Recombinant rhabdoviral g glycoproteins and uses thereof

WO2025217533A3PCT designated stage Publication Date: 2025-11-20VYRIAD INC
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/024301
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-06-14
Filing Date
2025-04-11
Publication Date
2025-11-20

AI Technical Summary

Technical Problem

There is a need for components and delivery vehicles that can specifically target hematopoietic stem cells and hepatic sinusoidal endothelial cells for efficient gene delivery and editing, as existing methods are slow, inconvenient, and expensive.

Method used

Development of recombinant fusion proteins comprising rhabdoviral G glycoproteins fused with targeting molecules such as stem cell factor (SCF), thrombopoietin (TPO), or epidermal growth factor (EGF) to target hematopoietic stem cells or hepatic sinusoidal endothelial cells, and the use of enveloped viral particles and vectors for in vivo delivery.

Benefits of technology

Enables fast, convenient, and cost-effective in vivo delivery of genetic material to specified target cells, reducing the inactivation of rhabdoviral G glycoproteins by serum and LDL, and enhancing the efficiency of gene editing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025024301_20112025_PF_FP_ABST
    Figure US2025024301_20112025_PF_FP_ABST
Patent Text Reader

Abstract

In aspects, the present disclosure provides a recombinant fusion protein comprising, consisting essentially of, or consisting of (a) a rhabdoviral G glycoprotein or a functional fragment or derivative thereof and (b) a targeting molecule, wherein the targeting molecule targets the recombinant fusion protein to a hematopoietic stem cell (HSC). Additional aspects are as described herein.
Need to check novelty before this filing date? Find Prior Art

Description

RECOMBINANT RHABDOVIRAL G GLYCOPROTEINS AND USES THEREOFCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This patent application claims the benefit of U.S. Provisional Patent Application No. 63 / 633,553, filed April 12, 2024; International Patent Application No.PCT / US2024 / 024511, filed April 12, 2024; International Patent Application No. PCT / US2024 / 024516, filed April 12, 2024; U.S. Provisional Patent Application No. 63 / 660,355, filed June 14, 2024; and U.S. Provisional Patent Application No. 63 / 660,217, filed June 14, 2024; the disclosures of which are incorporated herein by reference in their entireties for all purposes.INCORPORATION-BY-REFERENCE OF MATERIAL SUBMITTED ELECTRONICALLY

[0002] Incorporated by reference in its entirety herein is a computer-readable nucleotide / amino acid sequence listing submitted concurrently herewith and identified as follows: One 388,283 Byte XML (Extensible Markup Language) file named "772832_SequenceListing.xml," created on April 11, 2025.BACKGROUND

[0003] There is an ongoing need in the art for components that can be used in a virus or enveloped delivery vehicle to target the virus or enveloped delivery vehicle to particular cells. There is also an ongoing need in the art for viruses and enveloped delivery vehicles that incorporate such components.BRIEF SUMMARY

[0004] In aspects, the present disclosure provides a recombinant fusion protein comprising, consisting essentially of, or consisting of (a) a rhabdoviral G glycoprotein or a functional fragment or derivative thereof and (b) a targeting molecule, wherein the targeting molecule targets the recombinant fusion protein to a hematopoietic stem cell (HSC).

[0005] In aspects, the present disclosure provides a recombinant fusion protein comprising, consisting essentially of, or consisting of (a) a rhabdoviral G glycoprotein or a functional fragment or derivative thereof and (b) a targeting molecule, wherein the targetingmolecule targets the recombinant fusion protein to a hepatic sinusoidal endothelial cell (HSEC).

[0006] In aspects, the present disclosure provides a recombinant fusion protein comprising, consisting essentially of, or consisting of (a) a rhabdoviral G glycoprotein or a functional fragment or derivative thereof and (b) a targeting molecule, wherein the targeting molecule comprises: (1) stem cell factor (SCF), (2) an anti-c-KIT binding domain, (3) thrombopoietin (TPO), (4) epidermal growth factor (EGF), or (5) a functional fragment or derivative of (1), (2), (3) or (4).

[0007] In aspects, the present disclosure provides a membraned vesicle comprising, consisting essentially of, or consisting of a recombinant fusion protein as described herein.

[0008] In aspects, the present disclosure provides an enveloped viral particle comprising, consisting essentially of, or consisting of a recombinant fusion protein as described herein.

[0009] In aspects, the present disclosure provides a recombinant viral vector comprising, consisting essentially of, or consisting of a nucleotide encapsulated by a membraned vesicle as described herein or an enveloped viral particle as described herein.

[0010] In aspects, the present disclosure provides a composition comprising, consisting essentially of, or consisting of a pharmaceutically acceptable carrier and a membraned vesicle as described herein, an enveloped viral particle as described herein, or a recombinant viral vector as described herein.

[0011] In aspects, the present disclosure provides a method of delivering a payload to a hematopoietic stem cell or hepatic sinusoidal endothelial cell, the method comprising, consisting essentially of, or consisting of contacting the hematopoietic stem cell with a membraned vesicle as described herein, an enveloped viral particle as described herein, a recombinant viral vector as described herein, or a composition as described herein.

[0012] In aspects, the present disclosure provides a retroviral vector expression system comprising, consisting essentially of, or consisting of one or more nucleotide sequences encoding a recombinant fusion protein as described herein.

[0013] In aspects, the present disclosure provides a method of making a membraned vesicle, an enveloped viral particle, a virus-like particle, or a recombinant viral vector, the method comprising, consisting essentially of, or consisting of: a) transfecting or transducing a packaging host cell with a retroviral vector expression system as described herein; and b)recovering the membraned vesicle, enveloped viral particle, virus-like particle, or recombinant viral vector produced by the transfected or transduced packaging host cell.

[0014] In aspects, the present disclosure provides a plasmid comprising, consisting essentially of, or consisting of one or more nucleotide sequences encoding a recombinant fusion protein as described herein.

[0015] In aspects, the present disclosure provides a composition as described herein or a retroviral vector expression system as described herein for use in treating a disease in a mammal.

[0016] In aspects, the present disclosure provides a method of making a mixed rhabdoviral G glycoprotein trimer, the method comprising, consisting essentially of, or consisting of: a) transfecting or transducing a packaging host cell with a retroviral vector expression system as described herein; and b) recovering the mixed rhabdoviral G glycoprotein trimer.

[0017] In aspects, the present disclosure provides a method of reducing inactivation of a rhabdoviral G glycoprotein or a functional fragment or derivative thereof by serum, LDL, or vLDL, the method comprising producing a rhabdoviral G glycoprotein or functional fragment or derivative thereof as a recombinant fusion protein as described herein, and exposing the recombinant fusion protein to serum, LDL, or vLDL, wherein inactivation by serum, LDL, or vLDL is reduced.

[0018] Additional aspects are as described herein.

[0019] Without wishing to be bound by any particular theory, there may be discussion herein of beliefs or understandings of underlying principles relating to the materials and methods disclosed herein. It is recognized that regardless of the ultimate correctness of any mechanistic explanation or hypothesis, an aspect of the disclosure can nonetheless be operative and usefulBRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 A shows an illustration of the current state of ex vivo hematopoietic stem cell (HSC) gene therapies and genome editing, where target cells are removed from the body, modified ex vivo, and reinfused, making the process slow, inconvenient, and expensive compared to an illustration of potential state of in vivo stem cell gene therapies and genomeediting made possible by retargeting vectors, which allows for the delivery of genes or genome editors directly to specified target cells in vivo, making the process comparatively fast, convenient, and inexpensive.

[0021] Figure IB is an illustration of the differentiation lineage of HSCs, showing long term HSCs (LT-HSC) that undergo self-renewal and short-term HSCs (ST-HSCs) which undergo relatively limited self-renewal.

[0022] Figure 1C is an illustration of a trimer having receptor blinded recombinant fusion proteins of rhabdoviral G glycoproteins fused via a linker to a targeting molecule, such as a ligand or scFv, directed to HSCs.

[0023] Figure ID is a schematic diagram of transmembrane, cleavable, and soluble forms of the cytokine stem cell factor (SCF).

[0024] Figure IE is a diagram showing signaling pathways of the receptor tyrosine kinase C-KIT / CD117 via SCF dimer signaling.

[0025] Figures 2A-2C are a schematic diagram of envelope plasmids encoding a low density lipoprotein receptor (LDLR) blinded Vesiculovirus Indiana G glycoprotein (VSIV-G) with Q substitutions at the K47 and R354 residues (VSIV-G-QQ) (SEQ ID NO: 13) fused to a targeting molecule, human SCF (hSCF) (SEQ ID NO: 28) via different linkers (FIG. 2 A), a set of fluorescent (top) and bright field (bottom) micrographs showing K562 cells or K562 cells expressing c-KIT (K562-cKit), a SCF receptor, transduced with lentivirus containing a GFP-expression cassette (SEQ ID NO: 85) and pseudotyped with VSIV-G (G-WT) (SEQ ID NO: 9), VSIV-G-QQ (SEQ ID NO: 13) (G-QQ), or a recombinant fusion protein of hSCF (SEQ ID NO: 28) fused N terminal to VSIV-G-QQ (SEQ ID NO: 13) via each of the linker shown in FIG. 2A (FIG. 2B), and a bar graph quantifying the GFP positive K562 (left bar) and K562-C-KIT (right bar) cells transduced with each lentivirus. A preferred lentivirus pseudotyped with hSCF (SEQ ID NO: 28) fused N terminal to VSIV-G-QQ (SEQ ID NO: 13) via a 19 amino acid linker (SEQ ID NO: 49) is outlined with a box (FIG. 2C).

[0026] Figure 2D is a diagram of a preferred recombinant fusion protein of a targeting molecule against c-KIT, either SCF (SEQ ID NO: 28) or an anti-c-KIT single chain variable fragment (scFv) (SEQ ID NOs: 87 and 88) fused N terminal to a LDLR blinded VSIV-G, with Q substitutions at the K47 and R354 residues (VSIV-G-QQ) (SEQ ID NO: 13), Q substitutions at the K47, R354, and Y209 residues (VSIV-G-QQQ) (SEQ ID NO: 14), or adeletion at the K47 residue (VSIV-G-AK47) (SEQ ID NO: 15)) via a 19 amino acid flexible linker (19aaL(F)) (SEQ ID NO: 49).

[0027] Figure 3A is an illustration summarizing how lentiviruses (LVs) pseudotyped with recombinant rhabdoviral G glycoproteins fused with a c-KIT targeting molecule were prepared and used to transduce cells.

[0028] Figure 3B is a diagram showing the mixed trimer approach, and some potential resulting trimers. An envelope plasmid encoding a recombinant fusion protein of a targeting molecule attached to a receptor blinded rhabdoviral G protein is used at a 1 to 3 ratio with an envelope plasmid encoding a receptor blinded rhabdoviral G protein to create mixed trimers.

[0029] Figures 3C-3D are a set of fluorescent micrographs (FIG. 3C) and corresponding data (FIG. 3D) showing K562 cells, K562 cells expressing human c-KIT (K562-hcKit), or K562 cells expressing mouse c-KIT (K562-mcKit) transduced with lentivirus containing a GFP-expression cassette (SEQ ID NO: 85) and pseudotyped with VSIV-G (VSV G WT) (SEQ ID NO: 9), VSIV-G-QQ (VSV G-QQ) (SEQ ID NO: 13), or a recombinant fusion protein of hSCF (SEQ ID NO: 28) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) via a 19 amino acid linker (SEQ ID NO: 49) (hSCF-19aaL(F)-VSV G-QQQ), a recombinant fusion protein of the anti-human c-KIT scFv 2D1 (SEQ ID NOs: 87 and 88) fused N terminal to VSIV-G-QQ (SEQ ID NO: 13) via a 19 amino acid linker (SEQ ID NO: 49) alone (hacKit- 2Dl-19aaL(F)) or mixed at 1 :3 ratio with VSIV-G-QQ (SEQ ID NO: 13) (1 :3 hacKit-2Dl- 19aaL(F)) (FIG. 3C) and a bar graph quantifying the GFP positive K562 (left bar), K562- hcKit (middle bar), and K562-mcKit (right bar) cells transduced with each lentivirus (FIG. 3D).

[0030] Figures 3E-3G provide a set of fluorescent (FIG. 3E, top) and bright field (FIG. 3E, bottom) micrographs showing Jurkat cells, a T cell line, and Jurkat cells expressing c- KIT (Jurkat-cKit) transduced with lentivirus containing a GFP-expression cassette (SEQ ID NO: 85) and pseudotyped with VSIV-G (VSV G WT) (SEQ ID NO: 9), VSIV-G-QQQ (VSV G-QQQ) (SEQ ID NO: 14), or a recombinant fusion protein of hSCF (SEQ ID NO: 28) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) via a 19 amino acid linker (SEQ ID NO: 49) (hSCF- 19aaL(F)- VSV G-QQQ) mixed at varying ratios with VSIV-G-QQQ (SEQ ID NO: 14) (1 to 0, 1 to 1, 1 to 2, 1 to 3, 1 to 4, 1 to 5, 1 to 6, or 1 to 7) and bar graphs (FIGS. 3F & 3G) quantifying the GFP positive Jurkat (left bar) and Jurkat-cKit (right bar) cells transduced with each lentivirus displayed linearly (FIG. 3F) or logarithmically (FIG. 3G).

[0031] Figures 4A-4C are a set of fluorescent micrographs (FIG. 4A) and corresponding data (FIGS. 4B and 4C) showing Jurkat cells, Jurkat cells expressing human c-KIT (Jurkat- hcKit), or Jurkat cells expressing mouse c-KIT (Jurkat-mcKit) transduced with lentivirus containing a GFP-expression cassette (SEQ ID NO: 85) and pseudotyped with VSIV-G (VSV G WT) (SEQ ID NO: 9), VSIV-G-QQ (VSV G-QQ) (SEQ ID NO: 13), VSIV-G-QQQ (VSV G-QQQ) (SEQ ID NO: 14), or a recombinant fusion protein of human SCF (hSCF) (SEQ ID NO: 28), mouse SCF (mSCF) (SEQ ID NO: 30), mSCF with an alanine substitution at residue 63 (mSCF-F63A) (SEQ ID NO: 172), mSCF with substitutions N6D, D77H, K81I, V87F, L88F, and S101F (mSCF-6mut) (SEQ ID NO: 81), or mSCF with an alanine substitution at residue 63 and N6D, D77H, K81I, V87F, L88F, and S101F substitutions (mSCF-F63A-6mut) (SEQ ID NO: 83) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) via a 19 amino acid linker (SEQ ID NO: 49) alone or mixed at a 1 :3 ratio with VSIV-G-QQQ (SEQ ID NO: 14) (FIG. 4 A) and bar graphs quantifying the GFP positive Jurkat (left bar), Jurkat-hcKit (middle bar), and Jurkat-mcKit (right bar) cells transduced with each lentivirus at normal scale quantifications (FIG. 4B) or cut off at 100 cells (FIG. 4C).

[0032] Figures 5A and 5B are an illustration showing a gene editing system used to inhibit DEAD-box helicase family member DDX3 via lentivirus or virus-like particles (VLPs) (FIG. 5 A) and an illustration showing how VLPs containing a gene editing systems pseudotyped with rhabdoviral G glycoproteins alone or fused with a targeting molecule were prepared (FIG. 5B).

[0033] Figure 5C depicts illustrations of example VLPs which may be prepared by the schematic shown in FIG. 5B.

[0034] Figures 6A-6C are a diagram of the components of the gene editing system for inhibition of DDX3 used in production of VLPs (FIG. 6 A), a set of bright field (BF) and fluorescent micrograph (mNeon) images of HEK293T cells and another set of HEK293T cells obtained from Takara that are untransfected as a negative control (-ve control), or transfected with the gene editing system of FIG. 6 A at either 24 hours post transfection (VLP-DDX3 24 hpt) or 48 hours post transfection (VLP-DDX3 48 hpt) (FIG. 6B), and a set of western blot images of the same cells at 48 hours or 72 hours post transfection showing binding of an anti-Cas9 antibody, with arrows indicating bands of Cas9 and Gag-Cas9, and binding of an anti-VSIV-G antibody, with arrows indicating bands of VSIV-G (FIG. 6C).

[0035] Figures 7A-7E are a set of bright field (BF) and fluorescent micrograph (GFP) images of HEK293T cells taken 24 hours or 48 hours after no treatment (Control) or transduction with 10 pL, 20 pL, or 30 pL of VLPs with a CAS9 gene editing system for inhibition of DDX3 (DDX3-Cas9-VLPs) (FIG. 7 A), an agarose gel showing a restriction digest with Bstl of DDX3 amplified PCR product from HEK293T cells 72 hours post transduction (72 hpt) with 10 pL, 20 pL, or 30 pL DDX3-Cas9-VLPs and protamine sulfate (PS) either or unconcentrated, or concentrated using PEG-8000 or ultracentrifugation with a buffer (UC with buffer) or without (UC w / o buffer) and arrows indicating bands of undigested DDX3 or digested DDX3 (FIG. 7B), an illustration showing the sequences of the amplified PCR product from control HEK293T cells, and HEK293T cells transfected with the DDX3 gene editing systems to produce DDX3-VLPs, and HEK293T cells and HEK293T cells from Takara transduced with DDX3-VLPs, with a Bstl restriction site labeled (FIG. 7C), FIG. 7D shows a zoomed in portion of the illustration depicted in FIG. 7C, and a graph showing the percentage of edited (left bar) and unedited (Right bar) transfected HEK293T cells, transduced HEK293T cells, and transduced HEK293T cells from Takara (FIG. 7E).

[0036] Figures 8A-8D are a set of bright field (BF) and fluorescent micrograph (GFP) images of HEK293T cells transfected with an envelope plasmid (SEQ ID NO: 39) encoding VSIV-G (VSV G WT) (SEQ ID NO: 9), or an envelope plasmid encoding a recombinant fusion protein of a mutant form of epidermal growth factor (EGFml23) (SEQ ID NO: 34) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) (VSV EGFml23-GQQQ (SEQ ID NO: 93)), a recombinant fusion protein of hSCF (SEQ ID NO: 28) fused N terminal to VSIV-G- QQQ (SEQ ID NO: 14) via a 19 amino acid flexible linker (SEQ ID NO: 49) (VSV hSCF- 19aaL(F)-GQQQ (SEQ ID NO: 94)), or a recombinant fusion protein of the anti-c-KIT scFv 2D1 (SEQ ID NOs: 87 and 88) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) via a 19 amino acid linker (SEQ ID NO: 49) (VSV acKit-2Dl-19aaL-GQQQ (SEQ ID NO: 92)) at a 1 :3 ratio with an envelope plasmid encoding VSIV-G-QQQ (SEQ ID NO: 14), and a plasmid encoding Gag-Pol (SEQ ID NO: 91), a plasmid encoding Gag-Cas9 (SEQ ID NO: 90), and a transfer plasmid encoding the DDX3 sgRNA and GFP (SEQ ID NO: 89) to produce VLPs (FIG. 8A), or a packaging vector and a transfer plasmid encoding DDX3 sgRNA, Cas9, and GFP (FIG. 8B) or BCL11 A sgRNA, ABE, and GFP (FIG. 8C) to produce lentiviruses, and a set of western blot images of the same transfected cells showing binding of anti-P24 and anti- GAPDH antibodies as controls, and binding of anti-Cas9 antibodies, anti-ABE antibodies,and anti-VSIV-G antibodies with arrows indicating bands showing ABE-GFP / ABE, Cas9, Mixed Trimer VSV G, and VSV G (FIG. 8D).

[0037] Figures 9A-9E are a set of fluorescent micrograph (GFP filter) images of K562 cells, K562 cells expressing human epidermal growth factor receptor (K562-HuEGFR), and K562 cells expressing human c-KIT (K562-HucKit) untreated (-ve control) or transduced with VLP-DDX-Cas9-GFP pseudotyped with VSIV-G (VSV G WT) (SEQ ID NO: 9), or pseudotyped with a recombinant fusion protein of a mutant form of epidermal growth factor (EGFml23) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) (VSV EGFml23-GQQQ), a recombinant fusion protein of hSCF (SEQ ID NO: 28) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) via a 19 amino acid flexible linker (SEQ ID NO: 49) (VSV hSCF- 19aaL(F)-GQQQ), or a recombinant fusion protein of the anti-c-KIT scFv 2D1 (SEQ ID NOs: 87 and 88) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) via a 19 amino acid linker (SEQ ID NO: 49) (VSV acKit-2Dl-19aaL-GQQQ) at a 1 :3 ratio with VSIV-G-QQQ (SEQ ID NO: 14) (FIG. 9A), an agarose gel image of DDX3 amplified PCR products from the same cells, with an arrow indicating the 324 base pair amplicon (FIG. 9B), a diagram showing the CRISPR amplicon sequencing process (FIG. 9C), and graphs of the number of edited reads (FIG. 9D) and total reads (FIG. 9E) in K562 cells (left bar), K562 cells expressing human epidermal growth factor receptor (middle bar, K562-EGF), and K562 cells expressing human c-KIT (right bar, K562-c-kit).

[0038] Figures 9F-9M are an illustration showing the sequences of the CRISPR amplicon in K562 cells (FIG. 9F and FIG. 9G) and K562 cells expressing EGFR (FIG. 91 and FIG. 9 J) transduced with a VLP-DDX3-CAS9 pseudotyped with the indicated VSIV-G glycoprotein or recombinant fusion protein, and graphs showing the percentage of deletions, insertions, and combined insertions and deletions (% indels) in K562 cells transduced with a VLP- DDX3-CAS9 pseudotyped with VSV G WT (SEQ ID NO: 9) (FIG. 9H) and in K562 cells expressing EGFR transduced with a VLP-DDX3-CAS9 pseudotyped with VSV G WT (FIG. 9K) or VSV EGFml23-QQQ (FIG. 9L), or a graph showing the percent of gene editing in K562 cells (left bar), K562-EGF cells (middle bar), and K562-c-kit cells (right bar) transduced with a VLP-DDX3-CAS9 pseudotyped with the indicated VSIV-G glycoprotein or recombinant fusion protein (FIG. 9M).

[0039] Figure 10 is an illustration showing the production of VLPs without a transfer plasmid.

