dimerization and the binding of the adaptor protein TIRAP to the cytosolic TIR domain of TLR4. TIRAP interacts with the adaptor MyD88 and FAM118B, activating the enzymatic activity of FAM118B. FAM118B exerts its function via a SIR2-like domain, which degrades a NAD molecule, thereby releasing a molecule that activates TRPM2 (Transient Receptor Potential Melastatin 2).
[0028] NAD, or Nicotinamide Adenine Dinucleotide, is a coenzyme found in all living cells. It plays a fundamental role in various metabolic processes.
[0029] In immune cells, TRPM2 activation contributes to inflammatory responses by promoting the production of pro-inflammatory cytokines and reactive oxygen species (ROS). Furthermore, TRPM2-mediated calcium influx has been linked to the activation of T lymphocytes and the modulation of immune cell function.
[0030] The invention is defined by the independent claims. The dependent claims define advantageous embodiments.
[0031] In an embodiment, it is provided a modulator of Protein Family with sequence similarity 118 member B (FAM118B) for use in the modulation of the inflammatory response in a patient in need thereof.
[0032] Modulating the activity of Protein Family with sequence similarity 118 member B (FAM118B) allows to modulate an inflammatory response, in particular an inflammatory response present in association with a pathology, including cancer, infection (by bacteria, virus, parasites, fungus), or autoimmune disease. Thus, modulating the activity of FAM118B allows to either sustain, or enhance, the inflammatory response when inflammation is sought for treating a pathology (for example, a cancer), or to reduce, or inhibit, the inflammatory response when reducing or resolving inflammation is sought for treating a pathology (for example, an auto-immune disease).
[0033] Targeting FAM118B may allow to modulate inflammation with more specificity than current treatment, in particular those targeting TLR4. Inflammation process often involve multiple components, including receptors, enzymes, and downstream effectors. Targeting a specific molecule within the pathway allows for more precise modulation of the signaling cascade, potentially reducing off- target effects compared to targeting the main receptor or the final downstream effector, which might have broader effects on other pathways or functions. By targeting FAM118B within the pathway, it may be possible to modulate the pathway's activity without disrupting other cellular processes or pathways, providing a more modular approach to therapeutic intervention. Targeting FAM1 18B within the inflammatory process, in particular when the TLR4 pathway is involved, offers flexibility in adjusting the therapeutic approach based on the specific context of the patient, allowing for tailored interventions that may be more effective or have fewer side effects.
[0034] Further, by identifying a new molecule involved in the inflammation process, it may be possible to bypass or overcome resistance mechanisms associated with treatment involving the targeting of other molecules involved in the inflammatory response, thereby prolonging the effectiveness of the therapeutic intervention.
[0035] Further, many diseases involve dysregulation of signaling pathways rather than simply dysfunction of a single receptor or effector. Targeting FAM118B may address pathologies wherein the inflammatory response is not adapted to the treatment of the pathology.
[0036] Further, inflammatory response involves activation or repression of signaling pathways implicated in a wide range of diseases, including but not limited to cancer, infections, and inflammatory disorders. Targeting FAM118B may thus unlock new therapeutic opportunities for addressing unmet medical needs, potentially leading to the development of novel treatments with significant clinical impact.
[0037] In an embodiment, it is provided a blocker or an antagonist of FAM118B, or a compound that decreases, in particular inhibits, the expression of FAM118B, or a compound that decreases, in particular inhibits, a biological process involving FAM118B, in particular a compound that decreases, in particular inhibits, the SIR2 like activity of FAM118B, in particular for treating a pathology wherein reduction of inflammation is sought.
[0038] Providing a blocker or an antagonist of FAM118B, or a compound that decreases, in particular inhibits, the expression of FAM118B, or a compound that decreases, in particular inhibits, a biological process involving FAM118B, may lead to a reduction of the inflammation, by reducing or suppressing inflammatory signaling, thereby mitigating excessive immune responses, in particular in diseases associated with inflammatory dysfunction, like inflammatory diseases or autoimmune diseases, including but not limited to autoimmune disorders, inflammatory bowel disease, Crohn disease, ulcerative colitis, rheumatoid arthritis, systematic lupus erythematous, and multiple sclerosis, as well as excess of inflammation driven by pathogen infection, as seen by pathogen-induced sepsis and acute respiratory distress syndrome.
[0039] In another embodiment, it is provided an activator or an agonist of FAM118B, or a compound that enhances the expression of FAM118B, or a compound that enhances a biological process involving FAM118B, in particular a compound that enhances the SIR2-like activity of FAM118B in particular for treating a pathology wherein induction or stimulation of inflammation is sought.
[0040] By stimulating the activity provided by FAM118B, a pro-inflammatory signaling pathway can be promoted, thereby stimulating immune responses against a pathogen, including bacteria or virus, or against cancer cells. Activating or enhancing FAM118B activity leads to an inflammatory activation that can modify the tumor microenvironment, enhancing immune cell infiltration and function within the tumor, thereby promoting anti-tumor immunity. Inflammatory activation can disrupt tumor blood vessel formation (angiogenesis), leading to reduced tumor growth and metastasis. Activation of FAM118B can synergize with immunotherapy approaches, such as immune checkpoint inhibitors, enhancing their efficacy and expanding their applicability to a broader range of cancers.
[0041] The present application encompasses modulators, like antagonists or agonists, of FAM118B, compositions comprising such a modulator, methods of identifying, designing, synthesizing, or screening modulators, as well as methods of using modulators for diagnostic, prognostic, or therapeutic purposes. By providing a method for identifying modulators of FAM118B, this patent application aims to facilitate the development of new therapeutic treatments and diagnostic tools for various medical conditions.
[0042] Short description of the drawings
[0043] Fig.1 A) WT or FAM118B KO murine macrophages are treated with LPS to activate TLR4. Production of the inflammatory mediators NO and IL6 is measured. B) Levels of TIRAP or FAM118B are knock-down in murine bone marrow-derived macrophages and IL6 is measured after LPS treatment. C) WT or FAM118B KO murine macrophages are infected with the bacteria Salmonella. Intracellular bacteria accumulation is monitored. Fig.2 A) Cleavage of NAD by recombinant human FAM118B is measured in vitro in the presence of PEG400, a molecular crowding agent. B) Detail of FAM118B structure (predicted by AlphaFold) showing NAD+ accommodation as well as two critical conserved residues, H206 and N163. (C) HEK cells expressing TLR4 (HEKblue system) are transfected with a plasmid coding for FAM118B WT or catalytically dead. NF-kB activity (inflammation) is measured upon LPS stimulation. D) FAM118B or TIRAP are expressed in HEKblue cells by plasmid transfection and stimulated with LPS, in the presence or not of a TRPM2 inhibitor. NF-kB-driven inflammation is monitored.
[0044] Fig.3 illustrates (A) the gene expression of fam118b and (B) the subcellular localization of FAM118B.
[0045] Fig.4 illustrates the co-immunoprecipitation of TLR4 and FAL118B.
[0046] Fig.5 illustrates the levels of IL-8 and IFI44L secreted by Human Monocyte-
[0047] Derived Macrophages (huMDMs) transduced with a control shRNA, or a shRNA targeting SIRanc (the mice ortholog of FAM118B), and stimulated with LPS (100ng / mL), flagellin (500ng / mL) or R848 (1 pg / mL), agonists of TLR4, TLR5 and TLR7 / 8, respectively. Levels of IL8 and IFI44L transcripts were measured by RT-qPCR at 8h. Statistical analyses were performed using two-ways ANOVA and p-values were classified as * p<0.05; ** p<0.01 ; *** p<0.001 . Grey stars correspond to comparisons within one group and dark stars correspond to comparisons between groups.
[0048] Fig.6 illustrates the secretion of cytokines and nitric oxide production in
[0049] SIRanc knocked-out mice RAW264.7 cells. SIRanc is the mice ortholog of human FAM118B. RAW264.7 cells were stimulated with Pam3CysSK4 (500ng / mL), Poly(l:C) (1 pg / mL), LPS (100ng / mL), R848 (1 pg / mL) or CpG (1 pg / mL), agonists of TLR1 / 2, TLR3, TLR4, TLR7 / 8 and TLR9, respectively. Production of TNF, IL6, IFNbeta and NO were measured at 24h. Each dot represents the mean of technical replicates for each independent experiment. Statistical analyses were performed using two-ways ANOVA and p-values were classified as * p<0.05; ** p<0.01 ; *** p<0.001 . Grey stars correspond to comparisons within one group and dark stars correspond to comparisons between groups.
[0050] Fig.7 a. Schematic of HSV-1 -GFP infection measured by flow cytometry. Productive viral replication results in GFP production and high levels of fluorescence because viral particles contain GFP: viral entry is detected in cells by medium GFP levels (« intermediate »). Viral replication, but not entry, is inhibited by the drug acyclovir, b. Wild type or SIRanc KO RAW264.7 cells were infected or not with HSV-1 (MOI 7.5), in the presence or absence of acyclovir. Levels of GFP were measured by flow cytometry at 24h. c. Wild type or SIRanc KO RAW264.7 cells were infected or not with HSV-1 (MOI 5-10). Levels of GFP were measured by flow cytometry at 24h and the percentage of productively infected cells (GFP high) was determined. The geometric mean fluorescence intensity (MFI) of the GFP high gate is indicated as a surrogate of viral replication. d,e. Wild type or SIRanc KO RAW264.7 cells were infected with Salmonella enterica (MOI 10). Intracellular replication of bacteria was quantified by colony forming unit (CFU) assay. In (e), LPS from Rhodobacter sphaeroides (1 pg / mL) is used as a TLR4 antagonist. Each dot represents the mean of technical replicates for each independent experiment (c,d,e). Bars correspond to the mean and error bars to the standard deviation of all the independent experiments. Statistical analyses were performed using two-ways ANOVA and p-values were classified as * p<0.05; ** p<0.01 ; *** p<0.001 . Grey stars correspond to comparisons within one group and dark stars correspond to comparisons between groups.
[0051] Fig.8 IL-10, CCL2, IFNb, CXCL10, IFNa, GM-CSF, IL-1 B, IFNg and IL-6 production in wild type (WT) macrophages and FAM118B-knock Out (KO) macrophages stimulated or not with LPS.
[0052] Fig. 9 Nitric oxide production in Wild type (WT) or SIRanc knock-out (KO) RAW264.7 cells stimulated or not with LPS (100ng / mL), an agonist of TLR4, in presence or in absence of sirtinol, an antagonist of FAM118B. Production of NO was measured at 24h. Cells were treated with the indicated concentration of sirtinol at the start of the experiment. Detailed description of embodiments of the invention
[0053] In a first aspect, it is provided a modulator of Protein Family with sequence similarity 118 member B (FAM118B) for use in the modulation of the inflammatory response in a patient in need thereof.
[0054] Protein FAM118B (referenced herein as FAM118B) is a protein found in Homo sapiens (human). FAM118B stands for Family with sequence similarity 118 member B. Within the Uniprot database, the accession numbers of FAM118B are Q9BPY3 and Q9H7B0. In an embodiment of the invention, FAM118B has the amino sequence set forth in SEQ ID No. 1. FAM118B is an intracellular protein that is poorly characterized and is currently solely identified as playing a role in Cajal bodies formation. Cajal bodies, also coiled bodies, are spherical nuclear bodies found in the nucleus of proliferative cells like embryonic cells and tumor cells, or metabolically active cells like neurons. Overexpression of FAM118B changes the morphology of Cajal bodies, while its depletion disrupts the localization of components of Cajal bodies, reduces the splicing capacities of the cells, and inhibit cell proliferation. FAM118B possesses a SIR2-like domain (sirtuin-like domain). Sirtuin-like domains are also found in vertebrate FAM118A and bacterial NAD(+) hydrolase ThsA. ThsA is a component of bacterial antiphage defense system Thoeris and has robust NAD+ cleavage activity. It consists of a N-terminal NAD-binding domain (denoted as sirtuin-like or Macro) and C-terminal SLOG-like domain. The SIR2-like domain may be localized between amino acid residues 158 and 301 or between the amino acid residues 28 and 57 on one hand and 133 and 326 on the other hand within the FAM118B having the amino acid sequence set forth in SEQ ID No. 1 . FAM118B additionally bears a CARD-like domain, localized in residues 58-132 within the FAM118B having the amino acid sequence set forth in SEQ ID No. 1 . CARD domains belong to the superfamily of death domains, which are present in various immune proteins, including the adaptor MyD88.
[0055] Inflammatory response can be defined as a complex physiological reaction of the body to injury, infection, or other stimuli that disrupt tissue homeostasis. It is characterized by a coordinated series of events involving immune cells, blood vessels, and molecular mediators aimed at removing the injurious agent, initiating tissue repair, and restoring tissue integrity. An inflammatory response include:
[0056] - Vasodilation and increased vascular permeability,
[0057] - Recruitment of immune cells, such as neutrophils, monocytes, and macrophages,
[0058] - Release of Inflammatory Mediators, in particular interleukins (ILs), like IL- 6, tumor necrosis factor-alpha, interferons, chemokines,
[0059] - Phagocytosis of cells and clearance of pathogens; phagocytic cells, such as macrophages and neutrophils, engulf and destroy pathogens, dead cells, and debris through phagocytosis,
[0060] - Tissue Repair and Regeneration, including angiogenesis, fibroblast activation (collagen deposition), and epithelial cell proliferation, thereby restoring tissue integrity and function.
[0061] Inflammatory response can be measured by the evaluation of signs and symptoms associated with inflammation, such as redness, swelling, heat, pain, and loss of function.
