Mitochondria-derived mirna and use thereof in senescence-related disease

Abstract

The present invention provides an miR 1978 inhibitor and use thereof in treating a senescence-related disease. The etiology of senescence-related diseases is proposed, and the overexpression of miR 1978 derived from the mitochondrial genome in cell line SHSY5Y is proven to give rise to decreased mRNA expression and protein levels of DHFR, KIF5C, and MSH3; as a result, SHSY5Y cell division is arrested in the G1 phase of the cell cycle, the number of cells in the G2 / M phase is significantly reduced, and meanwhile, the number of apoptotic cells is increased. Compared with a control, cells containing miR1978 have different nuclear DNA methylation states. A plurality of Alzheimer's disease-related proteins, such as APP, Tau, p-Tau, and APOE, or Parkinson's disease-related proteins, such as α-synuclein, are increased in the SHSY5Y cell line containing miR 1978, etc.

Description

Mitochondria-derived miRNA and application thereof in aging-related diseases TECHNICAL FIELD

[0001] The present application relates to the field of biological medicine, in particular to a mitochondria-derived miRNA and application thereof in aging-related diseases. BACKGROUND

[0002] Human aging is inevitable, and the diseases related to aging mainly include Alzheimer's disease (AD) and Parkinson's disease (PD). According to statistics, the incidence of AD increases with age, and 3% of people aged 65-75, 17% of people aged 75-84, and 32% of people aged 84 and above are affected by AD (Soria Lopez, J. A., H. M. Gonzalez, and G. C. Leger, Alzheimer's disease. Handb Clin Neurol, 2019. 167: p. 231-255). In addition, PD is the most common movement disorder disease in the world. The incidence of PD in adults over 60 years old is about 1% (Samii, A., J. G. Nutt, and B. R. Ransom, Parkinson's disease. Lancet, 2004. 363(9423): p. 1783-93). Age is the main pathogenic factor of these diseases. However, the causes of these fatal diseases are still unknown, and there is also a lack of effective treatment for these diseases.

[0003] MicroRNA (miRNA) is a class of non-coding small fragments of RNA with a length of about 22 nucleotides, which is evolutionarily conserved, interacts with the 3' untranslated region (3'-UTR) of mRNA to regulate the translation of mRNA, and thereby participates in various functions of organisms. The nuclear DNA and mitochondrial DNA (mtDNA) of eukaryotic cells are considered to be independently evolved, while mtDNA comes from the circular genome of bacteria phagocytosed by the early ancestors of today's eukaryotic cells (Calvo, S.E., K.R. Clauser, and V.K. Mootha, MitoCarta2.0: an updated inventory of mammalian mitochondrial proteins. Nucleic Acids Res, 2016. 44(D1): p. D1251-7; Sagan, L., On the origin of mitosing cells. 1967. J NIH Res, 1993. 5(3): p. 65-72; Andersson, S.G., et al., The genome sequence of Rickettsia prowazekii and the origin of mitochondria. Nature, 1998. 396(6707): p. 133-40). Most of the proteins present in mitochondria are encoded by nuclear DNA, but the genes of some of these proteins are considered to originate from bacteria initially and are transferred to eukaryotic cells during evolution (Adams, K.L. and J.D. Palmer, Evolution of mitochondrial gene content: gene loss and transfer to the nucleus. Mol Phylogenet Evol, 2003. 29(3): p. 380-95).Due to this transfer, mechanisms must exist to coordinate and control the expression of genes encoded by both the nuclear and mitochondrial genomes to maintain and control cellular function (Butow, R. A. and N. G. Avadhani, Mitochondrial signaling: the retrograde response. Mol Cell, 2004. 14(1): p. 1-15; Liu, Z. and R. A. Butow, Mitochondrial retrograde signaling. Annu Rev Genet, 2006. 40: p. 159-85; Huang, J., et al., Non-coding RNA Regulated Cross-Talk Between Mitochondria and Other Cellular Compartments. Front Cell Dev Biol, 2021. 9: p. 688523). For example, nuclear-encoded miRNAs are isolated from mitochondria, and nuclear-encoded 5S rRNA is identified as one of the most abundant RNAs in human mitochondria, and thus, the import of RNAs into mammalian mitochondria is thought to be necessary for replication, transcription, and translation of the mitochondrial genome (Kren, B. T., et al., MicroRNAs identified in highly purified liver-derived mitochondria may play a role in apoptosis. RNA Biol, 2009. 6(1): p. 65-72; Smirnov, A. V., et al., Specific features of 5S rRNA structure - its interactions with macromolecules and possible functions. Biochemistry (Mosc), 2008. 73(13): p. 1418-37). On the other hand, deep sequencing of small RNAs shows that a large number of mitochondrial RNA-derived small RNAs are present in the nucleus and cytoplasm. Some of these are thought to be mitochondrial-derived miRNAs. These RNAs from mitochondria should play a role in maintaining normal function of the cell (Landerer, E., et al., Nuclear localization of the mitochondrial ncRNAs in normal and cancer cells. Cell Oncol (Dordr), 2011. 34(4): p. 297-305).

[0004] DHFR catalyzes the reduction of 7,8-dihydrofolic acid to 5,6,7,8-tetrahydrofolic acid. Lack of DHFR results in cells lacking 5,6,7,8-tetrahydrofolic acid (H4F). The main function of H4F is to act as a metal donor and provide a metal group (CH3) for DNA metabolism. This methyl group forms methionine with homocysteine (Hcy) and S-adenosyl-L-methionine (SAM). SAM is a global methyl donor for many methylation reactions, including the synthesis of phosphatidylcholine, methylation of DNA and histones. Tetrahydrofolate deficiency can lead to a decrease in SAM, which can lead to abnormal methylation status of nuclear DNA and histones, which in turn affects the stability of chromosomes and DNA, and in turn affects the expression of related genes. It has been reported that age is associated with global loss of DNA methylation, and there is some data to suggest that high homocysteine and abnormal DNA methylation are involved in the mechanism of AD.

[0005] Dendritic spines are small protrusions along the dendrites that constitute the main postsynaptic site of excitatory synaptic transmission. These spines have a high degree of motility, and remodeling can occur even in the adult nervous system. Spine remodeling and the formation of new synapses are activity-dependent processes that provide the basis for memory formation. The loss or alteration of these structures has been demonstrated in patients with neurodegenerative diseases such as Alzheimer's disease and in mouse models of these diseases. This alteration is believed to be the cause of cognitive deficits, and studies have summarized the loss or alteration of dendritic spines induced by amyloid beta (Aβ) peptide in AD (Knobloch, M. and I. M. Mansuy, Dendritic spine loss and synaptic alterations in Alzheimer's disease. Mol Neurobiol, 2008. 37(1): p. 73-82).

[0006] The plasticity of synaptic structures is key to the storage of long-term memory, requiring localized RNA released from the neuron cell body via long-distance transport. Studies have shown that loss of function of KIF5C and KIF3A proteins reduces dendritic structure and spine density, while enhancement of KIF5C function enhances dendritic structure and spine density. Long-distance transport of KIF5C-mediated local translation substrates has been shown to be a key mechanism of structural plasticity and memory (Swarnkar, S., et al., Molecular motor protein KIF5C mediates structural plasticity and long-term memory by constraining local translation. Cell Rep, 2021. 36(2): p. 109369).

[0007] In 2015, the inventors proposed a hypothesis of the role of aberrant mitochondrial RNA in aging and aging-associated diseases (Chen, Y., et al., Aberrant mitochondrial RNA in the role of aging and aging associated diseases. Med Hypotheses, 2015. 85(2): p. 178-82). As the accumulation of mutated mitochondrial DNA with age, the uneven mitochondrial genome RNA is produced, and excessive mitochondria-derived miRNA enters the cytoplasm or nucleus, affecting the expression or translation of nuclear genome genes, which can be the cause of human aging.

[0008] SUMMARY

[0009] There is a lack of effective treatment for aging-related diseases (especially Alzheimer's disease and Parkinson's disease) in the prior art. To solve this problem, the present application provides a mitochondria-derived miRNA and its application in aging-related diseases.

[0010] In one aspect, the present application provides a use of a miR 1978 inhibitor in the preparation of a medicament for treating an aging-related disease.

[0011] In some embodiments, the inhibitor is a polynucleotide that is at least partially complementary to miR 1978. In some embodiments, the polynucleotide is single-stranded or double-stranded. In some embodiments, the miR 1978 has a nucleotide sequence as set forth in SEQ ID NO: 3. In some embodiments, the polynucleotide is complementary to at least 12 bases of the nucleotide sequence set forth in SEQ ID NO: 3. In some embodiments, the polynucleotide has a length of 14 to 30 nucleotides. In some preferred embodiments, the polynucleotide comprises a modified internucleotide linkage selected from the group consisting of phosphoramidate, phosphorothioate, phosphorodithioate, boranophosphonate, alkylphosphonate, and methylenemethylimino. In some preferred embodiments, the polynucleotide agent comprises a modified nucleic acid unit selected from the group consisting of a locked nucleic acid unit, a 2'-O-alkyl ribonucleic acid unit, a 2'amine ribonucleic acid unit, a peptide nucleic acid unit, a 2'fluoro ribonucleic acid unit, a morpholino nucleic acid unit, a cyclohexane nucleic acid unit, and a tricyclo nucleic acid unit. In some preferred embodiments, the polynucleotide comprises a nucleotide sequence as set forth in SEQ ID NO: 24. In some embodiments, the aging-related disease comprises Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, Lewy body dementia.

[0012] In another aspect, the present application provides use of a compound capable of up-regulating the level of DHFR gene and / or DHFR protein in the manufacture of a medicament for treating an aging-related disease. In some embodiments, the compound up-regulates the level of DHFR gene and / or DHFR protein by inhibiting miR 1978.

[0013] In another aspect, the present application provides use of a compound capable of up-regulating the level of KIF5C gene and / or KIF5C protein in the manufacture of a medicament for treating an aging-related disease. In some embodiments, the compound up-regulates the level of KIF5C gene and / or KIF5C protein by inhibiting miR 1978.

[0014] In another aspect, the present application provides use of a compound capable of up-regulating the level of MSH3 gene and / or MSH3 protein in the manufacture of a medicament for treating an aging-related disease. In some embodiments, the compound up-regulates the level of MSH3 gene and / or MSH3 protein by inhibiting miR 1978.

[0015] In another aspect, the present application provides use of a compound capable of reducing cell abnormal methylation in the manufacture of a medicament for treating an aging-related disease. In some embodiments, the compound reduces cell abnormal methylation by inhibiting miR 1978.

[0016] In another aspect, the present application provides use of a compound capable of increasing the structure of neuron dendritic spine in the manufacture of a medicament for treating an aging-related disease. In some embodiments, the compound increases the structure of neuron dendritic spine by inhibiting miR 1978.