[0040] Figures 11 A-l IF are an illustration of VLPs containing Cas9 (FIG. 11 A) orCasMINI (FIG. 1 IB) and the plasmids used in their production, a diagram of the constructs used to test Cas9 vs CasMINI in VLPs (FIG. 11C), a set of bright field (left) and fluorescent micrograph images showing GFP (middle) and RFP (right) in Vero cells at 72 hours after no treatment (-ve control) or 72 hours post transduction with VLPs produced with the VSV-GFP construct, VSV-N-Cas9-P-RFP-gRNA construct, VSV-RFP-G-Cas9-L construct, or the VSV-RFP-G-CasMIN L construct (FIG. 1 ID), and western blots showing binding of an anti-Cas9 antibody (FIG. 1 IE) and an anti-VSIV-G antibody (FIG. 1 IF) with arrows indicating bands of Cas9 and VSIV-G.

[0041] Figure 12 is a diagram of constructs for testing the production of VLPs using the foamy virus as a viral vector.

[0042] Figures 13A-13H are overlapping figures showing alternate rhabdoviral G glycoproteins. FIGS. 13A-13B depicts select glycoproteins of the Vesiculovirus, Sprivivirus, Perhabdovirus, Ledantevirus, and Sigmavirus generas. FIG. 13C-13D depicts select glycoproteins of the Ephemerovirus, Tibrovirus, Hapavirus, Curiovirus, Caligrhavirus, Tupavirus, Sripuvirus, and Alphanemrhavirus generas. FIG. 13E-13F depicts select glycoproteins of the Lyssavirus, Almendravirus, and Varicosavirus generas. FIG. 13G-13H depicts select glycoproteins of the Cytorhabdovirus, Dichorhavirus, Nucleorhabdovirus, and Novirhabdovirus generas. Arrows indicate nine glycoproteins from nine different rhabdovirus genera (arrows pointing to Ledantevirus: KM205001 Fukuoka virus (FIG. 13B); Sigmavirus: GQ375258 Drosophila melanogaster sigmavirus (FIG. 13B); Ephemerovirus: AF234533 bovine ephemeral fever virus (FIG. 13C); Tibrovirus: JX297815 Bas-Congo virus (FIG. 13C); Hapavirus: KM205002 Flanders virus (FIG. 13C); Curiovirus: KM204994 Curionopolis virus (FIG. 13D); Tupavirus: AY840978 tupaia rhabdovirus (FIG. 13D); Sripuvirus: KC585008 Niakha virus (FIG. 13D); Almendravirus: KF543749 Puerto Almendras virus (FIG. 13F)).

[0043] Figure 14A is a schematic diagram of the human thrombopoietin (hTPO) protein, which binds the human thrombopoietin receptor (hTPO-R) which is also known as myeloproliferative leukemia protein (cMpl) and a schematic diagram of an envelope plasmid encoding a low density lipoprotein receptor (LDLR) blinded Vesiculovirus Indiana G glycoprotein (VSIV-G) with a deletion at the K47 residue (VSIV-GdK47) (SEQ ID NO: 15) fused to a hTPO targeting molecule, via a linker (19aaL(F)) (SEQ ID NO: 49).

[0044] Figure 14B is an illustration summarizing how lentiviruses (LVs) pseudotyped with recombinant rhabdoviral G glycoproteins fused with a hTPO-R targeting molecule were prepared and used to transduce cells.

[0045] Figures 15A-15B are a set of fluorescent micrographs (FIG. 15 A) and corresponding data (FIG. 15B) showing K562 cells, K562 cells expressing human TPO-R (K562-hcMpl), or K562 cells expressing mouse TPO-R (K562-mcMpl) transduced with lentivirus containing a GFP-expression cassette (SEQ ID NO: 85) and pseudotyped with VSIV-G (VSV G WT) (SEQ ID NO: 9); VSIV-G-AK47 (VSV G-dK47) (SEQ ID NO: 15); a recombinant fusion protein of a recombinant fusion protein of hTPO (SEQ ID NO: 161) fused N terminal to VSIV-G- AK47 (SEQ ID NO: 15) via a 19 amino acid linker (SEQ ID NO: 49) alone (hTPO-19aaL(F)) or mixed at 1 :3 ratio with VSIV-G-AK47 (VSV G-dK47) (SEQ ID NO: 15); a recombinant fusion protein of AF13948 peptide with a reverse G4S linker and no cysteine (SEQ ID NO: 170) fused N terminal to VSIV-G-AK47 (SEQ ID NO: 15) via a 19 amino acid linker (SEQ ID NO: 49) alone (AF13948 rev G4S linker no C- 19aaL(F)) or mixed at 1 :3 ratio with VSIV-G-AK47 (VSV G-dK47) (SEQ ID NO: 15); a recombinant fusion protein of romiplostim peptide with an 8 glycine repeat (SEQ ID NO: 175) fused N terminal to VSIV-G-AK47 (SEQ ID NO: 15) alone (Rom Gx8) or mixed at 1 :3 ratio with VSIV-G-AK47 (VSV G-dK47) (SEQ ID NO: 15); or a recombinant fusion protein of romiplostim peptide with an 8 glycine repeat and a 5 glycine spacer (SEQ ID NO: 176) fused N terminal to VSIV-G-AK47 (SEQ ID NO: 15) alone (Rom Gx8 w Gx5 spacer) or mixed at 1 :3 ratio with VSIV-G-AK47 (VSV G-dK47) (SEQ ID NO: 15) (FIG. 15 A); and a bar graph quantifying the percent of GFP positive K562 (left bar), K562-hcMpl (middle bar), and K562-mMpl (right bar) cells transduced with each lentivirus (FIG. 15B).

[0046] Figures 16A-16B are a set of fluorescent micrographs (FIG. 16A) and corresponding data (FIG. 16B) showing K562 cells, K562 cells expressing human TPO-R (K562-hcMpl), or K562 cells expressing mouse TPO-R (K562-mcMpl) transduced with lentivirus containing a GFP-expression cassette (SEQ ID NO: 85) and pseudotyped with VSIV-G (VSV G WT) (SEQ ID NO: 9); VSIV-G- AK47 (VSV G-dK47) (SEQ ID NO: 15); a recombinant fusion protein of a peptide of amino acids 21 to 184 of hTPO (SEQ ID NO: 162) fused N terminal to VSIV-G-AK47 (SEQ ID NO: 15) alone (aa21toaal84-VSV G-dK47) or mixed at 1 :3 ratio with VSIV-G-AK47 (VSV G-dK47) (SEQ ID NO: 15); a recombinant fusion protein of a peptide of amino acids 21 to 184 of hTPO (SEQ ID NO: 162) fused Nterminal to VSIV-G-AK47 (SEQ ID NO: 15) via a 19 amino acid linker (SEQ ID NO: 49) alone (aa21toaal84-19aaL(F)-VSV G-dK47) or mixed at 1 :3 ratio with VSIV-G-AK47 (VSV G-dK47) (SEQ ID NO: 15); a recombinant fusion protein of AF13948 peptide with a G4S linker and no cysteine residues (SEQ ID NO: 164) fused N terminal to VSIV-G-AK47 (SEQ ID NO: 15) alone (AF13948 G4S linker no C-VSV GdK47) or mixed at 1 :3 ratio with VSIV- G-AK47 (VSV G-dK47) (SEQ ID NO: 15); a recombinant fusion protein of AF13948 peptide with a G4S linker and no cysteine residues (SEQ ID NO: 164) fused N terminal to VSIV-G-AK47 (SEQ ID NO: 15) via a 19 amino acid linker (SEQ ID NO: 49) alone (AF13948 G4S linker no C-19aaL(F)-VSV G-dK47) or mixed at 1 :3 ratio with VSIV-G- AK47 (VSV G-dK47) (SEQ ID NO: 15); a recombinant fusion protein of AF13948 peptide with three reverse G4S linkers (SEQ ID NO: 173) fused N terminal to VSIV-G-AK47 (SEQ ID NO: 15) alone (AF13948 rev(G4S)x3 linker-VSV GdK47) or mixed at 1 :3 ratio with VSIV-G-AK47 (VSV G-dK47) (SEQ ID NO: 15); a recombinant fusion protein of AF 13948 peptide with three reverse G4S linkers (SEQ ID NO: 173) fused N terminal to VSIV-G-AK47 (SEQ ID NO: 15) via a 19 amino acid linker (SEQ ID NO: 49) alone (AF13948 rev(G4S)x3 linker- 19aaL(F)- VSV GdK47) or mixed at 1 :3 ratio with VSIV-G-AK47 (VSV G-dK47) (SEQ ID NO: 15); a recombinant fusion protein of romiplostim peptide with an 8 glycine repeat (SEQ ID NO: 175) fused N terminal to VSIV-G-AK47 (SEQ ID NO: 15) alone (Rom Gx8) or mixed at 1 :3 ratio with VSIV-G-AK47 (VSV G-dK47) (SEQ ID NO: 15); or a recombinant fusion protein of romiplostim peptide with an 8 glycine repeat and a 5 glycine spacer (SEQ ID NO: 176) fused N terminal to VSIV-G-AK47 (SEQ ID NO: 15) alone (Rom Gx8 w Gx5 spacer) or mixed at 1 :3 ratio with VSIV-G-AK47 (VSV G-dK47) (SEQ ID NO: 15) (FIG. 16A); and bar graphs quantifying the percent of GFP positive cells (FIG. 16B) and median fluorescence intensity (MFI) (FIG. 16C) of K562 (left bar), K562-hcMpl (middle bar), and K562-mMpl (right bar) cells transduced with each lentivirus.

[0047] Figures 17A-17B are a set of fluorescent micrographs (FIG. 17A) and corresponding data (FIG. 17B) showing K562 cells, K562 cells expressing human TPO-R (K562-hcMpl), or K562 cells expressing mouse TPO-R (K562-mcMpl) transduced with lentivirus containing a GFP-expression cassette (SEQ ID NO: 85) and pseudotyped with VSIV-G (VSV G WT) (SEQ ID NO: 9); VSIV-G-AK47 (VSV G-dK47) (SEQ ID NO: 15); a recombinant fusion protein of AF13948 peptide with two G4S linkers and no cysteine residues (SEQ ID NO: 166) fused N terminal to VSIV-G- AK47 (SEQ ID NO: 15) alone (AF13948 G4Sx2 linker no C-VSV GdK47) or mixed at 1 :3 ratio with VSIV-G-AK47 (VSVG-dK47) (SEQ ID NO: 15); a recombinant fusion protein of AF13948 peptide with three G4S linkers and no cysteine residues (SEQ ID NO: 168) fused N terminal to VSIV-G-AK47 (SEQ ID NO: 15) alone (AF13948 G4Sx3 linker no C-VSV GdK47) or mixed at 1 :3 ratio with VSIV-G-AK47 (VSV G-dK47) (SEQ ID NO: 15); a recombinant fusion protein of AF 13948 peptide with two reverse G4S linkers and no cysteine residues (SEQ ID NO: 172) fused N terminal to VSIV-G-AK47 (SEQ ID NO: 15) alone (AF13948 rev(G4S)x2 linker no C-VSV G-dK47) or mixed at 1 :3 ratio with VSIV-G-AK47 (VSV G-dK47) (SEQ ID NO: 15);or a recombinant fusion protein of AF13948 peptide with three reverse G4S linkers and no cysteine residues (SEQ ID NO: 174) fused N terminal to VSIV-G-AK47 (SEQ ID NO: 15) alone (AF13948 rev G4Sx3 linker no C) or mixed at 1 :3 ratio with VSIV-G-AK47 (VSV G- dK47) (SEQ ID NO: 15) (FIG. 17 A); and bar graphs quantifying the number of GFP positive K562 (left bar), K562-hcMpl (middle bar), and K562-mMpl (right bar) cells transduced with each lentivirus in total (FIG. 17B) or shown with a 5000 count off (FIG. 17C).

[0048] Figure 18A is an illustration summarizing how bone marrow derived human CD34 positive (hCD34+) cells were cultured and transduced with lentiviruses (LVs) containing a GFP-expression cassette (SEQ ID NO: 85) pseudotyped with recombinant rhabdoviral G glycoproteins fused with a c-KIT targeting molecule.

[0049] Figures 18B-18D are flow cytometry dot plots (FIGS. 18B-18C) and corresponding data (FIG. 18D) showing the percentage of GFP positive cells (% eGFP+ cells, top row) as measured by intensity of GFP vs. forward scatter area (FSC-A) and the percentage of living cells (% Live cells, bottom row) as measured by intensity of Live / Dead Allophycocyanin (APC) vs. FSC-A in hCD34+ cells transduced with a lentivirus containing a GFP cassette (SEQ ID NO: 85) and pseudotyped with VSIV-G (VSV G-WT) (SEQ ID NO: 9); VSIV-G-QQQ (VSV G-QQQ) (SEQ ID NO: 14); a 1 :3 ratio mix of a recombinant fusion protein of hSCF (SEQ ID NO: 28) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) via a linker (19aaL(F)) (SEQ ID NO: 49) and VSIV-G-QQQ (SEQ ID NO: 14) (1 :3 hSCF- 19aaL(F)-VSV-G-QQQ) (FIG. 18B); a 1 :3 ratio mix of a recombinant fusion protein of mSCF (SEQ ID NO: 30) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) via a linker (19aaL(F)) (SEQ ID NO: 49) and VSIV-G-QQQ (SEQ ID NO: 14) (1 :3 mSCF-19aaL(F)- VSV-G-QQQ); or a 1 :3 ratio mix of a recombinant fusion protein of anti-human c-KIT scFv 2D1 (SEQ ID NOs: 87 and 88) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) via a linker (19aaL(F)) (SEQ ID NO: 49) and VSIV-G-QQQ (SEQ ID NO: 14) (1 :3 h-acKit-2Dl-scFV-19aaL(F)-VSV G-QQQ); and untransduced controls (FIG. 18C); and bar graphs quantifying the percentage of GFP+ cells (top) and percentage of live cells (bottom) (FIG. 18D).

[0050] Figure 19A is an illustration summarizing how bone marrow derived human CD34 positive (hCD34+) cells were cultured and transduced with lentiviruses (LVs) containing a GFP-expression cassette (SEQ ID NO: 85) pseudotyped with recombinant rhabdoviral G glycoproteins fused with a c-KIT targeting molecule.

[0051] Figures 19B-19C are fluorescent images and flow cytometry dot plots (FIG. 19B) and corresponding data (FIG. 19C) showing the percentage of GFP positive cells as measured by intensity of GFP vs. FSC-A in hCD34+ cells transduced with a lentivirus containing a GFP cassette (SEQ ID NO: 85) and pseudotyped with VSIV-G (VSV G-WT) (SEQ ID NO: 9); VSIV-G-QQQ (VSV G-QQQ) (SEQ ID NO: 14); a 1 :3 ratio mix of a recombinant fusion protein of hSCF (SEQ ID NO: 28) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) via a linker (19aaL(F)) (SEQ ID NO: 49) and VSIV-G-QQQ (SEQ ID NO: 14) (1 :3 hSCF-19aaL(F)-VSV-G-QQQ) (FIG. 18B); or a 1 :3 ratio mix of a recombinant fusion protein of mSCF (SEQ ID NO: 30) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) via a linker (19aaL(F)) (SEQ ID NO: 49) and VSIV-G-QQQ (SEQ ID NO: 14) (1 :3 mSCF-19aaL(F)-VSV-G-QQQ) (FIG. 19B); and a bar graph quantifying the percentage of GFP positive cells (% eGFP+ cells) (FIG. 19C).

[0052] Figure 20 is an illustration summarizing how bone marrow derived human CD34 positive (hCD34+) cells were cultured under conditions with no cytokines (Condition 1) or conditions with cytokines (Condition 2) and then transduced with lentiviruses (LVs) containing a GFP-expression cassette (SEQ ID NO: 85) pseudotyped with recombinant rhabdoviral G glycoproteins fused with a c-KIT and / or TPO-R targeting molecule.

[0053] Figures 21A-21F are fluorescent images showing the GFP positive cells in hCD34+ cells cultured without cytokines in Condition 1 (FIG. 21 A) or with cytokines added in Condition 2 (FIG. 2 ID) and flow cytometry dot plots showing the GFP positive cells as measured by intensity of GFP vs. FSC-A in hCD34+ cells cultured without cytokines in Condition 1 (FIGS. 21B-21C) or with cytokines added in Condition 2 (FIGS. 21E-21F) and transduced with a lentivirus containing a GFP cassette (SEQ ID NO: 85) and pseudotyped with VSIV-G (VSV G-WT) (SEQ ID NO: 9); VSIV-G-QQQ (VSV G-QQQ) (SEQ ID NO: 14); a 1 :3, 1 :5, 1 :7, or 1 : 11 ratio mix of a recombinant fusion protein of hSCF(SEQ ID NO: 28) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) via a linker (19aaL(F)) (SEQ ID NO: 49) and VSIV-G-QQQ (SEQ ID NO: 14) (1 :3, 1 :5, 1 :7, or 1 : 11 hSCF:G-QQQ); a 1 :3 ratio mix of a recombinant fusion protein of romiplostim peptide (SEQ ID NO: 175) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) via a linker (19aaL(F)) (SEQ ID NO: 49) and VSIV-G-QQQ (SEQ ID NO: 14) (1 :3 hTPO Rom.:G-QQQ); a 0.5:0.5:3 ratio mix of a recombinant fusion protein of hSCF (SEQ ID NO: 28) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) via a linker (19aaL(F)) (SEQ ID NO: 49), a recombinant fusion protein of romiplostim peptide (SEQ ID NO: 175) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) via a linker (19aaL(F)) (SEQ ID NO: 49), and VSIV-G- QQQ (SEQ ID NO: 14) (0.5:0.5:3 hSCF:hTPO Rom.:G-QQQ); or a 0.5:0.5:3 ratio mix of a recombinant fusion protein of hSCF (SEQ ID NO: 28) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) via a linker (19aaL(F)) (SEQ ID NO: 49), an empty plasmid control (pcDNA3.1), and VSIV-G-QQQ (SEQ ID NO: 14) (0.5:0 5:3 hSCF:pcDNA3.1 :G-QQQ).

[0054] Figure 22 is a bar graph quantifying the percentage of GFP positive cells (% eGFP+ cells) in the hCD34+ cells cultured without cytokines in Condition 1 (FIGS. 21B- 21C) or with cytokines added in Condition 2 (FIGS. 21E-21F).

[0055] Figure 23 A is an illustration summarizing how mouse whole bone marrow cells(BMCs) were transduced with lentiviruses (LVs) containing a GFP-expression cassette (SEQ ID NO: 85) pseudotyped with recombinant rhabdoviral G glycoproteins fused with a c-KIT targeting molecule and analyzed via flow cytometry and colony forming unit (CFU) assay.

[0056] FIG. 23B is a set of flow cytometry dot plots showing the percentage of GFP positive cells as measured by intensity of GFP vs. FSC-A in mouse BMC derived cells four days post transduction with a lentivirus containing a GFP cassette (SEQ ID NO: 85) and pseudotyped with VSIV-G (VSV G-WT) (SEQ ID NO: 9); VSIV-G-QQQ (VSV G-QQQ) (SEQ ID NO: 14); or a 1 :3 ratio mix of a recombinant fusion protein of mSCF (SEQ ID NO: 30) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) via a linker (19aaL(F)) (SEQ ID NO: 49) and VSIV-G-QQQ (SEQ ID NO: 14) (1 :3 mSCF-19aaL(F)-VSV-G-QQQ) and a set of fluorescent images of colonies from a CFU assay taken fourteen days post transduction.

[0057] Figure 24A is a schematic diagram of the loxP -flanked STOP cassette inserted into the Gt(ROSA)26Sor locus that inhibits the transcription of a CAG promoter driven red fluorescent protein variant (tdTomato) in immunocompetent mice illustrating howupon lentiviral transduction of CRE recombinase (CRE) the loxP-flanked STOP cassette is excised causing expression of tdTomato in CRE expressing cells.

[0058] Figures 24B-24C are illustrations of the experimental design of an experiment showing biodistribution of intravenous delivery of lentiviral vectors in mice (FIG. 24B) and an experiment showing the lack of toxicity, efficiency of transduction, and biodistribution of lentiviral vectors in HSC mobilized mice and HSC non-mobilized mice.

[0059] Figure 24D is a set of graphs showing the body weight in grams of HSC mobilized mice and HSC non-mobilized mice from 0-88 days post treatment with saline or a lentivirus encoding CRE recombinase (SEQ ID NO: 186) and pseudotyped with VSIV-G WT (SEQ ID NO: 9) (LV-GWT-CRE); VSIV-G-QQQ (SEQ ID NO: 14) (Untargeted LV-Gqqq- CRE); a recombinant fusion protein of a mutant epidermal growth factor (EGF123) (SEQ ID NO: 34) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) (Mutant EGF retargeted LV- Gqqq-CRE); a recombinant fusion protein of anti-human c-KIT scFv 2D1 (SEQ ID NOs: 87 and 88) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) (Human SCF retargeted LV- Gqqq-CRE using scFv against human SCF); a recombinant fusion protein of mSCF (SEQ ID NO: 30) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) via a linker (19aaL(F)) (SEQ ID NO: 49) (Mouse SCF retargeted LV-Gqqq-CRE); or a recombinant fusion protein of hSCF (SEQ ID NO: 28) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) via a linker (19aaL(F)) (SEQ ID NO: 49) (Human SCF retargeted LV-Gqqq-CRE).

[0060] Figures 24E-24F are graphs showing the percentage of transduced CD45 positive cells as measured by flow cytometry analysis of tdTomato expression in HSC mobilized mice and HSC non-mobilized mice at days 17, 27, 62, and 88 post treatment with saline or a lentivirus encoding CRE recombinase (SEQ ID NO: 186) and pseudotyped with VSIV-G WT (SEQ ID NO: 9) (LV-GWT-CRE); VSIV-G-QQQ (SEQ ID NO: 14) (Untargeted LV-Gqqq- CRE); a recombinant fusion protein of a mutant epidermal growth factor known as EGFml23 (EGF 123) (SEQ ID NO: 34) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) (Mutant EGF retargeted LV-Gqqq-CRE); a recombinant fusion protein of anti -human c-KIT scFv 2D1 (SEQ ID NOs: 87 and 88) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) (Human SCF retargeted LV-Gqqq-CRE using scFv against human SCF); a recombinant fusion protein of mSCF (SEQ ID NO: 30) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) via a linker (19aaL(F)) (SEQ ID NO: 49) (Mouse SCF retargeted LV-Gqqq-CRE); or a recombinant fusionprotein of hSCF (SEQ ID NO: 28) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) via a linker (19aaL(F)) (SEQ ID NO: 49) (Human SCF retargeted LV-Gqqq-CRE) as a bar graph (FIG. 24E) and as a line graph of just the HSC mobilized mice (FIG. 24F).

