Novel peptide having activity of promoting growth and uses thereof

A peptide with the sequence SEQ ID NO: 1 stimulates growth hormone production and growth plate growth, addressing the limitations of current treatments for growth retardation by promoting growth without adverse reactions.

WO2025216517A1PCT designated stage Publication Date: 2025-10-16CAREGEN
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/004681
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-04-09
Filing Date
2025-04-07
Publication Date
2025-10-16

AI Technical Summary

Technical Problem

Current treatments for growth retardation and short stature, such as growth hormone prescriptions, have side effects and do not effectively promote growth without adverse reactions.

Method used

A peptide with the amino acid sequence of SEQ ID NO: 1, which stimulates the production of growth hormone in the pituitary gland and promotes growth plate growth, is developed for use in pharmaceutical and food compositions.

Benefits of technology

The peptide effectively promotes growth by increasing the production of growth hormone and growth plate growth, offering a therapeutic option for growth retardation disorders without significant side effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025004681_16102025_PF_FP_ABST
    Figure KR2025004681_16102025_PF_FP_ABST
Patent Text Reader

Abstract

The peptide of the present invention has activity for promoting the production of growth hormone (GH) and promoting the growth of the growth plate. Accordingly, the peptide of the present invention can be used for promoting growth and can be effectively used as an active ingredient for the treatment, prevention, or alleviation of growth delay disorders such as short stature.
Need to check novelty before this filing date? Find Prior Art

Description

Peptides having growth promoting activity and uses thereof

[0001] [Cross-citation with related applications]

[0002] This application claims the benefit of priority from Korean Patent Application No. 10-2024-0047911, filed April 9, 2024, the entire contents of which are incorporated herein by reference.

[0003] [Technical Field]

[0004] The present invention relates to a peptide having growth promoting activity and its use.

[0005] Skeletal development is regulated by a number of growth factors and growth hormones. Growth hormone is a peptide hormone secreted by the pituitary gland. It promotes bone growth by inducing calcium deposition in cartilage cells present in the growth plate at the epiphysis, where bone length growth occurs. Growth plates are the areas of the bones responsible for lengthening the area around joints or in the arms and legs. They are mainly located at the ends of long bones, and are formed by cartilage plates sandwiched between the bones. During the fetal period, all bones are composed of cartilaginous tissue, but as this cartilaginous tissue develops, bone growth occurs through calcium deposition. It is known that the remaining cartilage after conversion to bone becomes the growth plate.

[0006] Growth retardation or growth disorder is a delay in growth that is not appropriate for age or gender, resulting in short stature. Short stature can be caused by chronic systemic diseases such as chronic renal failure, short stature caused by abnormalities in hormone secretion such as growth hormone deficiency, hypothyroidism, and diabetes, and short stature caused by congenital abnormalities such as Turner syndrome. Growth hormone deficiency can be caused by anencephaly or when the pituitary gland is not produced normally, resulting in a small pituitary gland; brain tumors, congenital brain malformations, hydrocephalus, and other central nervous system abnormalities; damage to the pituitary gland due to trauma, encephalitis, brain tumors, tuberculous meningitis, or central nervous system X-ray examinations; and damage to the pituitary gland or hypothalamus due to inadequate oxygen supply to the newborn's brain due to difficult childbirth. In addition, short stature can be caused by abnormal secretion or deficiency of growth hormone due to chromosomal abnormalities, or environmental factors such as nutrition, exercise, sleep, and stress.

[0007] Growth hormone prescriptions for the treatment of growth retardation or short stature have been reported to have side effects, including a decrease in the amount of growth hormone normally produced or a decrease in the ability to produce growth hormone, the induction of diabetes, hypothyroidism, and an increase in nervous system disorders such as headaches or dizziness, gastrointestinal disorders, and skin disorders such as hives or itching.

[0008] International application PCT / EP2014 / 050800 (WO2014 / 111467) discloses soluble fibroblast growth factor receptor (FGR3) polypeptides for use in the prevention or treatment of skeletal growth retardation disorders, and international application PCT / US2013 / 068009 (WO2014 / 071158) discloses Activin-ACTRII antagonists for the treatment of bone disorders.

[0009] [Prior Art Literature]

[0010] [Patent Document]

[0011] International application PCT / EP2014 / 050800 (WO2014 / 111467)

[0012] International application PCT / US2013 / 068009 (WO2014 / 071158)

[0013] The present inventors have conducted research efforts to develop an active substance with growth-promoting activity for the treatment of growth retardation and short stature. As a result, the inventors experimentally demonstrated that the peptide they developed stimulates the production of growth hormone in the pituitary gland and promotes growth plate growth. This confirmed the potential of the peptide of the present invention as a therapeutic agent for diseases associated with growth retardation, leading to the completion of the present invention.

[0014] Accordingly, an object of the present invention is to provide a composition for promoting growth.

[0015] Another object of the present invention is to provide a pharmaceutical composition for preventing or treating growth retardation diseases.

[0016] Another object of the present invention is to provide a food composition for improving or preventing growth retardation.

[0017] One aspect of the present invention provides a growth promoting composition comprising a peptide having an amino acid sequence of SEQ ID NO: 1 as an active ingredient.

[0018] Another aspect of the present invention provides a pharmaceutical composition for treating or preventing growth retardation disease, comprising a peptide comprising the amino acid sequence of SEQ ID NO: 1 as an active ingredient.

[0019] Another aspect of the present invention provides a food composition for improving or preventing growth retardation, comprising a peptide having an amino acid sequence of SEQ ID NO: 1 as an active ingredient.

[0020] The present invention is described in detail below.

[0021] According to one aspect of the present invention, a peptide comprising an amino acid sequence disclosed in SEQ ID NO: 1 is provided.

[0022] [Amino acid sequence of sequence number 1]

[0023] RERMS (Arg-Glu-Arg-Met-Ser)

[0024] The term "peptide" in this specification means a linear molecule formed by amino acid residues being linked to each other by peptide bonds.

[0025] The peptide comprising the amino acid sequence of SEQ ID NO: 1 of the present invention may be used without modification, but a variant or fragment of an amino acid having a different sequence by deletion, insertion, substitution, or a combination thereof of amino acid residues may be used within a range that does not affect the original activity of the peptide, for example, growth promoting activity.

[0026] The peptide of the present invention can be modified by phosphorylation, sulfation, acrylation, glycosylation, methylation, farnesylation, etc., within a range that does not change its activity.