[0017] In the above applications of the present application, the compound upregulates DHFR gene and / or DHFR protein level, upregulates KIF5C gene and / or KIF5C protein level, upregulates MSH3 gene and / or MSH3 protein level, reduces cell abnormal methylation and increases neuron dendritic spine structure by inhibiting miR 1978. In some embodiments, the compound is a polynucleotide that is at least partially complementary to miR 1978. In some embodiments, the polynucleotide is single-stranded or double-stranded. In some embodiments, the miR 1978 has a nucleotide sequence as set forth in SEQ ID NO: 3. In some embodiments, the polynucleotide is complementary to at least 12 bases of the nucleotide sequence set forth in SEQ ID NO: 3. In some embodiments, the polynucleotide has a length of 14 to 30 nucleotides. In some preferred embodiments, the polynucleotide comprises a modified internucleotide linkage selected from the group consisting of phosphoramidate, phosphorothioate, phosphorodithioate, boranophosphonate, alkylphosphonate, and methylene methyl imino. In some preferred embodiments, the polynucleotide agent comprises a modified nucleic acid unit selected from the group consisting of a locked nucleic acid unit, a 2'-O-alkyl ribonucleic acid unit, a 2' amine ribonucleic acid unit, a peptide nucleic acid unit, a 2'fluoro ribonucleic acid unit, a morpholino nucleic acid unit, a cyclohexane nucleic acid unit, and a tricyclo nucleic acid unit. In some preferred embodiments, the polynucleotide comprises a nucleotide sequence as set forth in SEQ ID NO: 24. In some embodiments, the senescence-associated disease comprises Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, Lewy body dementia.

[0018] In another aspect of the present application, there is provided use of a diagnostic agent in the manufacture of a diagnostic agent for diagnosing whether a subject has a senescence-associated disease or is at risk of developing a senescence-associated disease, the diagnosis comprising the steps of: a) isolating a biological sample from the subject; b) measuring the expression level of miR 1978 in the biological sample; c) comparing the expression level of miR 1978 with a reference expression level; the subject is identified as having a senescence-associated disease or is at risk of developing a senescence-associated disease if the expression level of miR 1978 is higher than the reference expression level.

[0019] In some embodiments, the reference expression level is from a biological sample of a normal healthy subject. In some embodiments, the miR 1978 has a nucleotide sequence as set forth in SEQ ID NO: 3. In some embodiments, the expression level is measured by in situ hybridization method. In some embodiments, the senescence-associated disease comprises Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, Lewy body dementia.

[0020] Another aspect of the present application provides a pharmaceutical composition for treating a senescence-related disease, comprising a polynucleotide complementary to at least part of miR 1978 and a pharmaceutically acceptable carrier.

[0021] In some embodiments, the polynucleotide is single-stranded or double-stranded. In some embodiments, the miR 1978 has a nucleotide sequence as set forth in SEQ ID NO: 3. In some embodiments, the polynucleotide is complementary to at least 12 bases of the nucleotide sequence set forth in SEQ ID NO: 3. In some embodiments, the polynucleotide has a length of 14 to 30 nucleotides. In some preferred embodiments, the polynucleotide comprises a modified internucleotide linkage selected from the group consisting of phosphoramidate, phosphorothioate, phosphorodithioate, boranophosphonate, alkylphosphonate, and methylenemethylimino. In some preferred embodiments, the polynucleotide agent comprises a modified nucleic acid unit selected from the group consisting of a locked nucleic acid unit, a 2'-O-alkyl ribonucleic acid unit, a 2'amine ribonucleic acid unit, a peptide nucleic acid unit, a 2'fluoro ribonucleic acid unit, a morpholino nucleic acid unit, a cyclohexane nucleic acid unit, and a tricyclo nucleic acid unit. In some preferred embodiments, the polynucleotide comprises a nucleotide sequence as set forth in SEQ ID NO: 24. In some embodiments, the senescence-related disease comprises Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, Lewy body dementia.

[0022] One aspect of the present application provides a miR 1978 inhibitor for treating a senescence-related disease.

[0023] In some embodiments, the inhibitor is a polynucleotide that is at least partially complementary to miR 1978. In some embodiments, the polynucleotide is single-stranded or double-stranded. In some embodiments, the miR 1978 has a nucleotide sequence as set forth in SEQ ID NO: 3. In some embodiments, the polynucleotide is complementary to at least 12 bases of the nucleotide sequence set forth in SEQ ID NO: 3. In some embodiments, the polynucleotide is 14 to 30 nucleotides in length. In some preferred embodiments, the polynucleotide comprises a modified internucleotide linkage selected from the group consisting of phosphoramidate, phosphorothioate, phosphorodithioate, boranophosphonate, alkylphosphonate, and methylenemethylimino. In some preferred embodiments, the polynucleotide agent comprises a modified nucleic acid unit selected from the group consisting of a locked nucleic acid unit, a 2'-O-alkyl ribonucleic acid unit, a 2'amine ribonucleic acid unit, a peptide nucleic acid unit, a 2'fluoro ribonucleic acid unit, a morpholino nucleic acid unit, a cyclohexane nucleic acid unit, and a tricyclo nucleic acid unit. In some preferred embodiments, the polynucleotide comprises a nucleotide sequence as set forth in SEQ ID NO: 24. In some embodiments, the senescence-associated disease comprises Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, Lewy body dementia.

[0024] Another aspect of the present application provides a compound for treating a senescence-associated disease by upregulating a DHFR gene and / or a DHFR protein level. In some embodiments, the compound upregulates the DHFR gene and / or the DHFR protein level by inhibiting miR 1978.

[0025] Another aspect of the present application provides a compound for treating a senescence-associated disease by upregulating a KIF5C gene and / or a KIF5C protein level. In some embodiments, the compound upregulates the KIF5C gene and / or the KIF5C protein level by inhibiting miR 1978.

[0026] Another aspect of the present application provides a compound for treating a senescence-associated disease by upregulating a MSH3 gene and / or a MSH3 protein level. In some embodiments, the compound upregulates the MSH3 gene and / or the MSH3 protein level by inhibiting miR 1978.

[0027] Another aspect of the present application provides a compound for treating a senescence-associated disease by reducing cellular aberrant methylation. In some embodiments, the compound reduces cellular aberrant methylation by inhibiting miR 1978.

[0028] Another aspect of the present application provides a compound for treating an aging-related disease by increasing dendritic spine structure of neurons. In some embodiments, the compound increases dendritic spine structure of neurons by inhibiting miR 1978.

[0029] A compound as described above upregulates DHFR gene and / or DHFR protein level, upregulates KIF5C gene and / or KIF5C protein level, upregulates MSH3 gene and / or MSH3 protein level, reduces cell abnormal methylation, and increases dendritic spine structure of neurons by inhibiting miR 1978. In some embodiments, the compound is a polynucleotide that is at least partially complementary to miR 1978. In some embodiments, the polynucleotide is single-stranded or double-stranded. In some embodiments, the miR 1978 has a nucleotide sequence as set forth in SEQ ID NO: 3. In some embodiments, the polynucleotide is complementary to at least 12 bases of the nucleotide sequence set forth in SEQ ID NO: 3. In some embodiments, the polynucleotide has a length of 14 to 30 nucleotides. In some preferred embodiments, the polynucleotide comprises a modified internucleotide linkage selected from the group consisting of phosphoramidate, phosphorothioate, phosphorodithioate, boranophosphonate, alkylphosphonate, and methylene methyl imino. In some preferred embodiments, the polynucleotide agent comprises a modified nucleic acid unit selected from the group consisting of a locked nucleic acid unit, a 2'-O-alkyl ribonucleic acid unit, a 2' amine ribonucleic acid unit, a peptide nucleic acid unit, a 2'fluoro ribonucleic acid unit, a morpholino nucleic acid unit, a cyclohexane nucleic acid unit, and a tricyclo nucleic acid unit. In some preferred embodiments, the polynucleotide comprises a nucleotide sequence as set forth in SEQ ID NO: 24. In some embodiments, the aging-related disease comprises Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, Lewy body dementia.

[0030] One aspect of the present application provides a method for treating an aging-related disease, comprising inhibiting miR 1978 in a subject.

[0031] In some embodiments, the inhibiting comprises administering a therapeutically effective amount of a miR 1978 inhibitor. In some embodiments, the inhibitor is a polynucleotide that is at least partially complementary to miR 1978. In some embodiments, the polynucleotide is single-stranded or double-stranded. In some preferred embodiments, the miR 1978 has a nucleotide sequence as set forth in SEQ ID NO: 3. In some preferred embodiments, the polynucleotide is complementary to at least 12 bases of the nucleotide sequence set forth in SEQ ID NO: 3. In some preferred embodiments, the polynucleotide is 14 to 30 nucleotides in length. In other embodiments, the polynucleotide comprises a modified internucleotide linkage selected from the group consisting of phosphoramidate, phosphorothioate, phosphorodithioate, boranophosphonate, alkylphosphonate, and methylene methylimino. In other embodiments, the polynucleotide agent comprises a modified nucleic acid unit selected from the group consisting of a locked nucleic acid unit, a 2'-O-alkyl ribonucleic acid unit, a 2'amine ribonucleic acid unit, a peptide nucleic acid unit, a 2'fluoro ribonucleic acid unit, a morpholino nucleic acid unit, a cyclohexane nucleic acid unit, and a tricyclo nucleic acid unit. In some particular embodiments, the polynucleotide comprises a nucleotide sequence as set forth in SEQ ID NO: 24. In some embodiments, the senescence-associated disease comprises Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, Lewy body dementia.

[0032] In some embodiments, the inhibitor is delivered in a delivery agent. In some preferred embodiments, the delivery agent is a micelle, an exosome, a lipoid, a liposome, a lipid nanoparticle, an extracellular vesicle, or a synthetic vesicle. In some embodiments, the inhibitor is delivered by a viral vector. In some preferred embodiments, the viral vector is an AAV, an adenovirus, a retrovirus, or a lentivirus.

[0033] Another aspect of the present application provides a method of upregulating a DHFR gene and / or a DHFR protein level, comprising administering a therapeutically effective amount of a miR 1978 inhibitor.

[0034] Another aspect of the present application provides a method of upregulating a KIF5C gene and / or a KIF5C protein level, comprising administering a therapeutically effective amount of a miR 1978 inhibitor.

[0035] Another aspect of the present application provides a method of upregulating a MSH3 gene and / or a MSH3 protein level, comprising administering a therapeutically effective amount of a miR 1978 inhibitor.

[0036] Another aspect of the present application provides a method of reducing cell abnormal methylation, comprising administering a therapeutically effective amount of a miR 1978 inhibitor.

[0037] In another aspect, the present application provides a method of increasing neuronal dendritic spine structure, comprising administering a therapeutically effective amount of a miR 1978 inhibitor.

[0038] The inventors have demonstrated that DHFR gene and / or DHFR protein levels, KIF5C gene and / or KIF5C protein levels, MSH3 gene and / or MSH3 protein levels, cellular aberrant methylation, and neuronal dendritic spine structure are all associated with the pathological mechanisms of aging-related diseases, such as Alzheimer's disease and Parkinson's disease. By upregulating DHFR gene and / or DHFR protein levels, upregulating KIF5C gene and / or KIF5C protein levels, upregulating MSH3 gene and / or MSH3 protein levels, reducing cellular aberrant methylation, and increasing neuronal dendritic spine structure, aging-related diseases can be treated.