[0062] Inflammatory response can be measured by analysis the production and / or secretion and / or the level of inflammatory biomarkers pro-inflammatory cytokines such as interleukin-6 (IL-6), and / or tumor necrosis factor-alpha (TNF-a) and / or interferons. Elevated levels of these biomarkers indicate the presence of inflammation.
[0063] FAM118B acts downstream of TIRAP and MyD88, two adaptors of the TLR4 cascade that oligomerize upon activation, which implies that FAM118B enzymatic activity may be unleashed upon oligomerization. In addition, structural comparison with bacterial ThsA, for which there is an experimentally determined structure, indicate that FAM118B enzymatic activity may by blocked at baseline by an inhibitory loop located at residues 48-64 within the FAM118B having the amino acid sequence set forth in SEQ ID No. 1. Interactions between TLR4 adaptors (TIRAP and MyD88) and FAM118B may trigger a conformational change with movement of the loop, liberating the active site and allowing NADase activity, as seen with ThsA.
[0064] The microenvironment of a tumor refers to the cellular and molecular milieu surrounding cancer cells within the tumor mass. It may comprise various components, including cancer cells, stromal cells, extracellular matrix, blood vessels, immune cells, cytokines, and chemokines. The modulator of FAM118B may be administered to a patient suffering from a cancer within the microenvironment of a tumor.
[0065] A modulator of FAM118B, as used in the present application, refers to any compound or molecule capable of influencing, either positively or negatively, the activity, function, or expression of FAM118B. This modulation can include activation, or inhibition, of FAM118B, alteration of the conformation of FAM118, stabilization or destabilization of FAM118B, mutation of FAM118B to either constitutively activate or inactivate at least one function possessed by FAM118B, for example by mutating the inhibitory loop blocking the Sir2-like domain, thereby providing a FAM118B which constitutively cleaves NAD, or mutating the catalytic residues of the Sir2-like domain, which results in mutant FAM118B unable to cleave NAD.
[0066] The modulator may directly interact with the protein through binding to one of its active sites, in particular through binding to its SIR2-like domain of FAM118B, or other functional domains such as the CARD-like domain, thereby affecting its biochemical or physiological properties. Alternatively, the modulator may act indirectly by influencing upstream or downstream signaling pathways that regulate the activity or expression FAM118B, including proteins that bind to, modify, or degrade the molecule produced by FAM118B-driven degradation of NAD.
[0067] The SIR2-like domain of FAM118B may correspond to the domain localized between the amino acid 158 and 301 or between the amino acid residues 28 and 57 on one hand and 133 and 326 on the other hand of the wild type FAM118B protein, in particular the FAM118B protein having the amino acid sequence set forth in SEQ ID No. 1.
[0068] The modulator can be a small molecule (including molecules derived from NAD and NAD degradation, such as ADPR, molecules modulating sirtuins such as sirtinol, cambinol, splitomicin, quercetin, SRT2104, SRT2379, SRT3025, EX-527 as well as their derivatives), a peptide (including death domain and CARD-like domain such as the one present in MyD88 and FAM118B, as well as mutated or truncated FAM118B that could act as a dominant negative), a nucleic acid, an antibody, a natural product (including products produced by bacteria dedicated to counteract FAM118B-driven immune response, such as Thoens anti-defense proteins which sequester small molecules derived from NAD degradation), a synthetic compound, or any other biologically active entity capable of modulating at least one function of FAM118B, in particular capable of modulating the Sir2- like activity of FAM118B.
[0069] In an aspect, it is provided a modulator of FAM118B. In the context of the present invention, a modulator can refer to substances and molecules, such as agonists or activators or antagonists or blockers, that affect the activity of FAM118B. Modulators can either enhance (agonists or activators) or decrease (antagonists or blockers) the biological effect provided by FAM118B, thereby contributing to regulate physiological processes involving FAM118B. Modulators of FAM118B also encompass substances and molecules that affect the expression of FAM118B. The expression of FAM118B may be assessed by measuring the concentration of FAM118B protein in cells contacted with the modulator, or by measuring the concentration of mRNA encoding FAM118B in cells contacted with the modulator. Modulators of FAM118B can either enhance the expression of FAM1 18B, in particular enhance the production of mRNA encoding FAM118B or increase the concentration, in particular the cytosolic concentration or the nucleus concentration, or the cytosolic and the nucleus concentration, of the protein FAM118B; or reduce (in particular inhibit) expression of FAM118B, in particular reduce the production of mRNA encoding FAM118B or decrease the concentration, in particular the cytosolic concentration, of the protein FAM118B. In an embodiment, the modulator of FAM118B is an activator or an agonist of FAM118B, or enhances the expression of FAM118B, or enhances a biological process involving FAM118B, in particular the SIR2-like activity provided by FAM118B.
[0070] Providing such a modulator leads to the activation or the enhancement of FAM118B activity. In the context of the present invention, activating FAM118B refers to inducing or enhancing the biological activity or function of FAM118B, in particular within a cell or organism. This activation can occur through various mechanisms, including but not limited to: - Binding of an agonist to FAM118B, leading to conformational changes, in particular oligomerization or release of active site inhibition, that trigger downstream signaling pathways,
[0071] - Post-translational modifications such as phosphorylation, acetylation, or ubiquitination, which regulate the protein's activity and interactions with other cellular components,
[0072] - Allosteric regulation by small molecules or cofactors that modulate FAM118B’s enzymatic activity, in particular SIR2-like activity, or binding affinity, in particular through its SIR2-like domain,
[0073] - FAM118B-activator (or agonist) interactions that stabilize or enhance FAM118’s function, in particular within a complex molecular network,
[0074] - Induction of gene expression, in particular stimulation of mRNA production that encodes FAM 118, or stimulation of protein synthesis to increase the production of active FAM118B, and / or stimulation of FAM118B concentration, in particular in cytosol.
[0075] - Stabilization of FAM118B protein by preventing its degradation (increasing protein half-life).
[0076] An agonist of FAM118B can active FAM118B or can active, induce, or enhance the activity of FAM118B. FAM118B can be considered to be active when it shows an NADase activity, with degradation of NAD and production of NAD degradation product and / or a small molecule that activates the channel TRPM2. Thus, in presence of an activator or an agonist of FAM118B, the NADase activity of FAM1 18B in cells is increased, as compared to the NADase activity of FAM118B observed in cells that are not in presence of the activator or agonist of FAM118B. FAM118 can be considered activated, induced, or enhanced when FAM118B demonstrates an NADase activity. In particular, the NADase activity of FAM118B can be measured according to the following method: i) in vitro by putting recombinant FAM118B in the presence of NAD and measuring NAD concentration and / or concentration of products of NAD degradation, including FAM118B second messenger that activates TRPM2 and ii) in cells by directly measuring NAD concentration and / or concentration of products of NAD degradation, inlcuding FAM118B second messenger that activates TRPM2, or indirectly by assessing the activity of TRPM2 and TRPM2-driven, NF-kB- dependent downstream inflammation. The activity of FAM118B can be considered to be activated or increased when degradation of NAD is activated or increased in cells in contact with the activator or agonist of FAM118B, as compared to the same cells, in the same condition, but not in contact with an activator or an agonist of FAM118B.
[0077] Degradation of NAD can be measured according by NAD titration using spectrophotometry as well as high performance liquid chromatography and mass spectrometry in presence and in absence of the activator or agonist of FAM118B. The production of FAM118B’s second messenger from NAD degradation as well as NAD degradation procucts by HPLC and mass spectrometry can also be measured for determining activation of FAM118B by the activator or the agonist of FAM118b.
[0078] The activity of FAM118B may be determined by measuring the concentration of NAD, either in vitro or in vivo. As an example, the concentration of NAD may be measured by high performance liquid chromatography and mass spectrometry. A decrease in the concentration of NAD means that the activity of FAM118B is increased. An increase in the concentration of NAD, or a stagnation of the concentration of NAD, means that the activity of FAM118B is either decreased or unaffected.
[0079] The activity of FAM118B may be determined by measuring the activation of TRPM2, either in vitro or in vivo. As an example, the activation of TRPM2 may be measured by the downstream activation of NF-kB (measured using reporter proteins under an NF-kB-driven promoter) as well as measurement of mRNA and proteins under the control of TRPM2 activation (such as the pro-inflammatory cytokine IL-6) and chemical products resulting of the activity of proteins under the control of TRPM2-driven inflammation (such as nitric oxide). An increase in the activation of TRPM2 means that the activity of FAM118B is increased. A decrease in the activation of TRPM2 means that the activity of FAM118B is decreased. Thus, an agonist or an activator of FAM118 leads to an increase in the activation of TRPM2 in cells in contact with the agonist or activator, as compared to the same cells, in the same condition, but not in contact with the antagonist or blocker. The expression of FAM118B can be increased by administering to cells DNA or RNA encoding the FAM118B protein.
[0080] An agonist of FAM118B can be a modified FAM118B bearing an additional domain, such as TIR, CARD or Pyrin. When FAM118B is modified to bear an additional domain selected among the group consisting of TIR, CARD or Pyrin, FAM118B is likely to spontaneously oligomerize, thereby increasing the degradation of NAD.
[0081] An agonist of FAM118B can be two FAM118B joined by a flexible linker. Thus, it is provided an oligomerized FAM118B, that increases the degradation of NAD.
[0082] An agonist of FAM118B can be FAM118B mutated in the inhibitory loop located at residues 48-64 within the FAM118B having the amino acid sequence set forth in SEQ ID No. 1.
[0083] An agonist of FAM118B can be FAM118B mutated in the nuclear localization sequence located at residues 26-40 within the FAM118B having the amino acid sequence set forth in SEQ ID No. 1
[0084] An agonist of FAM118B can be FAM118B modified for bearing a nuclear export signal, for example the nuclear localization sequence (NLS) of the protein Rev of HIV-1 of SEQ ID No. 2 (LQLPPLERLTLD).
[0085] An agonist of FAM118B can be a modified FAM118B bearing several of the modifications described above.
[0086] An agonist of FAM118B can be FAM118B from other species than human (for example: blue whale, horseshoe bat, koala) as well as FAM118B from other species carrying one or several modifications as described above.
[0087] When the modulator of FAM118B is an activator or an agonist of FAM118B, or enhances the expression of FAM118B, or enhances a biological process involving FAM118B, in particular the degradation of NAD by the SIR2-like domain of FAM118B, it may initiate, or enhance, or sustain an inflammatory response.
[0088] In the context of the present invention, "initiation of inflammation" refers to the triggering or induction of the inflammatory response within a biological system, in particular within a host. This process involves the activation of various cellular and molecular components that contribute to the inflammatory cascade, leading to the recruitment of immune cells, release of inflammatory mediators, and tissue responses characteristic of inflammation. In a particular embodiment, initiation of the inflammation can be considered reached when activated immune cells, in particular myeloid cells, in particular macrophages and dendritic cells, release cytokines, in particular interleukins (ILs), more particularly IL-6, and / or, tumor necrosis factor-alpha (TNF-a), and interferons (IFNs), as well as chemokines that attract immune cells to the site of inflammation.
[0089] In the context of the present invention, "sustaining inflammation" refers to the maintenance or prolongation of the inflammatory response within a biological system beyond its typical duration. Sustained inflammation persists over an extended period, as compared to a typical inflammation process. In a particular embodiment, sustention of the inflammation can be considered reached when activated immune cells, in particular myeloid cells, in particular macrophages and dendritic cells, continue to release cytokines, in particular interleukins (ILs), more particularly IL-6, and / or, tumor necrosis factor-alpha (TNF-a), and interferons (IFNs), as well as chemokines that attract immune cells to the site of inflammation for a longer period of time as compared to the same cells in a condition of typical inflammation process.
[0090] In the context of the present invention, "enhancing inflammation" refers to the process of amplifying or intensifying the inflammatory response within a biological system. In a particular embodiment, enhancement of the inflammation can be considered reached when activated immune cells, in particular myeloid cells, in particular macrophages and dendritic cells, , release higher yields of cytokines, in particular interleukins (ILs), more particularly IL-6, and / or, tumor necrosis factor-alpha (TNF-a), and interferons (IFNs), as well as chemokines that attract immune cells to the site of inflammation, as compared to the same cells in a condition of typical inflammation process.
[0091] In an embodiment of the invention, the modulator of FAM118B is provided for initiating, sustaining, or enhancing inflammatory response in a patient suffering from a cancer, or a bacterial infection a viral infection, a parasite infection, or a fungal infection. In a particular embodiment, the modulator of FAM118B is provided for initiating, sustaining, or enhancing inflammatory response in a patient suffering from a cancer selected from the list consisting of solid tumors, including pancreatic, breast, lung, and intestinal tumors. In an embodiment of the invention, the modulator of FAM118B is an agonist of FAM1 18B provided for initiating, sustaining, or enhancing inflammatory response in a patient suffering from a bacterial infection, a viral infection, a parasite infection, or a fungal infection, that signal through the Toll-like receptor 4.
[0092] In an embodiment of the invention, the modulator of FAM118B is an agonist of FAM118B and is provided for initiating, sustaining, or enhancing inflammatory response in a patient suffering from a bacterial infection, a viral infection, a parasite infection, or a fungal infection, that lead to an immune activation of the innate immune system, in particular by enhancing the productions of pro- inflammatory cytokines, in particular TNF-alpha and / or IL-6, more particularly of IL-6, and / or by enhancing the production of nitric oxide (NO) and / or by enhancing the production or activation of nitric oxide synthase (NOS-2).