[0027] The peptide of the present invention includes a peptide comprising an amino acid sequence substantially identical to a peptide comprising an amino acid sequence of SEQ ID NO: 1, and a variant or active fragment thereof. The substantially identical amino acid sequence refers to an amino acid sequence having a sequence identity of 75% or more, for example, 80% or more, 85% or more, 90% or more, 95% or more, or 97% or more, with the amino acid sequence of SEQ ID NO: 1. In addition, the peptide may additionally include a targeting sequence, a tag, a labeled residue, an amino acid sequence manufactured for a specific purpose to increase half-life or peptide stability.

[0028] The peptide of the present invention may be modified at the N-terminus and / or C-terminus to select a portion of the amino acid sequence and increase its activity. Such N-terminus and / or C-terminus modifications can significantly improve the stability of the peptide of the present invention, for example, increasing the half-life of the peptide when administered in vivo. The term "stability" encompasses not only in vivo stability, which protects the peptide of the present invention from attack by in vivo protein-cleaving enzymes, but also storage stability (e.g., room temperature storage stability).

[0029] The above N-terminal modification may be a modification in which a protecting group selected from the group consisting of an acetyl group, a fluoreonylmethoxycarbonyl group, a formyl group, a palmitoyl group, a myristyl group, a stearyl group, and polyethylene glycol (PEG) is bonded to the N-terminus of the peptide. The above C-terminal modification may be a modification in which a hydroxyl group (-OH), an amino group (-NH2), a hydrazino group (-NHNH2), or the like is bonded to the C-terminus of the peptide, but is not limited thereto.

[0030] The peptide of the present invention can be prepared by various methods widely known in the art to which the present invention pertains. For example, the peptide of the present invention can be prepared by chemical synthesis methods known in the art, particularly solid-phase synthesis techniques (Merrifield, J. Amer. Chem. Soc. 85:2149-54 (1963); Stewart, et al., Solid Phase Peptide Synthesis, 2nd ed., Pierce Chem. Co.: Rockford, 111 (1984)) or liquid-phase synthesis techniques (US Patent No. 5,516,891).

[0031] The peptide of the present invention has growth promoting activity.

[0032] The peptide of the present invention has an activity that promotes the production of growth hormone (GH).

[0033] In one specific embodiment of the present invention, the peptide of the present invention has the activity of promoting the expression of growth hormone in pituitary or anterior pituitary cells.

[0034] The term "growth plate" in the present invention refers to the area of ​​a bone that is responsible for growth in length, such as near a joint or in the arms and legs. Growth plates are primarily located at the ends of long bones, and are formed by a cartilage plate sandwiched between the bones. The growth plate is composed of multiple layers of layered cartilage cells, with cell division occurring on one side and maturation of the cartilage cells on the other side, forming bone tissue. As the cartilage cells in the growth plate divide, bone growth occurs in length.

[0035] The peptide of the present invention has an activity that promotes growth of a growth plate.

[0036] Growth of the above growth plate means an increase in the length, size, or area of ​​the growth plate.

[0037] In a specific embodiment of the present invention, the peptide of the present invention has the activity of increasing the size of proliferative chondrocytes in a growth plate, increasing the expression of IGF-1 (Insulin-like growth factor 1), and increasing the expression of IGFBB3 (Insulin-like growth factor-binding protein 3).

[0038] As described above, the peptide of the present invention has bone growth promoting activity and can thereby exhibit therapeutic efficacy for diseases related to growth delay.

[0039] In another aspect of the present invention, the present invention provides a growth promoting composition comprising a peptide comprising an amino acid sequence of SEQ ID NO: 1 as an active ingredient.

[0040] In one embodiment, the peptide has activity that promotes the production of growth hormone (GH) or activity that promotes the growth of a growth plate.

[0041] In one embodiment, the growth promoting composition may be a food composition, a functional food composition, or a health functional food composition.

[0042] In another aspect of the present invention, the present invention provides a pharmaceutical composition for treating or preventing growth retardation disease, comprising a peptide comprising the amino acid sequence of SEQ ID NO: 1 as an active ingredient.

[0043] In the present invention, the term "growth retardation disease" refers to a disease in which growth is delayed due to a slower than normal growth rate.

[0044] In one embodiment, the growth retardation disorder may be due to a deficiency of growth hormone or insufficient secretion of growth hormone.

[0045] In one embodiment, the growth retardation disease may be due to a disorder of the growth plate, and the disorder of the growth plate may be a growth plate disorder caused by damage to the growth plate, infection of the growth plate, or genetic factors.

[0046] In one embodiment, the growth retardation disorder may be short stature disorder.

[0047] In the present invention, the term "short stature disorder" means a disorder in which a person has a height lower than the standard value for the same age and sex.

[0048] In one embodiment, the short stature disorder may be familial short stature, idiopathic short stature, intrauterine growth retardation (IUGR), short stature due to growth plate damage, short stature due to osteochondrodysplasia, short stature due to kidney disease, short stature due to chronic disease, short stature due to growth hormone deficiency, short stature due to thyroid hormone deficiency, short stature due to sex hormone deficiency, short stature due to adrenocortical hormone deficiency, short stature due to Turner syndrome, or short stature due to Down's syndrome.

[0049] The above growth hormone deficiency may be (i) biologically inactive GH, (ii) genetic GH deficiency, or (iii) growth hormone deficiency due to brain injury, brain tumor, brain radiation therapy, pituitary infarction, brain inflammation, or granulomatous disease.

[0050] In one embodiment, the short stature due to the renal disease may be short stature due to uremia, short stature due to renal tubular acidosis, or short stature due to chronic renal failure.

[0051] In one embodiment, the short stature due to the chronic disease may be short stature due to congenital heart disease, short stature due to chronic lung disease, or short stature due to liver disease.

[0052] In one embodiment, the peptide, which is an active ingredient of the pharmaceutical composition, has activity that promotes the production of growth hormone (GH) or activity that promotes the growth of a growth plate.

[0053] In one specific embodiment of the present invention, the peptide of the present invention has the activity of promoting the expression of growth hormone in pituitary or anterior pituitary cells.

[0054] The peptide of the present invention has the activity of promoting growth of a growth plate. Growth of the growth plate refers to an increase in the length, size, or area of ​​the growth plate.

[0055] In a specific embodiment of the present invention, the peptide of the present invention has the activity of increasing the size of proliferative chondrocytes in a growth plate, increasing the expression of IGF-1 (Insulin-like growth factor 1), and increasing the expression of IGFBB3 (Insulin-like growth factor-binding protein 3).

[0056] The pharmaceutical composition of the present invention may contain a therapeutically effective amount of a peptide comprising the amino acid of sequence number 1 of the present invention.