[0039] In the present application, upregulation of DHFR gene and / or DHFR protein levels, upregulation of KIF5C gene and / or KIF5C protein levels, upregulation of MSH3 gene and / or MSH3 protein levels, reduction of cellular aberrant methylation, and increase of neuronal dendritic spine structure can be achieved by administering a therapeutically effective amount of a miR 1978 inhibitor. In some embodiments, the inhibitor is a polynucleotide that is at least partially complementary to miR 1978. In some embodiments, the polynucleotide is single-stranded or double-stranded. In some preferred embodiments, the miR 1978 has a nucleotide sequence as set forth in SEQ ID NO: 3. In some preferred embodiments, the polynucleotide is complementary to at least 12 bases of the nucleotide sequence set forth in SEQ ID NO: 3. In some preferred embodiments, the polynucleotide is 14 to 30 nucleotides in length. In other embodiments, the polynucleotide comprises a modified internucleotide linkage selected from the group consisting of phosphoramidate, phosphorothioate, phosphorodithioate, boranophosphonate, alkylphosphonate, and methylenemethylimino. In other embodiments, the polynucleotide agent comprises a modified nucleic acid unit selected from the group consisting of a locked nucleic acid unit, a 2'-O-alkyl ribonucleic acid unit, a 2'amine ribonucleic acid unit, a peptide nucleic acid unit, a 2'fluoro ribonucleic acid unit, a morpholino nucleic acid unit, a cyclohexane nucleic acid unit, and a tricyclo nucleic acid unit. In some particular embodiments, the polynucleotide comprises a nucleotide sequence as set forth in SEQ ID NO: 24. In some embodiments, the aging-related disease comprises Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, Lewy body dementia.

[0040] In some embodiments, the inhibitor is delivered in a delivery agent. In some preferred embodiments, the delivery agent is a micelle, an exosome, a lipoid, a liposome, a lipid nanoparticle, an extracellular vesicle, or a synthetic vesicle. In some embodiments, the inhibitor is delivered by a viral vector. In some preferred embodiments, the viral vector is an AAV, an adenovirus, a retrovirus, or a lentivirus.

[0041] Another aspect of the present application provides a method of diagnosing whether a subject has a senescence-related disease or is at risk of developing a senescence-related disease, comprising a) isolating a biological sample from the subject; b) measuring the expression level of miR 1978 in the biological sample; c) comparing the expression level of miR 1978 with a reference expression level; the subject is identified to have a senescence-related disease or is at risk of developing a senescence-related disease if the expression level of miR 1978 is higher than the reference expression level.

[0042] In some embodiments, the reference expression level is from a biological sample of a normal healthy subject. In some embodiments, the miR 1978 has a nucleotide sequence as set forth in SEQ ID NO: 3. In some embodiments, the expression level is measured by in situ hybridization method. In some embodiments, the senescence-related disease comprises Alzheimer’s disease, Parkinson’s disease, amyotrophic lateral sclerosis, Lewy body dementia. BRIEF DESCRIPTION OF DRAWINGS

[0043] Figure 1 shows that the sequence of miR 1978 is perfectly matched with mtDNA sequence nt620-672, the sequence of miR 1978 is partially perfectly matched with KIF5C gene (minus strand) sequence, and the mature miR 1978 is almost perfectly matched with DHFR gene intron 2 sequence.

[0044] Figure 2 shows that overexpression of miR 1978 in SHSY5Y cell line results in retarded cell growth and development. This does not occur in SHSY5Y cells containing miR 1974 or miR 1977. Each experiment was repeated at least three times independently, and the results are presented as mean ± SEM.

[0045] Figure 3 shows that the cell cycle of SHSY5Y cells containing miR 1978 has reduced G2 / M phase cell number and increased G1 phase cell number compared to normal control SHSY5Y cells. All results were obtained from at least 3 repeated experiments.

[0046] Figure 4 shows that miR 1978 containing SHSY5Y cells have increased apoptotic cells compared to normal control SHSY5Y cells. All results were performed in at least 3 replicates. Graphs show mean ± SD (n=2, biological replicates). Statistical significance was determined by two-way ANOVA.

[0047] Figure 5 shows that the expression levels of DHFR, KIF5C and MSH3 are significantly reduced. All results were performed in at least 3 replicates. We divided the average gray value of each band by the average gray value of all bands to get the relative gray value of each band. Thus, the relative intensity of different bands was compared without being affected by the original image brightness.

[0048] Figure 6 shows that the protein levels of DHFR, KIF5C and MSH3 are significantly reduced. All results were performed in at least 3 replicates.

[0049] Figure 7 shows that miR 1978 inhibitor restores the expression levels of DHFR, KIF5C and MSH3.

[0050] Figure 8 shows that miR 1978 inhibitor restores the protein levels of DHFR, KIF5C and MSH3.

[0051] Figure 9 is a DSS analysis software for differential methylation region (DMR) analysis comparing the methylation status difference between miR 1978 containing SHSY5Y cells and their control cells. Note: the horizontal axis represents the comparison combination group, and the vertical axis represents the methylation level value. The distribution of DMR methylation level is shown in the form of violin plot. The violin plot was drawn for 10000 CG regions with high significance identified by DSS software.

[0052] Figure 10 shows that the protein levels of APP, APOE, APOE4, TAU, P-tau and SCNA are significantly increased in miR 1978 containing SHSY5Y cells.

[0053] Figure 11 shows that the protein level of GSK3 is significantly increased and the protein level of PSD95 is significantly reduced in miR 1978 containing SHSY5Y cells.

[0054] Figure 12 is the protein level of APP, TAU, P-TAU and APOE in SHSY5Y cells stably expressing exogenous miR 1978.

[0055] Figure 13 is the protein level of APP, TAU, P-TAU and APOE in wild type SHSY5Y cells.

[0056] Figure 14 is miR 1978 overexpressed in SHSY5Y cells, then differentiated into neuron-like cells. The neuron-like cells of miR 1978 lack dendritic spines, and their dendritic branch surface is smooth (A-F are fluorescence microscope 40x).

[0057] Figure 15 is the neuron-like cells of miR 1978 lack dendritic spines, and the distal axon lacks branches (A-D are confocal microscope 300x).

[0058] Figure 16 is normal control SHSY5Y cells and SHSY5Y cells overexpressing miR 1978 were stained to show that miR 1978 exists in the cytoplasm or mitochondria. The nucleus is stained with DAPI. The probe staining of anti-miR 1978 is red.

[0059] Figure 17 is the model of human aging process proposed by the present application. DETAILED DESCRIPTION

[0060] The various aspects of the present application will be described in detail below. It should be noted that the following description is not intended to limit the present application, and those skilled in the art can make any modifications or substitutions according to the following description based on the common technical knowledge in the art, without significantly affecting the technical effects of the present application.

[0061] Unless otherwise defined, all technical and scientific terms used in the present application have the same meaning as commonly understood by one of ordinary skill in the art. For the purposes of the present application, the following terms are defined below.

[0062] The terms "microRNA", "miRNA" and "miR" are synonymous and refer to a collection of non-coding single-stranded RNA molecules of approximately 19 to 28 nucleotides in length that regulate gene expression. miRNAs are found in a wide range of organisms and have been shown to play a role in development, homeostasis and disease etiology.

[0063] As used herein, a "miRNA inhibitor" refers to a compound that can decrease, alter, and / or modulate the expression, function, and / or activity of a miRNA. The miRNA inhibitor can be a polynucleotide sequence that is at least partially complementary to a target miRNA nucleic acid sequence, such that the miRNA inhibitor hybridizes to the target miRNA sequence. For example, in some aspects, a miR 1978 inhibitor of the present disclosure comprises a nucleotide sequence that is at least partially complementary to a target miR 1978 nucleic acid sequence, such that the miR 1978 inhibitor hybridizes to the miR 1978 sequence. In other aspects, hybridization of the miR 1978 inhibitor to the miR 1978 sequence decreases, alters, and / or modulates the expression, function, and / or activity of miR 1978 (e.g., hybridization results in increased expression of a DHFR protein and / or DHFR gene).

[0064] As used herein, the term "polynucleotide" refers to a polymer of nucleotides of any length, including ribonucleotides, deoxyribonucleotides, analogs thereof, or mixtures thereof.

[0065] In some aspects, the term "polynucleotide" refers to the primary structure of a molecule. Thus, it includes double- and single-stranded deoxyribonucleic acids ("DNA"), and double- and single-stranded ribonucleic acids ("RNA"). It also includes polynucleotides in modified and unmodified form.

[0066] In some aspects, the term "polynucleotide" includes polydeoxyribonucleotides (containing 2-deoxy-D-ribose); polyribonucleotides (containing D-ribose), including tRNA, rRNA, shRNA, siRNA, miRNA, and mRNA, whether spliced or unspliced; any other type of polynucleotide that is an N- or C-glycoside of a purine or pyrimidine base; and other polymers containing a positive nucleotide backbone, such as polyamides (e.g., peptide nucleic acids "PNAs") and poly-morpholino polymers; and other synthetic sequence-specific nucleic acid polymers, provided that the polymers contain nucleobases in a configuration that allows for base pairing and base stacking, as found in DNA and RNA.

[0067] In some embodiments of the disclosure, the polynucleotide can be, for example, an oligonucleotide, such as an antisense oligonucleotide. In preferred embodiments, the antisense oligonucleotide contains one or more nucleotide modifications that increase the stability of the antisense oligonucleotide in the presence of nucleases. For example, one or more of the nucleotide units of the antisense oligonucleotide can be locked nucleic acid (LNA) units. In some embodiments, one or more of the nucleotide units of the antisense oligonucleotide are 2' substituted nucleotide analogs. Additionally, one or more of the internucleoside linkages between the nucleotide units of the antisense oligonucleotide can be phosphorothioate internucleoside linkages. It will be appreciated that the antisense oligonucleotide can include one or more different types of modifications. Thus, the antisense oligonucleotide can have LNA units, 2' substituted nucleotide analogs, and phosphorothioate internucleoside linkages. Other modifications suitable to improve the therapeutic use of nucleic acids, such as RNA molecules, can also be used in the disclosed antisense oligonucleotides.

[0068] In some embodiments of the disclosure, the polynucleotide can be a single-stranded RNA that interacts with a target RNA sequence, e.g., miR 1978, to direct cleavage of the target RNA. In some embodiments of the disclosure, the polynucleotide can be a single-stranded siRNA introduced into a cell or organism to inhibit a target mRNA. Single-stranded RNAi agents bind to the RISC endonuclease Argonaute 2, which then cleaves the target mRNA. Single-stranded siRNAs are typically 15-30 nucleotides and are chemically modified.

[0069] In some embodiments of the disclosure, the polynucleotide can be a double-stranded RNA (dsRNA), referring to a complex of ribonucleic acid molecules having a double-stranded structure, comprising two antiparallel and substantially complementary nucleic acid strands, referred to as having "sense" and "antisense" orientation with respect to a target RNA, e.g., miR 1978. In some embodiments of the disclosure, double-stranded RNA (dsRNA) triggers the degradation of a target RNA through a post-transcriptional gene silencing mechanism, referred to herein as RNA interference or RNAi. Typically, a majority of the nucleotides of each strand of a dsRNA molecule are ribonucleotides, but as detailed herein, either or both of the two strands can also include one or more non-ribonucleotides, e.g., deoxyribonucleotides and / or modified nucleotides.