[0093] In particular, when the disease to be treated is a bacterial infection, a viral infection, a parasite infection, or a fungal infection, the modulator of FAM118 according to the invention is an agonist of FAM118B, that is administered to a patient in need thereof for activating and / or enhancing and / or sustaining the inflammatory response of the patient. The agonist of FAM118 is in particular a nucleic acid molecule encoding FAM118B or a functional fragment thereof, in particular a cDNA or a mRNA encoding FAM118B, or is a Chimeric antigen receptor (CAR) comprising within its cytoplasmic domain a functional domain of FAM118B, in particular the SIR2-like domain of FAM118B, more particularly FAM118B with the amino acid sequence set forth in SEQ ID No. 3, or SEQ ID No. 4, or SEQ ID No. 5 or SEQ ID No. 6.
[0094] In an embodiment of the invention, the modulator of FAM118B is used for treating an inflammatory disease associated with a Toll-like receptor. An inflammatory disease associated with a Toll-like receptor (TLR), particularly TLR2, TLR4, and TLR9, is a condition in which dysregulation of the innate immune response, mediated by TLR signaling, contributes to inflammation.
[0095] In an embodiment of the invention, the modulator of FAM118B is used for treating an inflammatory disease associated with a TLR dysfunction. Inflammatory diseases associated with TLR dysfunction may include systemic lupus erythematosus (SLE) (TLR7 / TLR9 overactivation), inflammatory bowel disease (TLR4 dysregulation), and psoriasis (TLR7 / 9 involvement). In an embodiment of the invention, the modulator of FAM118B is used for enhancing the immune response initiated or stimulated by Toll-like receptor.
[0096] In some embodiments, the invention relates to an agonist of FAM118B for use in the treatment of herpes simplex virus (HSV) infection, in particular HSV-1 infection. In some embodiments, the invention relates to an agonist of FAM118B for use in the treatment of a Salmonella infection, in particular Salmonella enterica infection.
[0097] In some embodiments, the invention relates to the modulator of FAM118B of the invention for use in the treatment of cancer.
[0098] In some embodiments, the invention relates to an agonist of FAM118B for use in the treatment of cancer.
[0099] In some embodiments, the invention relates to an agonist of FAM118B for use in the treatment of autoimmune disease.
[0100] In some embodiments, the invention relates to an antagonist of FAM118B for use in the treatment of sepsis.
[0101] In some embodiments, the invention relates to an antagonist of FAM118B for use in the treatment of an inflammatory disease.
[0102] An antagonist of FAM118B can be an inhibitor of SIR2-containg protein like sirtinol or a functional equivalent thereof.
[0103] By "treatment” or “treat", it is meant both prophylactic or preventive treatment as well as curative or disease modifying treatment, including treatment of subjects at risk of contracting the disease or suspected to have contracted the disease as well as subjects who are ill or have been diagnosed as suffering from a disease or medical condition, and includes suppression of clinical relapse. The treatment may be administered to a subject having a medical disorder or who ultimately may acquire the disorder, in order to prevent, cure, delay the onset of, reduce the severity of, or ameliorate one or more symptoms of a disorder or recurring disorder, or in order to prolong the survival of a subject beyond that expected in the absence of such treatment. By "treat" is meant to administer a compound or composition as described herein to a subject in order to prevent or eliminate a disease, including reducing the size of a tumor or the number of tumors in a subject; arrest or slow a disease in a subject; inhibit or slow the development of a new disease in a subject; decrease the frequency or severity of symptoms and / or recurrences in a subject who currently has or who previously has had a disease; and / or prolong, i.e. increase the lifespan of the subject. In particular, the term "treatment of a disease" includes curing, shortening the duration, ameliorating, preventing, slowing down or inhibiting progression or worsening, or preventing or delaying the onset of a disease or the symptoms thereof.
[0104] By "therapeutic regimen" is meant the pattern of treatment of an illness, e.g., the pattern of dosing used during therapy. A therapeutic regimen may include an induction regimen and a maintenance regimen.
[0105] The phrase "induction regimen" or "induction period" refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the initial treatment of a disease. The general goal of an induction regimen is to provide a high level of drug to a subject during the initial period of a treatment regimen. An induction regimen may employ (in part or in whole) a "loading regimen", which may include administering a greater dose of the drug than a physician would employ during a maintenance regimen, administering a drug more frequently than a physician would administer the drug during a maintenance regimen, or both.
[0106] The phrase "maintenance regimen" or "maintenance period" refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the maintenance of a subject during treatment of an illness, e.g., to keep the subject in remission for long periods of time (months or years). A maintenance regimen may employ continuous therapy (e.g., administering a drug at regular intervals, e.g., weekly, monthly, yearly, etc.) or intermittent therapy (e.g., interrupted treatment, intermittent treatment, treatment at relapse, or treatment upon achievement of a particular predetermined criteria [e.g., disease manifestation, etc.]).
[0107] The therapeutically active agents, products or compositions described herein may be administered via any conventional route, including by injection or infusion. By a "therapeutically effective amount", it is meant a sufficient amount of products and compositions according to the invention, to treat the disease (e.g. cancer, infection) at a reasonable benefit / risk ratio applicable to any medical treatment. An "effective amount" refers to the amount which achieves a desired reaction or a desired effect alone or together with further doses. In the case of treatment of a particular disease or of a particular condition, the desired reaction preferably relates to inhibition of the course of the disease. This comprises slowing down the progress of the disease and, in particular, interrupting or reversing the progress of the disease. The desired reaction in a treatment of a disease or of a condition may also be delay of the onset or a prevention of the onset of said disease or said condition.
[0108] It will be understood that the total daily usage of the product of the present invention will be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular patient will depend on the condition to be treated, the severity of the disease, the individual parameters of the patient, including age, body size and weight, general health, sex, diet of the patient, physiological condition, the time of administration, route of administration, and rate of excretion of the specific compound employed; the duration of treatment, the type of an accompanying therapy (if present), drugs used in combination or coincidental with the product; and like factors well known in the medical arts. For example, it is well known within the skill of the art to start doses of the compound at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. Accordingly, the doses administered of the agents described herein may depend on several of such parameters. In the case that a reaction in a patient is insufficient with an initial dose, higher doses (or effectively higher doses achieved by a different, more localized route of administration) may be used.
[0109] By "pharmaceutical" or “pharmaceutically acceptable”, it is meant that molecular entities and compositions do not produce an adverse, allergic or other untoward reaction when administered to a mammal, especially a human, as appropriate. A pharmaceutically acceptable carrier or excipient refers to a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type. In the pharmaceutical compositions of the present invention for oral, sublingual, subcutaneous, intramuscular, intravenous, transdermal, local, or rectal administration, the active principle, alone or in combination with another active principle, can be administered in a unit administration form, as a mixture with conventional pharmaceutical supports, to animals and human beings. The pharmaceutical compositions as herein described are preferably sterile and contain an effective amount of the therapeutically active substance to generate the desired reaction or the desired effect.
[0110] The pharmaceutical compositions as herein described are generally administered in pharmaceutically compatible amounts and in pharmaceutically compatible preparation. The term "pharmaceutically compatible" refers to a nontoxic material which does not interact with the action of the active component of the pharmaceutical composition. Preparations of this kind may usually contain salts, buffer substances, preservatives, carriers, supplementing immunity-enhancing substances such as adjuvants, e.g. CpG oligonucleotides, cytokines, chemokines, saponin, GM-CSF and / or RNA and, where appropriate, other therapeutically active compounds. When used in medicine, the salts should be pharmaceutically compatible.
[0111] Typically, the pharmaceutical compositions contain vehicles which are pharmaceutically acceptable for a formulation capable of being injected. These may be in particular isotonic, sterile, saline solutions (monosodium or disodium phosphate, sodium, potassium, calcium or magnesium chloride and the like or mixtures of such salts), or dry, especially freeze-dried compositions which upon addition, depending on the case, of sterilized water or physiological saline, permit the constitution of injectable solutions. The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations including sesame oil, peanut oil, or aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. Solutions comprising compounds of the invention as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. The product can be formulated into a composition in a neutral or salt form. Pharmaceutically acceptable salts include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like. The carrier can also be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetables oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminium monostearate and gelatin. Sterile injectable solutions are prepared by incorporating the active polypeptides in the required amount in the appropriate solvent with several of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuumdrying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations are easily administered in a variety of dosage forms, such as the type of injectable solutions described above, but drug release capsules and the like can also be employed. For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. In this connection, sterile aqueous media which can be employed will be known to those of skill in the art in light of the present disclosure. For example, one dosage could be dissolved in 1 ml of isotonic NaCI solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion. Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject.
[0112] As used herein, the term “cancer” has its general meaning in the art and refers to any cancer that may affect any one of the following tissues or organs: breast; liver; kidney; heart, mediastinum, pleura; floor of mouth; lip; salivary glands; tongue; gums; oral cavity; palate; tonsil; larynx; trachea; bronchus, lung; pharynx, hypopharynx, oropharynx, nasopharynx; esophagus; digestive organs such as stomach, intrahepatic bile ducts, biliary tract, pancreas, small intestine, colon; rectum; urinary organs such as bladder, gallbladder, ureter; rectosigmoid junction; anus, anal canal; skin; bone; joints, articular cartilage of limbs; eye and adnexa; brain; peripheral nerves, autonomic nervous system; spinal cord, cranial nerves, meninges; and various parts of the central nervous system; connective, subcutaneous and other soft tissues; retroperitoneum, peritoneum; adrenal gland; thyroid gland; endocrine glands and related structures; female genital organs such as ovary, uterus, cervix uteri; corpus uteri, vagina, vulva; male genital organs such as penis, testis and prostate gland; hematopoietic and reticuloendothelial systems; blood; lymph nodes; thymus.
[0113] The term “cancer” according to the invention comprises leukemias, seminomas, melanomas, teratomas, lymphomas, non-Hodgkin lymphoma, neuroblastomas, gliomas, adenocarninoma, mesothelioma (including pleural mesothelioma, peritoneal mesothelioma, pericardial mesothelioma and end stage mesothelioma), rectal cancer, endometrial cancer, thyroid cancer (including papillary thyroid carcinoma, follicular thyroid carcinoma, medullary thyroid carcinoma, undifferentiated thyroid cancer, multiple endocrine neoplasia type 2A, multiple endocrine neoplasia type 2B, familial medullary thyroid cancer, pheochromocytoma and paraganglioma), skin cancer (including malignant melanoma, basal cell carcinoma, squamous cell carcinoma, Karposi’s sarcoma, keratoacanthoma, moles, dysplastic nevi, lipoma, angioma and dermatofibroma), nervous system cancer, brain cancer (including astrocytoma, medulloblastoma, glioma, lower grade glioma, ependymoma, germinoma (pinealoma), glioblastoma multiform, oligodendroglioma, schwannoma, retinoblastoma, congenital tumors, spinal cord neurofibroma, glioma or sarcoma), skull cancer (including osteoma, hemangioma, granuloma, xanthoma or osteitis deformans), meninges cancer (including meningioma, meningiosarcoma or gliomatosis), head and neck cancer (including head and neck squamous cell carcinoma and oral cancer (such as, e.g., buccal cavity cancer, lip cancer, tongue cancer, mouth cancer or pharynx cancer)), lymph node cancer, gastrointestinal cancer, liver cancer (including hepatoma, hepatocellular carcinoma, cholangiocarcinoma, hepatoblastoma, angiosarcoma, hepatocellular adenoma and hemangioma), colon cancer, stomach or gastric cancer, esophageal cancer (including squamous cell carcinoma, larynx, adenocarcinoma, leiomyosarcoma or lymphoma), colorectal cancer, intestinal cancer, small bowel or small intestines cancer (such as, e.g., adenocarcinoma lymphoma, carcinoid tumors, Karposi’s sarcoma, leiomyoma, hemangioma, lipoma, neurofibroma or fibroma), large bowel or large intestines cancer (such as, e.g., adenocarcinoma, tubular adenoma, villous adenoma, hamartoma or leiomyoma), pancreatic cancer (including ductal adenocarcinoma, insulinoma, glucagonoma, gastrinoma, carcinoid tumors or vipoma), ear, nose and throat (ENT) cancer, breast cancer (including HER2-enriched breast cancer, luminal A breast cancer, luminal B breast cancer and triple negative breast cancer), cancer of the uterus (including endometrial cancer such as endometrial carcinomas, endometrial stromal sarcomas and malignant mixed Mullerian tumors, uterine sarcomas, leiomyosarcomas and gestational trophoblastic disease), ovarian cancer (including dysgerminoma, granulosa-theca cell tumors and Sertoli-Leydig cell tumors), cervical cancer, vaginal cancer (including squamous-cell vaginal carcinoma, vaginal adenocarcinoma, clear cell vaginal adenocarcinoma, vaginal germ cell tumors, vaginal sarcoma botryoides and vaginal melanoma), vulvar cancer (including squamous cell vulvar carcinoma, verrucous vulvar carcinoma, vulvar melanoma, basal cell vulvar carcinoma, Bartholin gland carcinoma, vulvar adenocarcinoma and erythroplasia of Queyrat), genitourinary tract cancer, kidney cancer (including clear renal cell carcinoma, chromophobe renal cell carcinoma, papillary renal cell carcinoma, adenocarcinoma, Wilm’s tumor, nephroblastoma, lymphoma or leukemia), adrenal cancer, bladder cancer, urethra cancer (such as, e.g., squamous cell carcinoma, transitional cell carcinoma or adenocarcinoma), prostate cancer (such as, e.g., adenocarcinoma or sarcoma) and testis cancer (such as, e.g., seminoma, teratoma, embryonal carcinoma, teratocarcinoma, choriocarcinoma, sarcoma, interstitial cell carcinoma, fibroma, fibroadenoma, adenomatoid tumors or lipoma), lung cancer (including small cell lung carcinoma (SCLC), non-small cell lung carcinoma (NSCLC) including squamous cell lung carcinoma, lung adenocarcinoma (LLIAD), and large cell lung carcinoma, bronchogenic carcinoma, alveolar carcinoma, bronchiolar carcinoma, bronchial adenoma, lung sarcoma, chondromatous hamartoma and pleural mesothelioma), sarcomas (including Askin's tumor, sarcoma botryoides, chondrosarcoma, Ewing's sarcoma, malignant hemangioendothelioma, malignant schwannoma, osteosarcoma and soft tissue sarcomas), soft tissue sarcomas (including alveolar soft part sarcoma, angiosarcoma, cystosarcoma phyllodes, dermatofibrosarcoma protuberans, desmoid tumor, desmoplastic small round cell tumor, epithelioid sarcoma, extraskeletal chondrosarcoma, extraskeletal osteosarcoma, fibrosarcoma, gastrointestinal stromal tumor (GIST), hemangiopericytoma, hemangiosarcoma, Kaposi's sarcoma, leiomyosarcoma, liposarcoma, lymphangiosarcoma, lymphosarcoma, malignant peripheral nerve sheath tumor (MPNST), neurofibrosarcoma, plexiform fibrohistiocytic tumor, rhabdomyosarcoma, synovial sarcoma and undifferentiated pleomorphic sarcoma, cardiac cancer (including sarcoma such as, e.g., angiosarcoma, fibrosarcoma, rhabdomyosarcoma or liposarcoma, myxoma, rhabdomyoma, fibroma, lipoma and teratoma), bone cancer (including osteogenic sarcoma, osteosarcoma, fibrosarcoma, malignant fibrous histiocytoma, chondrosarcoma, Ewing’s sarcoma, malignant lymphoma and reticulum cell sarcoma, multiple myeloma, malignant giant cell tumor chordoma, osteochronfroma, osteocartilaginous exostoses, benign chondroma, chondroblastoma, chondromyxoid fibroma, osteoid osteoma and giant cell tumors), hematologic and lymphoid cancer, blood cancer (including acute myeloid leukemia, chronic myeloid leukemia, acute lymphoblastic leukemia, chronic lymphocytic leukemia, myeloproliferative diseases, multiple myeloma and myelodysplasia syndrome), Hodgkin’s disease, non-Hodgkin’s lymphoma and hairy cell and lymphoid disorders, and the metastases thereof.