[0061] Figures 25A-25F are flow cytometry dot plots showing the percentage of transduced CD45 positive cells as measured by flow cytometry analysis of tdTomato expression after treatment with saline or a lentivirus encoding CRE recombinase (SEQ ID NO: 186) and pseudotyped with VSIV-G WT (SEQ ID NO: 9) (WT-LV-CRE); VSIV-G- QQQ (SEQ ID NO: 14) (Gqqq-LV-CRE); a recombinant fusion protein of EGFml23 (EGF123) (SEQ ID NO: 34) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) (EGF123- LV-CRE); a recombinant fusion protein of anti-human c-KIT scFv 2D1 (SEQ ID NOs: 87 and 88) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) (acKit-Gqqq-CRE); a recombinant fusion protein of mSCF (SEQ ID NO: 30) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) via a linker (19aaL(F)) (SEQ ID NO: 49) (mSCF-Gqqq-LV-CRE); or a recombinant fusion protein of hSCF (SEQ ID NO: 28) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) via a linker (19aaL(F)) (SEQ ID NO: 49) (hSCF-Gqqq-LV-CRE) in HSC non-mobilized mice at day 62 (FIGS. 25A-25B) and in HSC mobilized mice at day 62 (FIGS. 25C-25D) and day 88 (FIGS. 25E-25F) post treatment.

[0062] Figures 26A-26B are flow cytometry graphs showing the differentiation profiling of CD45 positive cells transduced with lentivirus encoding CRE recombinase (SEQ ID NO: 186) and pseudotyped with a 1 :3 ratio mix of a recombinant fusion protein of mSCF (SEQ ID NO: 30) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) via a linker (19aaL(F)) (SEQ ID NO: 49) and VSIV-G-QQQ (SEQ ID NO: 14) (mSCF-l :3 Gqqq-LV- CRE) as shown by selecting for CD45 positive cells (CD45+), and from the CD45+ cells selecting the tdTomato+ cells, and from those selecting for CD4 positive cells, CD8 positive cells, and CD1 lb positive cells at day 62 (FIG. 26A) and day 88 (FIG. 26B) post treatment.

[0063] Figures 27A-27D are micrographs of tissues samples of HSC mobilized mice 7 days post treatment with a lentivirus encoding CRE recombinase (SEQ ID NO: 186) and pseudotyped with VSIV-G WT (SEQ ID NO: 9) (LV-GWT-CRE); VSIV-G-QQQ (SEQ ID NO: 14) (Untargeted LV-Gqqq-CRE); a recombinant fusion protein of mSCF (SEQ ID NO: 30) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) (Mouse SCF retargeted LV-Gqqq- CRE) immunostained for tdTomato taken from the bone marrow (FIG. 27 A), spleen (FIG. 27B), heart (FIG. 27C), and kidney (FIG. 27D).

[0064] Figures 28A-28D are micrographs of liver tissue samples taken 7 days post treatment with a lentivirus encoding CRE recombinase (SEQ ID NO: 186) and pseudotyped with VSIV-G WT (SEQ ID NO: 9) (LV-GWT-CRE); VSIV-G-QQQ (SEQ ID NO: 14) (Untargeted LV-Gqqq-CRE); a recombinant fusion protein of mSCF (SEQ ID NO: 30) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) (Mouse SCF retargeted LV-Gqqq-CRE) and immunostained for tdTomato in HSC mobilized mice (FIG. 28 A) and HSC nonmobilized mice (FIG. 28B) or immunostained for tdTomato and CD31 in HSC mobilized mice (FIGS. 28C and 28D).

[0065] Figures 29A-29B are fluorescent images of cells isolated from the bone marrow of HSC mobilized (Mob+) and HSC non-mobilized (Mob-) mice seven days after treatment with saline or a lentivirus encoding CRE recombinase (SEQ ID NO: 186) and pseudotyped with VSIV-G WT (SEQ ID NO: 9) (WT-LV-CRE); VSIV-G-QQQ (SEQ ID NO: 14) (Gqqq-LV-CRE); a recombinant fusion protein of EGFml23 (EGF123) (SEQ ID NO: 34) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) (EGF123-LV-CRE); a recombinant fusion protein of anti-human c-KIT scFv 2D1 (SEQ ID NOs: 87 and 88) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) (acKit-Gqqq-CRE); a recombinant fusion protein of mSCF (SEQ ID NO: 30) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) via a linker (19aaL(F)) (SEQ ID NO: 49) (mSCF-Gqqq-LV-CRE); or a recombinant fusion protein of hSCF (SEQ ID NO: 28) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) via a linker (19aaL(F)) (SEQ ID NO: 49) (hSCF-Gqqq-LV-CRE) (FIG. 29A) and an enlarged view showing tdTomato positive cells derived from HSC mobilized mouse treated with a lentivirus encoding CRE recombinase (SEQ ID NO: 186) and pseudotyped with mSCF-Gqqq-LV-CRE (FIG. 29B).

[0066] Figures 30A-30B are images of cells isolated from the bone marrow of HSC mobilized (Mob+) and HSC non-mobilized (Mob-) mice using a lineage cocktail seven days after treatment with saline or a lentivirus encoding CRE recombinase (SEQ ID NO: 186) and pseudotyped with VSIV-G WT (SEQ ID NO: 9) (WT-LV-CRE); VSIV-G-QQQ (SEQ ID NO: 14) (Gqqq-LV-CRE); a recombinant fusion protein of EGFml23 (EGF123) (SEQ ID NO: 34) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) (EGF123-LV-CRE); a recombinant fusion protein of anti-human c-KIT scFv 2D1 (SEQ ID NOs: 87 and 88) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) (acKit-Gqqq-CRE); a recombinant fusion protein of mSCF (SEQ ID NO: 30) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) viaa linker (19aaL(F)) (SEQ ID NO: 49) (mSCF-Gqqq-LV-CRE); or a recombinant fusion protein of hSCF (SEQ ID NO: 28) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) via a linker (19aaL(F)) (SEQ ID NO: 49) (hSCF-Gqqq-LV-CRE) and sorted for lineage negative HSC like cells, showing a fluorescent view (FIG. 30A) and a bright field view (FIG. 30B).

[0067] Figures 31 A-3 IB are images of cells isolated from the bone marrow of HSC mobilized (Mob+) and HSC non-mobilized (Mob-) mice using a lineage cocktail seven days after treatment with saline or a lentivirus encoding CRE recombinase (SEQ ID NO: 186) and pseudotyped with VSIV-G WT (SEQ ID NO: 9) (WT-LV-CRE); VSIV-G-QQQ (SEQ ID NO: 14) (Gqqq-LV-CRE); a recombinant fusion protein EGFml23 (EGF123) (SEQ ID NO: 34) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) (EGF123-LV-CRE); a recombinant fusion protein of anti-human c-KIT scFv 2D1 (SEQ ID NOs: 87 and 88) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) (acKit-Gqqq-CRE); a recombinant fusion protein of mSCF (SEQ ID NO: 30) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) via a linker (19aaL(F)) (SEQ ID NO: 49) (mSCF-Gqqq-LV-CRE); or a recombinant fusion protein of hSCF (SEQ ID NO: 28) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) via a linker (19aaL(F)) (SEQ ID NO: 49) (hSCF-Gqqq-LV-CRE) and sorted for lineage positive differentiated cells, showing a fluorescent view (FIG. 31 A) and a bright field view (FIG.3 IB).

[0068] Figures 32A-32D are sets of fluorescent and bright field micrograph images of cells cultured for a CFU assay performed on cells isolated from the bone marrow of HSC mobilized and HSC non-mobilized mice using a lineage cocktail treated with a lentivirus encoding CRE recombinase (SEQ ID NO: 186) and pseudotyped with a 1 :3 ratio mix of a recombinant fusion protein of mSCF (SEQ ID NO: 30) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) via a linker (19aaL(F)) (SEQ ID NO: 49) and VSIV-G-QQQ (SEQ ID NO: 14) (mSCF-l :3 Gqqq-LV-CRE) for lineage positive (Lin+) and lineage negative cells (Lin-) cultured seven days post treatment at a concentration of 2e4 cells or le4 cells (FIG. 32A) with an enlarged view of the CFU assay of the HSC mobilized Lin- cells cultured at a concentration of le4 cells (FIG. 32B) and sets of images of the CFU assay of Lin+ and Lin- cells cultured 88 days post treatment with mSCF-1 :3 Gqqq-LV-CRE of the HSC mobilized cells (FIG. 32C) and HSC non-mobilized cells (FIG. 32D), with white arrows indicating colonies (FIG. 32C).DETAILED DESCRIPTION

[0069] In aspects, the present disclosure provides a recombinant fusion protein comprising, consisting essentially of, or consisting of (a) a rhabdoviral G glycoprotein or a functional fragment or derivative thereof and (b) a targeting molecule, wherein the targeting molecule targets the recombinant fusion protein to a hematopoietic stem cell (HSC).

[0070] Rhabdoviruses are viruses within the family Rhabdoviridae . The viruses encode proteins denoted N (nucleoprotein), P (phosphoprotein), M (matrix protein), G (glycoprotein), and L (large protein, which is a polymerase), and the viruses appear to have a shape of a bullet when observed using electron microscopy. Dimensions of rhabdovirus virions can range from 100 nm to 430 nm in length and can range from 45 nm to 100 nm in diameter. Exemplary rhabdoviruses, without limitation, that are contemplated herein are listed in FIGS. 13A-13H.

[0071] Rhabdoviral G glycoprotein mediates binding of rhabdovirus to a receptor on a cell, which binding then mediates entry of the rhabdovirus into the cell and infection of the cell. A rhabdoviral G glycoprotein or functional fragment or derivative thereof as described herein, including recombinant fusion proteins comprising the rhabdoviral G glycoprotein or functional fragment or derivative thereof, can be used to pseudotype a type of virus that is not the native / natural virus of the rhabdoviral G glycoprotein.

[0072] As used herein, a “pseudotype” of a virus, membraned vesicle, enveloped delivery vehicle, enveloped viral particle, or recombinant viral vector, etc. means a virus, membraned vesicle, enveloped delivery vehicle, enveloped viral particle, or recombinant viral vector, etc. comprising a molecule, e.g., a rhabdoviral G glycoprotein or functional fragment or derivative thereof (including a recombinant fusion protein comprising the rhabdoviral G glycoprotein or functional fragment or derivative thereof), that is not typically found in the virus, membraned vesicle, enveloped delivery vehicle, enveloped viral particle, or recombinant viral vector, etc. Such a molecule can have a mutation (e.g., a substitution or deletion) that impacts the tropism of the virus, membraned vesicle, enveloped delivery vehicle, enveloped viral particle, or recombinant viral vector, etc. The impact on tropism can be, e.g., to contribute to, direct, redirect, or completely change, or any combination thereof, the tropism of the virus, membraned vesicle, enveloped delivery vehicle, enveloped viral particle, or recombinant viral vector, etc. when compared to the virus, membraned vesicle, enveloped delivery vehicle, enveloped viral particle, or recombinant viral vector, etc. withoutthe molecule and / or compared to the wild-type virus, membraned vesicle, enveloped delivery vehicle, enveloped viral particle, or recombinant viral vector, etc. The impact on tropism can be, e.g., to target a cell that is different from the cell normally targeted by the virus, membraned vesicle, enveloped delivery vehicle, enveloped viral particle, or recombinant viral vector, etc. and / or to not target a cell that is normally targeted by the virus, membraned vesicle, enveloped delivery vehicle, enveloped viral particle, or recombinant viral vector, etc.

[0073] As used herein, “functional fragment” of a rhabdoviral G glycoprotein means a rhabdoviral G glycoprotein that is not a full length rhabdoviral G glycoprotein but is a portion of a parent rhabdoviral G glycoprotein (e.g., a truncated form of a full length rhabdoviral G glycoprotein), where the portion retains the fusion function of the parent full length rhabdoviral G glycoprotein. As used herein, “functional derivative” or “functional variant” of a rhabdoviral G glycoprotein means a rhabdoviral G glycoprotein that has been modified, e.g., by conservative amino acid substitution, where the rhabdoviral G glycoprotein retains the fusion function of the parent full length rhabdoviral G glycoprotein. As used herein, “functional fragment or derivative” and “functional fragment or variant” encompass the meanings of both “functional fragment” and “functional derivative” / “ functional variant.” The “fusion function” of a rhabdoviral G glycoprotein means that a rhabdoviral G glycoprotein, when part of a virus, can initiate fusion of the virus with a target cell, e.g., such that the virus can infect the target cell. Such fusion can be due to the interaction of the rhabdoviral G glycoprotein with its natural receptor or the interaction of the rhabdoviral G glycoprotein with a different receptor (e.g., the rhabdoviral G glycoprotein is blinded to its natural receptor, such that the rhabdoviral G glycoprotein is engineered to reduce or abolish its natural receptor binding specificity, and the rhabdoviral G glycoprotein is re-targeted to a new receptor). A functional fragment and / or functional derivative / functional variant of a rhabdoviral G glycoprotein can be within a recombinant fusion protein comprising a rhabdoviral G glycoprotein.

[0074] As used herein, “hematopoietic stem cell” or “HSC” refers to a multipotent primitive cell with the capability to self-renew and develop into all types of blood cells, including myeloid-lineage and lymphoid-lineage cells. HSCs may be categorized as longterm or short-term HSCs. As used herein, “long-term HSC” or “LT-HSC” refers to a hematopoietic stem cell characterized by its ability to self-renew and differentiate into various blood cell types over extended periods, typically months to years. A smallpercentage of blood cells are LT-HSCs, which are typically the target cells for gene editing. In mice LT-HSCs are typically CD34 negative (CD34-) (Matsuoka et al., “CD34 expression on long-term repopulating hematopoietic stem cells changes during developmental stages,” Blood, 97(2): 419-425 (2001)). In humans LT-HSCs are typically CD34 positive (CD34+), although a population of CD34- LT-HSCs have been identified in human hematopoietic tissue, including bone marrow (Hughes et al., “A sticky wicket: Defining molecular functions for CD34 in hematopoietic cells,” Experimental Hematology, 86: 1-14 (2020)). Human LT- HSCs can be CD34+ CD38- CD90+ Lin- (CD34 plus, CD38 minus, CD90 plus, Lin minus) cells. As used herein, “short-term HSC” or “ST-HSC” refers to a stem cell distinguished by its relatively limited self-renewal capacity and more immediate differentiation into specialized cell types, typically weeks to months. In aspects, the HSC is a long-term HSC.

[0075] As used herein, “hematopoietic progenitor cell” or “HPC” refers to a multipotent, oligopotent, or unipotent cell lacking significant self-renewal capacity but capable of differentiating further into mature blood cells of all hematopoietic lineages. As used herein, “hematopoietic stem and progenitor cell” or “HSPC” is a term that encompasses both HSCs and HPCs.

[0076] In aspects, the present disclosure provides a recombinant fusion protein comprising, consisting essentially of, or consisting of (a) a rhabdoviral G glycoprotein or a functional fragment or derivative thereof and (b) a targeting molecule, wherein the targeting molecule targets the recombinant fusion protein to a hepatic sinusoidal endothelial cell (HSEC).

[0077] As used herein, “hepatic sinusoidal endothelial cell” or “HSEC” refers to a specialized endothelial cell that lines the hepatic sinusoids within the liver. HSECs play a role in multiple liver-specific functions such as selective nutrient exchange, vascular permeability, immune surveillance, and maintaining hepatic blood flow and metabolism.

[0078] CD45, also known as protein tyrosine phosphatase receptor type C (PTPRC), is a transmembrane glycoprotein and protein tyrosine phosphatase expressed on the surface of all nucleated hematopoietic cells, including HSCs, HPCs and HSPCs, except that of erythrocytes and platelets. CD45 is known to regulate T and B cell receptor signaling, immune cell activation, proliferation, differentiation, and survival. Abnormal CD45 expressions or functions are associated with immunodeficiencies, autoimmune diseases, leukemias, and lymphomas. Notably, CD45 is not expressed on hepatic sinusoidal endothelial cells(HSECs), distinguishing these liver cells from hematopoietic lineage cells as shown in Table 1 below.Table 1

[0079] In aspects, the present disclosure provides a recombinant fusion protein comprising, consisting essentially of, or consisting of (a) a rhabdoviral G glycoprotein or a functional fragment or derivative thereof and (b) a targeting molecule, wherein the targeting molecule comprises: (1) stem cell factor (SCF), (2) an anti-c-KIT binding domain, (3) thrombopoietin (TPO), (4) epidermal growth factor (EGF), or (5) a functional fragment or derivative of (1), (2), (3) or (4).

[0080] In aspects, the recombinant fusion protein comprises a signal peptide. As used herein, a “signal peptide” refers to a peptide involved in targeting a glycoprotein to the secretory pathway. In aspects, different signal peptides can be selected to improve glycoprotein targeting to the secretory pathway. In aspects, the signal peptide may be the naturally occurring signal peptide for the rhabdoviral G glycoprotein. In aspects, the signal peptide comprises the amino acid sequence of a signal peptide as described herein. In aspects, the recombinant fusion protein comprises a signal peptide N-terminal to the targeting molecule. In aspects, the signal peptide comprises the amino acid sequence of SEQ ID NO: 35, 40, 41, 42, 137, or 139. In aspects, the signal peptide comprises the amino acid sequence of SEQ ID NO: 35. In aspects, the recombinant fusion protein comprises a mature form of arhabdoviral G glycoprotein or functional fragment or derivative thereof, where the signal peptide is not present in the recombinant fusion protein. In aspects, the recombinant fusion protein comprising a rhabdoviral G glycoprotein or functional fragment or derivative thereof does not comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more amino acids of the N-terminus of the mature form of the wild-type rhabdoviral G glycoprotein. In aspects, the recombinant fusion protein comprising a rhabdoviral G glycoprotein or functional fragment or derivative thereof does not comprise a signal peptide and also does not comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more amino acids of the N-terminus of the mature form of the wild-type rhabdoviral G glycoprotein.

[0081] In aspects, the recombinant fusion protein comprises a tag for western detection or purification. In aspects, the tag is a tag for western detection. In aspects, the tag is a tag for purification. In aspects the tag is a FLAG tag, GFP, or others.

[0082] In aspects, the recombinant fusion protein comprises a linker between the targeting molecule and the rhabdoviral G glycoprotein or functional fragment or derivative thereof. Any suitable linker is contemplated, e.g., as disclosed in Chen et al., Adv. Drug. Deliv. Rev., 65(10: 1357-1369 (2013), which is incorporated herein by reference in its entirety. In aspects, the linker is flexible. Exemplary flexible linkers include, but are not limited to, e.g.,AAASGGSGGGGSGGGGSGP (SEQ ID NO: 49), AAASGGSGGGGSGGGGS (SEQ ID NO: 50), GGGGSGGGGSGGGGSGGGGS (SEQ ID NO: 51), GGGGSGGGGSGGGGS (SEQ ID NO: 17), GGGGSGGGGS (SEQ ID NO: 52), GGGGS (SEQ ID NO: 53), GGGGGGGG (SEQ ID NO: 54), GGGGGG (SEQ ID NO: 55), GSAGSAAGSGEF (SEQ ID NO: 56), and VPGVGVPGVG (SEQ ID NO: 57).In aspects, the linker is rigid. Exemplary rigid linkers include, but are not limited to, e.g.,PAPAP (SEQ ID NO: 58),EAAAKEAAAKEAAAK (SEQ ID NO: 59), EAAAKEAAAK (SEQ ID NO: 60),EAAAK (SEQ ID NO: 61), AEAAAKEAAAKEAAAKEAAAKALEAEAAAKEAAAKEAAAKEAAAKA (SEQ ID NO: 62),AEAAAKEAAAKA (SEQ ID NO: 63), ESKYGPPCPPCP (SEQ ID NO: 64), CPPCPAPELLGGPSVF (SEQ ID NO: 65), and alanine-proline (AP) repeated for a total of 10 to 34 amino acids (SEQ ID NO: 66).

[0083] In aspects, the recombinant fusion protein comprises a rhabdoviral G glycoprotein or functional fragment or derivative thereof that is of a Flanders virus glycoprotein (FLAV- G) (SEQ ID NO: 1), a Chandipura virus glycoprotein (CHPV-G) (SEQ ID NO: 2), a Perinet virus glycoprotein (PERV-G) (SEQ ID NO: 3), a Piry virus glycoprotein (PIRYV-G) (SEQ ID NO: 4), a Fukuoka virus glycoprotein (FUKV-G) (SEQ ID NO: 5), a Joinjakaka virus glycoprotein (JOIV-G) (SEQ ID NO: 6), a Kumasi virus glycoprotein (KRV-G) (SEQ ID NO: 7), a Keuraliba virus glycoprotein (KEUV-G) (SEQ ID NO: 8), an Isfahan glycoprotein (ISFV-G), a Jurona glycoprotein (JURV-G), a Mediterranean Bat glycoprotein (MBV-G), a Malpais Spring glycoprotein (MSPV-G), a Radi glycoprotein (RADV-G), a Rhinolophus affinis-G, a Yug Bugdanavoc glycoprotein (YBV-G), a Yinshui Bat glycoprotein (YSBV-G), a Kimberley glycoprotein (KIMV-G), a Kanyawara glycoprotein (KYAV-G), a La Joya glycoprotein (LJV-G), a Mosquiero glycoprotein (MQOV-G), a Parry Creek glycoprotein (PCV-G), a Bas Congo glycoprotein (BASV-G), a Bovine Ephemeral fever glycoprotein (BEFV-G), a Curionopolis glycoprotein (CURV-G), a Drosophila melanogaster sigmavirus glycoprotein (DMelSV-G), a Niakha glycoprotein (NIAV-G), a Puerto almandras glycoprotein (PTAMV-G), or a Tupaia rhabdovirus (TUPTV-G). In aspects, the rhabdoviral G glycoprotein or functional fragment or derivative thereof is of Vesiculovirus glycoprotein or a functional fragment or derivative thereof. In aspects, the rhabdoviral G glycoprotein or functional fragment or derivative thereof is of Vesiculovirus Indiana (e.g., SEQ ID NO: 9, 95, 96, or 138), Vesiculovirus newjersey (e.g., SEQ ID NO: 48 or 99), Vesiculovirus carajas (e.g., SEQ ID NO: 11 or 100), Vesiculovirus alagoas (e.g., SEQ ID NO: 12 or 101), Vesiculovirus cocal (e.g., SEQ ID NO: 47 or 102), Vesiculovirus marraba (e.g., SEQ ID NO: 97 or 98), Vesiculovirus morreton (e.g., SEQ ID NO: 103 or 104), or any other rhabdoviral G glycoprotein or functional fragment or derivative thereof as provided herein. In aspects, the rhabdoviral G glycoprotein or functional fragment or derivative thereof is of Vesiculovirusindiana (e.g., SEQ ID NO: 9 or 96). In aspects, the rhabdoviral G glycoprotein or functional fragment or derivative thereof is of Vesiculovirus newjersey (e.g., SEQ ID NO: 48 or 99). In aspects, the rhabdoviral G glycoprotein or functional fragment or derivative thereof is of Vesiculovirus newjersey (SEQ ID NO: 10 or 16). In aspects, the rhabdoviral G glycoprotein or functional fragment or derivative thereof is of Vesiculovirus alagoas (e.g., SEQ ID NO: 43, 44, 155, or 158). In aspects, the rhabdoviral G glycoprotein or functional fragment or derivative thereof is of Vesiculovirus carajas (e.g., SEQ ID NO: 45, 46, 148, or 151). Shown in FIGS. 22A-22D are additional exemplary rhabdoviral G glycoproteins, without limitation, that are contemplated herein.