[0070] In some embodiments of the disclosure, the polynucleotide can be a single-stranded inverted RNA having 14-30 nucleotides that interacts with a target mRNA sequence (e.g., a miR 1978 sequence) to direct cleavage of the target RNA. The RNA can have a length in the range of 14-30 nucleotides. For example, each strand can be between 17-30 nucleotides in length, 25-30 nucleotides in length, 27-30 nucleotides in length, 17-23 nucleotides in length, 17-21 nucleotides in length, 17-19 nucleotides in length, 19-25 nucleotides in length, 19-23 nucleotides in length, 19-21 nucleotides in length, 21-25 nucleotides in length, or 21-23 nucleotides in length. For example, the sequence of the single-stranded inverted RNA can be AGAAAGGCUAGGACCAAACCU (SEQ ID NO: 24)

[0071] In some embodiments of the disclosure, the polynucleotide can be a single-stranded inverted RNA having 14-30 nucleotides that interacts with a target mRNA sequence (e.g., a miR 1978 sequence) to direct cleavage of the target RNA. The RNA can have a length in the range of 14-30 nucleotides. For example, each strand can be between 17-30 nucleotides in length, 25-30 nucleotides in length, 27-30 nucleotides in length, 17-23 nucleotides in length, 17-21 nucleotides in length, 17-19 nucleotides in length, 19-25 nucleotides in length, 19-23 nucleotides in length, 19-21 nucleotides in length, 21-25 nucleotides in length, or 21-23 nucleotides in length. For example, the sequence of the single-stranded inverted RNA can be AGAAAGGCUAGGACCAAACCU (SEQ ID NO: 24)

[0072] The sense strand and the antisense strand typically form a duplex double-stranded RNA ("dsRNA") having a duplex region that can have a length of 12-30 nucleotide pairs. For example, the duplex region can be between 14-30 nucleotide pairs in length, 17-30 nucleotide pairs in length, 27-30 nucleotide pairs in length, 17-23 nucleotide pairs in length, 17-21 nucleotide pairs in length, 17-19 nucleotide pairs in length, 19-25 nucleotide pairs in length, 19-23 nucleotide pairs in length, 19-21 nucleotide pairs in length, 21-25 nucleotide pairs in length, or 21-23 nucleotide pairs in length. In another example, the duplex region has a length selected from 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27 nucleotides. For example, the sequence of the double-stranded RNA can be, sense strand AGGUUUGGUCCUAGCCUUUCU (SEQ ID NO: 22); antisense strand AGAAAGGCUAGGACCAAACCU (SEQ ID NO: 23).

[0073] The terms "complementary" and "complementarity" refer to the pairing of two or more oligomers (i.e., each comprising a sequence of nucleobases) to one another, or between an oligomer and a target gene, by Watson-Crick base pairing. For example, the nucleobase sequence "T-G-A (5'→ 3')" is complementary to the nucleobase sequence "A-C-T (3'→ 5')". Complementarity can be "partial," in which less than all of the nucleobases of a given nucleobase sequence match with another nucleobase sequence, according to the rules of base pairing. For example, in some aspects, the complementarity between a given nucleobase sequence and another nucleobase sequence can be about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%. Thus, in certain aspects, the term "complementary" refers to at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% match or complementarity to a target nucleic acid sequence (e.g., a miR-485 nucleic acid sequence). Alternatively, there can be "complete" or "perfect" (100%) complementarity between a given nucleobase sequence and another nucleobase sequence to continue the example. In some aspects, the degree of complementarity between nucleobase sequences has a significant effect on the efficiency and strength of hybridization between the sequences.

[0074] As used herein, the term "inhibit" can be used interchangeably with "reduce," "silence," "down-regulate," "suppress," and other similar terms, and includes inhibition at any level.

[0075] As used herein, the term "pharmaceutical composition" refers to one or more compounds described herein, such as, for example, a miRNA inhibitor of the disclosure, in admixture or suspension with one or more other chemical components, such as pharmaceutically acceptable carriers and excipients. One object of a pharmaceutical composition is to facilitate administration of a formulation comprising a miRNA inhibitor of the disclosure to a subject.

[0076] The terms "pharmaceutically acceptable carrier," "pharmaceutically acceptable excipient," and variations thereof, encompass any dosage and carrier acceptable for use in animals, including humans, and does not encompass any components, which would produce an adverse physiological effect or react with the miRNA inhibitor in such a way as to impair the efficacy of the miRNA inhibitor or the biological activity and properties of the administered compound. Included are excipients and carriers that are acceptable for use in pharmaceutical compositions and are generally safe, nontoxic, and desirable.

[0077] As used herein, the term "therapeutically effective amount" refers to the amount of an agent or pharmaceutical compound comprising a miRNA inhibitor of the disclosure that is sufficient to effect a desired therapeutic, pharmacological, and / or physiological effect in a subject in need thereof. In prophylaxis can be considered therapy, a therapeutically effective amount can be a "prophylactically effective amount."

[0078] As used herein, the term "treatment" refers to, e.g., a reduction in severity of a disease or condition; a shortening of the duration of a course of a disease; an improvement or elimination of one or more symptoms associated with a disease or condition; providing a beneficial effect to a subject with a disease or condition, but not necessarily curing the disease or condition. The term also includes prophylaxis or prevention of a disease or condition or symptoms thereof.

[0079] The term "administering" and variants thereof, refer to introducing a composition, such as a miRNA inhibitor of the disclosure, into a subject by a pharmaceutically acceptable route. A composition, such as a micelle comprising a miRNA inhibitor of the disclosure, is introduced into a subject by any suitable route, including intratumorally, orally, pulmonarily, intranasally, parenterally (intravenously, intraarterially, intramuscularly, intraperitoneally, or subcutaneously), rectally, intralymphatically, intrathecally, periocularly, or topically. Administration includes self-administration and administration by another person. A suitable route of administration allows the composition or agent to perform its intended function. For example, if a suitable route is intravenously, the composition is administered by introducing it into a vein of the subject.

[0080] "Risk" is understood to be the likelihood that a subject or patient will develop or reach a certain disease outcome. In the context of the present invention, the term "risk" is not intended to carry any positive or negative connotations with respect to the health of the patient, but only the probability or likelihood of developing or forming a given event or condition.

[0081] In the context of the present invention, a "sample" or "biological sample" is a sample derived from or that has been in contact with a biological organism. Examples of biological samples are: cells, tissues, bodily fluids, biopsy samples, blood, urine, saliva, sputum, plasma, serum, cell culture supernatants, and others.

[0082] Materials and Methods

[0083] 1. Cells and Cell Culture

[0084] SHSY5Y cells were obtained from the China Typical Culture Collection Center (CCTCC). Before use, they were tested and confirmed to be free of mycoplasma contamination. They were cultured in high glucose DMEM / F12 medium (purchased from HyClone) supplemented with 10% fetal bovine serum (FBS, purchased from Tianhang Biological) and 1% penicillin-streptomycin solution (purchased from Kagi Biological) in a 5% CO2 incubator (purchased from ESCO) at 37°C.

[0085] 2. CCK-8 assay

[0086] Cells were cultured and treated in 96-well plates according to the manufacturer's instructions. Cell proliferation was assessed by CCK-8 assay (Bi Yun Tian Biotechnology, C0039) at multiple time points (days 1, 2, 3, 4, 5, 6, and 7) according to the instructions. Briefly, 10 μl of CCK-8 reagent was added to each well containing 90 μl of medium, and the plate was incubated at 37°C for 1 hour, and then the absorbance at 450 nm was detected by a microplate reader (Bio-Rad, Hercules, CA, USA). Statistical analysis was performed using the appropriate statistical test (Student's t-test) to compare differences between treatment groups.

[0087] 3. RNA extraction and RT-qPCR

[0088] Total RNA was extracted using Trizol Reagent (Invitrogen) according to the manufacturer's instructions. Reverse transcription (RT) reactions were performed according to the instructions of the FastQuant RT Kit (with gDNase) (Tiangen). The RT-qPCR system was prepared according to the instructions of the SYBR® Premix Ex Taq™ II (Tli RNase H- ) (Takara) and Cham Q™ Star Green Master Mix (Vazyme). The ΔCT values were measured and recorded using an ABI 7500 instrument. The relative quantity of each miRNA was normalized to the quantity of U6 using the ΔΔCT method. Similarly, the relative quantity of each mRNA was normalized to the quantity of tubulin using the ΔΔCT method. Student's t-test results showed that there were significant differences in the expression levels of the two genes under our experimental conditions, represented by * (p < 0.05), ** (p < 0.01), and *** (p < 0.001). The primer sequences are shown in Table 1.

[0089] Table 1

[0090] Table 1

[0091] 4. Western Blot analysis

[0092] ​The cultured SHSY5Y cells were lysed in radioimmunoprecipitation assay (RIPA) buffer with 1 mM phenylmethylsulfonyl fluoride on ice for 1 hour, and total protein was extracted and quantified using the BCA method. Equal amounts of protein were loaded onto 12% SDS-PAGE gels and then transferred to PVDF membranes. After blocking with 5% skim milk in 0.1% Tween-phosphate-buffered saline (PBST) at room temperature for 2 hours, the membranes were incubated with primary antibodies (as shown in Table 2) at 4°C overnight, followed by washing with PBST at room temperature for 15 minutes three times. Subsequently, the membranes were incubated with appropriate HRP-conjugated secondary antibodies at a dilution of 1:5000 for 1 hour. Then the membranes were washed with PBST and detected using a Tanon 2500 chemiluminescence imaging system (Tanon).

[0093] The antibodies used are shown in Table 2.

[0094] Table 2

[0095] We performed a comparative normalization analysis of the bands in the Western blot (WB) experiments to ensure the accuracy and reproducibility of the results. First, we analyzed the gray value of each band using ImageJ software and calculated the average gray value of each band. Then, we divided the average gray value of each band by the average gray value of all bands to get the relative gray value of each band. In this way, we can compare the relative intensity of different bands without being affected by the original image brightness.

[0096] Next, we used GraphPad Prism software to perform statistical analysis on the relative gray values. We compared the band intensities under different experimental conditions using one-way ANOVA and used Tukey's post-hoc test to determine which conditions showed significant differences. We also calculated the mean relative gray value and standard deviation for each condition to assess the dispersion of the results. By performing comparative normalization analysis and statistical analysis, we can more accurately compare the WB experiment results under different experimental conditions and determine which conditions show significant differences. This helps us better understand the experimental data and draw more reliable conclusions.

[0097] 5. Plasmid construction and lentivirus transfection

[0098] According to the manufacturer's instructions, miRNAs were transfected at a concentration of 100 nM using Lipofectamine 2000 transfection reagent (purchased from Invitrogen). The miRNAs used, miR 1978, miR 1974 and miR 1977, were synthesized by Hanheng Biotechnology, Shanghai, China. The target vector used for transfection was pHBLV-CMV-MCS-EF1-ZsGreen-T2A-puro (purchased from Hanheng Biotechnology, Shanghai).

[0099] The miRNA sequences are shown in Table 3.

[0100] Table 3

[0101] SHSY5Y cells were co-transfected with the following three plasmids: 10 pg of vector plasmid carrying HA-RNA, 10 pg of virus packaging helper plasmid (psPAX2 vector) and 5 pg of virus packaging helper plasmid (pMD2G vector) using 75 pl of LipoFiter™ transfection reagent (Hanheng Biotechnology).

[0102] Empty lentivirus and lentivirus containing miR1974, miR 1977 or miR 1978 plasmids were overexpressed in SHSY5Y cells for 7 days and the OD450nm value was detected by CCK-8 assay to obtain the target cell line.

[0103] The primer sequences are as follows:

[0104] LV-HSA-miR 1978-E / B-F: tactagaggatcttccggtgaattcatctccaaccacccccg (SEQ ID NO: 4);

[0105] LV-HSA-miR 1978-E / B-R: atccttactatatcgatggatccgtggctaacgttttgagct (SEQ ID NO: 5);

[0106] hsa-miR-1977P: UGAUUAGGGUGCUUAGCUGUUA (SEQ ID NO: 20);

[0107] hsa-miR-1974 MIMAT0009449: GUGGUUGUAGUCCGUGCGAGAAU (SEQ ID NO: 21).