[0114] In some embodiments, the modulator of FAM118B and / or pharmaceutical composition according to the invention is used in combination with cancer therapies. In particular, compound and / or pharmaceutical composition of the invention may be administered in combination with targeted therapy, immunotherapy such as immune checkpoint therapy and immune checkpoint inhibitor, co-stimulatory antibodies, chemotherapy and / or radiotherapy.
[0115] As used herein, the term “immunotherapy” refers to a cancer therapeutic treatment using the immune system to reject cancer. The therapeutic treatment stimulates the patient's immune system to attack the malignant tumor cells.
[0116] Immune checkpoint therapy such as checkpoint inhibitors include, but are not limited to programmed death-1 (PD-1 ) inhibitors, programmed death ligand-1 (PD-L1 ) inhibitors, programmed death ligand-2 (PD-L2) inhibitors, lymphocyteactivation gene 3 (LAG3) inhibitors, T-cell immunoglobulin and mucin-domain containing protein 3 (TIM-3) inhibitors, T cell immunoreceptor with Ig and ITIM domains (TIGIT) inhibitors, B- and T-lymphocyte attenuator (BTLA) inhibitors, V- domain Ig suppressor of T-cell activation (VISTA) inhibitors, cytotoxic T- lymphocyte-associated protein 4 (CTLA4) inhibitors, Indoleamine 2,3- dioxygenase (IDO) inhibitors, killer immunoglobulin-like receptors (KIR) inhibitors, KIR2L3 inhibitors, KIR3DL2 inhibitors and carcinoembryonic antigen- related cell adhesion molecule 1 (CEACAM-1 ) inhibitors. In particular, checkpoint inhibitors include antibodies anti-PD1 , anti-PD-L1 , anti-CTLA-4, anti-TIM-3, anti- LAG3. Immune checkpoint therapy also includes co-stimulatory antibodies delivering positive signals through immune-regulatory receptors including but not limited to ICOS, CD137, CD27, OX-40 and GITR.
[0117] Example of anti-PD1 antibodies include, but are not limited to, nivolumab, cemiplimab (REGN2810 or REGN-2810), tislelizumab (BGB-A317), tislelizumab, spartalizumab (PDR001 or PDR-001), ABBV-181 , JNJ-63723283, Bl 754091 , MAG012, TSR-042, AGEN2034, pidilizumab, nivolumab (ONO-4538, BMS- 936558, MDX1106, GTPL7335 or Opdivo), pembrolizumab (MK-3475, MK03475, lambrolizumab, SCH-900475 or Keytruda) and antibodies described in International patent applications W02004004771 , W02004056875, W02006121 168, W02008156712, W02009014708, W020091 14335, WO201 3043569 and WO2014047350. Example of anti-PD-L1 antibodies include, but are not limited to, LY3300054, atezolizumab, durvalumab and avelumab. Example of anti-CTLA-4 antibodies include, but are not limited to, ipilimumab (see, e.g., US patents US6,984,720 and US8, 017,114), tremelimumab (see, e.g., US patents US7,109,003 and US8,143,379), single chain anti-CTLA4 antibodies (see, e.g., International patent applications WO1 997020574 and W02007123737) and antibodies described in US patent US8,491 ,895. Example of anti-VISTA antibodies are described in US patent application US20130177557. Example of inhibitors of the LAG3 receptor are described in US patent US5,773,578. Example of KIR inhibitor is IPH4102 targeting KIR3DL2.
[0118] In some embodiments, the compound and / or pharmaceutical composition of the invention may be used in combination with targeted therapy. As used herein, the term “targeted therapy” refers to targeted therapy agents, drugs designed to interfere with specific molecules necessary for tumor growth and progression. For example, targeted therapy agents such as therapeutic monoclonal antibodies target specific antigens found on the cell surface, such as transmembrane receptors or extracellular growth factors. Small molecules can penetrate the cell membrane to interact with targets inside a cell. Small molecules are usually designed to interfere with the enzymatic activity of the target protein such as for example proteasome inhibitor, tyrosine kinase or cyclin-dependent kinase inhibitor, histone deacetylase inhibitor. Targeted therapy may also use cytokines. Examples of such targeted therapy include with no limitations: Ado-trastuzumab emtansine (HER2), Afatinib (EGFR (HER1 / ERBB1 ), HER2), Aldesleukin (Proleukin), alectinib (ALK), Alemtuzumab (CD52), axitinib (kit, PDGFRbeta, VEGFR1 / 2 / 3), Belimumab (BAFF), Belinostat (HDAC), Bevacizumab (VEGF ligand), Blinatumomab (CD19 / CD3), bortezomib (proteasome), Brentuximab vedotin (CD30), bosutinib (ABL), brigatinib (ALK), cabozantinib (FLT3, KIT, MET, RET, VEGFR2), Canakinumab (IL-1 beta), carfilzomib (proteasome), ceritinib (ALK), Cetuximab (EGFR), cofimetinib (MEK), Crizotinib (ALK, MET, ROS1 ), Dabrafenib (BRAF), Daratumumab (CD38), Dasatinib (ABL), Denosumab (RANKL), Dinutuximab (B4GALNT1 (GD2)), Elotuzumab (SLAMF7), Enasidenib (IDH2), Erlotinib (EGFR), Everolimus (mTOR), Gefitinib (EGFR), Ibritumomab tiuxetan (CD20), Sonidegib (Smoothened), Sipuleucel-T, Siltuximab (IL-6), Sorafenib (VEGFR, PDGFR, KIT, RAF),(Tocilizumab (IL-6R), Temsirolimus (mTOR), Tofacitinib (JAK3), Trametinib (MEK), Tositumomab (CD20), Trastuzumab (HER2), Vandetanib (EGFR), Vemurafenib (BRAF), Venetoclax (BCL2), Vismodegib (PTCH, Smoothened), Vorinostat (HDAC), Ziv-aflibercept (PIGF, VEGFA / B), Olaparib (PARP inhibitor).
[0119] In some embodiments, the compound and / or pharmaceutical composition of the invention may be used in combination with chemotherapy. As used herein, the term “antitumor chemotherapy” or “chemotherapy” has its general meaning in the art and refers to a cancer therapeutic treatment using chemical or biochemical substances, in particular using one or several antineoplastic agents or chemotherapeutic agents. Chemotherapeutic agents include, but are not limited to alkylating agents such as thiotepa and cyclosphosphamide; alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, trietylenephosphoramide, triethiylenethiophosphoramide and trimethylolomelamine; acetogenins (especially bullatacin and bullatacinone); a camptothecin (including the synthetic analogue topotecan); bryostatin; callystatin; CC-1065 (including its adozelesin, carzelesin and bizelesin synthetic analogues); cryptophycins (particularly cryptophycin 1 and cryptophycin 8); dolastatin; duocarmycin (including the synthetic analogues, KW-2189 and CB1 -TM1 ); eleutherobin; pancratistatin; a sarcodictyin; spongistatin; nitrogen mustards such as chlorambucil, chlornaphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil mustard; nitrosureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimnustine; antibiotics such as the enediyne antibiotics (e.g. , calicheamicin, especially calicheamicin gammall and calicheamicin omegall ; dynemicin, including dynemicin A; bisphosphonates, such as clodronate; an esperamicin; as well as neocarzinostatin chromophore and related chromoprotein enediyne antiobiotic chromophores, aclacinomysins, actinomycin, authrarnycin, azaserine, bleomycins, cactinomycin, carabicin, caminomycin, carzinophilin, chromomycinis, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L- norleucine, doxorubicin (including morpholino-doxorubicin, cyanomorpholinodoxorubicin, 2-pyrrolino-doxorubicin and deoxy doxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins such as mitomycin C, mycophenolic acid, nogalamycin, olivomycins, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; anti-metabolites such as methotrexate and 5- fluorouracil (5-Fll); folic acid analogues such as denopterin, methotrexate, pteropterin, trimetrexate; purine analogs such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6- azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine; androgens such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, testolactone; anti-adrenals such as aminoglutethimide, mitotane, trilostane; folic acid replenisher such as frolinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid; eniluracil; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elformithine; elliptinium acetate; an epothilone; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidainine; maytansinoids such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidanmol; nitraerine; pentostatin; phenamet; pirarubicin; losoxantrone; podophyllinic acid; 2- ethylhydrazide; methylhydrazine derivatives including N-methylhydrazine (MIH) and procarbazine; PSK polysaccharide complex); razoxane; rhizoxin; sizofuran; spirogermanium; tenuazonic acid; triaziquone; 2,2',2"-trichlorotriethylamine; trichothecenes (especially T-2 toxin, verracurin A, roridin A and anguidine); urethan; vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine; arabinoside ("Ara-C"); cyclophosphamide; thiotepa; taxoids, e.g., paclitaxel and doxetaxel; gemcitabine; 6-thioguanine; mercaptopurine; platinum coordination complexes such as cisplatin, oxaliplatin and carboplatin; vinblastine; platinum; etoposide (VP- 16); ifosfamide; mitoxantrone; vincristine; vinorelbine; novantrone; teniposide; edatrexate; daunomycin; aminopterin; xeloda; ibandronate; irinotecan (e.g., CPT-1 1 ); topoisomerase inhibitor RFS 2000; difluoromethylomithine (DMFO); retinoids such as retinoic acid; capecitabine; anthracyclines, nitrosoureas, antimetabolites, epipodophylotoxins, enzymes such as L-asparaginase; anthracenediones; hormones and antagonists including adrenocorticosteroid antagonists such as prednisone and equivalents, dexamethasone and aminoglutethimide; progestin such as hydroxyprogesterone caproate, medroxyprogesterone acetate and megestrol acetate; estrogen such as diethylstilbestrol and ethinyl estradiol equivalents; antiestrogen such as tamoxifen; androgens including testosterone propionate and fluoxymesterone / equivalents; antiandrogens such as flutamide, gonadotropin-releasing hormone analogs and leuprolide; and non-steroidal antiandrogens such as flutamide; and pharmaceutically acceptable salts, acids or derivatives of any of the above.