[0057] The term "therapeutically effective amount" above means an amount sufficient for the peptide, which is an active ingredient of the pharmaceutical composition of the present invention, to achieve its activity or efficacy, for example, an amount sufficient to achieve the efficacy of treating or preventing the growth retardation disease described above.

[0058] The term "prevention" as used herein means reducing the risk of developing a disease or disorder, and means any action that inhibits or delays the onset of a disease by preventing the disease or one or more of its clinical symptoms from progressing.

[0059] The term "treatment" as used herein means alleviating a disease or disorder, and includes any action that improves or beneficially alters the symptoms of a disease by arresting or reducing the progression of the disease or one or more of its clinical symptoms.

[0060] The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier.

[0061] The pharmaceutically acceptable carriers mentioned above are those commonly used in formulations, and include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil.

[0062] The pharmaceutical composition of the present invention may be a composition comprising a therapeutically effective amount of a peptide comprising an amino acid of SEQ ID NO: 1; and a pharmaceutically acceptable carrier.

[0063] The pharmaceutical composition of the present invention may additionally include, in addition to the above ingredients, a lubricant, a wetting agent, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, etc., but is not limited thereto.

[0064] Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington: The Science and Practice of Pharmacy, (21st ed., 2005, Lippincott Williams & Wilkins).

[0065] The pharmaceutical composition of the present invention can be administered by any suitable route for treating growth retardation disease, for example, it can be administered orally or parenterally, and in the case of parenteral administration, it can be administered by intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, topical administration, transdermal administration, etc.

[0066] The dosage of the pharmaceutical composition may be, but is not limited to, 0.0001 μg to 1000 mg, 0.001 μg to 1000 mg, 0.01 μg to 1000 mg, 0.1 μg to 1000 mg, 0.1 μg to 500 mg, or 1.0 μg to 1000 mg per day, and may be prescribed in various ways depending on factors such as the formulation method, administration method, patient's age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and reaction sensitivity.

[0067] The pharmaceutical composition of the present invention can be manufactured in a unit dose form or can be manufactured by inserting it into a multi-dose container by formulating it using a pharmaceutically acceptable carrier and / or excipient according to a method that can be easily performed by a person having ordinary skill in the art to which the present invention pertains, and the method can be performed. In this case, the formulation may be in the form of a solution, suspension or emulsion in an oil or aqueous medium, or in the form of an extract, powder, granules, tablet or capsule, and may additionally include a dispersing agent or stabilizer.

[0068] The pharmaceutical composition of the present invention may contain the peptide of the present invention at a concentration of 0.01 μM to 1000 mM, specifically, the peptide of the present invention may contain the peptide of the present invention at a concentration of 0.01 μM to 900 mM, 0.01 μM to 500 mM, 0.01 μM to 300 mM, 0.01 μM to 100 mM, 0.01 μM to 50 mM, 0.01 μM to 30 mM, 0.01 μM to 10 mM, 0.01 μM to 1 mM, 0.01 μM to 0.1 mM, 0.01 μM to 0.01 mM, 1.01 μM to 1000 μM; 0.05 μM to 800 μM, 0.05 μM to 700 μM, 0.05 μM to 600 μM, 0.05 μM to 500 μM, 0.05 μM to 300 μM, 0.05 μM to 200 μM; 0.1 μM to 800 μM, 0.1 μM to 700 μM, 0.1 μM to 600 μM, 0.1 μM to 500 μM, 0.1 μM to 300 μM, 0.1 μM to 200 μM; 1 μM to 800 μM, 1 μM to 700 μM, 1 μM to 600 μM, 1 μM to 500 μM, 1 μM to 300 μM, 1 μM to 200 μM; It may be included at a concentration of, but is not limited to, 5 μM to 800 μM, 5 μM to 700 μM, 5 μM to 600 μM, 5 μM to 500 μM, 5 μM to 300 μM, or 5 μM to 200 μM.

[0069] In another aspect of the present invention, the present invention provides a food composition for improving or preventing growth retardation, comprising a peptide comprising the amino acid sequence of SEQ ID NO: 1 as an active ingredient.

[0070] The term "improvement" herein may mean any action that at least reduces the severity of a symptom, for example, a parameter associated with alleviating or treating a condition.

[0071] The activity of the peptide of the present invention related to improving or preventing growth retardation in the food composition of the present invention is the same as that described in the pharmaceutical composition described above, and therefore, this is cited and will not be described in duplicate.

[0072] In the present invention, the term “growth delay” refers to a symptom or disease in which growth is delayed due to a slower than normal growth rate.

[0073] In one embodiment, the growth retardation may be due to a deficiency of growth hormone or insufficient secretion of growth hormone.

[0074] In one embodiment, the growth retardation may be due to a disorder of the growth plate, and the disorder of the growth plate may be a growth plate disorder caused by damage to the growth plate, infection of the growth plate, or genetic factors.

[0075] In one embodiment, the growth retardation may be short stature disorder.

[0076] In the present invention, the term "short stature disorder" means a disorder in which a person has a height lower than the standard value for the same age and sex.

[0077] In one embodiment, the short stature disorder may be familial short stature, idiopathic short stature, intrauterine growth retardation (IUGR), short stature due to growth plate damage, short stature due to osteochondrodysplasia, short stature due to kidney disease, short stature due to chronic disease, short stature due to growth hormone deficiency, short stature due to thyroid hormone deficiency, short stature due to sex hormone deficiency, short stature due to adrenocortical hormone deficiency, short stature due to Turner syndrome, or short stature due to Down's syndrome.

[0078] In one embodiment, the short stature due to the renal disease may be short stature due to uremia, short stature due to renal tubular acidosis, or short stature due to chronic renal failure.

[0079] In one embodiment, the short stature due to the chronic disease may be short stature due to congenital heart disease, short stature due to chronic lung disease, or short stature due to liver disease.

[0080] In one embodiment, the peptide, which is an active ingredient of the food composition, has activity that promotes the production of growth hormone (GH) or activity that promotes the growth of a growth plate.

[0081] In one specific embodiment of the present invention, the peptide of the present invention has the activity of promoting the expression of growth hormone in pituitary or anterior pituitary cells.

[0082] The peptide of the present invention has the activity of promoting growth of a growth plate. Growth of the growth plate refers to an increase in the length, size, or area of ​​the growth plate.

[0083] In a specific embodiment of the present invention, the peptide of the present invention has the activity of increasing the size of proliferative chondrocytes in a growth plate, increasing the expression of IGF-1 (Insulin-like growth factor 1), and increasing the expression of IGFBB3 (Insulin-like growth factor-binding protein 3).