[0108] 6. Cell cycle (flow cytometry)

[0109] The cell cycle analysis kit (Biyuntian, Cat. No. C1052) was used for cell cycle analysis. Cells were collected and fixed in 70% ethanol at 4°C for 2 hours and then stained with a solution containing propidium iodide (0.05 mg / ml), RNase A (1 mg / ml) and 0.3% Triton X-100 for 30 minutes in the dark. DNA content (propidium iodide intensity) was measured by flow cytometry (Beckman Coulter) to measure the DNA content indicated by propidium iodide intensity. ModFIT software was used to determine the number of cells in G1 phase, S phase and G2 / M phase. Each experiment was repeated three times independently to ensure the reliability of the results. We also compared the cell cycle distribution under different experimental conditions using one-way ANOVA and determined which conditions showed significant differences using Student's t-test.

[0110] 7. Apoptosis

[0111] Cell apoptosis was assessed using the Annexin V-FITC / PI Apoptosis Detection Kit (Beyotime) and an Accuri C6 flow cytometer (BD Biosciences) according to the manufacturer's instructions. We performed statistical analysis using the Student's t-test to determine whether there was a significant difference in the percentage of apoptosis between the two treatment conditions. The Student's t-test showed a significant difference in the apoptosis rate between the two treatment conditions in this experiment (p < 0.05).

[0112] 8. Methylation Analysis

[0113] SHSY5Y cell suspension was collected and total DNA was extracted using the Tiangen DNA extraction kit according to the manufacturer's instructions. TM Kit (Zymo Research) was used to construct the extracted genomic DNA library. DNA was purified using the AMPure XP system to obtain labeled DNA. TM Whole-genome bisulfite sequencing was performed using the Methyl-Seq kit on an Illumina novaseq 2500. The generated raw data (raw data or raw reads) were stored in the FASTQ (fq) file format. After passing quality assessment, data optimization was performed using Trimmomatic software, and methylation data were compared with the reference genome using Bsmap software. DNA methylation profiles were obtained for the SHSY5Y cell line transfected with miR 1978 and the control group. Gene enrichment analysis for DMRs (P < 0.05) was performed using the GO (Gene Ontology) and KEGG (Kyoto Encyclopedia of Genes and Genomes) databases, with a significance level of P < 0.05.

[0114] 9. Retinoic acid induction

[0115] Human SHSY5Y neuroblastoma cells were obtained from the National Collection of Authenticated Cell Cultures, Shanghai, China. Cells were cultured in L-glutamine-free DMEM / F-12 medium (Invitrogen) supplemented with 0.5% fetal calf serum (FCS), 100 U / ml penicillin (Sigma) and 0.1 mg / ml streptomycin (Sigma) for 8 days at 37°C and 5% CO2. Cells were grown in 12-well plates coated with 0.1 mg / ml poly-L-lysine (PLL, Sigma) and 1 mg / ml growth factor-reduced phenol red-free medium (BD Biosciences). 60,000 cells were plated per well. SHSY5Y cells were cultured in medium supplemented with 2 μΜ all-trans retinoic acid (RA, Sigma).

[0116] 10. Anti-miR (miRNA inhibitor) transfection

[0117] In this study, we used 100 nM of miRNA-1978, miRNA-1978 mimic and inhibitor and determined that this concentration was sufficient to produce its long-term biological effects. After 72 hours of culture, cells were collected for analysis of miRNA-1978 to determine the phenotypes of various genes and proteins. The miRNA mimic and miRNA inhibitor of miRNA-1978 were synthesized from Hanheng Company (Shanghai, China).

[0118] miRNA mimic: sense strand, AGGUUUGGUCCUAGCCUUUCU (SEQ ID NO: 22); antisense strand, AGAAAGGCUAGGACCAAACCU (SEQ ID NO: 23).

[0119] miRNA inhibitor: single-stranded reverse RNA, AGAAAGGCUAGGACCAAACCU (SEQ ID NO: 24).

[0120] 11. H4F rescue experiment

[0121] Cultured SHSY5Y cells were maintained in the appropriate growth medium with the addition of 15 nM tetrahydrofolate (H4F) to achieve the desired concentration. The cell experiment mainly studied the effect of H4F at a concentration of 15 nM. Cells overexpressing miR1978 were cultured in growth medium supplemented with H4F. After 7 days of culture, cells were harvested for subsequent Western blot analysis.

[0122] 12. Confocal microscopy

[0123] Images of apical secondary and tertiary dendrites of eGFP-transfected SHSY5Y neurons were acquired using a Leica Laser Scanning Confocal Microscope equipped with a 100x, 1.4 NA oil immersion lens. eGFP was excited with a 488 nm argon laser and detected using a standard FITC filter. Optical sections on the z-axis were acquired at 0.1 pm intervals.

[0124] 13. RNA FISH

[0125] RNA fluorescence in situ hybridization (FISH) was performed according to the protocol described in Carmichael (2015) for the study of regulatory non-coding RNAs, with some modifications. Custom-designed Fluor Red 610-Oligo nucleotide probes (5'- AGGUUUGGUCCUAGCCUUUCU-3') (SEQ ID NO: 22) against the target miRNA were synthesized by Shanghai Sain-BioTechnique Co., Ltd. Cultured cells were seeded in 6-well glass slides and fixed with paraformaldehyde. The slides were then pre-hybridized, including 0.01% proteinase K digestion in 0.01 M hydrochloric acid (20 min, 37°C), followed by a brief wash in 0.1 M glycine rinse. Subsequently, the slides were fixed in 4% formaldehyde for 10 min at room temperature and washed three times with PBS. Acetylation was performed by washing the slides with acetic anhydride (ph 8.0) for 5 min at room temperature (to reduce background), repeated twice. Then, the slides were washed with PBS and 5x SSC (pH = 7.5) for 1 min each, respectively. For hybridization, the slides were covered with hybridization solution and incubated in a humidified chamber at 65°C for 1 h. The hybridization mixture contained 500 ng / mL of Fluor Red 610 probe. The slides were then covered and incubated in a hybridization oven at 62°C for 2 h. After hybridization, the slides were washed with 2x SSC (pH = 7.5) for 1 min at room temperature and with PBS twice. To visualize the nuclei, the slides were stained with DAPI, anti-quenching agents were added, and observed under a fluorescence microscope (Olympus, Japan). The absence of signal when the sample was pre-treated with RNase confirmed the specificity of the RNA signal.

[0126] Example 1: miR 1978 affects growth and development of SHSY5Y cell line

[0127] Recently, three miRNAs, miR 1978, miR 1974 and miR 1977, were found to be potentially derived from mitochondria (Bandiera, S., et al., Nuclear outsourcing of RNA interference components to human mitochondria. PLoS One, 2011. 6(6): p. e20746). To verify the function of these mitochondrially derived miRNAs after entering the cytoplasm or nucleus, we constructed viral plasmids containing miR 1978, miR 1974 and miR 1977 with GFP or RFP and let them express in SHSY5Y cell lines.

[0128] The experimental results show that the cells containing miR 1978 grow and multiply slowly, the number of senescent cells increases, and then gradually die. These phenomena are not found in SHSY5Y cell lines containing miR 1974 and miR 1977 (Figure 2).

[0129] Cell cycle experiments show that the number of cells in the G2 / M phase in SHSY5Y cells decreases (Figure 3). Compared with normal control SHSY5Y cells, the cell cycle of SHSY5Y cells containing miR 1978 has a decreased number of G2 / M phase cells and an increased number of G1 phase cells.

[0130] Further apoptosis experiments show that SHSY5Y cells containing miR 1978 have an increased number of apoptotic cells (Figure 4).

[0131] Further in situ hybridization experiments show that miR 1978 can exist in the cytoplasm or mitochondria (Figure 16).

[0132] Example 2: miR 1978 affects the expression and protein levels of DHFR, KIF5C and MSH3 genes

[0133] By comparing with the sequence of humans, we found that the mature miR 1978 sequence is almost completely matched with the intron 2 sequence of the DHFR gene, with only one nucleotide difference (Figure 1). We speculate that miR 1978 can inhibit the expression of DHFR. Our further experiments confirmed this hypothesis. Compared with normal SHSY5Y cells, SHSY5Y cells overexpressing miR 1978 significantly reduced the expression of the DHFR gene and the level of protein production (Figures 5 and 6). This indicates that miR 1978 can affect the expression and translation of the nuclear gene DHFR, and thus affect the function of the cell.

[0134] Since miR 1978 has 53 nucleotide sequences that 100% match with part of the sequence of KIF5C gene (negative strand) (Figure 1), we hypothesized that miR 1978 might affect the expression of KIF5C gene and its protein production. Our experiments confirmed this hypothesis. The gene expression and protein content of KIF5C in miR 1978 SHSY5Y cells were significantly reduced (Figure 5 and Figure 6)

[0135] Since DHFR and MSH3 (MutS homolog 3) share the same promoter, it was reported that altered transcription from the DHFR locus can simultaneously affect the expression of MSH3 (Drummond, J. T., Genomic amplification of the human DHFR / MSH3 locus remodels mismatch recognition and repair activities. Adv Enzyme Regul, 1999. 39: p. 129-41). Blast results showed that part of miR 1978 is very close to the genomic sequence of MSH3 gene (2607 bp deletion) (Figure 1). Our experiments showed that the expression level of MSH3 by quantitative PCR was significantly reduced, and the protein level of MSH3 in SHSY5Y cells containing miR 1978 was significantly reduced (Figure 5 and Figure 6).

[0136] Example 3: miR 1978 inhibitor restored the expression and protein levels of DHFR, KIF5C and MSH3 genes in cells containing miR 1978

[0137] To further confirm that the reduction of expression and protein levels of DHFR, KIF5C and MSH3 is caused by miR 1978, we designed and synthesized an inhibitor of single-stranded reverse RNA miR 1978 (SEQ ID NO: 24, AGAAAGGCUAGGACCAAACCU) that can inhibit miR 1978 in cells, and introduced it into SHSY5Y cells together with miR 1978. When the selected SHSY5Y cells stably expressing exogenous miR 1978 (hereinafter referred to as cells containing miR 1978) were added with these miR 1978 inhibitors, the mRNA or protein levels of DHFR, KIF5C and MSH3 in these cells containing miR 1978 inhibitors were improved compared with cells without miR 1978 inhibitors, which confirmed that miR 1978 might play a role in affecting the expression of DHFR, KIF5C and MSH3.

[0138] Quantitative PCR showed (Figure 7) that there were differences in the expression levels of KIF5C, DHFR and MSH3 between CON+NC and miR 1978+NC, with p values of 0.0051, 0.001 and 0.0009, respectively; quantitative PCR showed that there were differences in the expression levels between miR 1978+NC and miR 1978+inhibitor, with p values of 0.0035, 0.026 and 0.042, respectively.

[0139] Western Blot showed (Figure 8) that there were differences in the protein levels of KIF5C, DHFR and MSH3 between CON+NC and miR 1978+NC, with p values of 0.0044.0, 0.0201, 0.0043, respectively; Western blot showed that there were differences in the expression levels between miR 1978+NC and miR 1978+inhibitor, with p values of 0.006, 0.0015, 0.0011, respectively.

[0140] wherein CON+NC represents normal SHSY5Y cells, miR 1978+NC represents SHSY5Y cells containing miR 1978, CON+inhibitor represents normal SHSY5Y cells containing inhibitor, and miR 1978+inhibitor represents miR 1978 SHSY5Y cells containing inhibitor.