[0120] In some embodiments, the compound and / or pharmaceutical composition of the invention is administered to the subject in combination with radiotherapy. Suitable examples of radiation therapies include, but are not limited to external beam radiotherapy (such as superficial X-rays therapy, orthovoltage X-rays therapy, megavoltage X-rays therapy, radiosurgery, stereotactic radiation therapy, Fractionated stereotactic radiation therapy, cobalt therapy, electron therapy, fast neutron therapy, neutron-capture therapy, proton therapy, intensity modulated radiation therapy (IMRT), 3-dimensional conformal radiation therapy (3D-CRT) and the like); brachytherapy; unsealed source radiotherapy; tomotherapy; and the like. Gamma rays are another form of photons used in radiotherapy. Gamma rays are produced spontaneously as certain elements (such as radium, uranium, and cobalt 60) release radiation as they decompose, or decay. In some embodiments, radiotherapy may be proton radiotherapy or proton minibeam radiation therapy. Proton radiotherapy is an ultra-precise form of radiotherapy that uses proton beams (Prezado Y, Jouvion G, Guardiola C, Gonzalez W, Juchaux M, Bergs J, Nauraye C, Labiod D, De Marzi L, Pouzoulet F, Patriarca A, Dendale R. Tumor Control in RG2 Glioma-Bearing Rats: A Comparison Between Proton Minibeam Therapy and Standard Proton Therapy. Int J Radiat Oncol Biol Phys. 2019 Jun 1 ;104(2):266-271. doi: 10.1016 / j. ijrobp.2019.01.080; Prezado Y, Jouvion G, Patriarca A, Nauraye C, Guardiola C, Juchaux M, Lamirault C, Labiod D, Jourdain L, Sebrie C, Dendale R, Gonzalez W, Pouzoulet F. Proton minibeam radiation therapy widens the therapeutic index for high-grade gliomas. Sci Rep. 2018 Nov 7;8(1 ): 16479. doi: 10.1038 / s41598-018-34796-8). Radiotherapy may also be FLASH radiotherapy (FLASH-RT) or FLASH proton irradiation. FLASH radiotherapy involves the ultra-fast delivery of radiation treatment at dose rates several orders of magnitude greater than those currently in routine clinical practice (ultra-high dose rate) (Favaudon V, Fouillade C, Vozenin MC. The radiotherapy FLASH to save healthy tissues. Med Sci (Paris) 2015; 31 : 121 -123. DOI: 10.1051 / medsci / 20153102002); Patriarca A., Fouillade C. M., Martin F., Pouzoulet F., Nauraye C., et al. Experimental set-up for FLASH proton irradiation of small animals using a clinical system. Int J Radiat Oncol Biol Phys, 102 (2018), pp. 619-626. doi: 10.1016 / j. ijrobp.2018.06.403. Epub 2018 Jul 11 ).
[0121] In a particular embodiment, the modulator of FAM118B is a nucleic acid molecule encoding FAM118B or a functional fragment thereof, in particular a cDNA or a mRNA encoding FAM118B or a functional fragment thereof, in particular a human FAM118B, either wild-type or a human FAM118B carrying one or several modifications disclosed above, or a FAM118B from other species than human (for example: blue whale, horseshoe bat, koala) as well as FAM118B from other species carrying one or several modifications as described above.
[0122] The cDNA or mRNA encoding FAM118B, or a functional fragment thereof may be inserted within an expression vector; like a plasmid, and associated enhancers allowing production of FAM118B protein in cells, in particular in immune cells.
[0123] A functionally equivalent fragment of FAM118B as used herein may mean any fragment or assembly of fragments of FAM118B. Accordingly, the present invention provides a polypeptide capable of providing a function associated with FAM118B, in particular the activity provided by the SIR2-like domain of FAM118B, which polypeptide comprises consecutive amino acids having a sequence which is the sequence of at least a portion of FAM118B, which in a preferred embodiment is a portion that comprises at least the SIR2-like domain of FAM118B. In a particular embodiment of the invention, the functional fragment of FAM118B is a polypeptide that comprises at least 20, in particular at least 25, in particular at least 30, in particular at least 40, in particular at least 50 amino acid residues, in particular at least 80 amino acid residues, in particular at least 100 amino acid residues, in particular at least 200, in particular at least 300, contiguous amino acid residues within sequence SEQ ID No. 1. Alternatively, the functional fragment of FAM118B is a peptide or a polypeptide that at least 20, in particular at least 25, in particular at least 30, in particular at least 40, in particular at least 50 amino acid residues, in particular at least 80 amino acid residues, in particular at least 100 amino acid residues, in particular at least 200, in particular at least 300, contiguous amino acid residues within sequence SEQ ID No. 1 and has at least 70% identity, in particular at least 80% identity, more particularly at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% and even more particularly at least 99% of identity, or share 100% identity, with FAM118B of SEQ ID No. 1.
[0124] The percentages of identity to which reference is made in the presentation of the present invention are determined on the basis of a global alignment of sequences to be compared, that is to say, on an alignment of sequences over their entire length, using for example the algorithm of Needleman and Wunsch 1970. This sequence comparison can be done for example using the needle software by using the parameter "Gap open" equal to 10.0, the parameter "Gap Extend" equal to 0.5, and a matrix "BLOSUM 62". Software such as needle is available on the website ebi.ac.uk worldwide, under the name "needle".
[0125] In a particular embodiment, the modulator of FAM118B is a functional equivalent of wild-type FAM118B, in particular of FAM118B of amino acid sequence set forth in SEQ ID No. 1.
[0126] As used herein, a “functional equivalent” of FAM118B is a compound which is capable of providing a function associated with FAM118B, in particular the activity provided by the SIR2-like domain of FAM118B; thereby allowing degradation of NAD. The term “functional equivalent” includes fragments, mutants, and muteins of FAM118B. The term “functionally equivalent” thus includes any equivalent of FAM1 18B obtained by altering the amino acid sequence, for example by one or more amino acid deletions, substitutions, or additions such that the protein analogue retains the ability of wild-type FAM118B. Amino acid substitutions may be made, for example, by point mutation of the DNA encoding the amino acid sequence.
[0127] Functional equivalents of FAM118B include but are not limited to molecules that bind to at least one ligand of FAM118B and comprise all or a portion of FAM118B so as to form a molecule that is capable have a SIR2-like domain activity. In particular, the functional equivalent of FAM118B has a SIR2-like domain. Particularly, the functional equivalent consists of an amino acid sequence having at least 70%, in particular at least 80% identity, more particularly at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% and even more particularly at least 99% of identity with the corresponding FAM118B protein over the entire length of the corresponding protein. As used herein, the term “corresponding protein” refers to the protein for which the functional equivalent of the invention has similar function. The percentages of identity to which reference is made in the presentation of the present invention are determined on the basis of a global alignment of sequences to be compared, that is to say, on an alignment of sequences over their entire length, using for example the algorithm of Needleman and Wunsch 1970. This sequence comparison can be done for example using the needle software by using the parameter "Gap open" equal to 10.0, the parameter "Gap Extend" equal to 0.5, and a matrix "BLOSUM 62". Software such as needle is available on the website ebi.ac.uk worldwide, under the name "needle".
[0128] In a particular embodiment, the SIR2-like domain of the FAM118B protein, or functional equivalent thereof, may be mutated to be constitutively activated. To this end, the inhibitory loop located at residues 48-64 within the FAM118B having the amino acid sequence set forth in SEQ ID No. 1 may be mutated by point mutating residues interacting with the active site, in particular residue 48, or residue 52, or residues 48 and 52, wherein the wild type amino acid residues at this localization can be substituted for an Alanine for example) as well as replace at least a part of the loop localized between amino acid residues 48-64 by a glycine-serine flexible linker, as illustrated for the protein of SEQ ID No. 6 wherein the amino acid residues GGGGSG (SEQ ID No. 9) are present on amino acid residues 59 to 64, so that the SIR2-like domain is constitutively activated and constitutively degrades NAD. Thus, the FAM118B protein with a constitutively activated SIR2-like domain can have the amino acid sequence set forth in SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, or SEQ ID NO. 6.
[0129] In a particular embodiment, the modulator of FAM118B is a Chimeric antigen receptor (CAR) comprising within its cytoplasmic domain a functional domain of FAM1 18B, in particular the S I R2-I ike domain of FAM118B.
[0130] The terms "Chimeric antigen receptor" or "CAR" or "CARs" as used herein refer to engineered receptors, which graft an antigen specificity onto cells (for example T cells such as naive T cells, central memory T cells, effector memory T cells or combination thereof as well as myeloid cells, including monocytes and macrophages) thus combining the antigen binding properties of the antigen binding domain with the lytic capacity and self-renewal of T cells or the inflammatory and phagocytic potential of myeloid cells. CARs are also known as artificial T cell receptors, chimeric T cell receptors or chimeric immunoreceptors, chimeric myeloid cell receptor. The term "antigen binding domain or "antigenspecific targeting domain" as used herein refers to the region of the CAR which targets and binds to specific antigens. When a CAR is expressed in a host cell, this domain forms the extracellular domain (ectodomain).
[0131] The CAR of the present disclosure comprises a molecule of the general formula: Extracellular domain - transmembrane domain - intracellular signaling domain comprising a functional domain of FAM118B, in particular the SIR2-like domain of FAM118B.
[0132] Typically, a CAR as herein described preferably comprises within its extracellular domain one or more, notably at least two antigen binding domains (each comprising a single domain antibody), which target one or more antigen.
[0133] The present disclosure also encompasses an isolated nucleic acid comprising a nucleic acid sequence encoding the FAM118B or a CAR as herein described which is advantageously linked to a heterologous regulatory control sequence.
[0134] The CAR of the invention may comprise within its intracellular signaling domain the full sequence of FAM118B, or a fragment thereof that possesses the SIR2- like domain of FAM118B. The intracellular signaling domain of a CAR thus typically comprises at least a fragment of FAM118B that is able to degrade NAD. The intracellular domain may further comprise other domains like but not limited to the chain of the T-cell receptor complex or any of its homologs (e.g., q chain, FcsRIy and [3 chains, MB 1 (Iga) chain, B29 (Ig ) chain, etc.), human CD3zeta chain, CD3 polypeptides (A, 5 and E), syk family tyrosine kinases (Syk, ZAP 70, etc.), src family tyrosine kinases (Lek, Fyn, Lyn, etc.) and intracellular domains from other molecules involved in T-cell transduction, such as CD2, CD5, 0X40, CD28, DAP 10 and DAP12 or intracellular domains of inflammatory proteins for CAR-M such as CD40, TIR or PYRIN. Other intracellular signaling domains may be used in connection with alternate embodiments of the present disclosure. In some embodiments, the intracellular domain in notably selected from the intracellular domain of DAP10, DAP12, CD28, 4-1 BB or the human CD3zeta chain.
[0135] In some embodiments, a CAR of the present disclosure further comprises a hinge or spacer region which connects the extracellular antigen binding domain and the transmembrane domain. This hinge or spacer region can be used to achieve different lengths and flexibility of the resulting CAR. Examples of a hinge or spacer region that can be used according to the present disclosure include, but are not limited to, Fc fragments of antibodies or fragments or derivatives thereof, hinge regions of antibodies, or fragments or derivatives thereof, CH2 regions of antibodies, CH3 regions of antibodies, artificial spacer sequences, for example peptide sequences, or combinations thereof. Other hinge or spacer region will be apparent to those of skill in the art and may be used in connection with alternate embodiments of the present disclosure. In one embodiment, the hinge is an lgG4 hinge or a CD8A hinge.
[0136] In some embodiments, a CAR of the present disclosure further comprises a "linker domain" or "linker region" that connects different domains of the CAR. This domain includes an oligo- or polypeptide region from about 1 to 100 amino acids in length. Suitable linkers will be apparent to those of skill in the art and may be used in connection with alternate embodiments of the present disclosure.
[0137] In some embodiments, a CAR of the present disclosure further comprises a "leader sequence". In one embodiment, the leader sequence is a CD8A domain. A CAR of the present disclosure may further include a label or a tag. For example, a label that facilitates imaging, such as a fluorescent label or other tag (such as myc). This can, for example be used in methods for imaging tumor binding. The label may be conjugated to the antigen binding domain.
[0138] The CARs described herein may be synthesized as single polypeptide chains. In this embodiment, the antigen-specific targeting regions are at the N- terminus, arranged in tandem and are separated by a linker peptide.
[0139] Example of CAR designs are notably provided in Jaspers JE, Brentjens RJ. “Development of CAR T cells designed to improve antitumor efficacy and safety” (Pharmacol Then 2017;178:83-91 ). Well-suited CAR designs according to the present disclosure notably include those described by Ying, Z. et al. (A safe and potent anti-CD19 CAR T cell therapy. Nat. Med. 25, 947-953 (2019)) and by June, C. H., O’Connor, R. S., Kawalekar, 0. U., Ghassemi, S. & Milone, M. C. (CAR T cell immunotherapy for human cancer. Science (80-. ). 359, 1361-1365 (2018)). Examples of CAR designs may be found online for example on https: / / elifesciences.org / articles / 36688 and https: / / www.nature.com / articles / s41590-023-01687-8.
[0140] In an embodiment, the modulator of is a blocker or an antagonist of FAM118B, or decreases, in particular inhibits, the expression of FAM118B, or decreases, in particular inhibits, a biological process involving FAM118B.
[0141] Providing such a modulator leads to the reduction or the inhibition of FAM118B activity. In the context of the present invention, inhibiting or blocking FAM118B refers to blocking or inhibiting the biological activity or function of FAM118B, in particular within a cell or organism. This blocking or inhibition can occur through various mechanisms, including but not limited to:
[0142] - Binding of an antagonist to FAM118B, leading to conformational changes, in particular leading to a conformation that does not allow oligomerization of FAM 118B,
[0143] - Allosteric regulation by small molecules or cofactors that reduce FAM118B’s enzymatic activity, in particular molecules or cofactors that reduce SIR2-like activity, or its binding affinity, in particular through its SIR2-like domain, - FAM118B-blocker (or antagonist) interactions that reduce, in particular inhibit, FAM118’s function, in particular within a complex molecular network,
[0144] - reduction of gene expression, in particular reduction of mRNA production that encodes FAM 118, or reduction of protein synthesis to decrease the production of active FAM118B, and / or reduction of FAM118B concentration, in particular in cytosol.
[0145] - Binding or conformational changes that affect the CARD-like domain, including its ability to interact in homotypic and heterotypic interaction.
[0146] - Destabilization of FAM118B protein, in particular increase degradation of FAM118B.