[0084] In one embodiment, the peptide, which is an active ingredient in the food composition of the present invention, may be included in an appropriate amount selected within a range of 10 wt% or less, specifically 0.000001 wt% to 10 wt%, based on the total composition weight.

[0085] The food composition of the present invention may contain a food-effective amount of a peptide and a food-acceptable carrier.

[0086] The food composition of the present invention comprises not only the peptide of the present invention as the effective ingredient, but also components commonly added during food manufacturing, and may include, for example, proteins, carbohydrates, fats, nutrients, seasonings, and flavoring agents. Examples of the carbohydrates described above include monosaccharides such as glucose, fructose, etc.; disaccharides such as maltose, sucrose, oligosaccharides, etc.; and polysaccharides such as dextrin, cyclodextrin, etc., and sugar alcohols such as xylitol, sorbitol, and erythritol. As flavoring agents, natural flavoring agents, thaumatin, stevia extracts (e.g., rebaudioside A, glycyrrhizin, etc.), and synthetic flavoring agents (saccharin, aspartame, etc.) can be used.

[0087] In addition to the above-described ingredients, the food composition of the present invention may contain various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and thickeners (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. In addition, it may contain fruit pulp for the production of natural fruit juice and fruit juice drinks and vegetable drinks. For example, when the food composition of the present invention is produced as a drink, in addition to the peptide, which is an effective ingredient of the present invention, citric acid, liquid fructose, sugar, glucose, acetic acid, malic acid, fruit juice, Eucommia extract, jujube extract, licorice extract, etc. may be additionally contained.

[0088] There is no particular limitation on the type of the above food composition. Examples of the above food or food composition include dairy products including meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, ice cream, various soups, beverages, tea drinks, alcoholic beverages, vitamin complexes, dairy products, fermented milk, etc., and may include all functional foods or foods in the conventional sense.

[0089] Meanwhile, the food composition may include a health functional food. As used herein, the term "health functional food" refers to a food manufactured and processed in the form of tablets, capsules, powders, granules, liquids, pills, etc. using raw materials or ingredients that have functionality useful to the human body. Here, "functionality" means obtaining a useful effect for health purposes, such as regulating nutrients for the structure and function of the human body or physiological functions. The health functional food may be manufactured by a method commonly used in the art, and may be manufactured by adding raw materials and ingredients commonly added in the art during the manufacturing process. In addition, the formulation of the health functional food may also be manufactured without limitation as long as it is a formulation recognized as a health functional food. The food composition may be manufactured in various forms, and, unlike general drugs, has the advantage of not having side effects that may occur with long-term use of drugs because it uses food as a raw material.

[0090] In another aspect of the present invention, a method for treating, preventing, or improving a growth retardation disorder is provided, comprising administering a therapeutically effective amount of a peptide comprising the amino acid sequence of SEQ ID NO: 1 described above to a subject in need of treatment for a growth retardation disorder.

[0091] The subject may be a human or a non-human animal.

[0092] In another aspect of the present invention, a use of a peptide comprising the amino acid sequence of SEQ ID NO: 1 described above for treating, preventing or improving a growth retardation disease is provided.

[0093] In another aspect of the present invention, there is provided a use of a peptide comprising the amino acid sequence of SEQ ID NO: 1 described above for the preparation of a composition for treating, preventing, or improving growth retardation disease. The composition may be a pharmaceutical composition or a food composition.

[0094] In the method for treating, preventing, or improving the above-mentioned growth retardation disease, the use for treating, preventing, or improving the growth retardation disease, or the use for manufacturing a composition for treating, preventing, or improving the growth retardation disease, other technical contents including the peptide and the composition are the same as those described in the growth promotion composition, the pharmaceutical composition for treating or preventing the growth retardation disease, and the food composition for improving or preventing the growth retardation, which are one aspect of the present invention, and therefore are cited and will not be described repeatedly.

[0095] The peptide of the present invention has activity that promotes the production of growth hormone (GH) and the growth of growth plates. Therefore, the peptide of the present invention can be used for growth promotion purposes and can be effectively developed and used as an active ingredient for the treatment, prevention, or improvement of growth-retarding diseases such as short stature.

[0096] However, the effects of the present invention are not limited to the effects mentioned above, and other effects not mentioned will be clearly understood by those skilled in the art from the description below.

[0097] Figure 1 shows the results of measuring the expression levels of growth hormone (GH) gene and Pit-1 gene in GH3 cells treated with the peptide of Manufacturing Example 1. Con: Control group, Peptide: Peptide of SEQ ID NO: 1 of the present invention, hGH: haman recombinant growth hormone.

[0098] Figures 2a and 2b show the results of measuring the length from the nose to the tip of the tail for SD rats in the experimental group (peptide administration group of Preparation Example 1), the control group (PBS administration group), and the positive control group (hGH administration group). Con: control group, Sequence 1: peptide of sequence number 1 of the present invention, hGH: haman recombinant growth hormone.

[0099] Figure 3 is a graph showing the results of measuring the length from the nose to the tip of the tail of SD rats in the experimental group (peptide administration group of Manufacturing Example 1), the control group (PBS administration group), and the positive control group (hGH administration group), divided by the measurement time points. Con: control group, Sequence 1: peptide of sequence number 1 of the present invention, hGH: haman recombinant growth hormone.

[0100] Figures 4a and 4b show the results of measuring body weight for SD rats in the experimental group (peptide administration group of Preparation Example 1), control group (PBS administration group), and positive control group (hGH administration group). Con: control group, Sequence 1: peptide of sequence number 1 of the present invention, hGH: haman recombinant growth hormone.

[0101] Figure 5 is a graph showing the results of measuring body weight of SD rats in the experimental group (peptide administration group of Manufacturing Example 1), control group (PBS administration group), and positive control group (hGH administration group) by dividing them into measurement time points. Con: control group, Sequence 1: peptide of sequence number 1 of the present invention, hGH: haman recombinant growth hormone.

[0102] Figure 6 shows the results of measuring the length of the tibia longitudinal bone in SD rats of the experimental group (peptide administration group of Manufacturing Example 1), control group (PBS administration group), and positive control group (hGH administration group). Panel A shows the results of photographing the tibia longitudinal bone, and Panel B shows the results of length measurement using a digital caliper. Con: control group, Sequence 1: peptide of sequence number 1 of the present invention, hGH: haman recombinant growth hormone.

[0103] Figure 7a shows the results of measuring the length of the growth plate of the tibia using the H&E staining method for SD rats of the experimental group (peptide administration group of Preparation Example 1), control group (PBS administration group), and positive control group (hGH administration group). Panel A is the control group, panel B is the experimental group, and panel C is the positive control group. RZ: Resting Zone, PZ: Proliferative Zone, HZ: Hypertrophic Zone. Control: control group, peptide: peptide of sequence number 1 of the present invention, hGH: haman recombinant growth hormone.