[0141] Example 4: Abnormal methylation status of SHSY5Y cells containing miR 1978

[0142] DHFR catalyzes the reduction of 7,8-dihydrofolic acid to 5,6,7,8-tetrahydrofolic acid. Lack of DHFR will lead to a lack of 5,6,7,8-tetrahydrofolic acid (H4F) in cells. The main function of H4F is to act as a metal donor and provide a metal group (CH3) for DNA metabolism. This methyl group forms methionine with homocysteine (Hcy) and S-adenosyl-L-methionine (SAM). SAM is a global methyl donor for many methylation reactions, including the synthesis of phosphatidylcholine, methylation of DNA and histones. Tetrahydrofolate deficiency will lead to a decrease in SAM, which can lead to abnormal methylation status of nuclear DNA and histones, which in turn affects the stability of chromosomes and DNA, and thus the expression of related genes (Abali, E. E., et al., Regulation of human dihydrofolate reductase activity and expression. Vitam Horm, 2008. 79: p. 267-92).

[0143] We investigated the methylation status of the SHSY5Y cells containing miR 1978. The experimental results show that the SHSY5Y cells containing miR 1978 have different DNA methylation status from the control cells, and the methylation CG region of the SHSY5Y cells is significantly down-regulated (Figure 9).

[0144] Example 5: The levels of proteins related to neurodegenerative diseases are changed in the SHSY5Y cells containing miR 1978, which are similar to the changes in human Alzheimer's disease or Parkinson's disease

[0145] It has been reported that age is associated with global loss of DNA methylation (Poon, C.H., L.S.R. Tse, and L.W. Lim, DNA methylation in the pathology of Alzheimer's disease: from gene to cognition. Ann N Y Acad Sci, 2020. 1475(1): p. 15-33; Drinkwater, R.D., et al., Human lymphocytes aged in vivo have reduced levels of methylation in transcriptionally active and inactive DNA. Mutat Res, 1989. 219(1): p. 29-37), and there is some data suggesting that homocysteine and abnormal DNA methylation are involved in the mechanism of AD (Robinson, N., P. Grabowski, and I. Rehman, Alzheimer's disease pathogenesis: Is there a role for folate?Mech Ageing Dev, 2018. 174: p. 86-94; Qazi, T.J., et al., Epigenetics in Alzheimer's Disease: Perspective of DNA Methylation. Mol Neurobiol, 2018. 55(2): p. 1026-1044). Since miR 1978 can affect the level of DHFR protein and its downstream functions, and it has been found that nuclear DNA undergoes abnormal methylation status, we speculate that this abnormal methylation status may further affect the level of gene expression and protein synthesis in the nucleus.

[0146] The experimental results show that the SHSY5Y cell line containing miR 1978 has significantly altered (increased or decreased) protein levels. For example, the protein levels of APP, Tau, and APOE, which are associated with the pathological mechanisms of Alzheimer's disease, are increased (Figure 10). We also found that the levels of Tau protein (e.g., pTau181 and pTau217) in SHSY5Y cells containing miR978 were significantly increased (Figure 10). In addition, we also found that the protein level of GSK3B in SHSY5Y cells containing miR978 was significantly increased (Figure 11). It is well known that GSK3B is found to be abnormally active in the brains of AD patients, and there is compelling evidence to support its role in AD pathology (Lauretti, E., O. Dincer, and D. Praticò, Glycogen synthase kinase-3 signaling in Alzheimer's disease. Biochim Biophys Acta Mol Cell Res, 2020. 1867(5): p. 118664). In addition, we also found that the protein level of PSD95, a protein involved in synaptic plasticity of glutamatergic synapses, was decreased in SHSY5Y cell lines containing miR978 (Figure 11). Further studies have also found that the level of alpha-synuclein (encoded by the SNCA gene), which is mainly involved in the pathological mechanisms of PD, is significantly increased in SHSY5Y cells containing miR978 (Figure 10).

[0147] Example 6: miR 1978 inhibitor and H4F reduce the increased levels of APP, TAU, P-TAU, and APOE proteins in cells containing miR 1978

[0148] We further explored whether the miR 1978 inhibitor could reduce the increased levels of Alzheimer's disease-related proteins. After the single-stranded reverse RNA miR 1978 inhibitor (SEQ ID NO: 24, AGAAAGGCUAGGACCAAACCU) was introduced into selected stable SHSY5Y cells containing miR 1978, these miR 1978 inhibitor-containing cells reduced the protein levels of APP, TAU, P-TAU, and APOE proteins compared to SHSY5Y cells without miR 1978 inhibitor (Figure 12). In addition, when the miR 1978 was introduced into the SHSY5Y cells for 3 days, the miR 1978 inhibitor was added and cultured for 7 days, the increased levels of APP, TAU, P-TAU, and APOE proteins were significantly lower than the cells that introduced miR 1978 but did not add miR 1978 inhibitor (Figure 13).

[0149] We speculate that miR 1978 can hinder the synthesis of DHFR, leading to tetrahydrofolate reduction, further reducing its downstream pathways. Therefore, if SHSY5Y cells are cultured with tetrahydrofolate (H4F), this process can be reduced. Our experiments confirmed this idea, as shown in Figure 12, when H4F was added to stable SHSY5Y cells containing miR 1978, these cells containing H4F reduced the protein levels of APP, TAU, P-TAU, and APOE compared to stable miR 1978 SHSY5Y cells without FH4. Likewise, when miR 1978 was transferred into SHSY5Y cells for 3 days, H4F was added and cultured for 7 days, the increased levels of Tau, p-tau, APP, and APOE were significantly lower than the miR 1978 transfer group without the addition of H4F (Figure 13).

[0150] Example 7: Dendritic spines are absent in neuron-like cells from SHSY5Y containing miR 1978

[0151] The dendritic spine lake of neurons is a major pathological basis of Alzheimer's disease. We found that the expression of KIF5C and PSD95 was significantly reduced in SHSY5Y cells containing miR 1978. Because KIF5C is considered a key mechanism of structural plasticity and memory, and PSD-95 is a neuronal PDZ protein associated with receptors and cytoskeletal elements at synapses. We speculate that miR 1978 can affect the formation of neuronal dendritic spines.

[0152] We studied the role of miR 1978 in neuron-like cells by retinoic acid (RA) induction of selected stable SHSY5Y cells containing miR 1978 as neuron-like cells. The experimental results show that when SHSY5Y cells are induced to become neuron-like cells, the dendritic shafts of neuron-like cells of SHSY5Y cells expressing miR 1978 are smooth and lack dendritic spines compared to normal controls (Figures 14 and 15).

Claims

1. Use of a miR 1978 inhibitor in the preparation of a drug for treating aging-related diseases.

2. The use according to claim 1, characterized in that The inhibitor is a polynucleotide that is at least partially complementary to miR1978.

3. The use according to claim 2, characterized in that The polynucleotide is single-stranded or double-stranded.

4. The use according to claim 2, characterized in that The miR 1978 has a nucleotide sequence as shown in SEQ ID NO:

3.

5. The use according to claim 4, characterized in that The polynucleotide is complementary to at least 12 bases of the nucleotide sequence described in SEQ ID NO:

3.

6. The use according to claim 5, characterized in that The polynucleotide is 14 to 30 nucleotides in length.

7. The use according to claim 5, characterized in that The polynucleotide comprises a modified internucleotide linkage selected from the group consisting of phosphoramidate, phosphorothioate, phosphorodithioate, boranophosphate, alkylphosphonate, and methylenemethylimine.

8. The use according to claim 5, characterized in that The polynucleotide agent comprises a modified nucleic acid unit selected from the group consisting of a locked nucleic acid unit, a 2'-O-alkyl ribonucleic acid unit, a 2'amine ribonucleic acid unit, a peptide nucleic acid unit, a 2'fluoro ribonucleic acid unit, a morpholino nucleic acid unit, a cyclohexane nucleic acid unit, and a tricyclic nucleic acid unit.

9. The use according to claim 5, characterized in that The polynucleotide comprises the nucleotide sequence shown in SEQ ID NO:

24.

10. The use according to any one of claims 1 to 9, characterized in that The aging-related diseases include Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, and Lewy body dementia.

11. Use of a compound capable of upregulating DHFR gene and / or DHFR protein levels in the preparation of a drug for treating aging-related diseases.

12. The use according to claim 11, characterized in that The compound upregulates DHFR gene and / or DHFR protein levels by inhibiting miR 1978.

13. The use according to claim 12, wherein the compound is a polynucleotide that is at least partially complementary to miR 1978.

14. The use according to claim 13, characterized in that The polynucleotide is single-stranded or double-stranded.

15. The use according to claim 13, characterized in that The miR 1978 has a nucleotide sequence as shown in SEQ ID NO:

3.

16. The use according to claim 15, characterized in that The polynucleotide is complementary to at least 12 bases of the nucleotide sequence described in SEQ ID NO:

3.

17. The use according to claim 15, characterized in that The polynucleotide is 14 to 30 nucleotides in length.

18. The use according to claim 15, characterized in that The polynucleotide comprises a modified internucleotide linkage selected from the group consisting of phosphoramidate, phosphorothioate, phosphorodithioate, boranophosphate, alkylphosphonate, and methylenemethylimine.

19. The use according to claim 15, characterized in that The polynucleotide agent comprises a modified nucleic acid unit selected from the group consisting of a locked nucleic acid unit, a 2'-O-alkyl ribonucleic acid unit, a 2'amine ribonucleic acid unit, a peptide nucleic acid unit, a 2'fluoro ribonucleic acid unit, a morpholino nucleic acid unit, a cyclohexane nucleic acid unit, and a tricyclic nucleic acid unit.

20. The use according to claim 15, characterized in that The polynucleotide comprises the nucleotide sequence shown in SEQ ID NO:

24.

21. The use according to any one of claims 11 to 20, characterized in that The aging-related diseases include Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, and Lewy body dementia.

22. Use of a compound capable of upregulating the level of KIF5C gene and / or KIF5C protein in the preparation of a drug for treating aging-related diseases.

23. The use according to claim 22, characterized in that The compound upregulates the KIF5C gene and / or KIF5C protein level by inhibiting miR 1978.

24. The use according to claim 23, wherein the compound is a polynucleotide that is at least partially complementary to miR 1978.

25. The use according to claim 24, characterized in that The polynucleotide is single-stranded or double-stranded.

26. The use according to claim 24, characterized in that The miR 1978 has a nucleotide sequence as shown in SEQ ID NO:

3.

27. The use according to claim 26, characterized in that The polynucleotide is complementary to at least 12 bases of the nucleotide sequence described in SEQ ID NO:

3.

28. The use according to claim 26, characterized in that The polynucleotide is 14 to 30 nucleotides in length.

29. The use according to claim 26, characterized in that The polynucleotide comprises a modified internucleotide linkage selected from the group consisting of phosphoramidate, phosphorothioate, phosphorodithioate, boranophosphate, alkylphosphonate, and methylenemethylimine.

30. The use according to claim 26, wherein The polynucleotide agent comprises a modified nucleic acid unit selected from the group consisting of a locked nucleic acid unit, a 2'-O-alkyl ribonucleic acid unit, a 2'amine ribonucleic acid unit, a peptide nucleic acid unit, a 2'fluoro ribonucleic acid unit, a morpholino nucleic acid unit, a cyclohexane nucleic acid unit, and a tricyclic nucleic acid unit.

31. The use according to claim 26, wherein The polynucleotide comprises the nucleotide sequence shown in SEQ ID NO:

24.