[0084] In aspects, the recombinant fusion protein comprises a rhabdoviral G glycoprotein or functional fragment or derivative thereof that has 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, 80% 75%, 70%, 65%, or 60% sequence identity compared to a rhabdoviral G glycoprotein or functional fragment or derivative thereof described herein. In aspects, the rhabdoviral G glycoprotein or functional fragment or derivative thereof contains one or more conservative amino acid substitutions that do not interfere with the fusion function of the rhabdoviral G glycoprotein or functional fragment or derivative thereof.

[0085] In aspects, the recombinant fusion protein comprises a rhabdoviral G glycoprotein that is substantially intact. As used herein, a “substantially intact” rhabdoviral G glycoprotein means a rhabdoviral G glycoprotein that is a functional fragment of the rhabdoviral G glycoprotein, where the rhabdoviral G glycoprotein has each of the domains of a rhabdoviral G glycoprotein, the domains as defined in Roche et al., Cell. Mol. Life Sci., 65: 1716-1728 (2008), which is incorporated herein by reference in its entirety.

[0086] In aspects, the recombinant fusion protein comprises a rhabdoviral G glycoprotein that is a functional fragment or derivative thereof. In aspects, the cytoplasmic tail of the glycoprotein is truncated, deleted, or replaced with another sequence. Previous work has shown that such truncation or deletion can enhance fusion activity in rhabdoviral G glycoprotein. In aspects, the truncations from the C terminus can be, for example, 1 amino acid, 2 amino acids, 3 amino acids, 4 amino acids, 5 amino acids, 6 amino acids, 7 amino acids, 8 amino acids, 9 amino acids, 10 amino acids, 20 amino acids, 30 amino acids, 40 amino acids, 50 amino acids, 60 amino acids, up to 10 amino acids, up to 20 amino acids, up to 30 amino acids, up to 40 amino acids, up to 50 amino acids, up to 60 amino acids, or more than 60 amino acids. In aspects, the cytoplasmic tail is replaced with another sequence.

[0087] In aspects, the recombinant fusion protein comprises a rhabdoviral G glycoprotein or functional fragment or derivative thereof that is engineered to reduce or abolish its natural receptor binding specificity. Reduction in binding specificity can be of any amount, e.g., reduced by 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, 2%, 1%, or any range between these percentages. Vesicular stomatitis virus (VSV) is a rhabdovirus, having a natural receptor of the low-density lipoprotein receptor (LDL-R) or very low density lipoprotein receptor (VLDL-R), which are expressed on the cell membrane of many types of cells. In aspects, the rhabdoviral G glycoprotein or functional fragment or derivative thereof is engineered to have a mutation to reduce or abolish its natural receptor binding specificity to LDL-R or VLDL-R, or other receptors which exhibit cross-reactivity to these receptors. In aspects, the rhabdoviral G glycoprotein or functional fragment or derivative thereof comprises a mutation at one or more positions corresponding to H8, K47, Y209, and K354 on the Vesiculovirus Indiana glycoprotein (SEQ ID NO: 9). In aspects, the mutation is a substitution of a wild-type amino acid to another amino acid. In aspects, the substitution is with a Q. In aspects, the mutation is a substitution at three or more positions corresponding to H8, K47, Y209, and K354 on the Vesiculovirus Indiana glycoprotein (SEQ ID NO: 9). In aspects, the mutation comprises, consists of, or consists essentially of the amino acid sequence of SEQ ID NO: 14, 36, 37, 38,141, 143, 145, 149, 152, or 156. The US Patent Publication No. 2020 / 0216502 is incorporated herein by reference in its entirety. In aspects, the mutation is a deletion of a wild-type amino acid. In aspects, the mutation is deletion of one or more positions corresponding to H8, K47, Y209, and K354 on the Vesiculovirus Indiana glycoprotein (SEQ ID NO: 9), wherein each deleted amino acid is not present within the amino acid sequence of the glycoprotein. In aspects, the mutation is a single deletion at K47, wherein the K47 amino acid is not present within the amino acid sequence of the glycoprotein. In aspects, the mutation comprises, consists of, or consists essentially of the amino acid sequence of SEQ ID NO: 15, 16, 142, 144, 146, 147, 150, 153, 154, or 157.

[0088] In aspects, preferred full length rhabdoviral G glycoproteins, ectodomains, signal peptides, and engineered mutations of the ectodomains to reduce or abolish its natural receptor binding affinity are shown in Table 2. VSIV indicates Vesiculovirus indiana G glycoprotein, VSNJV indicates Vesiculovirus newjersey G glycoprotein, VSCV indicates Vesiculovirus carajas G glycoprotein, VS AV indicates Vesiculovirus alagoas G glycoprotein, VSCOV indicates Vesiculovirus cocal G glycoprotein, KEUV indicates Keuraliba virus G glycoprotein, KRV indicates Kumasi virus G glycoprotein, WT indicateswild type, 41 J indicates residue 41 can be an I or L, KIR indicates a R substitution at residue 1 corresponding to SEQ ID NO: 9, G115A indicates an A substitution at residue 115 corresponding to SEQ ID NO: 9, Delta K47 indicates a deletion at residue 47 corresponding to SEQ ID NO: 9, and K47Q+Y209Q+R354Q indicates Q substitutions at residues 47, 209, and 354 corresponding to SEQ ID NO: 9.Table 2

[0089] It has been found that a Vesiculovirus Indiana rhabdoviral G glycoprotein having a deletion of K47 reduces or abolishes the natural receptor binding specificity of the rhabdoviral G glycoprotein when the rhabdoviral G glycoprotein while unexpected retaining full function of the G protein in other respects. In particular, this feature is seen when incorporated into a lentiviral vector. However, when used in a VSV vector, there is a second site mutation (F405I) generated in the VSV-G protein during the virus amplification. This mutation leads to the loss of detargeting effect caused by the deletion on K47 residue. Without wishing to be bound by theory, this phenomenon may be due to VSV being a replicating virus, whereas lentivirus is a non-replicating virus.

[0090] Vesiculovirus indiana glycoprotein having H8 and / or K47 deletions, when incorporated into a lentiviral system, can support production of functional pseudotyped lentivirus and successful cell transduction. The H8 and / or K47 deletions, but not Y209 or R354 deletions or Y209 / R354 deletion combinations, demonstrated generation and rescue of pseudotyped lentivirus with low to no LDL-R background binding.

[0091] In aspects, the recombinant fusion protein comprises a rhabdoviral G glycoprotein or functional fragment or derivative thereof that comprises one or more viral titer increasing mutations. In aspects, the one or more viral titer increasing mutations is one or both ofM184T and F250L in SEQ ID NO: 9 (or the positions corresponding to M184T and F250L). Other exemplary mutations, without limitation, for increasing viral titer include those described in US Patent Publication No. 2022 / 0162266, which is incorporated herein by reference in its entirety. The mutations include H22N and S422I in the ectodomain of Vesiculovirus Indiana G glycoprotein (SEQ ID NO: 9) (or substitutions in positions corresponding to these in other rhabdoviral G glycoproteins).

[0092] Amino acid positions of other rhabdoviral G glycoproteins or functional fragments or derivatives thereof that are “positions corresponding to” the amino acids discussed above can be determined using a global sequence alignment algorithm (see, e.g., Madeira et al., Nuc. Acids Res., 50(Wl): W276-W279 (2022), which is incorporated herein by reference in its entirety) comparing the base rhabdoviral G glycoprotein to another rhabdoviral G glycoprotein.

[0093] In aspects, the rhabdoviral G glycoprotein or functional fragment or derivative thereof is mutated to reduce or abolish protease cleavage.

[0094] In aspects, the recombinant fusion protein comprises a targeting molecule. As used herein, the term “targeting molecule” refers to a binding moiety (that can bind or that can be bound), such as a natural ligand, antibody, multispecific binding molecule, or others known in the art. In aspects, the targeting molecule is an antibody or portion thereof. In aspects, the portion thereof is an antigen-binding fragment. In aspects, the antibody or portion thereof is a single chain fragment variable (scFv), an affibody, a diabody, a minibody, a nanobody, a single-domain antibody (sdAb), or a single heavy chain antibody. Also contemplated herein are monoclonal antibodies, human antibodies, humanized antibodies, chimeric antibodies, single chain antibodies, Fab fragments, F(ab') fragments, disulfide- linked Fvs (sdFv), intrabodies, and anti -idiotypic (anti -Id) antibodies (including, e.g., anti -Id antibodies to antigen specific TCR), Ig-DARTS, epitope-binding fragments of any of the above, and what is described in US Patent Publication No. 2007 / 0004909 and US Patent Publication No. 2009 / 0060910, each of which is incorporated herein by reference in their entireties). Also contemplated are immunoglobulin molecules and immunologically active fragments of immunoglobulin molecules, i.e., molecules that contain an antigen binding site. Immunoglobulin molecules can be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgGI, IgG2, IgG3, IgG4, IgAI and IgA2) or subclass. In aspects, the targeting molecule is an antibody comprising a variable domain that binds a cell surface protein on a target celland a heavy chain constant domain. In aspects, the targeting molecule is an antibody comprising a variable domain that binds a cell surface protein on a target cell and an IgG heavy chain constant domain. In aspects, the targeting molecule is an antibody comprising a variable domain that binds a cell surface protein on a target cell and an IgG heavy chain constant domain.

[0095] In aspects, a targeting molecule specifically binds a cell surface molecule, e.g., an oligosaccharide, a receptor, cell surface marker, etc., expressed on the surface of a mammalian (e.g., human) eukaryotic cell. In aspects, a targeting molecule binds a (e.g., human) liver cell, a (e.g., human) brain cell, a (e.g., human) T cell, a (e.g., human) kidney cell, a (e.g., human) intestinal cell, a (e.g., human) lung cell, a (e.g., human) cancerous cell, or a (e.g., human) cell infected with heterologous pathogen. In aspects, the targeting molecule binds a receptor expressed by a (e.g., human) liver cell, e.g., an asialoglycoprotein receptor, e.g., hASGRl. In aspects, the targeting molecule binds a molecule expressed by a (e.g., human) neuronal cell, e.g., GABA, transferrin, etc. In aspects, the targeting molecule binds a molecule expressed by a (e.g., human) T cell, e.g., CD3, e.g., CD3c. In aspects, the targeting molecule binds CD63. In aspects, the targeting molecule binds a molecule expressed by a (e.g., human) hematopoietic stem cell, e.g., CD34. In aspects, the targeting molecule binds a molecule expressed by a (e.g., human) kidney cell. In aspects, the targeting molecule binds a molecule expressed by a (e.g., human) muscle cell, e.g., an integrin. In aspects, the targeting molecule binds a molecule expressed by a (e.g., human) cancerous cell, e.g., a tumor associated antigen, e.g., adipophilin, AIM-2, ALDHIAI, alpha-actinin-4, alpha-fetoprotein (“AFP”), ARTCI, B-RAF, BAGE-1, BCLX (L), BCR-ABL fusion protein b3a2, beta-catenin, BING-4, CA-125, CALCA, carcinoembryonic antigen (“CEA”), CASP-5, CASP-8, CD274, CD45, Cdc27, CDK12, CDK4, CDKN2A, CEA, CLPP, COA-1, CPSF, CSNKIAI, CTAGI, CTAG2, cyclin DI, Cyclin-Al, dek-can fusion protein, DKKI, EFTUD2, Elongation factor 2, ENAH (hMena), Ep-CAM, EpCAM, EphA3, epithelial tumor antigen (“ETA”), ETV6- AML1 fusion protein, EZH2, E6, E7, FGF5, FLT3-ITD, FNI, G250 / MN / CAIX, GAGE- 1,2,8, GAGE- 3, 4, 5, 6, 7, GAS7, glypican-3, GnTV, gplOO / Pmell 7, GPNMB, HAUS3, Hepsin, HER-2 / neu, HERV-K-MEL, HLA-A1 1, HLA-A2, HLA-DOB, hsp70-2, IDOI, IGF2B3, IL13Ralpha2, Intestinal carboxyl esterase, K-ras, Kallikrein 4, KIF20A, KK-LC-1, KKLCI, KM-HN-1, KMHNI also known as CCDCI 10, LAGE-I, LDLR- fucosyltransferaseAS fusion protein, Lengsin, M-CSF, MAGE-A1, MAGE-AIO, MAGE-A12, MAGE-A2, MAGE- A3, MAGE-A4, MAGE-A6, MAGE-A9, MAGE-CI, MAGE-C2, malicenzyme, mammaglobin-A, MART2, MATN, MCIR, MCSP, mdm-2, MEI, Melan-A / MART- 1, Meloe, Midkine, MMP-2, MMP-7, MUCI, MUC5AC, mucin, MUM-I, MUM-2, MUM-3, Myosin, Myosin class I, N-raw, NA88- A, neo-PAP, NFYC, NY-BR-I, NY-ESO-l / LAGE-2, OAI, OGT, OS-9, P polypeptide, p53, PAP, PAX5, PBF, pml-RARalpha fusion protein, polymorphic epithelial mucin (“PEM”), PPPIR3B, PRAME, PRDX5, PSA, PSMA, PTPRK, RAB38 / NY-MEL-1, RAGE-I, RBAF600, RGS5, RhoC, RNF43, RU2AS, SAGE, secemin 1, SIRT2, SNRPDI, SOXIO, Spl7, SPA17, SSX-2, SSX-4, STEAPI, survivin, SYT-SSXI or - SSX2 fusion protein, TAG-I, TAG-2, Telomerase, TGF-betaRII, TPBG, TRAG-3, Triosephosphate isomerase, TRP-l / gp75, TRP-2, TRP2-INT2, tyrosinase, tyrosinase (“TYR”), VEGF, WTI, XAGE-lb / GAGED2a, Kras, NYESOI, HPV E2, HPV E6, HPV E7, WT-I antigen (in lymphoma and other solid tumors), ErbB receptors, Melan A [MARTI], gp 100, tyrosinase, TRP-l / gp 75, and TRP-2 (in melanoma); MAGE-I and MAGE-3 (in bladder, head and neck, and non-small cell carcinoma); HPV EG and E7 proteins (in cervical cancer); Mucin [MUC-1] (in breast, pancreas, colon, and prostate cancers); prostate-specific antigen [PSA] (in prostate cancer); carcinoembryonic antigen [CEA] (in colon, breast, and gastrointestinal cancers), and such shared tumor-specific antigens as MAGE-2, MAGE-4, MAGE-6, MAGE-IO, MAGE-12, BAGE-1, CAGE-1,2,8, CAGE-3 TO 7, LAGE-I, NY- ESO-l / LAGE-2, NA-88, GnTV, TRP2-INT2, etc. In aspects, the targeting molecule binds E6 and / or E7. In aspects, the targeting molecule binds Her2. In aspects, the targeting molecule binds CD63. In aspects, the targeting molecule binds human glucagon receptor (hGCGR). In aspects, the targeting molecule binds human ectonucleoside triphosphate diphosphohydrolase 3 (hENTPD3).

[0096] In aspects, the targeting molecule is a polypeptide antibody construct. In aspects, the targeting molecule is agonistic to CD3. In aspects, the polypeptide antibody construct comprises a single chain variable fragment (scFv). In aspects, the scFv has the VL N-terminal to VH. In aspects, the scFv has the VH N-terminal to VL. In aspects, the scFv is UCHT1, HuM291, OKT3, or TR66. In aspects, the scFv is a humanized UCHT1. In aspects, the scFv comprises a variable heavy chain (VH) comprising, consisting essentially of, or consisting of the amino acid sequence of SEQ ID NO: 27 and a variable light chain (VL) comprising, consisting essentially of, or consisting of the amino acid sequence of SEQ ID NO: 26. In aspects, the VH and VL are separated by a flexible linker. In aspects, the flexible linker is SEQ ID NO: 17. In aspects, the scFv is TR66 and wherein the TR66 is codon optimized for expression in human (TR66opt) and wherein the scFv comprises a variable heavy chain (VH)comprising, consisting essentially of, or consisting of the amino acid sequence of SEQ ID NO: 25 and a variable light chain (VL) comprising, consisting essentially of, or consisting of the amino acid sequence of SEQ ID NO: 24. In aspects, the scFv is TR66opt and wherein the scFv comprises a variable heavy chain (VH) comprising, consisting essentially of, or consisting of the amino acid sequences of a complementarity determining region 1 (CDR1) of SEQ ID NO: 131, a complementarity determining region 2 (CDR2) of SEQ ID NO: 132, and a complementarity determining region 3 (CDR3) of SEQ ID NO: 133, and a variable light chain (VL) comprising, consisting essentially of, or consisting of the amino acid sequences of a CDR1 of SEQ ID NO: 134, a CDR2 of SEQ ID NO: 135, and a CDR3 of SEQ ID NO: 136. In aspects, the scFv is UCHT1 wherein the scFv comprises a variable heavy chain (VH) comprising, consisting essentially of, or consisting of the amino acid sequence of SEQ ID NO: 27 and a variable light chain (VL) comprising, consisting essentially of, or consisting of the amino acid sequence of SEQ ID NO: 26. In aspects, the scFv is UCHT1 and wherein the scFv comprises a variable heavy chain (VH) comprising, consisting essentially of, or consisting of the amino acid sequences of a CDR1 of SEQ ID NO: 107, a CDR2 of SEQ ID NO: 108, and a CDR3 of SEQ ID NO: 109, and a variable light chain (VL) comprising, consisting essentially of, or consisting of the amino acid sequences of a CDR1 of SEQ ID NO: 110, a CDR2 of SEQ ID NO: 111, and a CDR3 of SEQ ID NO: 112. In aspects, the scFv is HuM291 wherein the scFv comprises a variable heavy chain (VH) comprising, consisting essentially of, or consisting of the amino acid sequence of SEQ ID NO: 19 and a variable light chain (VL) comprising, consisting essentially of, or consisting of the amino acid sequence of SEQ ID NO: 18. In aspects, the scFv is Hum291 and wherein the scFv comprises a variable heavy chain (VH) comprising, consisting essentially of, or consisting of the amino acid sequences of a CDR1 of SEQ ID NO: 119, a CDR2 of SEQ ID NO: 120, and a CDR3 of SEQ ID NO: 121, and a variable light chain (VL) comprising, consisting essentially of, or consisting of the amino acid sequences of a CDR1 of SEQ ID NO: 122, a CDR2 of SEQ ID NO: 123, and a CDR3 of SEQ ID NO: 124. In aspects, the scFv is OKT3 wherein the scFv comprises a variable heavy chain (VH) comprising, consisting essentially of, or consisting of the amino acid sequence of SEQ ID NO: 21 and a variable light chain (VL) comprising, consisting essentially of, or consisting of the amino acid sequence of SEQ ID NO: 20. In aspects, the scFv is OKT3 and wherein the scFv comprises a variable heavy chain (VH) comprising, consisting essentially of, or consisting of the amino acid sequences of a CDR1 of SEQ ID NO: 125, a CDR2 of SEQ ID NO: 126, and a CDR3 of SEQ ID NO:127, and a variable light chain (VL) comprising, consisting essentially of, or consisting of the amino acid sequences of a CDR1 of SEQ ID NO: 128, a CDR2 of SEQ ID NO: 129, and a CDR3 of SEQ ID NO: 130. In aspects, the scFv is TR66 wherein the scFv comprises a variable heavy chain (VH) comprising, consisting essentially of, or consisting of the amino acid sequence of SEQ ID NO: 23 and a variable light chain (VL) comprising, consisting essentially of, or consisting of the amino acid sequence of SEQ ID NO: 22. In aspects, the scFv is TR66 and wherein the scFv comprises a variable heavy chain (VH) comprising, consisting essentially of, or consisting of the amino acid sequences of a CDR1 of SEQ ID NO: 113, a CDR2 of SEQ ID NO: 114, and a CDR3 of SEQ ID NO: 115, and a variable light chain (VL) comprising, consisting essentially of, or consisting of the amino acid sequences of a CDR1 of SEQ ID NO: 116, a CDR2 of SEQ ID NO: 117, and a CDR3 of SEQ ID NO: 118.

[0097] In aspects, the targeting molecule is an anti-c-KIT binding domain or a functional fragment or derivative thereof capable of selectively binding to the c-KIT receptor, which is sometimes abbreviated as cKit or ckit. In aspects, the anti-c-KIT binding domain comprises an anti-c-KIT 2D1 scFv (SEQ ID NOs: 87 and 88) or a functional fragment or derivative thereof.

[0098] In aspects, the targeting molecule is a ligand. In aspects, the ligand is epidermal growth factor (EGF), a mutant EGF (EFGml23) (SEQ ID NO: 34), stem cell factor (SCF) (SEQ ID NO: 28), thrombopoietin (TPO) (SEQ ID NO: 31), human hepatocyte growth factor (HGF) (SEQ ID NO: 32), or type 1 insulin-like growth factor (IGF1) (SEQ ID NO: 33). In aspects, the targeting molecule is a single chain variable fragment (scFv). In aspects, the scFv binds epidermal growth factor (EGF), human epidermal growth factor receptor 2 (Her2), cluster of differentiation 3 (CD3), or cluster of differentiation 117 (c-KIT), mucin-16 (MUC16), B cell maturation antigen (BCMA), or Nectin4.

[0099] In aspects, the targeting molecule is capable of selectively binding to a receptor expressed by a HSC, a mast cell, a melanocyte, and / or a germ cell. In aspects, the receptor is a c-Kit receptor (also known as CD117). In preferred aspects, the c-Kit receptor is expressed by a HSC. In aspects, the targeting molecule is capable of initiating the c-Kit receptor to homodimerize and auto-phosphorylate at tyrosine residues.