[0104] Figure 7b is a graph showing the results of measuring the length of the growth plate of the tibia using the H&E staining method for SD rats of the experimental group (peptide administration group of Preparation Example 1), control group (PBS administration group), and positive control group (hGH administration group). Panel A shows the length of the growth plate of the tibia measured in the Resting Zone, Proliferative Zone, and Hypertrophic Zone, and Panel B shows the length of the entire growth plate measured. Con: Control group, Sequence 1: Peptide of sequence number 1 of the present invention, hGH: haman recombinant growth hormone.

[0105] Figure 7c shows the results of confirming proliferative chondrocytes in the growth plate of the tibia through IHC staining using Ki67 (proliferative rat marker) in SD rats of the experimental group (peptide administration group of Manufacturing Example 1), control group (PBS administration group), and positive control group (hGH administration group). Control: control group (PBS), Sequence 1: peptide of sequence number 1 of the present invention, hGH: haman recombinant growth hormone.

[0106] Figure 8a is a photograph showing the expression level of IGF-1 in the growth plate area of ​​the tibia using the DAB staining method for SD rats of the experimental group (peptide administration group of Preparation Example 1), control group (PBS administration group), and positive control group (hGH administration group). Control: control group, peptide: peptide of sequence number 1 of the present invention, hGH: haman recombinant growth hormone.

[0107] Figure 8b is a photograph showing the expression level of IGFBP3 in the growth plate area of ​​the tibia using the DAB staining method for SD rats of the experimental group (peptide administration group of Preparation Example 1), control group (PBS administration group), and positive control group (hGH administration group). Control: control group, peptide: peptide of sequence number 1 of the present invention, hGH: haman recombinant growth hormone.

[0108] Figures 9a and 9b are photographs and graphs showing the level of GH (growth hormone) expression in the pituitary gland of SD rats in the experimental group (peptide administration group of Manufacturing Example 1) and the control group (PBS administration group) using the IHC staining method. Control: Control group, Peptide: Peptide of sequence number 1 of the present invention.

[0109] Figure 10 is a photograph showing the presence of toxicity in liver tissue of SD rats of the experimental group (peptide administration group of Manufacturing Example 1) and the control group (PBS administration group) using the H&E staining method. Control: Control group, Peptide: Peptide of sequence number 1 of the present invention.

[0110] Hereinafter, the present invention will be described in detail by way of examples. However, the following examples specifically illustrate the present invention, and the content of the present invention is not limited by the following examples.

[0111] Manufacturing Example 1: Manufacturing of peptides

[0112] A peptide having the amino acid sequence of SEQ ID NO: 1 shown in Table 1 below was synthesized using an automatic peptide synthesizer (Milligen 9050, Millipore, USA), and the synthesized peptide was purified using C18 reverse-phase high-performance liquid chromatography (HPLC) (Waters Associates, USA). The column used was ACQUITY UPLC BEH300 C18 (2.1 mm Y 100 mm, 1.7 μm, Waters Co, USA).

[0113] Amino acid sequence of the peptide sequence 1 RERMS (Arg-Glu-Arg-Met-Ser)

[0114] The efficacy of the peptide of sequence number 1 manufactured above was evaluated through the following experiment.

[0115] Experimental Example 1: Experiment to measure the expression of growth hormone genes and transcription factor Pit-1.

[0116] The effect of the peptide (peptide of sequence number 1) manufactured in the above manufacturing example 1 on the expression of the growth hormone (GH) gene and the Pit-1 (Pituitary-specific transcription factor) gene in the anterior pituitary cells of a rat was evaluated.

[0117] GH3 cells (Rat pituitary gland-derived cells, ATCC cat. CCL-82.1) were seeded at 3 x 10 5 Cells were seeded in 12-well cell culture plates at a density of 10 cells / well and cultured for 24 hours using F12-K medium (ATCC, cat. 30-2004) containing 10% FBS (fetal bovine serum, Gibco). Subsequently, the cells were replaced with serum-free F12-K medium and maintained under starvation conditions for 6 hours. After treatment with the peptides of Preparation Example 1 (100 μM, 200 μM) and hGH (Caregen, haman recombinant growth hormone, CG-hGH) (6.8 μg / ml) as a positive control, the cells were cultured for 24 hours to obtain cells. The medium was removed from the obtained cells, washed twice with PBS, and RNA was isolated using easy blue (iNtRON, Cat. No.: 17061, Korea). After quantifying the amount of isolated RNA, 2,000 ng of RNA was aliquoted per tube and cDNA was synthesized using a cDNA synthesis kit (Enzynomics, Cat. No. RT200, Korea). PCR was performed using primers targeting the GH (Growth hormone) gene and Pit-1 gene (Table 2) and a PCR kit (Enzynomics, Cat. No. P581T, Korea). The PCR products were then electrophoresed on a 1.2% agarose gel, and bands were detected and analyzed using a Bio-Rad gel image system.

[0118] PCR primer sequence list

[0119] Primer Name Sequence (5'-> 3') SEQ ID NO: GH3 ForwardACT CCC TGG CTC CTG ACC TT2GH3 ReverseGGA TGA GCA GCA GCG AGA A3Pit-1 ForwardCTG AGA ATG CAC CAC AGT GC4Pit-1 ReverseATG ATC TCC TGC GAA GAA GG5GAPDH ForwardACCACAGTCCATGCCATCAC6GAPDH ReverseTCCACCACCCTGTTGCTGTA7

[0120] As a result of the experiment, as shown in Fig. 1, it was confirmed that the peptide of Manufacturing Example 1 increased the expression of the growth hormone (GH) gene and the Pit-1 gene, a transcription factor of GH, in GH3 cells to a level similar to that of hGH (positive control).

[0121] Experimental Example 2: Measurement experiment of height and ilium

[0122] It was evaluated whether the peptide manufactured in the above manufacturing example 1 promotes height growth and long bone growth.

[0123] Three-week-old Sprague-Dawley rats (hereinafter, SD rats) (n=15) were administered the peptide of Preparation Example 1 at the 4-week age after a 1-week acclimatization period. Specifically, the control group (Con) (n=5) was orally administered PBS (1 ml) once daily, the peptide administration group of Preparation Example 1 (experimental group) (n=5) was orally administered 100 mg / 250 g in PBS (1 ml) once daily, and the positive control hGH (P / C) (n=5) was subcutaneously injected 50 μg / 250 g in PBS (0.5 ml) once daily. Oral or subcutaneous administration was performed once daily for a total of 4 weeks from weeks 4 to 9. At 5 weeks (1W), 6 weeks (2W), 8 weeks (3W), and 9 weeks (4W), body weight and length from nose to tail tip were measured using a microscale and a ruler. At 9 weeks (4W), SD rats were sacrificed, and the tibia of the hind legs of SD rats was deboned and measured for length using a digital caliper.