32. The use according to any one of claims 22 to 31, characterized in that The aging-related diseases include Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, and Lewy body dementia.

33. Use of a compound capable of upregulating the level of the MSH3 gene and / or MSH3 protein in the preparation of a medicament for treating aging-related diseases.

34. The use according to claim 33, wherein The compound upregulates the MSH3 gene and / or MSH3 protein level by inhibiting miR 1978.

35. The use according to claim 34, wherein the compound is a polynucleotide that is at least partially complementary to miR 1978.

36. The use according to claim 35, characterized in that The polynucleotide is single-stranded or double-stranded.

37. The use according to claim 35, wherein The miR 1978 has a nucleotide sequence as shown in SEQ ID NO:

3.

38. The use according to claim 37, wherein The polynucleotide is complementary to at least 12 bases of the nucleotide sequence described in SEQ ID NO:

3.

39. The use according to claim 37, wherein The polynucleotide is 14 to 30 nucleotides in length.

40. The use according to claim 37, wherein The polynucleotide comprises a modified internucleotide linkage selected from the group consisting of phosphoramidate, phosphorothioate, phosphorodithioate, boranophosphate, alkylphosphonate, and methylenemethylimine.

41. The use according to claim 37, wherein The polynucleotide agent comprises a modified nucleic acid unit selected from the group consisting of a locked nucleic acid unit, a 2'-O-alkyl ribonucleic acid unit, a 2'amine ribonucleic acid unit, a peptide nucleic acid unit, a 2'fluoro ribonucleic acid unit, a morpholino nucleic acid unit, a cyclohexane nucleic acid unit, and a tricyclic nucleic acid unit.

42. The use according to claim 37, wherein The polynucleotide comprises the nucleotide sequence shown in SEQ ID NO:

24.

43. The use according to any one of claims 33 to 42, characterized in that The aging-related diseases include Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, and Lewy body dementia.

44. Use of a compound capable of reducing abnormal methylation of cells in the preparation of a drug for treating aging-related diseases.

45. The use according to claim 44, characterized in that The compound reduces abnormal cellular methylation by inhibiting miR 1978.

46. ​​The use according to claim 45, wherein the compound is a polynucleotide at least partially complementary to miR 1978.

47. The use according to claim 46, wherein The polynucleotide is single-stranded or double-stranded.

48. The use according to claim 46, wherein The miR 1978 has a nucleotide sequence as shown in SEQ ID NO:

3.

49. The use according to claim 48, wherein The polynucleotide is complementary to at least 12 bases of the nucleotide sequence described in SEQ ID NO:

3.

50. The use according to claim 48, wherein The polynucleotide is 14 to 30 nucleotides in length.

51. The use according to claim 48, wherein The polynucleotide comprises a modified internucleotide linkage selected from the group consisting of phosphoramidate, phosphorothioate, phosphorodithioate, boranophosphate, alkylphosphonate, and methylenemethylimine.

52. The use according to claim 48, wherein The polynucleotide agent comprises a modified nucleic acid unit selected from the group consisting of a locked nucleic acid unit, a 2'-O-alkyl ribonucleic acid unit, a 2'amine ribonucleic acid unit, a peptide nucleic acid unit, a 2'fluoro ribonucleic acid unit, a morpholino nucleic acid unit, a cyclohexane nucleic acid unit, and a tricyclic nucleic acid unit.

53. The use according to claim 48, wherein The polynucleotide comprises the nucleotide sequence shown in SEQ ID NO:

24.

54. The use according to any one of claims 44 to 53, wherein The aging-related diseases include Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, and Lewy body dementia.

55. Use of a compound capable of increasing the structure of neuronal dendritic spines in the preparation of a drug for treating aging-related diseases.

56. The use according to claim 55, characterized in that The compound increases neuronal dendritic spine structure by inhibiting miR 1978.

57. The use according to claim 56, wherein the compound is a polynucleotide at least partially complementary to miR 1978.

58. The use according to claim 57, wherein The polynucleotide is single-stranded or double-stranded.

59. The use according to claim 57, wherein The miR 1978 has a nucleotide sequence as shown in SEQ ID NO:

3.

60. The use according to claim 59, wherein The polynucleotide is complementary to at least 12 bases of the nucleotide sequence described in SEQ ID NO:

3.

61. The use according to claim 59, wherein The polynucleotide is 14 to 30 nucleotides in length.

62. The use according to claim 59, wherein The polynucleotide comprises a modified internucleotide linkage selected from the group consisting of phosphoramidate, phosphorothioate, phosphorodithioate, boranophosphate, alkylphosphonate, and methylenemethylimine.

63. The use according to claim 59, wherein The polynucleotide agent comprises a modified nucleic acid unit selected from the group consisting of a locked nucleic acid unit, a 2'-O-alkyl ribonucleic acid unit, a 2'amine ribonucleic acid unit, a peptide nucleic acid unit, a 2'fluoro ribonucleic acid unit, a morpholino nucleic acid unit, a cyclohexane nucleic acid unit, and a tricyclic nucleic acid unit.

64. The use according to claim 59, wherein The polynucleotide comprises the nucleotide sequence shown in SEQ ID NO:

24.

65. The use according to any one of claims 55 to 64, characterized in that The aging-related diseases include Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, and Lewy body dementia.

66. Use of a detection reagent for miR 1978 in the preparation of a diagnostic agent for diagnosing whether a subject has or is at risk of developing an aging-related disease, the diagnosis comprising the following steps: a) isolating a biological sample from a subject; b) measuring the expression level of miR 1978 in the biological sample; c) comparing the miR 1978 expression level with a reference expression level; if the miR 1978 expression level is higher than the reference expression level, the subject is identified as having an aging-related disease or being at risk of developing an aging-related disease.

67. The use according to claim 66, wherein The reference expression level is derived from a biological sample of a normal healthy subject.

68. The use according to claim 66, wherein The miR 1978 has a nucleotide sequence as shown in SEQ ID NO:

3.

69. The use according to claim 66, wherein The expression levels were measured by in situ hybridization.

70. The use according to claims 66-69, characterized in that The aging-related diseases include Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, and Lewy body dementia.

71. A pharmaceutical composition for treating aging-related diseases, characterized in that: The pharmaceutical composition includes a polynucleotide that is at least partially complementary to miR 1978 and a pharmaceutically acceptable carrier.

72. The pharmaceutical composition of claim 71, wherein The polynucleotide is single-stranded or double-stranded.

73. The pharmaceutical composition of claim 71, wherein The miR1978 has a nucleotide sequence as shown in SEQ ID NO:

3.

74. The pharmaceutical composition of claim 73, wherein The polynucleotide is complementary to at least 12 bases of the nucleotide sequence described in SEQ ID NO:

3.

75. The pharmaceutical composition of claim 73, wherein The polynucleotide is 14 to 30 nucleotides in length.

76. The pharmaceutical composition of claim 73, wherein The polynucleotide comprises a modified internucleotide linkage selected from the group consisting of phosphoramidate, phosphorothioate, phosphorodithioate, boranophosphate, alkylphosphonate, and methylenemethylimine.

77. The pharmaceutical composition of claim 73, wherein The polynucleotide agent comprises a modified nucleic acid unit selected from the group consisting of a locked nucleic acid unit, a 2'-O-alkyl ribonucleic acid unit, a 2'amine ribonucleic acid unit, a peptide nucleic acid unit, a 2'fluoro ribonucleic acid unit, a morpholino nucleic acid unit, a cyclohexane nucleic acid unit, and a tricyclic nucleic acid unit.

78. The pharmaceutical composition of claim 73, wherein The polynucleotide comprises the nucleotide sequence shown in SEQ ID NO:

24.

79. The pharmaceutical composition according to any one of claims 71 to 78, wherein The aging-related diseases include Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, and Lewy body dementia.

80. A miR 1978 inhibitor for treating aging-related diseases.

81. The inhibitor according to claim 80, characterized in that The inhibitor is a polynucleotide that is at least partially complementary to miR 1978.

82. The inhibitor according to claim 81, wherein The polynucleotide is single-stranded or double-stranded.

83. The inhibitor according to claim 81, wherein The miR 1978 has a nucleotide sequence as shown in SEQ ID NO:

3.

84. The inhibitor according to claim 83, wherein The polynucleotide is complementary to at least 12 bases of the nucleotide sequence described in SEQ ID NO:

3.

85. The inhibitor according to claim 84, characterized in that The polynucleotide is 14 to 30 nucleotides in length.

86. The inhibitor according to claim 84, characterized in that The polynucleotide comprises a modified internucleotide linkage selected from the group consisting of phosphoramidate, phosphorothioate, phosphorodithioate, boranophosphate, alkylphosphonate, and methylenemethylimine.

87. The inhibitor according to claim 84, characterized in that The polynucleotide agent comprises a modified nucleic acid unit selected from the group consisting of a locked nucleic acid unit, a 2'-O-alkyl ribonucleic acid unit, a 2'amine ribonucleic acid unit, a peptide nucleic acid unit, a 2'fluoro ribonucleic acid unit, a morpholino nucleic acid unit, a cyclohexane nucleic acid unit, and a tricyclic nucleic acid unit.

88. The inhibitor according to claim 84, wherein The polynucleotide comprises the nucleotide sequence shown in SEQ ID NO:

24.

89. The inhibitor according to any one of claims 80 to 88, characterized in that The aging-related diseases include Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, and Lewy body dementia.

90. A compound for treating aging-related diseases by upregulating DHFR gene and / or DHFR protein levels.

91. The compound of claim 90, wherein The compound upregulates DHFR gene and / or DHFR protein levels by inhibiting miR 1978.

92. The compound of claim 91, which is a polynucleotide that is at least partially complementary to miR 1978.

93. The compound of claim 92, wherein The polynucleotide is single-stranded or double-stranded.

94. The compound of claim 92, wherein The miR 1978 has a nucleotide sequence as shown in SEQ ID NO:

3.

95. The compound of claim 94, wherein The polynucleotide is complementary to at least 12 bases of the nucleotide sequence described in SEQ ID NO:

3.

96. The compound of claim 94, wherein The polynucleotide is 14 to 30 nucleotides in length.

97. The compound of claim 94, wherein The polynucleotide comprises a modified internucleotide linkage selected from the group consisting of phosphoramidate, phosphorothioate, phosphorodithioate, boranophosphate, alkylphosphonate, and methylenemethylimine.

98. The compound of claim 94, wherein The polynucleotide agent comprises a modified nucleic acid unit selected from the group consisting of a locked nucleic acid unit, a 2'-O-alkyl ribonucleic acid unit, a 2'amine ribonucleic acid unit, a peptide nucleic acid unit, a 2'fluoro ribonucleic acid unit, a morpholino nucleic acid unit, a cyclohexane nucleic acid unit, and a tricyclic nucleic acid unit.

99. The compound of claim 94, wherein The polynucleotide comprises the nucleotide sequence shown in SEQ ID NO:

24.

100. The compound of any one of claims 90-99, wherein The aging-related diseases include Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, and Lewy body dementia.

101. A compound for treating aging-related diseases by upregulating KIF5C gene and / or KIF5C protein levels.

102. The compound of claim 101, wherein The compound upregulates the KIF5C gene and / or KIF5C protein level by inhibiting miR 1978.

103. The compound of claim 102, which is a polynucleotide that is at least partially complementary to miR 1978.

104. The compound of claim 103, wherein The polynucleotide is single-stranded or double-stranded.

105. The compound of claim 103, wherein The miR 1978 has a nucleotide sequence as shown in SEQ ID NO:

3.