[0100] In aspects, the targeting molecule is a SCF or a functional fragment or derivative thereof. In aspects, the SCF is a mouse SCF (mSCF) (e.g., SEQ ID NO: 29 or 30) or a functional fragment or derivative thereof. In aspects the SCF is a human SCF (hSCF) (SEQID NO: 28) or a functional fragment or derivative thereof. In aspects, the SCF comprises a mutation. In aspects, the SCF comprises a substitution of F63A (SEQ ID NO: 82).

[0101] In aspects, the targeting molecule is functionally modified, e.g., by conservative amino acid substitution. For example, in aspects, the targeting molecule is a mSCF ligand that is modified with an alanine substitution at residue 63 (F63A) (SEQ ID NO: 82) to, e.g., reduce dimerization, causing mSCF F63 A to act as a monomer in solution. In aspects, the targeting molecule is a mSCF ligand that is modified with N6D, D77H, K81I, V87F, L88F, and / or S101F substitutions (6mut) (SEQ ID NO: 81), e.g., to increase binding affinity for c- KIT. In aspects, the targeting molecule is a mSCF ligand that is modified to have both F63A and 6mut substitutions (F63A-6mut) (SEQ ID NO: 83), e.g., to reduce dimerization and increase binding affinity for c-KIT. Functional modifications to targeting molecules can be beneficial, e.g., for fine tuning binding affinity and avoiding cross-reactivity with other cell types, such as Mast cells.

[0102] In aspects, the targeting molecule comprises a thrombopoietin (TPO) (SEQ ID NO: 31) or a functional fragment or derivative thereof. In aspects, the TPO is capable of binding to and activating the TPO receptor (TPO-R) also known as the myeloproliferative leukemia protein (cMpl) expressed on the surface of HSCs. In aspects, this binding facilitates the activation of signal transduction pathways that promote cell proliferation, survival, and maturation of the target cell.

[0103] In aspects, the present disclosure provides a polynucleotide that encodes any of the proteins and polypeptides described herein, including any rhabdoviral G glycoprotein or functional fragment or derivatives thereof, and their recombinant fusion proteins, described herein.

[0104] In aspects, the present disclosure provides a membraned vesicle comprising, consisting essentially of, or consisting of a recombinant fusion protein as described herein.

[0105] As used herein, a “membraned vesicle” is a vesicle bound (delimited) by a lipid bilayer. In aspects, the membraned vesicle is either naturally-derived or engineered. A membraned vesicle can be cell-derived and thus be a cell-derived enveloped particle (CDEP).

[0106] In aspects, the vesicle is a gesicle or an exosome. A gesicle can be as described in Mangeot et al., Mol. Ther.. 19: 1656-1666 (2011), which is incorporated herein by reference in its entirety, where overexpression of glycoprotein of VSV-G in human cells inducedrelease of fusogenic vesicles. As used herein, an “exosome” refers to a lipid bilayer vesicle ranging in size from approximately 30 nm to 150 nm in diameter, secreted by eukaryotic cells via the endosomal pathway, and containing biologically active molecules such as proteins, lipids, RNA, or DNA. An exosome typically originates from multivesicular bodies (MVBs) and is released into the extracellular environment through exocytosis. Exosomes are known to serve as intercellular communication vehicles and may be utilized for diagnostic, therapeutic, or drug delivery applications. Examples of exosomes are provided in Li et al., European Journal of Medicinal Chemistry, 207: 112784 (2020); Yang et al., Adv. Mater., 29: 1605604 (2017); U.S. Pat. No. 10,195,290; and U.S. Patent Application Publication No. 2018 / 0028600, each of which is incorporated herein by reference in its entirety.

[0107] In aspects, the present disclosure provides an enveloped viral particle comprising, consisting essentially of, or consisting of a recombinant fusion protein as described herein.

[0108] As used herein, an “enveloped viral particle” is a vesicle bound (delimited) by a lipid bilayer and has the ability to infect a cell and produce additional enveloped viral particles. An enveloped viral particle can include one or more components of a virus, in addition to a rhabdoviral G glycoprotein or functional fragment or derivative thereof or recombinant fusion protein thereof. Exemplary components of a virus include, without limitation, the gag,pol, or env gene or gene product of lentivirus.

[0109] A “virus-like particle” as used herein means an enveloped viral particle that cannot produce additional virus-like particles (i.e., is replication-incompetent). Virus-like particles (VLPs) are non-infectious and mimic the conformation of their parental viruses but lack the viral genetic material required for replication. A VLP can contain genetic material / nucleic acid not associated with self-replication. VLPs can preserve the high packaging efficiency and target-specificity of certain viruses while greatly minimizing the risk of host genome integration. Because VLPs do not replicate or integrate into the host genome, they are often associated with lower cytotoxicity and reduced immunogenic risk compared to replication-competent viral systems.

[0110] In aspects, membraned vesicles, cell-derived enveloped particles, enveloped viral particles, and virus-like particles can encapsulate proteins, lipids, nucleic acids, etc. for delivery, such that membraned vesicles, cell-derived enveloped particles, enveloped viral particles, and virus-like particles can be considered “enveloped delivery vehicles.”

[0111] An “enveloped delivery vehicle” (EDV) can encapsulate a cargo or payload. Any suitable cargo or payload of an EDV is contemplated herein, including, but not limited to, e.g., a protein, a lipid, a nucleic acid, a small molecule, a therapeutic agent, a gene editing system, such as CRISPR Cas, and any combination thereof.

[0112] In aspects, an enveloped delivery vehicle, a membraned vesicle, or an enveloped viral particle comprises a mixed trimer, wherein the mixed trimer comprises (a) at least one recombinant fusion protein comprising a targeting molecule, and (b) at least one rhabdoviral G glycoprotein or functional fragment or derivative thereof that does not comprise a targeting molecule. Without being bound by theory, decreasing the number of units in a recombinant rhabdoviral G glycoprotein trimer that have a targeting molecule better allows the transformation of the trimer from a prefusion to a fusion conformation. In aspects, an enveloped delivery vehicle described herein comprises a mixed trimer. In aspects, a targeting molecule of the mixed trimer is a ligand selected from an epidermal growth factor (EGF), a mutant EGF (EFGml23) (SEQ ID NO: 34), stem cell factor (SCF) (SEQ ID NO: 28), thrombopoietin (TPO) (SEQ ID NO: 31), human hepatocyte growth factor (HGF) (SEQ ID NO: 32), or type 1 insulin-like growth factor (IGF1) (SEQ ID NO: 34). In aspects, a targeting molecule of the mixed trimer is an EGF, CD19, CD20, CD4, CD28, or SCF. In aspects, a targeting molecule of the mixed trimer is an EGF. In aspects, a targeting molecule of the mixed trimer is a SCF. In aspects, a targeting molecule of the mixed trimer is a TPO. In aspects, a targeting molecule of the mixed trimer is a scFv such as, a-CD19, a-CD3, and a-c- Kit. In aspects, the a-CD19 scFv is FMC63, and wherein the scFv comprises a variable heavy chain (VH) comprising, consisting essentially of, or consisting of the amino acid sequence of SEQ ID NO: 74 and a variable light chain (VL) comprising, consisting essentially of, or consisting of the amino acid sequence of SEQ ID NO: 73. In aspects, the a-c-Kit scFv is 2D1, and wherein the scFv comprises a variable heavy chain (VH) comprising, consisting essentially of, or consisting of the amino acid sequence of SEQ ID NO: 87 and a variable light chain (VL) comprising, consisting essentially of, or consisting of the amino acid sequence of SEQ ID NO: 88. In aspects, the mixed trimer of the enveloped delivery vehicle, membraned vesicle, or an enveloped viral particle comprises at least two recombinant fusion proteins that are different. In aspects, the mixed trimer comprises a first recombinant fusion protein comprising EGF, CD 19, CD20, CD4, CD28, TPO, or SCF, and a second recombinant fusion protein comprising a-CD19, a-CD3, or a-c-Kit. In aspects, the mixed trimer comprisesa first recombinant fusion protein comprising EGF, CD 19, CD20, CD4, CD28, TPO, or SCF, and a second recombinant fusion protein comprising a-CD19, a-CD3, or a-c-Kit.

[0113] In aspects, the enveloped delivery vehicle, membraned vesicle, or enveloped viral particle comprises an unmixed trimer, wherein the unmixed trimer comprises only rhabdoviral G glycoprotein or a functional fragment or derivative thereof that is not within a recombinant fusion protein. In aspects, an enveloped delivery vehicle described herein comprises an unmixed trimer.

[0114] In aspects, an enveloped delivery vehicle, a membraned vesicle, or an enveloped viral particle comprises the maximum number of the recombinant fusion proteins possible to be accommodated within the membrane of the enveloped delivery vehicle, membraned vesicle, or enveloped viral particle, wherein each recombinant fusion protein comprises a targeting molecule. In aspects, an enveloped delivery vehicle, a membraned vesicle, or an enveloped viral particle comprises less than the maximum number of the recombinant fusion proteins possible to be accommodated within the membrane of the enveloped delivery vehicle, membraned vesicle, or enveloped particle, wherein each recombinant fusion protein comprises a targeting molecule. Less than the maximum amount can be of any amount less than 100%, e.g., 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, 2%, or 1%, or any range between these percentages. In aspects, any enveloped delivery vehicle as described herein comprises the maximum number of the recombinant fusion proteins possible to be accommodated within the membrane, wherein each recombinant fusion protein comprises a targeting molecule.

[0115] In aspects, the present disclosure provides a recombinant viral vector comprising, consisting essentially of, or consisting of a nucleotide encapsulated by an enveloped delivery vehicle as described herein, a membraned vesicle as described herein, or an enveloped viral particle as described herein.

[0116] In aspects, the present disclosure provides a composition comprising, consisting essentially of, or consisting of a pharmaceutically acceptable carrier and an enveloped delivery vehicle as described herein, a membraned vesicle as described herein, an enveloped viral particle as described herein, or a recombinant viral vector as described herein. Pharmaceutically acceptable carriers are well-known in the art.

[0117] In aspects, the present disclosure provides a method of delivering a payload to a target cell, the method comprising, consisting essentially of, or consisting of contacting the target cell with a membraned vesicle as described herein, an enveloped viral particle as described herein, an enveloped delivery vehicle as described herein, a recombinant viral vector as described herein, or a composition as described herein. In aspects, the target cell is a HSC. In aspects, the target cell is a HSEC. In aspects, the target cell is in vitro or ex vivo. In aspects, the target cell is in vivo. In aspects, the payload is a nucleotide sequence encoding a chimeric antigen receptor (CAR) comprising, consisting essentially of, or consisting of an antigen binding domain, a transmembrane domain, and an intracellular signaling domain. In aspects, the CAR has antigenic specificity for CD19 (e.g., SEQ ID NO: 75) or BCMA (e.g., SEQ ID NOs: 76-80). In aspects, the CAR comprises a hinge domain, wherein the hinge domain is the hinge domain of CD28a or CD8a (SEQ ID NO: 68). In aspects, the transmembrane domain is the transmembrane domain of CD28 or CD8 (SEQ ID NO: 69). In aspects, the intracellular signaling domain comprises a costimulatory domain and an activating domain. In aspects, the costimulatory domain is 4- IBB (SEQ ID NO: 70). In aspects, the activating domain is CD3zeta (SEQ ID NO: 71). In aspects, the payload is a gene editing system or a nucleotide encoding a transgene. In aspects, the gene editing system comprises one or more nucleases, such as CRISPR-Cas9, CasMINI, TALENs, or zinc finger nucleases, as well as guide RNAs or other molecules that direct the nucleases to specific genomic loci.

[0118] Without wishing to be bound by theory, CD 19 acts as a co-receptor for B-cell receptor (BCR) signaling and plays a role in B-cell activation, development, and differentiation. CD 19 is expressed on B cells from the earliest recognizable B-lineage cells during development to B-cell precursors. It is present on many B-cell malignancies, including, e.g., acute lymphoblastic leukemia (ALL) and chronic lymphocytic leukemia (CLL).

[0119] Without wishing to be bound by theory, BCMA is involved in the regulation of plasma cell survival and proliferation. BCMA is expressed on mature B cells and plasma cells. BCMA is present on, e.g., multiple myeloma, as it is a disease characterized by malignant plasma cell proliferation.

[0120] In aspects, the present disclosure provides a retroviral vector expression system comprising, consisting essentially of, or consisting of one or more nucleotide sequencesencoding a recombinant fusion protein as described herein. In aspects, the retroviral vector expression system comprises a vector construct and helper constructs that are each on separate plasmids. In aspects, the retroviral vector expression system is a lentirival vector expression system, a foamy vector expression system, or a respiratory syncytial virus (RSV). A rhabdoviral G glycoprotein or functional fragment or derivative thereof as described herein can be expressed within a retorviral vector expression system to pseudotype the vector and alter the tropism of the vector.

[0121] As used herein, a “vector construct” comprises a nucleic acid of interest, e.g., encoding a rhabdoviral G glycoprotein or functional fragment or derivative thereof, or recombinant fusion protein thereof, as described herein, and “helper constructs” comprise proteins useful for the formation of, e.g., virions. Such helper constructs can encode, e.g., structural proteins, and can be packaging vectors that are, e.g., plasmids.

[0122] In aspects, the retroviral vector expression system comprises, consists essentially of, or consists of a nucleotide sequence encoding a chimeric antigen receptor (CAR) comprising, consisting essentially of, or consisting of an antigen binding domain, a transmembrane domain, and an intracellular signaling domain. In aspects, the CAR has antigenic specificity for CD 19 or BCMA. In aspects, the CAR comprises a hinge domain, wherein the hinge domain is the hinge domain of CD28a or CD8a. In aspects, the transmembrane domain is the transmembrane domain of CD28 or CD8. In aspects, the intracellular signaling domain comprises a costimulatory domain and an activating domain. In aspects, the costimulatory domain is 4- IBB. In aspects, the activating domain is CD3zeta. In aspects, the retroviral vector expression system comprises, consists essentially of, or consists of a gene editing system or one or more nucleotide sequences encoding a transgene. In aspects, the gene editing system comprises one or more nucleases, such as CRISPR-Cas9, CasMINI, TALENs, or zinc finger nucleases, as well as guide RNAs or other molecules that direct the nucleases to specific genomic loci.

[0123] In aspects, the present disclosure provides a method of making a membraned vesicle, an enveloped viral particle, an enveloped delivery vehicle, a virus-like particle, or a recombinant viral vector, the method comprising, consisting essentially of, or consisting of: a) transfecting or transducing a packaging host cell with a retroviral vector expression system as described herein; and b) recovering the membraned vesicle, enveloped viral particle,enveloped delivery vehicle, virus-like particle, or recombinant viral vector produced by the transfected or transduced packaging host cell.

[0124] “Transfecting” and “transfection” as used herein means non-viral means of introducing nucleic acid into a cell. “Transducing” and “transduction” as used herein means use of viral means of introducing nucleic acid into a cell.

[0125] In aspects, any method of making an enveloped delivery vehicle, lentivirus, retroviral vector expression system, recombinant viral vector, etc. as described herein can comprise transduction in a medium comprising a poloxamer-based chemical adjuvant. In aspects, the poloxamer-based chemical adjuvant is selected from vectofusin-1, poloxamer Fl 08, and Lentiboost™. In aspects, the method of making comprises a spinoculation step at the beginning of transduction.

[0126] In aspects, the packaging host cell is HEK 293T or a 293-cell suspension line.

[0127] In aspects, the present disclosure provides a plasmid comprising, consisting essentially of, or consisting of one or more nucleotide sequences encoding a recombinant fusion protein as described herein.

[0128] In aspects, the present disclosure provides a composition as described herein or a retroviral vector expression system as described herein for use in treating a disease in a mammal.

[0129] The mammal may be any suitable mammal. Mammals include, but are not limited to, the order Rodentia, such as mice, and the order Lagomorpha, such as rabbits. The mammal can be from the order Carnivora, including Felines (cats) and Canines (dogs). The mammal can be from the order Artiodactyla, including Bovines (cows) and Swines (pigs) or of the order Perissodactyla, including Equines (horses). The mammal can be of the order Primates, Cebids, or Simioids (monkeys) or of the order Anthropoids (humans and apes). In aspects, the mammal is human.

[0130] In aspects the disease is a genetic disease. In aspects the disease is a cancer. In aspects the disease is beta-thalassemia, anemia, sickle cell disease, Gaucher disease, Parkinson disease, immunologic deficiency syndromes, mucopolysaccharidosis III, severe combined immunodeficiency disease, hepatitis C, chronic hepatitis C, pancytopenia, X-linked combined immunodeficiency diseases, epidermolysis bullosa, solid tumors, melanoma, Fanconi anemia, adenosine deaminase deficiency, granulomatous disease, chronic cysticfibrosis, HIV infections, HIV seropositivity, Hodgkin’s lymphoma, Bruton type agammaglobulinemia, Hemophilia A, arthritis, or choroidal neovascularization. In other aspects, the disease is any disease or condition that can be treated by delivery of a gene editing system. In aspects, the gene editing system comprises one or more nucleases, such as CRISPR-Cas9, CasMINI, TALENs, or zinc finger nucleases, as well as guide RNAs or other molecules that direct the nucleases to specific genomic loci.

[0131] As used herein, “treatment” or “treat” refers to a therapeutic intervention that ameliorates a sign or symptom of a disease or pathological condition after it has begun to develop, and also includes addressing a medical condition or disease with the objective of improving or stabilizing an outcome in a mammal being treated. “Treating,” “treat,” and “treatment” have grammatically corresponding meanings. In the context of cancer, the terms “treat” or “treating” or “treatment” can, among other things, refer to inducing apoptosis of cancerous cells, reducing the size of a cancerous tumor, delaying the growth of tumors, or inducing or enhancing an immune response against one or more cancerous cells, where the immune response has the effect of inducing apoptosis, reducing the size of a tumor, or the like. The terms “treat,” “treating,” “treatment,” “therapeutically effective,” “prevention,” etc. used herein do not necessarily imply 100% or complete treatment / prevention / etc. Rather, there are varying degrees, which one of ordinary skill in the art recognizes as having a potential benefit or therapeutic effect. In this respect, the membraned vesicles, enveloped viral particles, recombinant viral vectors, etc. as described herein and methods as described herein can provide any amount of any level of treatment. Furthermore, the treatment provided by the disclosed method can include the treatment of one or more conditions or symptoms of the disease or condition being treated.

[0132] In aspects, a method of treating comprises administering a composition as described herein or a retroviral vector expression system as described herein, comprising a rhabdoviral G glycoprotein or functional fragment or derivative thereof or recombinant fusion protein thereof, and subsequently administering a composition as described herein or a retroviral vector expression system as described herein, comprising a different rhabdoviral G glycoprotein or functional fragment or derivative thereof or recombinant fusion protein thereof. The subsequent administration may be within hours, days, months, or years of the first administration, with scheduling to be determined by patient needs. Multiple rounds of subsequent administrations may be performed, using the same or different rhabdoviral Gglycoproteins as determined by the patient needs. Without wishing to be bound by theory, it is believed that administering a different rhabdoviral G glycoprotein or functional fragment or derivative thereof reduces the likelihood of decreased effectiveness due to any immune response that is directed against the first rhabdoviral G glycoprotein or functional fragment or derivative thereof. A rhabdoviral G glycoprotein or functional fragment or derivative thereof or recombinant fusion protein thereof described herein can be the first administered, and a rhabdoviral G glycoprotein or functional fragment or derivative thereof or recombinant fusion protein thereof as described herein that has a different rhabdoviral G glycoprotein than the first rhabdoviral G glycoprotein or functional fragment or derivative thereof or recombinant fusion protein thereof can be the subsequently administered rhabdoviral G glycoprotein or functional fragment or derivative thereof or recombinant fusion protein thereof. This sequence of events can be termed “re-dosing”.

[0133] In aspects, the composition is administered intravenously. In aspects, the composition is administered intraperitoneally.

[0134] Rhabdoviral G glycoproteins can associate into trimers at the surface of a native virus, an enveloped delivery vehicle as described herein, a membraned vesicle as described herein, an enveloped viral particle as described herein, or a recombinant viral vector as described herein. As used herein, a “mixed rhabdoviral G glycoprotein trimer” comprises, consists essentially of, or consists of three rhabdoviral G glycoproteins or functional fragments or derivatives thereof (wherein each is optionally within a recombinant fusion protein), wherein (a) at least one of the rhabdoviral G glycoproteins or functional fragments or derivatives thereof in the trimer is within a recombinant fusion protein comprising, consisting essentially of, or consisting of a rhabdoviral G glycoprotein or a functional fragment or derivative thereof engineered to reduce or abolish natural receptor binding specificity and a targeting molecule, and (b) at least one of the rhabdoviral G glycoproteins or functional fragments or derivatives thereof in the trimer is not within a recombinant fusion protein and does not have a targeting molecule.

[0135] Trimers of rhabdoviral G glycoproteins or functional fragments or derivatives thereof, may have one, two, or three targeting molecules. The number of targeting molecules in the trimer is the occupancy of the trimer, wherein the trimer may have full occupancy (three targeting molecules in the trimer), partial occupancy (targeting molecules on fewer than all rhabdoviral G glycoproteins or functional fragments or derivatives thereof of thetrimer, e.g., two or one targeting molecules), or no occupancy (no targeting molecule in the trimer). In aspects, trimers of rhabdoviral G glycoproteins or functional fragments or derivatives thereof having full occupancy or partial occupancy comprise targeting molecules with the same identity (i.e., two identical targeting molecules or three identical targeting molecules). In aspects, trimers of rhabdoviral G glycoproteins or functional fragments or derivatives thereof having full occupancy or partial occupancy comprise at least two different targeting molecules (e.g., three distinct targeting molecules).

[0136] In aspects, the present disclosure provides a method of making a mixed rhabdoviral G glycoprotein trimer, the method comprising, consisting essentially of, or consisting of: a) transfecting or transducing a packaging host cell with a retroviral vector expression system as described herein; and b) recovering the mixed rhabdoviral G glycoprotein trimer. Mixed trimers may be prepared using any suitable method.

[0137] In aspects, the present disclosure provides a method of reducing inactivation of a rhabdoviral G glycoprotein or a functional fragment or derivative thereof by serum, LDL, or vLDL, the method comprising, consisting essentially of, or consisting of producing the rhabdoviral G glycoprotein or functional fragment or derivative thereof as a recombinant fusion protein, and exposing the recombinant fusion protein to serum, LDL, or vLDL, wherein inactivation by serum, LDL, or vLDL is reduced.