[0124] It was confirmed that the length from the nose to the tip of the tail in SD rats that were administered the peptide of Manufacturing Example 1 once a day increased more than in the control group and positive control group (hGH) (Fig. 2a and Fig. 2b).

[0125] In SD rats that were administered the peptide of Manufacturing Example 1 once daily for 4 weeks, it was confirmed that the length from the nose to the tip of the tail grew at the 2-week and 4-week points (Fig. 3). Panel A of Fig. 3 shows the length increased from 0W to 1W, Panel B of Fig. 3 shows the length increased from 1W to 2W, Panel C of Fig. 3 shows the length increased from 2W to 3W, and Panel D of Fig. 3 shows the length increased from 3W to 4W.

[0126] It was confirmed that the body weight of SD rats that were administered the peptide of Manufacturing Example 1 once a day increased more than that of the control group and positive control group (hGH) (Fig. 4a and Fig. 4b).

[0127] In SD rats that were fed the peptide of Manufacturing Example 1 once a day for 4 weeks, body weight increases were observed at 1, 2, and 4 weeks (Fig. 5). Panel A of Fig. 5 shows the body weight increase from 0W to 1W, Panel B of Fig. 5 shows the body weight increase from 1W to 2W, Panel C of Fig. 5 shows the body weight increase from 2W to 3W, and Panel D of Fig. 5 shows the body weight increase from 3W to 4W.

[0128] It was confirmed that the length of the tibia longitudinal bone in SD rats that were administered the peptide of Manufacturing Example 1 once daily for 4 weeks increased more than in the control group and the positive control group (hGH) (Fig. 6). Panel A of Fig. 6 shows the results of photographing the tibia longitudinal bone, and Panel B of Fig. 6 shows the results of length measurement using a digital caliper.

[0129] Experimental Example 3: Growth Plate Length Measurement Experiment - H&E Staining and IHC Staining

[0130] It was evaluated whether the peptide manufactured in the above Manufacturing Example 1 has therapeutic activity for growth retardation by promoting bone growth.

[0131] Tissue sample preparation

[0132] Three-week-old Sprague-Dawley rats (hereinafter, SD rats) (n=15) were administered the peptide of Preparation Example 1 at the 4-week mark after a 1-week acclimatization period. Specifically, the control group (Con) (n=5) was orally administered PBS (1 ml) once daily, the peptide administration group of Preparation Example 1 (experimental group) (n=5) was orally administered 100 mg / 250 g in PBS (1 ml) once daily, and the positive control group, hGH (P / C) (n=5), was subcutaneously injected 50 μg / 250 g in PBS (0.5 ml) once daily. Oral or subcutaneous administration or subcutaneous injection was performed once daily for a total of four weeks from weeks 4 to 9. After 4 weeks of treatment, SD rats were sacrificed at the 9-week mark, and the tibia of the rats was isolated. The isolated tibia was fixed in 3.7% formaldehyde for 24 hours. After fixation, the tissue was washed in phosphate-buffered saline (PBS) and decalcified in 5% nitric acid for 3 days. After immersing in PBS and washing for approximately 3 hours or more without shaking, it was transferred to a cassette and dehydrated using a tissue processor (ethanol 70%, 80%, 90%, 100% I, II ethanol, xylene I, II in that order). The dehydrated tissue was embedded and made into a paraffin block, then cut into sections at a thickness of 4 μm, which were then attached to slide glasses and completely dried for more than 24 hours.

[0133] H&E (Hematoxylin and Eosin) staining

[0134] H&E (Hematoxylin and Eosin) staining was performed as follows. Paraffin was removed from the tissue and hydrated. (After treatment with Xylene I and II for 5 minutes each, the sections were treated in the order of Xylene: 100% Ethanol = 1:1, 100% I, II, 90%, 80%, and 70% ethanol for 3 minutes each step). The sections were washed in running water for 5 minutes with intermittent dipping. The sections were stained with Hematoxylin (Dako, S3309) for 5 minutes and washed in running water for 5 minutes with intermittent dipping until the dye was completely washed away. The sections were stained with Eosin Y (Shandon, 6766007) for 5 minutes. The sections were washed in running water for 5 minutes. Subsequently, it was dehydrated (95% I, II, 100% I, II ethanol, xylene III in that order for 2 minutes each, xylene IV for 3 minutes). After mounting the sample on a microscope, it was dried for more than 24 hours, and the growth plate was observed under a microscope to measure its length.

[0135] Immunohistochemistry (IHC) staining

[0136] The slides were placed in a slide holder, and placed in Xylane (1, 2, 3) solution for 5 minutes three times, then placed in 100% ethanol (EtOH) solution for 3 minutes twice, placed in 90% ethanol solution for 3 minutes, placed in 80% ethanol solution for 3 minutes, and placed in 70% ethanol solution for 3 minutes. Then, the slides were washed in running water, and after 5 minutes, the tissue area was marked with a pen (Daco Pen). After treating with 3% H2O2 for 10 minutes, the slides were washed with DPBS for 10 minutes. Pepsin (100 μl / sample) was sprayed on the tissues, placed at 37°C for 30 minutes, and then washed with DPBS for 10 minutes. Ultravision protein block (Epredia, cat no. TA-125-PBQ, 1X diluted in DPBS) was used for blocking at room temperature for 1 hour. The primary antibody (anti-Ki67 Ab, Invitrogen, MA514520, 1:25) was treated for 2 hours at room temperature (RT), followed by three 10-minute washes in DPBS. The secondary antibody (Goat pAb to Rb lgG / Alexa Fluor 488, Abcam, cat no. AB150077) was treated for 2 hours at room temperature (RT), followed by three 10-minute washes in DPBS. After treating with DAPI (2 drops + 2 ml substrate) for 5 minutes, the sections were washed with DPBS for 5 minutes. The sections were mounted on a confocal microscope, photographed, and the length of the growth plate was measured.