106. The compound of claim 105, wherein The polynucleotide is complementary to at least 12 bases of the nucleotide sequence described in SEQ ID NO:

3.

107. The compound of claim 105, wherein The polynucleotide is 14 to 30 nucleotides in length.

108. The compound of claim 105, wherein The polynucleotide comprises a modified internucleotide linkage selected from the group consisting of phosphoramidate, phosphorothioate, phosphorodithioate, boranophosphate, alkylphosphonate, and methylenemethylimine.

109. The compound of claim 105, wherein The polynucleotide agent comprises a modified nucleic acid unit selected from the group consisting of a locked nucleic acid unit, a 2'-O-alkyl ribonucleic acid unit, a 2'amine ribonucleic acid unit, a peptide nucleic acid unit, a 2'fluoro ribonucleic acid unit, a morpholino nucleic acid unit, a cyclohexane nucleic acid unit, and a tricyclic nucleic acid unit.

110. The compound of claim 105, wherein The polynucleotide comprises the nucleotide sequence shown in SEQ ID NO:

24.

111. The compound according to any one of claims 101 to 111, wherein The aging-related diseases include Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, and Lewy body dementia.

112. A compound for treating aging-related diseases by upregulating the level of MSH3 gene and / or MSH3 protein.

113. The compound of claim 112, wherein The compound upregulates the MSH3 gene and / or MSH3 protein level by inhibiting miR 1978.

114. The compound of claim 113, which is a polynucleotide that is at least partially complementary to miR 1978.

115. The compound of claim 114, wherein The polynucleotide is single-stranded or double-stranded.

116. The compound of claim 114, wherein The miR 1978 has a nucleotide sequence as shown in SEQ ID NO:

3.

117. The compound of claim 115, wherein The polynucleotide is complementary to at least 12 bases of the nucleotide sequence described in SEQ ID NO:

3.

118. The compound of claim 115, wherein The polynucleotide is 14 to 30 nucleotides in length.

119. The compound of claim 115, wherein The polynucleotide comprises a modified internucleotide linkage selected from the group consisting of phosphoramidate, phosphorothioate, phosphorodithioate, boranophosphate, alkylphosphonate, and methylenemethylimine.

120. The compound of claim 115, wherein The polynucleotide agent comprises a modified nucleic acid unit selected from the group consisting of a locked nucleic acid unit, a 2'-O-alkyl ribonucleic acid unit, a 2'amine ribonucleic acid unit, a peptide nucleic acid unit, a 2'fluoro ribonucleic acid unit, a morpholino nucleic acid unit, a cyclohexane nucleic acid unit, and a tricyclic nucleic acid unit.

121. The compound of claim 115, wherein The polynucleotide comprises the nucleotide sequence shown in SEQ ID NO:

24.

122. The compound of any one of claims 112 to 122, wherein The aging-related diseases include Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, and Lewy body dementia.

123. A compound for treating aging-related diseases by reducing abnormal cellular methylation.

124. The compound of claim 123, wherein The compound reduces abnormal cellular methylation by inhibiting miR 1978.

125. The compound of claim 124, which is a polynucleotide that is at least partially complementary to miR 1978.

126. The compound of claim 125, wherein The polynucleotide is single-stranded or double-stranded.

127. The compound of claim 125, wherein The miR 1978 has a nucleotide sequence as shown in SEQ ID NO:

3.

128. The compound of claim 127, wherein The polynucleotide is complementary to at least 12 bases of the nucleotide sequence described in SEQ ID NO:

3.

129. The compound of claim 127, wherein The polynucleotide is 14 to 30 nucleotides in length.

130. The compound of claim 127, wherein The polynucleotide comprises a modified internucleotide linkage selected from the group consisting of phosphoramidate, phosphorothioate, phosphorodithioate, boranophosphate, alkylphosphonate, and methylenemethylimine.

131. The compound of claim 127, wherein The polynucleotide agent comprises a modified nucleic acid unit selected from the group consisting of a locked nucleic acid unit, a 2'-O-alkyl ribonucleic acid unit, a 2'amine ribonucleic acid unit, a peptide nucleic acid unit, a 2'fluoro ribonucleic acid unit, a morpholino nucleic acid unit, a cyclohexane nucleic acid unit, and a tricyclic nucleic acid unit.

132. The compound of claim 127, wherein The polynucleotide comprises the nucleotide sequence shown in SEQ ID NO:

24.

133. The compound of any one of claims 123-132, wherein The aging-related diseases include Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, and Lewy body dementia.

134. A compound for treating aging-related diseases by increasing the structure of neuronal dendritic spines.

135. The compound of claim 134, wherein The compound increases neuronal dendritic spine structure by inhibiting miR 1978.

136. The compound of claim 135, which is a polynucleotide that is at least partially complementary to miR 1978.

137. The compound of claim 136, wherein The polynucleotide is single-stranded or double-stranded.

138. The compound of claim 136, wherein The miR 1978 has a nucleotide sequence as shown in SEQ ID NO:

3.

139. The compound of claim 138, wherein The polynucleotide is complementary to at least 12 bases of the nucleotide sequence described in SEQ ID NO:

3.

140. The compound of claim 138, wherein The polynucleotide is 14 to 30 nucleotides in length.

141. The compound of claim 138, wherein The polynucleotide comprises a modified internucleotide linkage selected from the group consisting of phosphoramidate, phosphorothioate, phosphorodithioate, boranophosphate, alkylphosphonate, and methylenemethylimine.

142. The compound of claim 138, wherein The polynucleotide agent comprises a modified nucleic acid unit selected from the group consisting of a locked nucleic acid unit, a 2'-O-alkyl ribonucleic acid unit, a 2'amine ribonucleic acid unit, a peptide nucleic acid unit, a 2'fluoro ribonucleic acid unit, a morpholino nucleic acid unit, a cyclohexane nucleic acid unit, and a tricyclic nucleic acid unit.

143. The compound of claim 138, wherein The polynucleotide comprises the nucleotide sequence shown in SEQ ID NO:

24.

144. The compound of any one of claims 134-143, wherein The aging-related diseases include Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, and Lewy body dementia.

145. A method for treating a disease associated with aging, comprising inhibiting miR 1978 in a subject.

146. The method of claim 145, wherein the inhibition comprises administering a therapeutically effective amount of a miR 1978 inhibitor.

147. The method of claim 146, wherein the inhibitor is a polynucleotide that is at least partially complementary to miR1978.

148. The method of claim 147, wherein the polynucleotide is single-stranded or double-stranded.

149. The method of claim 147, wherein the miR 1978 has the nucleotide sequence shown in SEQ ID NO:

3.

150. The method of claim 149, wherein the polynucleotide is complementary to at least 12 bases of the nucleotide sequence described in SEQ ID NO:

3.

151. The method of claim 149, wherein the polynucleotide is 14 to 30 nucleotides in length.

152. The method of claim 149, wherein the polynucleotide comprises a modified internucleotide linkage selected from the group consisting of phosphoramidate, phosphorothioate, phosphorodithioate, boranophosphate, alkylphosphonate, and methylenemethylimine.

153. The method of claim 149, wherein the polynucleotide agent comprises a modified nucleic acid unit selected from the group consisting of a locked nucleic acid unit, a 2'-O-alkyl ribonucleic acid unit, a 2'amine ribonucleic acid unit, a peptide nucleic acid unit, a 2'fluoro ribonucleic acid unit, a morpholino nucleic acid unit, a cyclohexane nucleic acid unit, and a tricyclic nucleic acid unit.

154. The method of claim 149, wherein the polynucleotide comprises the nucleotide sequence shown in SEQ ID NO:

24.

155. The method of claim 146, wherein the inhibitor is delivered in a delivery agent; preferably, the delivery agent is a micelle, an exosome, a lipidoid, a liposome, a lipid nanoparticle, an extracellular vesicle, or a synthetic vesicle.

156. The method of claim 146, wherein the inhibitor is delivered via a viral vector; preferably, the viral vector is AAV, adenovirus, retrovirus, or lentivirus.

157. The method of claims 145-156, wherein the aging-related diseases include Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, and Lewy body dementia.

158. A method for upregulating DHFR gene and / or DHFR protein levels comprising administering a therapeutically effective amount of a miR 1978 inhibitor.

159. A method for upregulating KIF5C gene and / or KIF5C protein levels, comprising administering a therapeutically effective amount of a miR 1978 inhibitor.

160. A method for upregulating MSH3 gene and / or MSH3 protein levels comprising administering a therapeutically effective amount of a miR 1978 inhibitor.

161. A method for reducing aberrant methylation in cells, comprising administering a therapeutically effective amount of a miR 1978 inhibitor.

162. A method of increasing dendritic spine structure in neurons comprising administering a therapeutically effective amount of a miR 1978 inhibitor.

163. The method of any one of claims 158-162, wherein the inhibitor is a polynucleotide that is at least partially complementary to miR 1978.

164. The method of claim 163, wherein the polynucleotide is single-stranded or double-stranded.

165. The method of claim 163, wherein the miR 1978 has the nucleotide sequence shown in SEQ ID NO:

3.

166. The method of claim 165, wherein the polynucleotide is complementary to at least 12 bases of the nucleotide sequence described in SEQ ID NO:

3.

167. The method of claim 165, wherein the polynucleotide is 14 to 30 nucleotides in length.

168. The method of claim 165, wherein the polynucleotide comprises a modified internucleotide linkage selected from the group consisting of phosphoramidate, phosphorothioate, phosphorodithioate, boranophosphate, alkylphosphonate, and methylenemethylimine.

169. The method of claim 165, wherein the polynucleotide agent comprises modified nucleic acid units selected from the group consisting of locked nucleic acid units, 2'-O-alkyl ribonucleic acid units, 2'amine ribonucleic acid units, peptide nucleic acid units, 2'fluoro ribonucleic acid units, morpholino nucleic acid units, cyclohexane nucleic acid units, and tricyclic nucleic acid units.

170. The method of claim 165, wherein the polynucleotide comprises the nucleotide sequence shown in SEQ ID NO:

24.

171. The method of any one of claims 158-162, wherein the inhibitor is delivered in a delivery agent; preferably, the delivery agent is a micelle, an exosome, a lipidoid, a liposome, a lipid nanoparticle, an extracellular vesicle, or a synthetic vesicle.

172. The method of any one of claims 158-162, wherein the inhibitor is delivered via a viral vector; preferably, the viral vector is AAV, adenovirus, retrovirus, or lentivirus.

173. The method of any one of claims 158-162, wherein the method is used to treat aging-related diseases; preferably, the aging-related diseases include Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, and Lewy body dementia.

174. A method for diagnosing whether a subject has an aging-related disease or is at risk of developing an aging-related disease, comprising a) isolating a biological sample from the subject; b) measuring the expression level of miR 1978 in the biological sample; c) comparing the miR 1978 expression level with a reference expression level; if the miR 1978 expression level is higher than the reference expression level, the subject is identified as having an aging-related disease or being at risk of developing an aging-related disease.

175. The method of claim 174, wherein: The reference expression level is derived from a biological sample of a normal healthy subject.

176. The method of claim 174, wherein: The miR 1978 has a nucleotide sequence as shown in SEQ ID NO:

3.

177. The method of claim 174, wherein: The expression levels were measured by in situ hybridization.

178. The method of claims 174-177, wherein: The aging-related diseases include Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, and Lewy body dementia.

Images