[0138] In aspects, the present disclosure provides a method of reducing inactivation of a rhabdoviral G glycoprotein or a functional fragment or derivative thereof (e.g., reducing inactivation of rhabdoviral G glycoprotein mediated fusion) by serum, LDL, or vLDL (e.g., ApoB-100-containing lipoproteins), the method comprising, consisting essentially of, or consisting of producing a rhabdoviral G glycoprotein or functional fragment or derivative thereof as a recombinant fusion protein as described herein, and exposing the recombinant fusion protein to serum, LDL, or vLDL, wherein inactivation by serum, LDL, or vLDL is reduced. In aspects, the recombinant fusion protein is inactivated to a lesser degree by serum, LDL, or vLDL compared to a rhabdoviral G glycoprotein without the targeting molecule. Reduction in inhibition can be of any amount, e.g., reduced by 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, 2%, 1%, or any range between these percentages. In aspects, producing vectors as described herein in a cell that expresses CD55 (or overexpresses CD55) can increase resistance to complement inactivation.

[0139] In aspects, the present disclosure provides a method of activating lymphocytes by contacting the lymphocyte with a composition, a virus, a membraned vesicle, an enveloped delivery vehicle, an enveloped viral particle, or a recombinant viral vector as described herein. Lymphocytes include, e.g., T cells and natural killer cells. The T cell can be, e.g., a CD8+ T cell.

[0140] Methods contemplated include the use of a retroviral vector expression system as described herein to genetically modify hematopoietic stem cells for use in treatment of a disease in a mammal. The modification can be to treat, e.g., transfusion-dependent P- thalassemia, cerebral adrenoleukodystrophy, sickle cell disease, metachromatic leukodystrophy and adrenoleukodystrophy, Wiskott-Aldrich syndrome, X-SCID or ADA- SCID (ADA: adenosine deaminase, SCID: severe combined immunodeficiency), Fanconi anemia, or X-linked chronic granulomatous disease.

[0141] International Patent Application No. PCT / US2024 / 024511, titled “MODULAR RE-TARGETING OF RHABDOVIRAL (G) GLYCOPROTEINS FROM THEIR NATURAL RECEPTORS,” filed on April 12, 2024, is incorporated herein by reference in its entirety.

[0142] International Patent Application No. PCT / US2024 / 024516, titled “CD3- REDIRECTED VECTORS, COMPONENTS THEREOF, AND USES OF THE VECTORS AND COMPONENTS THEREOF,” filed on April 12, 2024, is incorporated herein by reference in its entirety.

[0143] International Patent Application No. PCT / US2024 / 013058, titled “MODIFIED RHABDOVIRUS GLYCOPROTEINS AND USES THEREOF,” filed on January 26, 2024, is incorporated herein by reference in its entirety.

[0144] The following are certain aspects of the disclosure.

[0145] 1. A recombinant fusion protein comprising (a) a rhabdoviral G glycoprotein or a functional fragment or derivative thereof and (b) a targeting molecule, wherein the targeting molecule targets the recombinant fusion protein to a hematopoietic stem cell (HSC).

[0146] 2 The recombinant fusion protein of aspect 1, wherein the HSC is a long-termHSC.

[0147] 3 A recombinant fusion protein comprising (a) a rhabdoviral G glycoprotein or a functional fragment or derivative thereof and (b) a targeting molecule, wherein the targeting molecule targets the recombinant fusion protein to a hepatic sinusoidal endothelial cell (HSEC).

[0148] 4. A recombinant fusion protein comprising (a) a rhabdoviral G glycoprotein or a functional fragment or derivative thereof and (b) a targeting molecule, wherein the targeting molecule comprises: (1) stem cell factor (SCF), (2) an anti-c-KIT binding domain, (3) thrombopoietin (TPO), (4) epidermal growth factor (EGF), or (5) a functional fragment or derivative of (1), (2), (3) or (4).

[0149] 5. The recombinant fusion protein of aspect 4, wherein the targeting molecule comprises: SCF or a functional fragment or derivative thereof.

[0150] 6. The recombinant fusion protein of aspect 5, wherein the SCF has a substitution of F63A.

[0151] 7 The recombinant fusion protein of aspect 5 or 6, wherein the SCF has a 6mut substitution.

[0152] 8. The recombinant fusion protein of aspect 5, wherein the SCF has a substitution of N6D, D77H, K81I, V87F, L88F, and / or S101F.

[0153] 9. The recombinant fusion protein of aspect 4, wherein the targeting molecule comprises: an anti-c-KIT binding domain or a functional fragment or derivative thereof.

[0154] 10. The recombinant fusion protein of aspect 4, wherein the targeting molecule comprises: TPO or a functional fragment or derivative thereof.

[0155] 11. The recombinant fusion protein of aspect 4, wherein the targeting molecule comprises: EGF or a functional fragment or derivative thereof.

[0156] 12. The recombinant fusion protein of any one of aspects 1-11, wherein the targeting molecule is N-terminal to the rhabdoviral G glycoprotein or functional fragment or derivative thereof.

[0157] 13. The recombinant fusion protein of any one of aspects 1-12, wherein the recombinant fusion protein comprises a linker between the targeting molecule and the rhabdoviral G glycoprotein or functional fragment or derivative thereof.

[0158] 14. The recombinant fusion protein of aspect 13, wherein the linker is flexible.

[0159] 15. The recombinant fusion protein of aspect 14, wherein the linker isAAASGGSGGGGSGGGGSGP (SEQ ID NO: 49),AAASGGSGGGGSGGGGS (SEQ ID NO: 50),GGGGSGGGGSGGGGSGGGGS (SEQ ID NO: 51),GGGGSGGGGSGGGGS (SEQ ID NO: 17),GGGGSGGGGS (SEQ ID NO: 52),GGGGS (SEQ ID NO: 53),GGGGGGGG (SEQ ID NO: 54),GGGGGG (SEQ ID NO: 55),GSAGSAAGSGEF (SEQ ID NO: 56), andVPGVGVPGVG (SEQ ID NO: 57).

[0160] 16. The recombinant fusion protein of aspect 13, wherein the linker is rigid.

[0161] 17. The recombinant fusion protein of aspect 16, wherein the linker isPAPAP (SEQ ID NO: 58),EAAAKEAAAKEAAAK (SEQ ID NO: 59),EAAAKEAAAK (SEQ ID NO: 60),EAAAK (SEQ ID NO: 61), AEAAAKEAAAKEAAAKEAAAKALEAEAAAKEAAAKEAAAKEAAAKA (SEQ ID NO: 62),AEAAAKEAAAKA (SEQ ID NO: 63),ESKYGPPCPPCP (SEQ ID NO: 64),CPPCPAPELLGGPSVF (SEQ ID NO: 65), and alanine-proline (AP) repeated for a total of 10 to 34 amino acids (SEQ ID NO: 66).

[0162] 18. The recombinant fusion protein of any one of aspects 1-17, wherein the rhabdoviral G glycoprotein or functional fragment or derivative thereof is of a Flanders virus glycoprotein (FLAV-G) (SEQ ID NO: 1), a Chandipura virus glycoprotein (CHPV-G) (SEQ ID NO: 2), a Perinet virus glycoprotein (PERV-G) (SEQ ID NO: 3), a Piry virus glycoprotein (PIRYV-G) (SEQ ID NO: 4), a Fukuoka virus glycoprotein (FUKV-G) (SEQ ID NO: 5), a Joinjakaka virus glycoprotein (JOIV-G) (SEQ ID NO: 6), a Kumasi virus glycoprotein (KRV-G) (SEQ ID NO: 7), a Keuraliba virus glycoprotein (KEUV-G) (SEQ ID NO: 8), an Isfahan glycoprotein (ISFV-G), a Jurona glycoprotein (JURV-G), a Mediterranean Bat glycoprotein (MBV-G), a Malpais Spring glycoprotein (MSPV-G), a Radi glycoprotein (RADV-G), a Rhinolophus affinis-G, a Yug Bugdanavoc glycoprotein (YBV-G), a Yinshui Bat glycoprotein (YSBV-G), a Kimberley glycoprotein (KIMV-G), a Kanyawara glycoprotein (KYAV-G), a La Joya glycoprotein (LJV-G), a Mosquiero glycoprotein (MQOV-G), a Parry Creek glycoprotein (PCV-G), a Bas Congo glycoprotein (BASV-G), a Bovine Ephemeral fever glycoprotein (BEFV-G), a Curionopolis glycoprotein (CURV-G), a Drosophila melanogaster sigmavirus glycoprotein (DMelSV-G), a Niakha glycoprotein(NIAV-G), a Puerto almandras glycoprotein (PTAMV-G), or a Tupaia rhabdovirus (TUPTV- G).

[0163] 19. The recombinant fusion protein of any one of aspects 1-17, wherein the rhabdoviral G glycoprotein or functional fragment or derivative thereof is of a Vesiculovirus glycoprotein or a functional fragment or derivative thereof.

[0164] 20. The recombinant fusion protein of any one of aspects 1-17, wherein the rhabdoviral G glycoprotein or functional fragment or derivative thereof is of Vesiculovirus Indiana, Vesiculovirus newjersey, Vesiculovirus carajas, or Vesiculovirus alagoas.

[0165] 21. The recombinant fusion protein of aspect 20, wherein the rhabdoviral G glycoprotein or functional fragment or derivative thereof is of Vesiculovirus indiana (SEQ ID NO: 9).

[0166] 22. The recombinant fusion protein of aspect 20, wherein the rhabdoviral G glycoprotein or functional fragment or derivative thereof is of Vesiculovirus newjersey (SEQ ID NO: 10).

[0167] 23. The recombinant fusion protein of any one of aspects 1-22, wherein the rhabdoviral G glycoprotein is a functional fragment or derivative thereof.

[0168] 24. The recombinant fusion protein of aspect 23, wherein the cytoplasmic tail of the glycoprotein is truncated, deleted, or replaced with another sequence.

[0169] 25. The recombinant fusion protein of any one of aspects 1-22, wherein the rhabdoviral G glycoprotein is substantially intact.

[0170] 26. The recombinant fusion protein of any one of aspects 1-25, wherein the rhabdoviral G glycoprotein is engineered to reduce or abolish its natural receptor binding specificity.

[0171] 27. The recombinant fusion protein of aspect 26, wherein the rhabdoviral G glycoprotein is engineered to have a mutation to reduce or abolish its natural receptor binding specificity.

[0172] 28. The recombinant fusion protein of aspect 27, wherein the rhabdoviral G glycoprotein comprises a mutation at one or more positions corresponding to H8, K47, Y209, and K354 on the Vesiculovirus Indiana glycoprotein (SEQ ID NO: 9).

[0173] 29. The recombinant fusion protein of aspect 27 or 28, wherein the mutation is a substitution.

[0174] 30. The recombinant fusion protein of aspect 29, wherein the substitution is with aQ

[0175] 31. The recombinant fusion protein of any one of aspects 27-30, wherein the mutation is a substitution at two or more positions.

[0176] 32. The recombinant fusion protein of aspect 27 or 28, wherein the mutation is a deletion.

[0177] 33. The recombinant fusion protein of aspect 32, wherein the mutation is a single deletion at the position corresponding to K47 on the Vesiculovirus indiana glycoprotein (SEQ ID NO: 9).

[0178] 34. The recombinant fusion protein of any one of aspects 1-33, wherein the recombinant fusion protein is inactivated to a lesser degree by serum, LDL, or vLDL compared to a rhabdoviral G glycoprotein without the targeting molecule.

[0179] 35. The recombinant fusion protein of any one of aspects 1-34, wherein the recombinant fusion protein comprises a signal peptide N-terminal to the targeting molecule.

[0180] 36. The recombinant fusion protein of aspect 35, wherein the signal peptide comprises the amino acid sequence of SEQ ID NO: 35.

[0181] 37. The recombinant fusion protein of aspect 35 or 36, wherein the signal sequence is cleaved off.

[0182] 38. A membraned vesicle comprising the recombinant fusion protein of any one of aspects 1-37.

[0183] 39. The membraned vesicle of aspect 38, wherein the vesicle is a gesicle or an exosome.

[0184] 40. The membraned vesicle of aspect 38 or 39, wherein the membraned vesicle comprises a mixed trimer, wherein the mixed trimer comprises (a) at least one of the recombinant fusion protein, and (b) at least one rhabdoviral G glycoprotein or functional fragment or derivative thereof that is not within a fusion protein.

[0185] 41. The membraned vesicle of any one of aspects 38-40, wherein the membraned vesicle comprises an unmixed trimer, wherein the unmixed trimer comprises only rhabdoviral G glycoprotein or a functional fragment or derivative thereof that is not within a fusion protein.

[0186] 42. The membraned vesicle of any one of aspects 38-41, wherein the membraned vesicle comprises the maximum number of the recombinant fusion proteins possible to be accommodated within the membrane of the membraned vesicle.

[0187] 43. The membraned vesicle of any one of aspects 38-42, wherein the membraned vesicle comprises at least two recombinant fusion proteins, each recombinant fusion protein comprising (a) a rhabdoviral G glycoprotein or a functional fragment or derivative thereof and (b) a targeting molecule, and wherein the at least two recombinant fusion proteins have different targeting moieties.

[0188] 44. The membraned vesicle of any one of aspects 38-43, wherein the membraned vesicle comprises a gene editing system.

[0189] 45. The membraned vesicle of aspect 44, wherein the gene editing system comprises Cas9 or CasMINI.

[0190] 46. An enveloped viral particle comprising the recombinant fusion protein of any one of aspects 1-37.

[0191] 47. The enveloped viral particle of aspect 46, wherein the enveloped viral particle comprises a mixed trimer, wherein the mixed trimer comprises (a) at least one of the recombinant fusion protein, and (b) at least one rhabdoviral G glycoprotein or functional fragment or derivative thereof that is not within a fusion protein.

[0192] 48. The enveloped viral particle of aspect 46 or 47, wherein the enveloped viral particle comprises an unmixed trimer, wherein the unmixed trimer comprises only rhabdoviral G glycoprotein or a functional fragment or derivative thereof that is not within a fusion protein.

[0193] 49. The enveloped viral particle of any one of aspects 46-48, wherein the enveloped viral particle comprises the maximum number of the recombinant fusion proteins possible to be accommodated within the membrane of the enveloped viral particle.

[0194] 50. The enveloped viral particle of any one of aspects 46-49, wherein the enveloped viral particle comprises at least two recombinant fusion proteins, each recombinant fusion protein comprising (a) a rhabdoviral G glycoprotein or a functional fragment or derivative thereof and (b) a targeting molecule, and wherein the at least two recombinant fusion proteins have different targeting moieties.

[0195] 51. The enveloped viral particle of any one of aspects 46-50, wherein the enveloped viral particle comprises a gene editing system.

[0196] 52. The enveloped viral particle of aspect 51, wherein the gene editing system comprises Cas9 or CasMINI.

[0197] 53. A recombinant viral vector comprising a nucleotide encapsulated by the membraned vesicle of any one of aspects 38-45 or the enveloped viral particle of any one of aspects 46-52.

[0198] 54. A composition comprising a pharmaceutically acceptable carrier and the membraned vesicle of any one of aspects 38-45, the enveloped viral particle of any one of aspects 46-52, or the recombinant viral vector of aspect 53.

[0199] 55. A method of delivering a payload to a hematopoietic stem cell or hepatic sinusoidal endothelial cell, the method comprising contacting the target cell with the membraned vesicle of any one of aspects 38-45, the enveloped viral particle of any one of aspects 46-52, the recombinant viral vector of aspect 53, or the composition of aspect 54.

[0200] 56. The method of aspect 55, wherein the target cell in in vitro or ex vivo.

[0201] 57. The method of aspect 55, wherein the target cell in in vivo.

[0202] 58. A retroviral vector expression system comprising one or more nucleotide sequences encoding the recombinant fusion protein of any one of aspects 1-37.

[0203] 59. The retroviral vector expression system of aspect 58, wherein the retroviral vector expression system comprises a vector construct and helper constructs that are each on separate plasmids.

[0204] 60. The retroviral vector expression system of aspect 58 or 59, wherein the retroviral vector expression system is a lentiviral vector expression system.

[0205] 61. The retroviral vector expression system of any one of aspects 58-60, wherein the retroviral vector expression system comprises a gene editing system.

[0206] 62. The retroviral vector expression system of aspect 61, wherein the gene editing system comprises Cas9 or CasMINI.

[0207] 63. A method of making a membraned vesicle, an enveloped viral particle, a virus-like particle, or a recombinant viral vector, the method comprising: a) Transfecting or transducing a packaging host cell with the retroviral vector expression system of any one of aspects 58-62; and b) recovering the membraned vesicle, enveloped viral particle, virus-like particle, or recombinant viral vector produced by the transfected or transduced packaging host cell.

[0208] 64. A plasmid comprising one or more nucleotide sequences encoding the recombinant fusion protein of any one of aspects 1-37.

[0209] 65. The composition of aspect 54 or the retroviral vector expression system of any one of aspects 57-61 for use in treating a disease in a mammal.

[0210] 66. The composition or retroviral vector expression system of aspect 65, wherein the mammal is a human.

[0211] 67. The composition or retroviral vector expression system of aspect 65 or 66, wherein the disease is a genetic disease.

[0212] 68. The composition or retroviral vector expression system of aspect 65 or 66, wherein the disease is a cancer.

[0213] 69. The composition or retroviral vector expression system of any one of aspects65-68, wherein the composition is administered intravenously.

[0214] 70. The composition or retroviral vector expression system of any one of aspects65-68, wherein the composition is administered intraperitoneally.

[0215] 71. A method of making a mixed rhabdoviral G glycoprotein trimer, the method comprising: a) transfecting or transducing a packaging host cell with the retroviral vector expression system of any one of aspects 58-62; and b) recovering the mixed rhabdoviral G glycoprotein trimer.

[0216] 72. A method of reducing inactivation of a rhabdoviral G glycoprotein or a functional fragment or derivative thereof by serum, LDL, or vLDL, the method comprising producing the rhabdoviral G glycoprotein or functional fragment or derivative thereof as the recombinant fusion protein of any one of aspects 1-37, and exposing the recombinant fusion protein to serum, LDL, or vLDL, wherein inactivation by serum, LDL, or vLDL is reduced.

[0217] It shall be noted that the preceding are merely examples of aspects of the disclosure. Other exemplary aspects are apparent from the entirety of the description herein. It will also be understood by one of ordinary skill in the art that each of these aspects may be used in various combinations with the other aspects provided herein.

[0218] The following examples further illustrate aspects of the disclosure, but, of course, should not be construed as in any way limiting its scope.EXAMPLE 1

[0219] This example demonstrates the development of expression vectors encoding Vesiculovirus Indiana G glycoprotein (VSIV-G) constructs with reduced low density lipoprotein receptor (LDLR) binding fused to a HSC targeting molecule for use in lentivirus.

[0220] To develop a method for in vivo gene therapies and genome editing of HSCs as shown in Figure 1 A, recombinant fusion proteins comprising a VSIV-G with reduced or abolished LDLR binding fused N terminal to HSC targeting molecules, such as ligands or scFvs were developed for pseudotyping enveloped delivery vehicles as in Figure 1C. The primary HSC targets for gene editing are long term HSCs (LT-HSCs), which are capable of self-renewal (FIG. IB). One of the HSC targeting molecules selected was a ligand, stem cell factor (SCF), specifically the soluble SCF form (SEQ ID NO: 28) (FIG. ID), which binds to the tyrosine-protein kinase receptor c-KIT, also known as CD117 (FIG. IE).

[0221] Constructs were designed using a pCG-4MCl 1 expression vector with sequences encoding human SCF (hSCF) (SEQ ID NO: 28) connected via a linker (SEQ ID NO: 49) to a VSIV-G with Q substitutions at residues K47 and R354 (VSIV-G-QQ) (SEQ ID NO: 13) to reduce or abolish LDLR binding (FIG. 2A). K562 cells and K562 cells expressing c-KIT were transduced with lentivirus containing a GFP-expression cassette (SEQ ID NO: 85) pseudotyped with VSIV-G (SEQ ID NO: 9), VSIV-G-QQ (SEQ ID NO: 13) , or a recombinant fusion protein of hSCF (SEQ ID NO: 28) fused N terminal to VSIV-G-QQ (SEQ ID NO: 13) via one of the linkers shown in FIG. 2A at a multiplicity of infection (MOI)of 5. 6 days post transduction bright field (bottom) and fluorescence (top) images were taken (FIG. 2B). The number of GFP positive cells in each group were quantified and the recombinant fusion proteins of hSCF (SEQ ID NO: 28) fused N terminal to VSIV-G-QQ (SEQ ID NO: 13) via a 19 amino acid flexible linker (19aaL(F)) (SEQ ID NO: 49), 17 amino acid flexible linker (17aaL(F)) (SEQ ID NO: 50), or 15 amino acid rigid linker (15aaL(R)) (SEQ ID NO: 59) showed the highest counts in c-KIT expressing K562 cells with low counts in K562 cells (FIG. 2C). Based on these results the 19aaL(F) linker (SEQ ID NO: 49) was selected for further study in recombinant fusion proteins to fuse a HSC targeting molecule, such as a SCF ligand or an anti-c-KIT scFv, N terminal to a VSIV-G with reduced or abolished LDLR binding, such as VSIV-G-QQ (SEQ ID NO: 13), VSIV-G-QQQ (SEQ ID NO: 14), or VSIV-G with a deletion at residue K47 (VSIV-G-AK47) (SEQ ID NO: 15)) (FIG. 2D). These results suggest that an enveloped delivery vehicle, such as a lentivirus or virus like particle (VLP) pseudotyped with a recombinant protein of a HSC targeting molecule fused N terminal to a receptor blinded rhabdoviral G glycoprotein would be able to specifically target HSCs and be useful for delivering a payload, such as a gene editing system.EXAMPLE 2

[0222] This example demonstrates the targeting specificity of lentivirus pseudotyped with mixed trimers of LDLR blinded VSIV-G and recombinant fusion proteins of LDLR blinded VSIV-G fused to a HSC targeting molecule.

[0223] Experiments were performed in order to test the targeting specificity and efficacy of lentivirus pseudotyped with a recombinant fusion protein of a HSC targeting molecule fused to a LDLR blinded VSIV-G using a mixed trimer approach (FIG. 3 A). Using a mixed trimer approach packaging cells were transfected with envelope plasmids encoding a recombinant fusion protein of a HSC targeting molecule fused to a LDLR blinded VSIV-G at ratios from 1 :0 to 1 :7 with an envelope plasmid encoding LDLR blinded VSIV-G (FIG. 3B). HEK-293 packaging cells were cultured in 15 cm dishes and transfected with transfer plasmid, packaging plasmid, and envelope plasmids. 72 hours post-transfection, virus supernatant was collected and concentrated, and then used to transduce cells. 72 hours after transduction cells were imaged on CELIGO machines.