[0147] - Modification of post-translational modifications that regulate FAM118B activity.
[0148] An antagonist or a blocker of FAM118B can bind to FAM118B and, as a consequence, inactive, reduce or inhibit the activity of FAM118B. FAM118B can be considered to be inactive when it is not able to exert or fully exert its NADase activity. NADase activity can be measured as disclosed above. Thus, in presence of a blocker or an antagonist of FAM118B, NADase activity of FAM118B is reduced in cells, as compared to the NADase activity of FAM118B observed in cells that are not in presence of the blocker or an antagonist of FAM118B. The activity of FAM118 can be considered inactivated, reduced, or inhibited when degradation of NAD and / or production of degradation products of NAD, including FAM118B second messenger activating TRPM2, is reduced or inhibited in cells in contact with the antagonist or blocker of FAM118B, as compared to the same cells, in the same condition, but not in contact with a blocker or an antagonist of FAM118B. Degradation of NAD and / or production of degradation products of NAD, including FAM118B second messenger activating TRPM2, can be measured according to the method disclosed above.
[0149] The activity of FAM118B may be determined by measuring the concentration of NAD, either in vitro or in vivo. As an example, the concentration of NAD may be measured by HPLC or mass spectrometry. An increase in the concentration of NAD means that the activity of FAM118B is reduced or inhibited. A decrease in the concentration of NAD, or a stagnation of the concentration of NAD, means that the activity of FAM118B is either increased or unaffected. Thus, an antagonist or a blocker of FAM118 leads to an increase of the concentration of NAD in cells in contact with the antagonist or blocker, as compared to the same cells, in the same condition, but not in contact with the antagonist or blocker.
[0150] The activity of FAM118B may be determined by measuring the concentration of degradation products of NAD, including the FAM118B second messenger activating TRPM2, either in vitro or in vivo. As an example, the concentration of degradation products of NAD may be measured by HPLC or mass spectrometry. An increase in the concentration of degradation products of NAD means that the activity of FAM118B is reduced or inhibited. A decrease in the concentration of degradation products of NAD, or a stagnation of the concentration of degradation products of NAD, means that the activity of FAM118B is either increased or unaffected. Thus, an antagonist or a blocker of FAM118 leads to an increase of the concentration of degradation products of NAD in cells in contact with the antagonist or blocker, as compared to the same cells, in the same condition, but not in contact with the antagonist or blocker.
[0151] The activity of FAM118B may be determined by measuring the activation of TRPM2, either in vitro or in vivo. As an example, the activation of TRPM2 may be measured by the downstream activation of NF-kB (for example measured using reporter proteins under an NF-kB-driven promoter) as well as measurement of mRNA and proteins under the control of TRPM2 activation (such as the pro- inflammatory cytokine IL-6) and chemical products resulting of the activity of proteins under de control of TRPM2-driven inflammation (such as nitric oxide). A decrease in the activation of TRPM2 means that the activity of FAM118B is decreased. An increase in the activation of TRPM2 means that the activity of FAM118B is increased. Thus, an antagonist or a blocker of FAM118 leads to a decrease in the activation of TRPM2 in cells in contact with the antagonist or blocker, as compared to the same cells, in the same condition, but not in contact with the antagonist or blocker.
[0152] The expression of FAM118B can be decreased by administering to cells DNA or RNA that interfere with the expression of FAM118B, , in particular Small interfering RNA (siRNA) that reduces the transcription of mRNA encoding FAM118B into FAM118B protein. When the modulator of FAM118B is a blocker or an antagonist of FAM118B, or decreases the expression of FAM118B, or decreases a biological process involving FAM118B, in particular the degradation of NAD by the SIR2-like domain of FAM118B, it may reduce, block, or inhibit an inflammatory response.
[0153] In the context of the present invention, reduction of the inflammation refers to the process of mitigating the inflammatory response within a biological system. This process involves interventions aimed at suppressing excessive or dysregulated immune responses, modulating inflammatory signaling pathways, and restoring tissue homeostasis to alleviate inflammation-related symptoms and tissue damage. In a particular embodiment, the reduction of the inflammation can be considered to be reached when the production or activity of pro-inflammatory cytokines (like ILs, in particular IL-6, TNF-alpha, interferons), chemokines, and other mediators involved in the inflammatory cascade, by immune cells, in particular myeloid cells, in particular dendritic cells or macrophages, is reduced, thereby attenuating the inflammatory response, as compared to the same cells in a condition of typical inflammation process.
[0154] Inhibiting inflammation refers to the process of suppressing the inflammatory response within a biological system. In a particular embodiment, the inhibition of the inflammation can be considered to be reached when the production or activity of pro-inflammatory cytokines (like ILs, in particular IL-6, TNF-alpha, interferons), chemokines, and other mediators involved in the inflammatory cascade, by immune cells, in particular myeloid cells, in particular dendritic cells or macrophages, is inhibited, thereby attenuating the inflammatory response, as compared to the same cells in a condition of typical inflammation process.
[0155] Blockade of the inflammation refers to the process of blocking or preventing the activation and progression of the inflammatory response within a biological system. In a particular embodiment, the blockade of the inflammation can be considered to be reached when the production or activity of pro-inflammatory cytokines (like ILs, in particular IL-6, TNF-alpha, interferons), chemokines, and other mediators involved in the inflammatory cascade, by immune cells, in particular myeloid cells, in particular dendritic cells or macrophages, is inhibited, thereby attenuating the inflammatory response, as compared to the same cells in a condition of typical inflammation process. In an embodiment of the invention, the modulator of FAM118B is provided for reducing, blocking, or inhibiting the inflammatory response in a patient suffering from an autoimmune disease or an inflammatory disease, or a pathogen-induced inflammatory disease (sepsis, acute respiratory distress syndrome) or pathologies that have been linked to inflammation such as neurodegeneration (including early-onset dementia, Parkinson’s disease, and Alzheimer’s disease). In a particular embodiment, the modulator of FAM118B is provided for reducing, blocking, or inhibiting the inflammatory response in a patient suffering from an autoimmune disease selected from the list consisting of inflammatory bowel disease, Crohn disease, and systematic lupus erythematous, or for reducing, blocking or inhibiting the inflammatory response in a patient suffering from an inflammatory disease selected from the list consisting of interferonopathies, sepsis and acute respiratory distress syndrome, pathologies of neurodegeneration, in particular Parkinson’s disease and Alzheimer's disease . In a particular embodiment, it is provided a cell, in particular an immune cell, more particularly a monocyte, macrophage, dendritic cell, a B cell, or a T cell, that overexpresses FAM118B, or expresses a FAM118B that has its SIR2-like domain constitutively activated, or that comprises a Chimeric Antigen Receptor (CAR) comprising within its cytoplasmic domain at least a functional domain of FAM1 18B, in particular at least a S I RP2-like domain of FAM118B.
[0156] Overexpression of FAM1 18B and expression of FAM118B hat has its SIR2-like domain constitutively activated, can be achieved by administering to a cell a nucleic acid molecule encoding FAM118B, in particular FAM118B of SEQ ID No. 1 , or encoding a FAM118B with a mutated SIR2-like domain as compared to wildtype protein, in particular with the SIR2-like domain present within FAM118B of SEQ ID No. 3 or SEQ ID No. 4 or SEQ ID No. 5 or SEQ ID No. 6.
[0157] Thus, the present disclosure also provides isolated nucleic acids encoding a FAM118B or encoding a FAM118B that has its SIR2-like domain constitutively activated, as previously described and nucleic acid constructs comprising thereof. A nucleic acid according to the present disclosure may be obtained by well-known methods of recombinant DNA technology and / or of chemical DNA synthesis. Also, within the scope of the present disclosure, are sequences with at least 60%, 70%, 80% or 90% sequence identity thereto. The term "nucleic acid," "polynucleotide," or "nucleic acid molecule" refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), or a combination of a DNA or RNA. RNA includes in vitro transcribed RNA or synthetic RNA; an mRNA sequence encoding a CAR polypeptide as described herein). The nucleic acid may further comprise a suicide gene. The construct may be in the form of a plasmid, vector, transcription, or expression cassette.
[0158] In an embodiment, the , nucleic acid molecule(s), for example mRNA encoding a FAM1 18 as disclosed herein, can be delivered to a cell through a lipidic vesicle, for example lipid nanoparticles.
[0159] The present disclosure thus also provides a recombinant expression cassette comprising a nucleic acid according to the present disclosure under the control of a transcriptional promoter allowing the regulation of the transcription of said nucleic acid in a host cell. Said nucleic acid can also be linked to appropriate control sequences allowing the regulation of its translation in a host cell.
[0160] The present disclosure also provides a recombinant vector (e.g., a recombinant expression vector) comprising a nucleic acid according to the present disclosure. Advantageously, said recombinant vector is a recombinant expression vector comprising an expression cassette according to the present disclosure.
[0161] The term "vector," as used herein, refers to a nucleic acid molecule capable of propagating another nucleic acid to which it is linked. The term includes the vector as a self-replicating nucleic acid structure as well as the vector incorporated into the genome of a host cell into which it has been introduced. Certain vectors are capable of directing the expression of nucleic acids to which they are operatively linked. Such vectors are referred to herein as "expression vectors".
[0162] A vector according to the present disclosure is preferably a vector suitable for stable gene transfer and long-term gene expression into mammalian cells, such as by replication of the sequence of interest, expression of this sequence, maintaining of this sequence in extrachromosomal form, or else integration into the chromosomal material of the host. The recombinant vectors are constructed using standard recombinant DNA technology techniques and produced using conventional methods that are known in the art.
[0163] In some embodiments, a vector of the present disclosure is an integrating vector, such as an integrating viral vector, such as in particular a retrovirus or AAV vector. Preferably, the viral vector is a lentiviral vector, most preferably an integrating viral vector.
[0164] According to the present disclosure, the vector can be an expression vector. The vector can be a plasmid vector.
[0165] The present disclosure also provides a host cell containing a nucleic acid construct as herein disclosed, notably a recombinant expression cassette or a recombinant vector according to the present disclosure. The host cell is either a prokaryotic or eukaryotic host cell. The terms "host cell" refers to a cell into which exogenous nucleic acid has been introduced, including the progeny of such cells. Host cells include "transformants" and "transformed cells", which include the primary transformed cell and progeny derived therefrom without regard to the number of passages. Progeny may not be completely identical in nucleic acid content to a parent cell but may contain mutations. Mutant progeny that has the same function or biological activity as screened or selected for in the originally transformed cell are included herein.
[0166] The present disclosure also provides a method for producing in a host cell as defined above a polypeptide, consisting of or comprising a single domain antibody or a CAR as previously defined, comprising the steps of: providing a host cell containing a nucleic acid construct, a recombinant expression cassette or a recombinant vector according to the present disclosure, culturing said host cell, and optionally purifying the single domain antibody or CAR of the present disclosure.
[0167] Methods for purifying polypeptides are well known in the art, such as chromatography (e.g., ion exchange chromatography, gel permeation chromatography and reversed phase chromatography).
[0168] The present disclosure also encompasses compositions comprising a nucleic acid construct as herein disclosed.
[0169] The present disclosure also provides isolated nucleic acids encoding any modulator as disclosed herein. A nucleic acid according to the present disclosure may be obtained by well-known methods of recombinant DNA technology and / or of chemical DNA synthesis. The present disclosure also provides isolated cells, populations of cells, cell lines, or cell cultures, comprising a nucleic acid construct as previously described, notably vectors and more particularly a viral vector particle encoding at least one or more CAR as previously described.
[0170] In one embodiment, the cell contains the vector and / or viral vector particle integrated into the cellular genome. In one embodiment, the cell contains the vector stably expressing the CAR. In one embodiment, the cell produces lentiviral vector particles encoding the CARs.
[0171] The cells are preferably mammalian cells, particularly human cells. Particularly preferred are human non-dividing cells. Preferably, the cells are immune cells, As used herein, the term “immune cells” includes cells that are of hematopoietic origin and that play a role in the immune response. Immune cells include lymphocytes, such as B cells and T cells, natural killer cells (NK cells), myeloid cells, such as monocytes, macrophages, eosinophils, mast cells, basophils, and granulocytes.
[0172] As used herein, the term “T cell” includes cells bearing a T cell receptor (TCR), T-cells according to the present disclosure can be selected from the group consisting of inflammatory T-lymphocytes, cytotoxic T-lymphocytes, regulatory T- lymphocytes, Mucosal-Associated Invariant T cells (MAIT), Yb T cell, tumour infiltrating lymphocyte (TILs) or helper T- lymphocytes included both type 1 and 2 helper T cells and Th17 helper cells. In another embodiment, said cell can be derived from the group consisting of CD4+ T- lymphocytes and CD8+ T- lymphocytes.
[0173] Said immune cells may originate from a healthy donor or from a subject suffering from a cancer.
[0174] The present invention also relates to a method for reducing or inhibiting inflammation, in particular acute or chronic inflammation, in particular in a human suffering from an auto-immune disease or an inflammatory disease, in particular interferonopathies, sepsis and acute respiratory distress syndrome, pathologies of neurodegeneration, in particular Parkinson’s disease and Alzheimer's disease, inflammatory bowel disease, Crohn disease, and systematic lupus erythematous, the method comprising the administration of a therapeutically or prophylactically effective amount of an antagonist or a blocker of FAM1 18B to a human in need thereof, thereby reducing or inhibiting inflammation.