[0137] Results Analysis

[0138] According to the H&E staining results (Fig. 7a), it was confirmed that the length of the tibia growth plate in SD rats (experimental group, panel B) that were administered the peptide of Manufacturing Example 1 once a day for 4 weeks increased more than in the control group (panel A) and the positive control group (hGH) (panel C). Specifically, based on the PZ (Proliferative Zone), the experimental group (panel B) was measured to have a PZ of 173.00 μm, the control group (panel A) to have a PZ of 146.07 μm, and the positive control group (hGH) (panel C) to have a PZ of 146.63 μm, confirming that growth plate growth was promoted in rats treated with the peptide of Manufacturing Example 1 (Fig. 7a).

[0139] Figure 7b graphically displays the results of measuring the length of the tibial growth plate using H&E staining. The results shown in Figure 7b also confirm that growth plate growth is promoted in rats treated with the peptide of the present invention.

[0140] Figure 7c shows the results of confirming the status of proliferative chondrocytes in the tibial growth plate by the IHC (Immunohistochemistry) staining method using the proliferative marker Ki67. It was confirmed that proliferative chondrocytes were formed longer in the PZ zone of rats (experimental group) treated with the peptide of Manufacturing Example 1 than in the control group (PBS treatment).

[0141] Experimental Example 4: Growth Plate Length Measurement Experiment - DAB Staining

[0142] Whether the peptide manufactured in the above Manufacturing Example 1 can promote growth plate growth was evaluated through a DAB staining experiment.

[0143] Tissue sample preparation

[0144] Three-week-old Sprague-Dawley rats (hereinafter, SD rats) (n=15) were administered the peptide of Preparation Example 1 at the 4-week mark after a 1-week acclimatization period. Specifically, the control group (Con) (n=5) was orally administered PBS (1 ml) once daily, the peptide administration group of Preparation Example 1 (experimental group) (n=5) was orally administered 100 mg / 250 g in PBS (1 ml) once daily, and the positive control group, hGH (P / C) (n=5), was subcutaneously injected 50 μg / 250 g in PBS (0.5 ml) once daily. Oral or subcutaneous administration or subcutaneous injection was performed once daily for a total of four weeks from weeks 4 to 9. After 4 weeks of treatment, SD rats were sacrificed at the 9-week mark, and the tibia of the rats was isolated. The isolated tibia was fixed in 3.7% formaldehyde for 24 hours. After fixation, the tissue was washed in phosphate-buffered saline (PBS) and decalcified in 5% nitric acid for 3 days. After immersing in PBS and washing for approximately 3 hours or more without shaking, it was transferred to a cassette and dehydrated using a tissue processor (ethanol 70%, 80%, 90%, 100% I, II, ethanol, xylene I, II in that order). The dehydrated tissue was embedded and made into a paraffin block, then cut into sections at a thickness of 4 μm, which were then attached to slide glasses and completely dried for more than 24 hours.

[0145] DAB (3,3'-diaminobenzidine) staining

[0146] The slides were placed in a slide holder, and placed in Xylane (1, 2, 3) solution for 5 minutes three times, then placed in 100% ethanol (EtOH) solution for 3 minutes twice, placed in 90% ethanol solution for 3 minutes, placed in 80% ethanol solution for 3 minutes, and placed in 70% ethanol solution for 3 minutes. Then, the slides were washed in running water, and after 5 minutes, the tissue area was marked with a pen (Daco Pen). After treating with 3% H2O2 for 10 minutes, the slides were washed with DPBS for 10 minutes. Pepsin (100 μl / sample) was sprayed on the tissues, placed at 37°C for 30 minutes, and then washed with DPBS for 10 minutes. Ultravision protein block (Epredia, cat no. TA-125-PBQ, 1X diluted in DPBS) was used for blocking at room temperature for 1 hour. Anti-IGF-1 Antibody (Invitrogen, MA518035, 1:100 dilution) or anti-IGFBP3 Antibody (Santa Cruz, SC-365936, 1:100 dilution) was treated as the primary antibody, and reacted overnight at 4℃, followed by three 10-minute DPBS washes. Anti-Mouse IgG antibody (Jackson, 115-035-003) was treated as the secondary antibody for 2 hours at room temperature (RT), followed by three 10-minute DPBS washes. DAB solution (Epredia, TA-125-QHDX; 2 drops + 2 ml substrate) was added, and when it turned brown, DW was dropped and reacted. The reaction was stopped, mounted on a microscope (Confocal Microscopy), photographed, and the length of the growth plate was measured.

[0147] Results Analysis

[0148] It was confirmed that the expression of IGF-1 increased in the growth plate area of ​​the tibia of SD rats that were administered the peptide of Manufacturing Example 1 once daily for 4 weeks. It was confirmed that the expression of IGF-1 (Insulin-like growth factor 1) increased more in the experimental group (Panel B) compared to the control group (Panel A) (Fig. 8a).

[0149] It was confirmed that the expression of IGFBP3 (Insulin-like growth factor-binding protein 3) increased in the growth plate area of ​​the tibia of SD rats that were administered the peptide of Manufacturing Example 1 once daily for 4 weeks. It was confirmed that the expression of IGFBP3 increased more in the experimental group (Panel B) compared to the control group (Panel A) (Fig. 8b).

[0150] Experimental Example 5: Experiment to measure GH (Growth hormone) expression in the pituitary gland

[0151] It was evaluated whether the peptide manufactured in the above Manufacturing Example 1 increases the expression of GH (Growth hormone) in the pituitary gland.

[0152] Tissue sample preparation

[0153] Three-week-old Sprague-Dawley rats (hereinafter, SD rats) (n=15) were administered the peptide of Manufacturing Example 1 at the 4-week mark after a 1-week acclimatization period. Specifically, the control group (Con) (n=5) was orally administered PBS (1 ml) once daily, and the peptide administration group (experimental group) of Manufacturing Example 1 (n=5) was orally administered 100 mg / 250 g in PBS (1 ml) once daily. Oral administration or subcutaneous injection was performed once daily for a total of 4 weeks from weeks 4 to 9. After 4 weeks of treatment, SD rats were sacrificed at the 9-week mark, and the pituitary glands of the rats were isolated. The isolated pituitary tissues were fixed in 3.7% formaldehyde for 24 hours. The fixed tissues were processed with paraffin (sequentially, 70% EtOH for 1 h, 80% EtOH for 1 h, 90% EtOH for 1 h, 95% EtOH for 1 h, 100% EtOH for 1 h, 100% EtOH for 1 h, Xylene for 1 h 30 min, Xylene for 1 h 30 min, Paraffin for 2 h, Paraffin for 2 h). The tissues were embedded in paraffin and cut into 5 μm thick sections, which were then attached to slide glasses and completely dried for more than 24 hours. Subsequently, IHC (Immunohistochemistry) staining was performed.