[0224] Lentivirus containing a GFP-expression cassette (SEQ ID NO: 85) pseudotyped with VSIV-G (VSV G WT) (SEQ ID NO: 9), VSIV-G-QQ (VSV G-QQ) (SEQ ID NO: 13), or a recombinant fusion protein of hSCF (SEQ ID NO: 28) fused N terminal to VSIV-G- QQQ (SEQ ID NO: 14) via a 19 amino acid linker (SEQ ID NO: 49) (hSCF-19aaL(F)-VSV G-QQQ), a recombinant fusion protein of the anti-human c-KIT scFv 2D1 (SEQ ID NOs: 87 and 88) fused N terminal to VSIV-G-QQ (SEQ ID NO: 13) via a 19 amino acid linker (SEQ ID NO: 49) alone (hacKit-2Dl-19aaL(F)) or mixed at 1 :3 ratio with VSIV-G-QQ (SEQ ID NO: 13) (1 :3 hacKit-2Dl-19aaL(F)) were produced as described above. The collected lentivirus particles were titered using p24 ELISA and quantified as shown in Table 3.Table 3

[0225] Lentiviruses were lysed in the buffer provided in the Takara Kit and the p24 ELISA was performed according to the manufacturer’s instructions and the p24 levels were then converted to TCIDso / ml. K562 cells, K562 cells expressing human c-KIT (K562-hcKit), and K562 cells expressing mouse c-KIT (K562-mcKit) were transduced with 5.43 x 107lentiviral particles per well of the lentiviruses shown in Table 3. 72 hours after transduction fluorescent images of the K562, K562-hcKit, and K562-mcKit cells were taken (FIG. 3C). The number of GFP positive cells in each group was quantified and lentiviruses pseudotyped with a recombinant fusion protein of the anti-c-KIT scFv 2D1 (SEQ ID NOs: 87 and 88) fused N terminal to VSIV-G (SEQ ID NO: 9) via the 19aaL(F) linker (SEQ ID NO: 49) showed more GFP positive cells in K562-hcKit and K562-mcKit cells than K562 cells.These results suggest that scFv HSC targeting molecules can be used in recombinant fusion proteins with a rhabdoviral G glycoprotein to target lentiviruses to HSCs. These results also show that lentiviruses in this system produced using the mixed trimer approach show targeting specificity for cells expressing c-KIT.

[0226] To further test the mixed trimer approach Jurkat cells and Jurkat cells expressing c-KIT (Jurkat-cKit) were transduced with lentiviruses containing a GFP-expression cassette (SEQ ID NO: 85) pseudotyped with VSIV-G (VSV G WT) (SEQ ID NO: 9), VSIV-G-QQQ (VSV G-QQQ) (SEQ ID NO: 14), or a recombinant fusion protein of hSCF (SEQ ID NO: 28) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) via a 19 amino acid linker (SEQ ID NO: 49) (hSCF-19aaL(F)-VSV G-QQQ) mixed at varying ratios with VSIV-G-QQQ (SEQ ID NO: 14) (1 to 0, 1 to 1, 1 to 2, 1 to 3, 1 to 4, 1 to 5, 1 to 6, or 1 to 7) at a MOI of 5. 72 hours after transduction fluorescent images of the Jurkat and Jurkat-cKit cells were taken (FIG. 3E). The GFP positive Jurkat (left bar) and Jurkat-cKit (right bar) cells transduced with each lentivirus were quantified and displayed linearly (FIG. 3F) or logarithmically (FIG. 3G). These results showed that transduction efficiency increased with a mixed plasmid approach, with diminishing increases above a 1 :3 ratio. These results suggest that the plasmid mixing approach increases transduction efficiency in this system while maintaining targeting specificity. Not wishing to be bound by theory, these results suggest that trimers of recombinant fusion protein of VSIV-G fused to targeting molecules may have reduced functionality due to steric hindrance caused by the targeting molecules. Based on these results lentiviruses produced using a mixed trimer approach with a 1 :3 ratio were used for further studies.EXAMPLE 3

[0227] This example demonstrates the targeting specificity of lentivirus pseudotyped with mixed trimers of LDLR blinded VSIV-G and recombinant fusion proteins of LDLR blinded VSIV-G fused to mutant human or mouse SCF.

[0228] To further test the targeting specificity and transduction efficiency of lentiviruses pseudotyped with recombinant fusion protein of SCF targeting molecules fused to LDLR blinded VSIV-G, lentiviruses were produced as described in Example 2. Lentiviruses were produced containing a GFP-expression cassette (SEQ ID NO: 85) pseudotyped with VSIV-G (VSV G WT) (SEQ ID NO: 9), VSIV-G-QQ (VSV G-QQ) (SEQ ID NO: 13), VSIV-G-QQQ (VSV G-QQQ) (SEQ ID NO: 14), or a recombinant fusion protein of human SCF (hSCF)(SEQ ID NO: 28), mouse SCF (mSCF) (SEQ ID NO: 30), mSCF with an alanine substitution at residue 63 (mSCF-F63A) (SEQ ID NO: 82), mSCF with substitutions N6D, D77H, K81I, V87F, L88F, and S101F (mSCF-6mut) (SEQ ID NO: 81), or mSCF with an alanine substitution at residue 63 and N6D, D77H, K81I, V87F, L88F, and S101F substitutions (mSCF-F63 A-6mut) (SEQ ID NO: 83) (mSCF), fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) via a 19 amino acid linker (SEQ ID NO: 49) alone or mixed at a 1 :3 ratio with VSIV-G-QQQ (SEQ ID NO: 14) The collected lentivirus particles were titered using p24 ELISA and quantified as shown in Table 4. Lentiviruses were lysed in the buffer provided in the Takara Kit and the p24 ELISA was performed according to the manufacturer’s instructions and the p24 levels were then converted to TCIDso / ml. Jurkat cells, Jurkat cells expressing human c-KIT (Jurkat-hcKit), and Jurkat cells expressing mouse c-KIT (Jurkat- mcKit) were transduced at a MOI of 5 with the lentiviruses shown in Table 4. 5 days after transduction fluorescent images of the Jurkat, Jurkat-hcKit, and Jurkat-mcKit cells were taken (FIG. 4A). The number of GFP positive cells in each group was quantified at normal scale (FIG. 4B) or with a cut off at 100 cells (FIG. 4C) to better visualize small numbers of GFP positive cells. These results showed that lentiviruses produced using the mixed trimer approach had increased transduction efficiency compared to lentiviruses produced without the mixed trimer approach. These results also show that all of the lentiviruses produced using the mixed timer approach were able to transduce Jurkat-hcKit cells, while the lentiviruses pseudotyped with recombinant fusion proteins with hSCF (SEQ ID NO: 28), mSCF-F63A (SEQ ID NO: 82), or mSCF-F63A-6mut (SEQ ID NO: 83) transduced fewer Jurkat-mcKit cells than the lentiviruses pseudotyped with recombinant fusion proteins with mSCF (SEQ ID NO: 30) or mSCF-6mut (SEQ ID NO: 81). These results suggest that targeting specificity of lentiviruses produced using the mixed trimer approach pseudotyped with SCF fused to VSIV- G-QQQ (SEQ ID NO: 14) could be modified by using targeting molecules from different species and mutating the targeting molecules.Table 4EXAMPLE 4

[0229] This example demonstrates the development of plasmids for the production of lentiviruses and VLPs containing a gene editing system pseudotyped with receptor blinded rhabdoviral G glycoproteins fused to a targeting molecule.

[0230] To test the efficacy of lentivirus and VLPs pseudotyped with a recombinant fusion protein of a HSC targeting molecule fused to VSIV-G with reduced or abolished LDLR binding affinity for delivering gene editing systems plasmids encoding a CAS9 gene editing system to inhibit DDX3 expression were designed (FIG. 5A). VLPs were produced by transfecting HEK293T cells with plasmids and using lentiviral machinery mediated encapsulation (FIG. 5B). To produce the VLPs plasmids encoding HIV Gag-Cas9 (SEQ IDNO: 90), plasmids encoding HIV Gag-Pol (SEQ ID NO: 91), plasmids encoding VSIV-G, and lentiviral transfer plasmids (SEQ ID NO: 89) encoding a DDX3 sgRNA (SEQ ID NO: 86), mNeon fluorescent protein (SEQ ID NO: 84), and woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) (SEQ ID NO: 72) flanked by long terminal repeats (LTR) were developed (FIG. 6A) and HEK293T cells obtained from Takara and inhouse HEK293T cells were transfected. HEK293T cells given no treatment as a negative control (-ve control), or transfected with the plasmids shown in FIG. 6A, were imaged at 24 hours post transfection (VLP-DDX3 24 hpt) or 48 hours post transfection (VLP-DDX3 48 hpt) and bright field (BF) and fluorescent (mNeon) micrographs were taken with a Nikon fluorescent microscope using a lOx objective (FIG. 6B). At 48 hours and 72 hours posttransfection VLPs were collected and clarified by a centrifugation at 500 x g for 5 minutes and then filtered through a 0.8 pm pore-size filter before undergoing ultracentrifugation at 96,000 x g for 75 minutes. The concentrated VLPs were then subjected to western blotting with anti-Cas9 and anti-VSIV-G antibodies (FIG. 6C). These results showed that the VLPs contained VSIV-G and Cas-9, both fused to Gag and cleaved. These results suggest that VLPs produced with this system will be useful for delivering gene editing systems to specific target cells, such as HSCs in vivo.EXAMPLE 5

[0231] This example demonstrates the targeting specificity of lentiviruses and VLPs containing a gene editing system pseudotyped with a recombinant fusion protein of a targeting molecule fused to VSIV-G-QQQ (SEQ ID NO: 14).

[0232] To test the targeting specificity of the VLPs produced in Example 4 HEK293T cells were transduced with 10 pL, 20 pL, or 30 pL of those VLPs containing a CAS9 gene editing system for inhibition of DDX3 (DDX3-Cas9-VLPs) and 8 pg / mL of protamine sulfate and then imaged at 24 or 48 hours post transduction and bright field (BF) and fluorescent (mNeon) micrographs were taken with a Nikon fluorescent microscope using a lOx objective (FIG. 7 A). 72 hours post-transduction DNA was extracted from the transduced cells, as well as transfected HEK293T cells, and untreated HEK293T cells as a negative control. The unconcentrated DNA and DNA concentrated using PEG-8000 or ultracentrifugation with a buffer (UC with buffer) or without (UC w / o buffer) was then amplified via PCR for DDX3. The PCR amplification for DDX3 was performed using Q5® High-Fidelity DNA polymerase (New England Biolabs, Canada) on an AppliedBiosystems™ ProFlex™ PCR system (Fisher Scientific, USA). A 25 pL PCR mix was prepared containing 1 * Q5 reaction buffer, 10 mM dNTPs, 0.5 pM forward and reverse primers (DDX3 Forward: AATTGCGGTGTGAGAGGGAG (SEQ ID NO: 105) and DDX3 Reverse: AAGTAAGGGTGCCGGTTAGC (SEQ ID NO: 106)), 0.02 units of Q5® High- Fidelity DNA polymerase, and 1 pl genomic DNA. The PCR was performed using the following program: 98°C for 30 s; 35 cycles of 98°C for 10 s, 68°C for 20 s, and 72°C for 30 s; and an additional 2 minute elongation step was used to ensure complete amplicon synthesis. The DDX3 PCR amplicons were purified using a PCR clean up kit (NEB) before restriction digestion. Purified undigested amplicons were sent for CRISPR amplicon sequencing. The DDX3 amplicons underwent restriction digest with Bstl, and were visualized with gel electrophoresis (FIG. 7B). The cells transduced with 20 pL or 30 pL of VLPs, and those concentrated by ultracentrifugation showed large undigested bands, indicating the gene editing system had successfully edited the Bstl restriction site in DDX3. The DDX3 amplicons underwent sequencing, and representative sequences are shown (FIGS. 7C and 7D). 92% of the transfected HEK293T cells showed gene editing and for the transduced HEK293T cells 28% of the in-house cells and 16% of the cells from Takara showed gene editing (FIG. 7E). These results suggest that the DDX3-Cas9-VLPs can transduce cells and successfully deliver functional gene editing systems to cells to modify targeted genes.

[0233] To test the targeting specificity of VLPs and lentiviruses containing gene editing systems, lentiviruses and VLPs were produced containing a Cas9 gene editing system targeting DDX3 and lentiviruses were produced containing an adenine base editor (ABE) gene editing system targeting BCL11 A as in Example 4 that were pseudotyped with VSIV-G (VSV G WT) (SEQ ID NO: 9), or a recombinant fusion protein of a mutant form of epidermal growth factor (EGFml23) (SEQ ID NO: 34) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) (VSV EGFml23-GQQQ), a recombinant fusion protein of hSCF (SEQ ID NO: 28) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) via a 19 amino acid flexible linker (SEQ ID NO: 49) (VSV hSCF-19aaL(F)-GQQQ), or a recombinant fusion protein of the anti-c-KIT scFv 2D1 (SEQ ID NOs: 87 and 88) fused N terminal to VSIV-G-QQ (SEQ ID NO: 13) via a 19 amino acid linker (SEQ ID NO: 49) (VSV acKit-2Dl-19aaL-GQQ), produced with the mixed trimer approach at a 1 :3 ratio with VSIV-G-QQQ (SEQ ID NO: 14) in HEK293T cells. 72 hours post-transfection the HEK293T cells were imaged and bright field (BF) and fluorescent (GFP) micrographs were taken with a Nikon fluorescentmicroscope using a lOx objective (FIGS. 8A-8C). 72 hours post-transfection VLPs and lentiviruses were collected and clarified by a centrifugation at 500 * g for 5 minutes and then filtered through a 0.8 pm pore-size filter before undergoing ultracentrifugation at 96,000 x g for 75 minutes. VLPS were then subjected to western blotting with anti-Cas9, anti -ABE, and anti-VSIV-G antibodies and antibodies for P24 and GAPDH as controls (FIG. 8D). These results showed that the transfected cells expressed VSIV-G, p24, and Cas9 or ABE.

[0234] To test the targeting specificity of these VLPs K562 cells, K562 cells expressing human epidermal growth factor receptor (K562-HuEGFR), and K562 cells expressing human c-KIT (K562-HucKit) were seeded at 2 xlO4cells per well and transduced with 2.48 xlO10VSV G WT pseudotyped DDX3-Cas9-VLPs per well, 1.67 xlO8VSV-G-QQQ + VSV EGFml23-G-QQQ pseudotyped DDX3-Cas9-VLPs per well, 1.09 xlO8VSV-G-QQQ + VSV hSCF-19aaL(F)-G-QQQ pseudotyped DDX3-Cas9-VLPs per well, or 2.84 xlO8VSV-G- QQQ + VSV acKit-2Dl-19aaL-G-QQ pseudotyped DDX3-Cas9-VLPs per well. 72 hours post-transduction the HEK293T cells were imaged and fluorescent (GFP) micrographs were taken with a Nikon fluorescent microscope using a lOx objective (FIG. 9A). These micrographs showed that K562-HuEGFR cells transduced with VSV-G-QQQ + VSV EGFml23-G-QQQ pseudotyped DDX3-Cas9-VLPs showed GFP positive cells and K562- HucKit cells transduced with VSV-G-QQQ + VSV hSCF-19aaL(F)-G-QQQ or VSV acKit- 2Dl-19aaL-G-QQ pseudotyped DDX3-Cas9-VLPs showed GFP positive cells. These results showed that DDX3-Cas9-VLPs pseudotyped with both ligand and scFv targeting molecules specifically transduce expression in cells expressing the targeted receptor. 72 hours posttransduction DNA was extracted from the transduced cells and then amplified via PCR for DDX3 (FIG. 9B). The PCR amplicon products underwent gel electrophoresis (FIG. 9C) and then were sent for sequencing. The number of edited reads (FIG. 9D) and total reads (FIG. 9E) were quantified in K562 cells (left bar), K562 cells expressing human epidermal growth factor receptor (middle bar, K562-EGF), and K562 cells expressing human c-KIT (right bar, K562-c-kit). Representative sequences of the DDX3 amplicons of K562 cells (FIG. 9F and 9G) and K562-EGF cells are shown (FIG. 91 and 9J). The percentage of insertions, deletions, and combined insertions and deletions (indels) gene edits in K562 cells (FIG. 9H) and K562- EGF cells (FIGS. (9K and 9L) were quantified. The percentage of gene editing in K562 cells (left bar), K562-EGF cells (middle bar), and K562-c-kit cells (right bar) transduced with a VLP-DDX3-CAS9 pseudotyped with VSIV-G alone (SEQ ID NO: 9) or fused to a targeting molecule was also quantified (FIG. 9K). These results showed that in K562-EGF cells geneediting only occurred when transduced by VSV-G-QQQ + VSV EGFml23-G-QQQ pseudotyped DDX3-Cas9-VLPs and in K562-c-kit cells gene editing only occurred when transduced by VSV-G-QQQ + VSV hSCF-19aaL(F)-G-QQQ pseudotyped DDX3-Cas9- VLPs. These results suggest that the VLPs of this system can selectively target cells for gene editing in vivo, and could be useful for treating genetic diseases and cancers.EXAMPLE 6

[0235] This example demonstrates the production of VLPs containing a gene editing system pseudotyped with recombinant fusion proteins of targeting molecules fused to receptor blinded rhabdoviral G glycoproteins without the use of a transfer plasmid.

[0236] To improve production of VLPs a method of VLP production without a transfer plasmid is tested (Fig. 10). Plasmids encoding the guide RNA (gRNA), rhabdoviral G glycoprotein, Gag-Pol, and Gag-Cas9 are transfected into a producer cell and viral machinery is used for VLP encapsulation. The producer cells are imaged with fluorescent microscopy to detect transfection. VLPs are collected and western blotting is performed to test for expression of the rhabdoviral G glycoprotein and Cas9. The VLPs are used to transduce target cells which are imaged with fluorescent microscopy to detect transduction. DNA is extracted from transduced cells, and PCR amplified flanking the gRNA site and is sequenced to test for gene editing.EXAMPLE 7

[0237] This example demonstrates the production of VLPs containing a CasMINI gene editing system pseudotyped with receptor blinded rhabdoviral G glycoproteins fused to a targeting molecule.

[0238] CasMINI is a smaller Cas protein than Cas9 that can be used in gene editing. Not wishing to be bound by theory a VLP could contain more CasMINI proteins than Cas9 proteins, which could increase gene editing efficiency. To produce VLPs in this system plasmids encoding Gag, Gag-pol, and Gag-Pro-Cas9 (FIG. 11 A) or encoding Gag-CasMINI, Gag-Pro, and Gag-Pro-CasMINI (FIG. 1 IB) were developed. Vero cells were transfected with the plasmid constructs shown in FIG. 11C. 72 hours post-transduction the Vero cells were imaged and bright field (left) and fluorescent micrograph images showing GFP (middle) and RFP (right) were taken with a Nikon fluorescent microscope using a lOx objective (FIG.1 ID). 72 hours post-transfection VLPs were collected and clarified by a centrifugation at500 x g for 5 minutes and then filtered through a 0.8 gm pore-size filter before undergoing ultracentrifugation at 96,000 x g for 75 minutes. The concentrated VLPs were subjected to western blotting with anti-Cas9 antibodies (Fig. 1 IE) and anti-VSIV-G antibodies (FIG.1 IF). These results showed that the VSV-G-Cas9-L, VSV-G-CasMINI-L, and VSV-GFP transfected cells expressed VSIV-G and that the VSV-G-Cas9-L transfected cells expressed Cas9.

[0239] These VLPs can be used to transduce target cells, which can be imaged with fluorescent microscopy to detect transduction. DNA can be extracted from transduced cells, PCR amplified flanking the gRNA site, and can be sequenced for gene editing testing.EXAMPLE 8

[0240] This example demonstrates the production of VLPs containing a gene editing system pseudotyped with receptor blinded rhabdoviral G glycoproteins fused to a targeting molecule using a foamy virus vector.

[0241] To improve production of VLPs a method of VLP production using foamy virus, a retrovirus within the Spumavirus genus, tested. Plasmids encoding the guide RNA (gRNA), rhabdoviral G glycoprotein, Gag-Pol, and either Gag-Cas9 or Gag-Cas9E and pegRNA are transfected into a producer cell and foamy virus machinery is used for VLP encapsulation (FIG. 12). The producer cells are imaged with fluorescent microscopy to detect transfection. VLPs are collected and western blotting is performed to test for expression of the rhabdoviral G glycoprotein and Cas9. The VLPs are used to transduce target cells which are imaged with fluorescent microscopy to detect transduction. DNA is extracted from transduced cells, and PCR amplified flanking the gRNA site and is sequenced to test for gene editing.EXAMPLE 9

[0242] This example demonstrates the development of plasmids for the production of lentiviruses pseudotyped with a recombinant fusion protein of a thrombopoietin receptor (TPO-R) targeting molecule fused to a Vesiculovirus Indiana G glycoprotein with a deletion of residue K47 (VSIV-G-AK47) and the targeting specificity of said lentiviruses.