[0175] The present invention also relates to a method for inducing or sustaining inflammation, in particular in a human suffering from cancer, or from an infection, more particularly from a bacterial infection or a viral infection, the method comprising the administration of a therapeutically or prophylactically effective amount of an agonist or an activator of FAM118B to a human in need thereof, thereby inducing or sustaining inflammation. In particular, when the patient is suffering from cancer, the agonist or activator of FAM118B may be administered within the microenvironment of the tumor.
[0176] The present invention also relates to a method for identifying a compound that is able to modulate the activity provided by FAM118B, in particular the SIR2-like activity provided by FAM118B. The compound to be identified may be any modulator as defined here in. To this end, the method comprises the following steps:
[0177] - providing a candidate for assessing its capability to modulate FAM118B activity,
[0178] - measuring in presence of the candidate the degradation of NAD in cells, in particular in immune cells,
[0179] - when the degradation of NAD is increased as compared to a negative control (for example, the same cells, in the same condition, but not in contact with the candidate), classifying the candidate as a compound that increases FAM118B activity,
[0180] - when the degradation of NAD is decreased as compared to a negative control (for example, the same cells, in the same condition, but not in contact with the candidate), classifying the candidate as a compound that decrease FAM118B activity.
[0181] Alternatively, the method may comprise the following steps:
[0182] - providing a candidate for assessing its capability to modulate FAM118B activity,
[0183] - measuring in presence of the candidate the activation of TRPM2 in cells, in particular in immune cells, - when the activation of TRPM2 is increased as compared to a negative control (for example, the same cells, in the same condition, but not in contact with the candidate), classifying the candidate as a compound that increases FAM118B activity,
[0184] - when the activation of TRPM2 is decreased as compared to a negative control (for example, the same cells, in the same condition, but not in contact with the candidate), classifying the candidate as a compound that decrease FAM118B activity.
[0185] Alternatively, the method may comprise the following steps:
[0186] - providing a candidate for assessing its capability to modulate FAM118B activity,
[0187] - measuring in presence of the candidate the degradation of NAD in cells, in particular in immune cells,
[0188] - measuring in presence of the candidate the activation of TRPM2 in cells, in particular in immune cells,
[0189] - when the degradation of NAD is increased as compared to a negative control (for example, the same cells, in the same condition, but not in contact with the candidate) and the activation of TRPM2 is increased as compared to a negative control (for example, the same cells, in the same condition, but not in contact with the candidate), classifying the candidate as a compound that increases FAM118B activity,
[0190] - when the degradation of NAD is decreased as compared to a negative control (for example, the same cells, in the same condition, but not in contact with the candidate) and the activation of TRPM2 is decreased as compared to a negative control (for example, the same cells, in the same condition, but not in contact with the candidate), classifying the candidate as a compound that decrease FAM118B activity.
[0191] In an embodiment, the method may comprise one, or more than one, or several or all of the following steps:
[0192] - purifying recombinant FAM118B; and / or
[0193] - mixing in vitro recombinant FAM118B with NAD; and / or
[0194] - measuring NAD degradation and / or products of NAD degradation. In an embodiment, the method may comprise one, or more than one, or several or all of the following steps:
[0195] - providing a candidate for assessing its capability to modulate FAM118B activity; and / or
[0196] - measuring in presence of the candidate the activation of inflammation in cells, in particular in immune cells, more particularly in dendritic cells, and / or macrophages; and / or
[0197] - when the activation of inflammation is increased as compared to a negative control (for example, the same cells, in the same condition, but not in contact with the candidate and not in the presence of a TRPM2 inhibitor, or not in cells lacking or having decreased levels of TRPM2), classifying the candidate as a compound that increases FAM118B activity in particular classifying the compound as an agonist or activator of FAM118B,
[0198] - when the activation of inflammation is decreased as compared to a negative control (for example, the same cells, in the same condition, but not in contact with the candidate and not in the presence of a TRPM2 inhibitor, or not in cells lacking or having decreased levels of TRPM2), classifying the candidate as a compound that decrease FAM118B activity, in particular classifying the compound as an antagonist or blocker of FAM118B.
[0199] Examples illustrating the invention.
[0200] I. MATERIALS
[0201] 1.1 . Cell lines
[0202] RAW264.7 macrophage-like cells (initially purchased from ATTC) were kindly provided by Dr Catherine Werts (Institut Pasteur, Paris). RAW264.7 fam 118b - / - (or controls) were generated using transduction with Lenti-CRIPSR-v2 containing either the following guides targeting exon 7: GAAGTTATGGTAAGTAGTAC (forward - SEQ ID No. 7) and GTACTACTTACCATAACTTC (reverse - SEQ ID NO. 8), or non-targeting control guides. Transduction was followed by puromycin selection, single cell cloning, and knock-out phenotype was confirmed using both PCR showing genomic deletions, and western blot confirming the total absence of protein expression. HEK293T-Blue-Null2 and HEK293T-Blue-hTLR4 (initially purchased from Invivogen) were kindly provided by Dr Catherine Werts (Institut Pasteur, Paris).
[0203] 1.2. Plasmids
[0204] Plasmids were ordered from GenScript: pcDNA3.1 backbone (neomycin resistance) with either human (Hs) FAM118B, with a N term FLAG tag, or human (Hs) TIRAP, with a N term HA tag. Alanine substitution of HsFAMI 18B (N163A & H206A) was performed by site directed mutagenesis (Quick change XL, Agilent), according to the manufacturer’s instructions. All Minipreps and Midipreps were performed using endotoxin-free kits (Macherey-Nagel).
[0205] 1.3. Bacterial strains
[0206] Salmonella enterica serovar Typhimurium strain SL1344 was kindly provided by Dr Aline Rifflet (Institut Pasteur, Paris).
[0207] II. METHODS
[0208] 11.1. Macrophages culture and agonists stimulation
[0209] RAW264.7 cells (control and fam118b - / -) were cultivated in complete RPMI medium (Gibco) (10% FCS + Penicillin-Streptomycin) and were plated at 0.5 x 106 cells / mL in 200pL in 96 well plates (TPP) the day before stimulation.
[0210] Primary bone-marrow derived macrophages were obtained after differentiation of bone marrow myeloid precursors. Briefly, 6-10 weeks female mice were euthanized by cervical dislocation and tibias, femurs and iliac bones were retrieved. The bone marrow was flushed out of the bones using 22G needle and red blood cells were then lysed (RBC Buffer, Sigma) for 10 minutes at room temperature. Cells were enumerated and either frozen or used freshly. In both cases, bone marrow cells were differentiated for 7 days in 60 mm dishes in 12 mL complete RPMI + 10% filtered supernatant of confluent L929 fibroblasts, with addition of 3 mL of medium at day 3. Bone-marrow derived macrophages were recovered by scrapping in PBS and were plated at 0.5 x 106 cells / mL in 200pL in 96-wells plates (TPP) the day before siRNA transfection.
[0211] Stimulation with TLRs agonists was performed the day after plating (RAW264.7 cells) or the day after siRNA transfection (BMDMs). Cells were stimulated for 24 hours with 10-1000 ng / mL LPS of Escherichia coli strain O111 :B4 (LPS-EB, Invivogen) or with 1 -10 pg / mL synthetic dsRNA analog poly(l:C) (PIC-HMW, Invivogen). Supernatants were then recovered for dosage of nitric oxide and inflammatory cytokines.
[0212] 11.2. Macrophages subcellular fractionation
[0213] RAW264.7 cells (control and fam118b - / -) were plated at 0.5 x 106 cells / mL in 1 mL in 24-well plates (TPP) the day before collection. Cells were collected by scrapping in PBS after media removal and the different subcellular fractions were obtained using commercial kit (Fractionation kit for cultured cells, ThermoFisher) according to the manufacturer’s instructions. The different fractions were analyzed by SDS-PAGE (4%-15% gradient gel, BioRad) followed by transfer on PVDF membranes (Trans-Blot, BioRad) and Western blotting. Membranes were saturated in tris-buffered-saline (TBS) buffer with 0.1 % Tween 20 and 5% nonfat milk. Membranes were then incubated with the different antibodies of Table 1 , and chemiluminescence was recorded on ChemiDoc (BioRad).
[0214] Table 1 : Antibodies used on the different fractions issued from macrophages.
[0215] 11.3. siRNA transfections of BMDMs siRNA transfections were performed on differentiated BMDMs using lipofectamine reagent (Lipofectamine-3000, ThermoFisher) in serum-free medium (OptiMEM, Gibco). Briefly, pools of siRNA targeting either fam118B (#GS109229), tirap (#GS117149) (FlexiTube, Qiagen), or scrambled control siRNA (AllStar Negative Control, Qiagen) were incubated with lipofectamine in OptiMEM for 30 minutes at room temperature before drop-to-drop addition on the BMDMs at 100mM final concentration (4 x 25nM of each siRNA). Transfection was performed for 24 hours, and the media was changed to complete RPMI before agonists stimulation.
[0216] 11.4. Nitric oxide dosage and cytokines quantification Nitric oxide (NO) production by macrophages was measured in fresh macrophages supernatants by the Griess reaction (Griess reagent system, Promega), according to the supplier’s recommendations. Cytokines, such as IL- 6, were dosed in frozen supernatants using ELISA (DuoSet, R&D Systems) and according to the manufacturer’s instructions.
[0217] 11.5. TLR4-NFkB reporter systems
[0218] NFkB reporter HEK293T-Blue-Null2 and HEK293T-Blue-hTLR4 cells (stably transfected with human TLR4, MD2 and CD14) were cultivated in complete DMEM medium (Gibco) (10% FCS + Penicillin-Streptomycin). FAM118B and TIRAP overexpression was achieved by transfection of both cell lines with either 10 ng / well pcDNA3.1 -HsFAM118B-Flag (or catalytic mutant) or 0.1 ng / well pcDNA3.1 -HsTIRAP-HA in 12-wells plates (TPP), using lipofectamine (Lipofectamine-3000, ThermoFisher) in serum-free medium (OptiMEM, Gibco). Transfection was performed for 48 hours, and cells were then collected by gentle flushing in PBS, enumerated and resuspended in commercial detection medium (HEK-Blue Detection, Invivogen), containing the substrate of the NFkB-reporter secreted embryonic alkaline phosphatase (SEAP). LPS stimulation was performed by incubating 50 000 transfected cells / well with 0.1 -100 ng / mL LPS of Escherichia coli strain 0111 :B4 (LPS-EB, Invivogen) overnight in detection media in 96-wells plate (TPP). Activity of the NFkB reporter SEAP was measured by colorimetry at OD 655 nm.
[0219] 11.6. Gentamicin protection assay for Salmonella intracellular replication
[0220] RAW264.7 cells (control and fam118b - / -) were plated at 0.5 x 106 cells / mL in 200pL in 96-well plates (TPP) the day before infection. Salmonella enterica serovar Typhimurium strain SL1344 was grown overnight in liquid antibiotic-free LB medium for a maximum of 12 hours. Stationary bacterial culture was centrifuged at 4000 rpm for 10 minutes and resuspended in PBS before OD 600 nm measurement. Bacterial concentration was calculated based on standard reference 1 OD 600 nm = 8 x 108 CFUs / mL. Cells were then infected with a multicity of infection (MOI) 1 10 of bacteria in complete antibiotic-free RPMI for 30 minutes. After infection, cells were washed gently 3 times with PBS and medium containing 50 pg / mL of gentamicin was added for 30 minutes to kill all the extracellular bacteria. After the gentamicin protection assay, cells were washed again 3 times with PBS and medium containing 10 pg / mL of gentamicin was added to prevent the extracellular growth of any residual bacteria. Infected cells were then incubated for 1-12 hours and were then quickly lysed in PBS with 0.2 % sodium deoxycholate at indicated time point. Viable intracellular bacteria were recovered and enumerated by CFU enumeration on antibiotic-free LB-agar plates.
[0221] II.7. In silico structure and NAD+ interaction prediction
[0222] Predicted structure of Hs-FAM118B (Uniprot entry Q9BPY3) was obtained from Alphafold (EMBL’s European Bioinformatics Institute) and interaction prediction with NAD+ was modeled by predicted Protein-Compound Interaction Search (Honig Lab). Potentially interacting residues N163 and H206 were also predicted by PCIS (Honing Lab). All visualizations were achieved with Mol*Viewer (Mol*Star web-based open-source toolkit).
[0223] Inflammatory response in mice with functional FAM118B or knocked down for FAM118B.
[0224] The inventors generated a murine macrophage cell line (Raw 264.7) knock-out for FAM118B. LPS stimulation of wild type macrophage results in the secretion of the cytokine IL-6, as well as of nitric oxide (NO), a late marker of inflammation. IL-6 and NO productions are abolished in macrophages lacking FAM118B (Fig 1A). In primary murine macrophages derived from bone marrow, reduction of FAM1 18B levels by silencing is as potent as a TIRAP reduction when it comes to diminishing LPS-induced cytokines (Fig 1 B). Lack of LPS-induced inflammation translates into increased Salmonella infection in FAM118B KO macrophages with respect to wild type (Fig 1C). These results demonstrate that FAM118B is a central player in the induction of inflammation downstream of TLR4.