[0154] Immunohistochemistry (IHC) staining and results

[0155] The slides were placed in a slide holder and placed in xylane (1, 2, 3) solution for 5 minutes three times, then placed in 100% ethanol (EtOH) solution for 3 minutes twice, placed in 90% ethanol solution for 3 minutes, placed in 80% ethanol solution for 3 minutes, and placed in 70% ethanol solution for 3 minutes. Then, the slides were washed in running water and after 5 minutes, the tissue area was marked with a pen (Daco Pen). After 10 minutes of treatment with 3% H2O2, the slides were washed with DPBS for 10 minutes. Pepsin (100 μl / sample) was sprayed on the tissues, placed at 37°C for 30 minutes, and then washed with DPBS for 10 minutes. Ultravision protein block (Epredia, cat no. TA-125-PBQ, 1X diluted in DPBS) was used for blocking at room temperature for 1 hour. The primary antibody (anti-GH Ab, Abcam, cat no. AB126882, 1:1000) was treated overnight at 4°C, followed by three 10-minute washes in DPBS. The secondary antibody (Goat pAb to Rb lgG / Alexa Fluor 488, Abcam, cat no. AB150077) was treated for 2 hours at room temperature (RT), followed by three 10-minute washes in DPBS. After treating with DAPI (2 drops + 2ml substrate) for 5 minutes, the sections were washed with DPBS for 10 minutes. The sections were mounted on a microscope (Confocal Microscopy) and photographed.

[0156] It was confirmed that the expression of GH in the pituitary glands of SD rats (experimental group) that were administered the peptide of Manufacturing Example 1 once daily for 4 weeks was increased compared to the control group (Figs. 9a and 9b). Fig. 9a shows that GH fluorescence increased in the experimental group, and Fig. 9b shows a graph of the measured fluorescence intensity.

[0157] Experimental Example 6: Toxicity Test

[0158] It was evaluated whether the peptide manufactured in the above Manufacturing Example 1 had toxicity when administered.

[0159] Three-week-old Sprague-Dawley rats (hereinafter, SD rats) were acclimatized for one week, and then administered the peptide of Preparation Example 1 at the four-week mark. Specifically, the control group (Con) (n=5) was orally administered PBS (1 ml) once daily, and the peptide of Preparation Example 1 (n=5) was orally administered 100 mg / 250 g in PBS (1 ml) once daily. After four weeks of treatment, SD rats were sacrificed at the nine-week mark, and cardiac perfusion was performed twice into the left ventricle with PBS (40 to 50 ml) using a syringe. Liver tissue was removed using surgical scissors. The removed tissue was fixed in 3.7% formaldehyde for 24 hours. After washing in PBS (no shaking), the liver tissue was transferred to a cassette and dehydrated using a tissue processor (ethanol 70%, 80%, 90%, 100% I, II ethanol, xylene I, II in that order). The tissue was embedded and made into a paraffin block, then cut into sections at a thickness of 4 μm, attached to slide glasses, and completely dried for more than 24 hours. Subsequently, H&E (Hematoxylin and Eosin) staining was performed. Paraffin was removed from the tissue and it was hydrated (Xylene I, II each for 5 min, Xylene:100% Ethanol 1:1, 100% I, II, 90%, 80%, 70% ethanol in that order, treated for 3 min each step). It was washed in running water for 5 minutes with intermittent immersion in between. Stained with hematoxylin (Dako, S3309) for 5 minutes, washed in running water for 5 minutes with intermittent immersion until the dye was completely washed away.The samples were stained with Eosin Y (Shandon, 6766007) for 5 minutes. The samples were washed in running water for 5 minutes. The samples were then dehydrated (95% ethanol I, II, 100% ethanol I, II, xylene III for 2 minutes each, xylene IV for 3 minutes). The samples were mounted on a microscope, dried for more than 24 hours, and observed under a microscope. No liver toxicity was observed in the liver tissue of SD rats that were administered the peptide of Preparation Example 1 once daily for 4 weeks (Fig. 10).

[0160] Although representative embodiments of the present application have been described above as examples, the scope of the present application is not limited to the specific embodiments described above, and a person with ordinary knowledge in the relevant field will be able to make appropriate changes within the scope described in the claims of the present application.

Claims

1. A growth promoting composition comprising a peptide having an amino acid sequence of sequence number 1 as an active ingredient.

2. In claim 1, A composition wherein the above peptide has an activity of promoting the production of growth hormone or an activity of promoting the growth of a growth plate.

3. A pharmaceutical composition for treating or preventing growth retardation disease, comprising a peptide having an amino acid sequence of sequence number 1 as an active ingredient.

4. In claim 3, A pharmaceutical composition, wherein the above growth retardation disease is short stature disorder.

5. In claim 4, A pharmaceutical composition, wherein the above short stature disorder is familial short stature, idiopathic short stature, intrauterine growth retardation (IUGR), short stature due to growth plate damage, short stature due to osteochondrodysplasia, short stature due to kidney disease, short stature due to chronic disease, short stature due to growth hormone deficiency, short stature due to thyroid hormone deficiency, short stature due to sex hormone deficiency, short stature due to adrenocortical hormone deficiency, short stature due to Turner syndrome, or short stature due to Down's syndrome.

6. In claim 5, A pharmaceutical composition, wherein the short stature due to the above renal disease is short stature due to uremia, short stature due to renal tubular acidosis, or short stature due to chronic renal failure.

7. In claim 6, A pharmaceutical composition wherein the short stature caused by the chronic disease is short stature caused by congenital heart disease, short stature caused by chronic lung disease, or short stature caused by liver disease.

8. In claim 3, A pharmaceutical composition wherein the peptide has an activity of promoting the production of growth hormone (GH) or an activity of promoting the growth of a growth plate.

9. A food composition for improving or preventing growth retardation, comprising a peptide having an amino acid sequence of sequence number 1 as an active ingredient.

10. In claim 9, A food composition wherein the above growth retardation is short stature disorder.

11. In claim 9, A food composition wherein the above peptide has an activity of promoting the production of growth hormone (GH) or an activity of promoting the growth of a growth plate.

Citation Information

Patent Citations

  • Human Growth Hormone―Derived Peptides and Uses Thereof

    KR101054519B1

  • Compositions targeting 3-repeat tau for the treatment of neurodegenerative disorders, and methods for making and using them

    US10947302B2

  • Stereoisomer peptides, their polymer conjugates, their encapsulation into nanoparticles, and uses thereof for the treatment of diseases caused by abnormal angiogenesis.

    US20150050351A1

  • Liposomes for in-vivo delivery

    US9655848B2