[0225] The signaling events linking LPS detection by TLR4 to inflammation are incompletely understood. It is well-documented TLR4 signals to TIRAP, which leads to the activation of the protein TRPM2 and inflammation. TRPM2 activation depends to its binding to a small molecule second messenger such as ADPR or cyclic ADPR, which derive from NAD degradation. The identity of the enzyme that produces the second messenger is still debated. Because FAM118B bears a Sir2 domain that can potentially degrade NAD, the inventors hypothesize FAM118B may be the missing actor of the TLR4 signaling cascade. In vitro, recombinant FAM118B can degrade NAD (Fig 2A). The inventors predicted the structure of FAM118B with Alphafold, and identified two residues likely involved in the enzymatic activity (Fig 2B). To test its activity, the inventors use the reporter system HEKblue, which consist of human embryonic kidney cells expressing TLR4 as well as a reporter for NF-kB activation, responsible for inflammation. NF- kB-driven inflammation downstream of TLR4 can be monitored in a quantitative manner using the reporter (Fig 2C). Inflammation increases when FAM118B is expressed, but not when FAM118B enzymatic activity is abolished by point mutation (Fig 2C). FAM 11 SB-dependent increase in inflammation is abolished when TRPM2 is chemically inhibited (Fig 2D). These results demonstrate that FAM118B transduces TLR4-driven inflammation by generating a second messenger from NAD degradation that activates TRPM2.
[0226] Activation of the inflammatory downstream signal n functional FAM118B cells or in FAM118B-K0 cells.
[0227] Fig. 5 and Fig. 6 illustrate the pivotal function of FAM118B in activating inflammation downstream of TLR1 / 2, TLR3, TLR4, TLR7 / 8, TLR9. It can be seen that inflammation downstream of TLR4 and 7 / 8 is decreased in human primary macrophages with reduced FAM118B expression (knock-down by shRNA transduction), as measured by the expression of the IFI44L, an interferon- stimulated gene (see Fig. 5). inflammation downstream of TLR1 / 2, 3, 4, 7 / 8 and 9 is abrogated in macrophages lacking FAM118B, as measured by cytokine (Fig. 6, left and the two central panels) and nitric oxide production (Fig.6, right panel). Numerous pathologies of inflammation have a TLR-driven component. These data demonstrate that FAM118B is a central mediator of inflammation downstream of all tested TLRs, except TLR5. Targeting FAM118B is thus a viable therapeutic strategy to treat inflammatory diseases or diseases associated with TLR signaling.
[0228] Effect of FAM118B activation for treating herpes simplex virus 1 infection (Fig. Zll
[0229] To test FAM118B’s importance in controlling pathogens that activate TLRs, the inventors compared infection between control and FAM118B KO murine macrophages. Entry of GFP-tagged HSV-1 results in cells expressing intermediate GFP levels, as measured by flow cytometry (Fig 7a, b). Viral replication translates into the production of additional GFP molecules and high GFP+ fluorescence. Acyclovir, an inhibitor of viral replication, prevents the apparition of GFP+ high cells containing replicative virus (Fig 7a, b). Viral entry is equivalent in wild type and FAM118B KO macrophages (Fig 7b). However, absence of FAM118B translates into an increase in the percentage of productively infected cells and 2-fold increase in GFP mean fluorescence intensity, a measure of viral replication (Fig 7b, c). These results demonstrate that FAM118B plays a role in the control of HSV-1 infection in macrophages. To interrogate the participation FAM118B in TLR-driven antibacterial immunity, macrophages were infected with Salmonella enterica and intracellular bacterial accumulation was measured by colony forming unit (CFU) assay (Fig 7d). There is a 2-fold increase in Salmonella accumulation in macrophages knocked-out for SIRanc, compared to control (Fig 7d). Infected FAM118B KO macrophages show an abrogation of the production of the ISG Rsad2, whereas TNF transcript levels appear unmodified. To assess if this increased infection is related to the TLR4 pathway, the inventors utilized LPS of Rhodobacter sphaeroides, an antagonist of the receptor (Fig 7e). In control macrophages, blocking TLR4 translates into increased bacterial loads, reaching the levels measured in FAM118B KO cells (Fig 7e) Treatment with TLR4 antagonist does not affect the accumulation of Salmonella in FAM118B KO macrophages, demonstrating that SIRanc acts within the TLR4 pathway in this infectious model (Fig 7e). Altogether, these results demonstrate that FAM118B plays a pivotal role in TLR-driven immune protection against viruses and bacteria infection since FAM118B controls the production of interferons and other pro-inflammatory cytokines, which are instrumental in thwarting pathogens. These results indicate that activating FAM1 18B can allow to control infection from bacteria and viruses.
[0230] Lack of FAM118B is associated with a deficit in the production of pro- inflammatory cytokines and in an increase of the production of pro-inflammatory cytokines (Fig. 8):
[0231] Macrophages wild type (WT) or lacking FAM118B (KO) are stimulated with LPS. Production of the indicated cytokines is monitored by LegendPlex at 24h. Production of the inflammatory cytokines CCL2, IFNbeta, CXCL10, IFNalpha, GM-CSF, ILI beta, IFNgamma, IL6 is abrogated or severely downregulated. Production of the anti-inflammatory cytokine IL-10 is increased. These cytokines and chemokines, including IFN and IL-10 are instrumental in driving autoimmune pathologies as well as controlling infection (PMID: 35016780, 37359549). FAM118B can thus be considered a therapeutic target for modulating inflammation: By agonizing FAM118B, it is possible to initiate, sustain or enhance an inflammatory response, while antagonizing FAM118B may lead to reduce or inhibit inflammatory response.
[0232] Inhibition of FAM118 when administering an antagonist of FAM118B (Fig. 9):
[0233] An inhibitor of SIR2-containing proteins, sirtinol, was used to inhibit the activity of FAM118B. As demonstrated in macrophages lacking FAM118B, treatment with sirtinol inhibits the production of nitric oxide induced by TLR4 stimulation. These results demonstrate that using an antagonist of FAM118B leads to the inhibition of its function, thereby reducing the production of NO.
[0234] Antitumoral function when agonis FAM118B:
[0235] The inventors generated a colon cancer cell line (MC38) knock-out for FAM118B or overexpressing FAM118B. Cells were implanted on the flank of mice and the tumor growth is being monitored. Tumors lacking FAM118B grow faster, and tumors overexpressing FAM118B grow slower, demonstrating that agonizing FAM1 18B has an antitumoral effect.
[0236] Sepsis treatment using an antagonist of FAM118:
[0237] To assess the role of FAM118B in the pathology of sepsis, the inventors injected a C57BL6 / J mouse model FAM118B knocked-out (full-body), or wild type mice as a control, with LPS intraperitoneally. FAM118B KO may tolerate better the LPS injection (production of inflammatory cytokines such as IL6), demonstrating that FAM1 18B is a driver of sepsis pathology.
[0238] Methods for measuring FAM118 activity:
[0239] The ability of a compound to modulate the FAM118B activity to induce or inhibit inflammation may be tested in the HEKblue system presented in Fig 2C-D. Cells can be transfected with various concentrations of plasmid encoding a compound for testing its capability to modulate the FAM118B activity and NF-kB-driven inflammation can be monitored. TRPM2 inhibition may also be measured as in Fig 2D to verify that inflammation follows a canonical TLR4 pathway. This experiment can be performed with or without LPS stimulation, preferably without LPS stimulation.
[0240] The compound to be tested may be an agonist of FAM118B as defined herein. The compound to be tested may be an antagonist of FAM118B as defined herein. The compound to be tested may be a functional equivalent of FAM118B as defined herein.
[0241] The compound to be tested may be a mutated FAM118B with its SIR2-like domain constitutively activated.
[0242] The compound to be tested may be a mutated FAM118B with its SIR2-like domain constitutively inactivated.
[0243] Provision of a FAM118B constitutively activated.
[0244] Modification of an NAD-degrading enzyme to obtain a constitutively active form as been performed with a TIR protein (Bayless, A. M. et al. Plant and prokaryotic TIR domains generate distinct cyclic ADPR NADase products. Sci. Adv. 9, eade8487 (2023)). Modified FAM118B based on our data, structural predictions, and mining of the tree of life are synthetized.
[0245] FAM118B acts downstream of TIRAP and MyD88, two adaptors of the TLR4 cascade that oligomerize upon activation, which implies that FAM118B enzymatic activity may be unleashed upon oligomerization. In that line, recombinant FAM118B can degrade NAD in vitro only upon addition of PEG, a molecular crowding agent that enforces protein-protein interactions (Fig 2A). Modified FAM118B bearing an additional domain documented to spontaneously oligomerize, such as TIR, CARD and Pyrin3-5 is synthetized. A tandem FAM118B joined by a flexible linker is synthetized. These approaches include any methods of enforced oligomerization using other domains from natural origin (amyloids and prions, signalosomes, multivalent signaling complexes) as well as artificial constructions (including split protein / domains and helix-helix interactions).
[0246] Anti-tumour activity of FAM118B agonists.
[0247] Compounds that induce inflammation by activating FAM118B or being agonist of FAM118B are tested for their capability to induce inflammation within cancer environment. FAM1 18B agonists or activators are provided in vivo through the use of a system of messenger RNA encapsulated in lipid nano-articles (LNP).
[0248] 1 ) Cell culture validation: FAM118B-LNP inflammatory activity can be confirmed in HEKblue cells as described here above.
[0249] 2) In vivo toxicity: Mice will receive a single injection of 6 different doses of FAM118B-LNP. Toxicity may be monitored in mice through the apparition of adverse effect, including weight loss. A dose can thus be determined.
[0250] 3) [Optionnal] Homing in vivo: lipid composition of LNPs can be modified to improve the anti-tumour efficacy. In that case, identifying the homing sites of LNP by means of a luciferase-LNP, with luciferase expression monitored by MS Spectrum in vivo imaging, is performed.
[0251] Measuring the anti-tumour activity of an agonist of FAM118B can be performed by considered at least one of the following experiments:
[0252] 1 ) Tumour growth. Mice are injected with B16 (melanoma), MC38 (colon cancer) and LLC (lung cancer) and treated with control or FAM118B-LNP at the dose determined according to the previous experiment. Tumour growth is monitored.
[0253] 2) Inflammation. Presence of pro-inflammatory cytokines is monitored in the blood of mice via ELISA.
[0254] 3) Immune cells in tumours, presence of immune cells in tumours is monitored by flow cytometry, with a focus on myeloid and T cell population, both of which involved in anti-tumour immunity.
Claims
CLAIMS1. A modulator of Protein Family with sequence similarity 118 member B (FAM118B) for use in the modulation of the inflammatory response in a patient in need thereof.
2. The modulator of FAM118B for use according to claim 1 , wherein the modulator of FAM118B is an activator or an agonist of FAM118B, or enhances the expression of FAM118B, or enhances a biological process involving FAM118B.
3. The modulator of FAM118B for use according to claim 2, wherein the modulator of FAM118B initiates, enhances, or sustains an inflammatory response.
4. The modulator of FAM118B for use according to claim 3, wherein the inflammatory response is initiated, enhanced, or sustained in a patient suffering from a cancer or a bacterial infection or a viral infection.
5. The modulator of FAM118B for use according to any one of claims 2 to 4, for use in the treatment of a cancer, a bacterial infection, a viral infection, a parasite infection, or a fungal infection.
6. The modulator of FAM118B for use according to claim 5, wherein the cancer is selected from the group consisting of solid tumors, including pancreatic, breast, lung, and intestinal tumors.
7. The modulator of FAM118B for use according to any one of claims 2 to 5, wherein the modulator of FAM118B is a nucleic acid molecule encoding FAM118B or a functional fragment thereof, in particular a cDNA or a mRNA encoding FAM118B, or is a Chimeric antigen receptor (CAR) comprising within its cytoplasmic domain a functional domain of FAM118B, in particular the SIR2- like domain of FAM118B, more particularly FAM118B with the amino acidsequence set forth in SEQ ID No. 3, or SEQ ID No. 4, or SEQ ID No. 5 or SEQ ID No. 6.
8. The modulator of FAM118B for use according to claim 1 , wherein the modulator of FAM118B is a blocker or an antagonist of FAM118B, or decreases, in particular inhibits, the expression of FAM118B, or decreases, in particular inhibits, a biological process involving FAM118B.
9. The modulator of FAM118B for use according to claim 7, wherein the modulator of FAM118B reduces, blocks, or inhibits an inflammatory response.
10. The modulator of FAM118B for use according to claim 8, wherein the inflammatory response is reduced, blocked, or inhibited in a patient suffering from an autoimmune disease or an inflammatory disease.
11. The modulator of FAM118B for use according to claim 9, wherein the autoimmune disease is selected from the group consisting of inflammatory bowel disease, Crohn disease, and systematic lupus erythematous, or wherein the inflammatory disease is selected from the group consisting of interferonopathies, sepsis and acute respiratory distress syndrome, pathologies of neurodegeneration, in particular Parkinson’s disease and Alzheimer’s disease.
12. The modulator of FAM 118B for use according to any one of claims 7 to 10, wherein the modulator of FAM118B is a nucleic acid molecule that interferes with the expression of FAM118, in particular a Small interfering RNA.
13. An engineered immune cell, in particular a monocyte, a macrophage, a B cell, a T cell, that overexpresses FAM118B, or expresses a FAM118B that has its SIR2-like domain constitutively activated, or that comprises a CAR comprising within its cytoplasmic domain a functional domain of FAM118B, in particular the SIR2-like domain of FAM118B.
14. The engineered immune cell of claim 13, wherein the cell comprises a nucleic acid molecule encoding FAM118B, in particular a FAM118B with its SIR2-like domain that is constitutively activated.
Citation Information
Patent Citations
Vista regulatory t cell mediator protein, vista binding agents and use thereof
US20130177557A1
Proteins produced by human lymphocytes, DNA sequence encoding these proteins and their pharmaceutical and biological use
US5773578A
Human CTLA-4 antibodies
US6984720B1
Methods for expressing and recovering human monoclonal antibodies to CTLA-4
US7109003B2
Human CTLA-4 antibodies and their uses
US8017114B2