[0243] Constructs were designed using a pCG-4MCl 1 expression vector with sequences encoding a hTPO derived ligand or peptide targeted against the hTPO-R connected via a linker (19aaL(F)) (SEQ ID NO: 49) to a VSIV-G with a deletion at residue K47(VSIV-G-AK47) (SEQ ID NO: 15) to reduce or abolish LDLR binding (FIG. 14A). Table 5 lists the hTPO-R targeting molecules and linkers used in these constructs.Table 5

[0244] Experiments were performed in order to test the targeting specificity and efficacy of lentivirus pseudotyped with a recombinant fusion protein of a hTPO-R targeting molecule fused to a LDLR blinded VSIV-G (VSIV-G-AK47) using a mixed trimer approach (FIG. 14B). Using a mixed trimer approach HEK293 packaging cells were transfected with envelope plasmids encoding a recombinant fusion protein of a hTPO-R targeting molecule from Table 5 fused to VSIV-G- AK47 (pCG-4MCl 1-hTPO ligand- 19aaL(F)-G-dK47 (SEQ ID NO: 178); pCG-4MCl 1-AF13948 rev G4S linker no C-19aaL(F)-G-dK47 (SEQ ID NO: 179); pCG-4MCl 1-AF13948 G4S no C-19aaL(F)-G-dK47 (SEQ ID NO: 180); pCG-4MCl l- AF13948 G4S no C-G-dK47 (SEQ ID NO: 181); pCG-4MCl 1-Romiplostim Gx8-G-dK47 (SEQ ID NO: 182); pCG-4MCl 1-Romiplostim Gx8 w Gx5 spacer-G-dK47 (SEQ ID NO: 183); pCG-4MCl l-aa21-184-G-dK47 (SEQ ID NO: 184); or pCG-4MCl l-aa21-184- 19aaL(F)-G-dK47 (SEQ ID NO: 185)) at ratios from 1 :0 or 1 :3 with an envelope plasmid encoding VSIV-G- AK47 (pCG-4MCl 1-VSV G-dK47 (SEQ ID NO: 177)). HEK-293 packaging cells were cultured in one or two 15 cm dishes and transfected using 1500 pLtransfection buffer, 30 pL transfection reagent, 6 pg of packaging plasmid, 6 pg of transfer plasmid, and 3 pg total of the envelope plasmid or plasmids per dish. 72 hours posttransfection, virus supernatant was collected and concentrated, and then used to transduce K562 cells, K562 cells expressing hTPO-R (K562-hcMpl), and K562 cells expressing mouse TPO-R (K562-mcMpl). 72 hours after transduction cells were imaged on CELIGO machines or underwent flow cytometry.

[0245] In one experiment K562 cells, K562-hcMpl cells, and K562-mcMpl were transduced with lentivirus containing a GFP-expression cassette (SEQ ID NO: 85) pseudotyped with VSIV-G (SEQ ID NO: 9); VSIV-G-AK47 (SEQ ID NO: 15); a recombinant fusion protein of a recombinant fusion protein of hTPO (SEQ ID NO: 161) or AF13948 rev G4S linker no C (SEQ ID NO: 170), fused N terminal to VSIV-G-AK47 (SEQ ID NO: 15), via 19aaL(F) linker (SEQ ID NO: 49) alone or mixed at a 1 :3 ratio with VSIV- G-AK47 (SEQ ID NO: 15); or a recombinant fusion protein of Rom (G)x8 (SEQ ID NO: 175) or Rom (G)x8 w (G)x5 spacer (SEQ ID NO: 176), fused N terminal to VSIV-G-AK47 (SEQ ID NO: 15) alone or mixed at a 1 :3 ratio with VSIV-G- AK47 (SEQ ID NO: 15), directly, at a multiplicity of infection (MOI) of 5. 3 days post transduction fluorescence images were taken using a 15,000 ps exposure (FIG. 15 A). The number of GFP positive cells in each group were quantified by Celigo and the lentiviruses pseudotyped by a 1 :3 ratio of mixed trimer recombinant fusion proteins of hTPO, AF13948 rev G4S linker no C, Rom (G)x8, and Rom (G)x8 w (G)x5 spacer all showed transduction in K562-hcMpl cells and lower levels of transduction in K562-mcMpl cells, suggesting that these hTPO-R targeting molecules pseudotyping the lentiviruses bind to both hTPO-R (hcMpl) and less effectively to mouse TPO-R (mcMpl) (FIG. 15B). None of the lentiviruses pseudotyped by a 1 :3 ratio of mixed trimer recombinant fusion proteins of hTPO, AF13948 rev G4S linker no C, Rom (G)x8, and Rom (G)x8 w (G)x5 spacer showed transduction in the K562 cells, suggesting the lentiviruses showed high specificity to transducing TPO-R (cMpl) and did not have any off-target binding. The lentiviruses pseudotyped by recombinant fusion proteins of hTPO, AF13948 rev G4S linker no C, Rom (G)x8, and Rom (G)x8 w (G)x5 spacer not using the mixed trimer approach showed no detectable transduction in any of the cells, except for the Rom (G)x8 and Rom (G)x8 w (G)x5 spacer pseudotyped lentiviruses which showed just detectable levels of expression in K562-hcMpl cells (FIG. 15B). These results further support the findings in Example 3, showing that lentiviruses produced using the mixed trimerapproach had increased transduction efficiency compared to lentiviruses produced without the mixed trimer approach.

[0246] In another experiment, K562 cells, K562-hcMpl cells, and K562-mcMpl were transduced with lentivirus containing a GFP-expression cassette (SEQ ID NO: 85) pseudotyped with VSIV-G (SEQ ID NO: 9); VSIV-G-AK47 (SEQ ID NO: 15); a recombinant fusion protein of one of the hTPO-R targeting molecules shown in Table 5 fused N terminal to VSIV-G-AK47 (SEQ ID NO: 15), directly or via a 19aaL(F) linker (SEQ ID NO: 49) alone or mixed at a 1 :3 ratio with VSIV-G-AK47 (SEQ ID NO: 15), at a concentration of 1000 lentiviral particles per cell. 3 days post transduction fluorescence images were taken using a 15 ms exposure (FIG. 16A). The percentage of GFP positive cells and median fluorescence intensity (MFI) in each group were quantified by Celigo and the lentiviruses pseudotyped with a 1 :3 ratio of mixed trimer recombinant fusion proteins of hTPO-R targeting molecules showed almost 100% transduction in K562-hcMpl cells and approximately 80% to 95% transduction in K562-mcMpl cells, suggesting that these hTPO-R targeting molecules pseudotyping the lentiviruses bind to both human TPO-R (hcMpl) and mouse TPO-R (mcMpl) (FIG. 16B). However, the MFI in the K562-hcMpl cells transduced by lentiviruses pseudotyped with a 1 :3 ratio of mixed trimer recombinant fusion proteins of hTPO-R targeting molecules was several orders of magnitude higher than in the similarly transduced K562-mcMpl cells, suggesting that more of the cargo, i.e. the GFP expression cassette, was delivered when targeting hTPO-R (hcMpl) compared to mouse TPO-R (mcMpl). The lentiviruses pseudotyped by a 1 :3 ratio of mixed trimer recombinant fusion proteins of hTPO-R targeting molecules showed much lower transduction in the K562 cells, approximately 10% to 15%, suggesting the lentiviruses showed high specificity to transducing TPO-R (cMpl) and had minimal off target binding. The lentiviruses pseudotyped by recombinant fusion proteins of hTPO-R targeting molecules not using the mixed trimer approach showed no detectable transduction in any of the cells, except for the AF13948 G4S no C with and without 19aaL(F) linker pseudotyped lentiviruses which showed less than 10% transduction, demonstrating further support that lentiviruses produced using the mixed trimer approach demonstrate increased transduction efficiency compared to lentiviruses produced without the mixed trimer approach.

[0247] To further test the efficacy of different AF13948 variants, K562 cells, K562- hcMpl cells, and K562-mcMpl were transduced with lentivirus containing a GFP-expression cassette (SEQ ID NO: 85) pseudotyped with VSIV-G (SEQ ID NO: 9); VSIV-G-AK47 (SEQID NO: 15); a recombinant fusion protein of the hTPO-R targeting molecule AF13948 with no cysteine residues and two G4S linkers (G4Sx2), three G4S linkers (G4Sx3), two reverse G4S linkers (rev G4Sx2), or three reverse G4S linkers (rev G4Sx3) fused N terminal to VSIV-G-AK47 (SEQ ID NO: 15) alone or mixed at a 1 :3 ratio with VSIV-G-AK47 (SEQ ID NO: 15), at a concentration of 1000 lentiviral particles per cell. 3 days post transduction fluorescence images were taken using a 15 ms exposure (FIG. 17A). The number of GFP positive cells in each group was quantified by Celigo and the lentiviruses pseudotyped with a 1 :3 ratio of mixed trimer recombinant fusion proteins of AF13948 with no cysteine residues and different G4S linker numbers and orientations all showed high numbers of transduced K562-hcMpl cells (approximately 40,000-45000) and even higher numbers of transduced K562-mcMpl cells (approximately 45,000-50,000), suggesting that these AF13948 variants pseudotyping the lentiviruses bind to both human TPO-R (hcMpl) and mouse TPO-R (mcMpl) (FIG. 17B). The lentiviruses pseudotyped by a 1 :3 ratio of mixed trimer recombinant fusion proteins of AF13948 variants showed much lower numbers of transduced K562 cells, approximately 10,000 cells, suggesting the lentiviruses showed specificity to transducing TPO-R (cMpl) with minimal off target binding. The lentiviruses pseudotyped by recombinant fusion proteins of hTPO-R targeting molecules not using the mixed trimer approach showed low levels of transduced K562 cells, K562-hcMpl cells, and K562-mcMpl cells (less than 500 cells), except for the AF13948 variants with two G4S linkers and three G4S linkers, which showed approximately 2500 transduced K562-hcMpl cells and approximately 4000 transduced K562-hcMpl cells, respectively (FIG. 17C).

[0248] These results suggest that an enveloped delivery vehicle, such as a lentivirus or virus like particle (VLP) pseudotyped with a recombinant protein of a hTPO-R targeting molecules fused N terminal to a receptor blinded rhabdoviral G glycoprotein would be able to specifically target HSCs and be useful for delivering a payload.EXAMPLE 10

[0249] This example demonstrates the targeting specificity of lentivirus pseudotyped with mixed trimers of LDLR blinded VSIV-G and recombinant fusion proteins of LDLR blinded VSIV-G fused to human SCF, mouse SCF, or human anti-c-KIT scFv targeting molecules in bone marrow derived human CD34 positive (CD34+) cells.

[0250] Experiments were performed in order to test the targeting specificity and efficacy of lentivirus containing a GFP cassette (SEQ ID NO: 85) and pseudotyped using a mixed trimer approach at a ratio of 1 :3 with a recombinant fusion protein of a c-KIT targeting molecule fused to a LDLR blinded VSIV-G (VSIV-G-QQQ) and blinded VSIV-G (VSIV-G- QQQ) (SEQ ID NO: 14) in bone marrow derived human CD34+ cells. On day 0 of the protocol, the CD34+ cells were initially expanded in SFEM II media supplemented with StemSpan CD34+ Expansion Supplement for 3 days. After the 3-day expansion cells were washed with plain media and switched to media supplemented with rh-TPO and rh-Flt3L only for 1 day to “starve” cells of rhSCF and avoid competition for binding to c-KIT with the retargeted lentiviruses. On day 5, after 1 day of SCF “starvation” 5e4 cells per well were transduced with 25 pL (acKit-2Dl and mSCF pseudotyped lentiviruses) or 50pL (hSCF pseudotyped lentivirus) of lentiviruses in a 100 pL volume in the presence of rh-TPO and rh- Flt3L only. On day 6, 1-day post-transduction, rhSCF was added back to cells in 100 pL of media containing rhSCF, rh-TPO, and rh-FLt3L (FIG. 18 A). On day 8 the CD34+ cells underwent analysis by flow cytometry for eGFP expression (FIGS. 18B and 18C).

[0251] The flow cytometry results showed that untransduced control CD34+ cells and CD34+ cells treated with lentivirus pseudotyped with VSIV-G (VSV G-WT) (SEQ ID NO: 9); VSIV-G-QQQ (VSV G-QQQ) (SEQ ID NO: 14); a 1 :3 ratio mix of a recombinant fusion protein of hSCF (SEQ ID NO: 28) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) via a linker (19aaL(F)) (SEQ ID NO: 49) and VSIV-G-QQQ (SEQ ID NO: 14) (1 :3 hSCF-19aaL(F)-VSV-G-QQQ), and untransduced cells had over 80% live cells, while the CD34+ cells transduced with lentivirus pseudotyped with a 1 :3 ratio mix of a recombinant fusion protein of mSCF (SEQ ID NO: 30) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) via a linker (19aaL(F)) (SEQ ID NO: 49) and VSIV-G-QQQ (SEQ ID NO: 14) (1 :3 mSCF-19aaL(F)-VSV-G-QQQ) or a 1 :3 ratio mix of a recombinant fusion protein of antihuman c-KIT scFv 2D1 (SEQ ID NOs: 87 and 88) fused N terminal to VSIV-G-QQQ (SEQ ID NO: 14) via a linker (19aaL(F)) (SEQ ID NO: 49) and VSIV-G-QQQ (SEQ ID NO: 14) (1 :3 h-acKit-2Dl-scFV-19aaL(F)-VSV G-QQQ) had approximately 30% live cells (FIG. 18D). The CD34+ cells treated with the 1 :3 hSCF-19aaL(F)-VSV-G-QQQ or 1 :3 mSCF- 19aaL(F)-VSV-G-QQQ pseudotyped lentivirus showed transduction as measured by the percentage of GFP+ cells, approximately 5%. The CD34+ cells treated with the 1 :3 h-acKit- 2Dl-scFV-19aaL(F)-VSV G-QQQ pseudotyped lentivirus did not show detectable transduction. Previous studies have reported that the 2D1 scFv inhibit viability in blood cellsby inhibiting c-KIT dependent growth and (US Patent 9,932,410). Therefore, the 1 :3 h- acKit-2Dl-scFV-19aaL(F)-VSV G-QQQ pseudotyped lentivirus may have transduced CD34+ cells and killed those cells making them undetectable by flow cytometry.

[0252] To further test the targeting specificity and efficacy of lentivirus containing a GFP cassette (SEQ ID NO: 85) and pseudotyped using a mixed trimer approach at a ratio of 1 :3 with a recombinant fusion protein of a c-KIT targeting molecule fused to a LDLR blinded VSIV-G (VSIV-G-QQQ) (SEQ ID NO: 14) and blinded VSIV-G (VSIV-G-QQQ) (SEQ ID NO: 14) in bone marrow derived human CD34+ cells additional experiments were performed with the following modified culturing and transduction conditions. 5e4 CD34+ cells were thawed and initially expanded in 200 pL SFEM II media supplemented with rhTPO, rhFlt3L, and rhIL6 cytokines and on day 1 transduced with 1E9 lentiviral particles, as determined by p24 ELISA for each lentivirus, without recombinant hSCF in the media to avoid competition for binding with the retargeted lentiviruses, while other recombinant proteins remain in the culture. On day 2 a half media change was performed replacing 100 pL SFEM II media supplemented with rhSCF, rhTPO, rhFlt3L, and rhIL6 (FIG. 19A). On day 4 the CD34+ cells underwent analysis by fluorescent imaging with Celigo and flow cytometry for eGFP expression (FIG. 19B). The flow cytometry results showed that the CD34+ cells treated with the 1 :3 hSCF-19aaL(F)-VSV-G-QQQ or 1 :3 mSCF-19aaL(F)-VSV-G-QQQ pseudotyped lentivirus showed transduction, approximately 5% (FIG. 19C).

[0253] These results suggest that an enveloped delivery vehicle, such as a lentivirus or virus like particle (VLP) pseudotyped with a recombinant protein of a c-KIT targeting molecule fused N terminal to a receptor blinded rhabdoviral G glycoprotein would be able to specifically target human HSCs and be useful for ex vivo applications.EXAMPLE 11

[0254] This example demonstrates the targeting specificity of lentivirus pseudotyped with mixed trimers of LDLR blinded VSIV-G and recombinant fusion proteins of LDLR blinded VSIV-G fused to human anti-c-KIT and / or hTPO-R targeting molecules in bone marrow derived human CD34+ cells.

[0255] Experiments were performed to test the targeting specificity and efficacy of lentivirus containing a GFP cassette (SEQ ID NO: 85) and pseudotyped using a mixed trimer approach at a ratio of 1 :3, 1 :5, 1 :7, or 1 : 11 with a recombinant fusion protein of a c-KITtargeting molecule (hSCF) (SEQ ID NO: 28) or a hTPO-R targeting molecule (romiplostim) (SEQ ID NO: 182) targeting molecule fused to a LDLR blinded VSIV-G (VSIV-G-QQQ) (SEQ ID NO: 14) and blinded VSIV-G (VSIV-G-QQQ) (SEQ ID NO: 14) or pseudotyped using a multiplexed mixed trimer approach at a ratio of 0.5:0.5:3 with a recombinant fusion protein of a c-KIT targeting molecule (hSCF) (SEQ ID NO: 28) fused to a LDLR blinded VSIV-G (VSIV-G-QQQ) (SEQ ID NO: 14), a recombinant fusion protein of a TPO-R targeting molecule (romiplostim) (SEQ ID NO: 182) fused to a LDLR blinded VSIV-G (VSIV-G-QQQ) (SEQ ID NO: 14), and blinded VSIV-G (VSIV-G-QQQ) (SEQ ID NO: 14) in bone marrow derived human CD34+ cells additional experiments with additional modifications to the culturing conditions. 4e4 CD34+ cells were thawed and initially expanded in 100 pL SFEM II media alone (Condition 1) or supplemented with rhTPO, rhFlt3L, and rhIL6 cytokines (Condition 2) and on day 1 transduced with 1E9 lentiviral particles, as determined by p24 ELISA for each lentivirus. On day 2, an additional 100 pL of SFEM II media supplemented with either rhSCF and rhTPO (Condition 1) or rhSCF, rhTPO, rhFlt3L, and rhIL6 (Condition 2) was added to the culture (FIG. 20). On day 4 the CD34+ cells underwent analysis by fluorescent imaging with Celigo and flow cytometry for eGFP expression (FIGS. 21A-21F).

[0256] The flow cytometry results showed that the CD34+ cells treated with lentivirus pseudotyped with the 1 :3 to 1 : 11 ratio mix of recombinant hSCF-VSV-G-QQQ and VSV-G- QQQ had comparable levels of transduction, approximately 4%-7% in Condition 1 and approximately 6%-9% in Condition 2 (FIG. 22). These results further support the efficacy of the mixed trimer approach and suggest that the presence of certain cytokines may inhibit transduction. The CD34+ cells treated with lentivirus pseudotyped with a 1 :3 ratio mix of recombinant romiplostim fused to VSV-G-QQQ and VSV-G-QQQ (1 :3 hTPO Rom.:G- QQQ) showed low but detectable levels of transduction in both conditions with higher levels in Condition 2. The CD34+ cells treated with lentivirus pseudotyped with a multiplexed 0.5:0.5:3 ratio mix of recombinant hSCF- fused to VSV-G-QQQ, recombinant romiplostim fused to VSV-G-QQQ or an empty vector control of pcDNA3.1, and VSV-G-QQQ showed similar levels of transduction of approximately 5% in Condition 1 and approximately 6% in Condition 2.EXAMPLE 12

[0257] This example demonstrates the transduction of lentivirus pseudotyped with mixed trimers of LDLR blinded VSIV-G and recombinant fusion proteins of LDLR blinded VSIV- G fused to mouse SCF in mouse whole bone marrow cells (BMCs) and in vivo.

[0258] Experiments were performed in order to test the targeting specificity and efficacy of lentivirus containing a GFP cassette (SEQ ID NO: 85) and pseudotyped using a mixed trimer approach at a ratio of 1 :3 with a recombinant fusion protein of mSCF (SEQ ID NO: 30) molecule fused to a LDLR blinded VSIV-G (VSIV-G-QQQ) (SEQ ID NO: 14) via a 19 amino acid long flexible linker (SEQ ID NO: 49) and blinded VSIV-G (VSIV-G-QQQ) (SEQ ID NO: 14) (1 :3 mSCF-19aaL(F)-VSV G-QQQ: VSV G-QQQ) in mouse whole bone marrow cells (BMCs) to assess in vivo feasibility.

[0259] Whole BMCs were isolated from C57BL / 6 mice and 2e6 BMCs were transduced with 200 pL of lentiviruses containing a GFP cassette (SEQ ID NO: 85) and pseudotyped with VSV G-WT (SEQ ID NO: 9), VSV G-QQQ (SEQ ID NO: 14), or 1 :3 mSCF-19aaL(F)- VSV G-QQQ: VSV G-QQQ in 1 mL of SFEM II media supplement with rmTPO, rmFlt3L, and rmIL7 but without recombinant mSCF (rmSCF) in the media to avoid competition for binding with the retargeted lentivirus, while other recombinant proteins remain in the culture. On day 2 an additional 1 mL of SFEM II media supplemented with rmSCF, rmTPO, rmFlt3L, and rmIL7 was added to the culture (FIG. 23 A). On day 4 the CD34+ cells underwent analysis by flow cytometry for eGFP expression and le4 cells were seeded for a colony forming unit (CFU) assay. In a CFU assay cells are cultured in semi-solid media and, if they are capable of proliferation and differentiation, which for BMCs indicates their potential as either hematopoietic stem or progenitor cells, the cells will form colonies. On day 14 the CFU assays underwent fluorescent imaging for colony detection (FIG 23B). These results showed that the lentiviruses retargeted to c-KIT by pseudotyping with a recombinant fusion protein of mSCF fused to VSV G-QQQ are capable of transducing mouse whole BMCs. Further the CFU assay results show that the transduced cells are capable of colony formation, indicating that the retargeted lentivirus transduced cells with differentiation potential, e.g. hematopoietic stem and progenitor cells, within the bone marrow cells.

[0260] Further experiments were performed to test the targeting specificity and efficacy of the redirected lentiviruses in vivo using CRE reporter mice in HSC mobilized and HSC non-mobilized conditions. Immunocompetent CRE reporter mice (Ail4 CRE tdTomato)were used to test lentiviruses containing CRE recombinase (SEQ ID NO: 186) (FIG. 24A). The CRE reporter mice were Ail4 mice (B6.Cg-Gt(ROSA)26Sortml4(CAG-tdTomato) Hze / J; strain number: #007914, 4 weeks old) purchased from Jackson Lab. HSC mobilization treatment was carried out to mobilize the stem cells from bone marrow to systemic circulation, hoping that this will increase the probability of interaction of lentiviral vectors with hematopoietic stem cells (Li et al., “In vivo base editing by a single i.v. vector injection for treatment of hemoglobinopathies,” JCI Insight, 7(19): el 62939 (2022)). Each mouse in the HSC mobilized group were administered four doses of 5 pg G-CSF (Granulocyte colony stimulating factor) once each day for the four days prior to the lentivirus treatment, followed by a single dose of 100 pg plerixafor on day 0, 80 minutes before lentivirus treatment. 5e9 lentiviral particles of lentivirus containing CRE recombinase (SEQ ID NO: 186) and pseudotyped with VSIV-G WT (SEQ ID NO: 9) (WT-G-LV-CRE), VSIV-G-QQQ (SEQ ID NO: 14) (Gqqq-LV-CRE), EGFml23 (SEQ ID NO: 34) (mEGF123 Gqqq-LV-CRE) or a 1 :3 mix of recombinant protein of anti-human c-KIT scFv 2D1 (anti CD117) (SEQ ID NOs: 87 and 88), mSCF (SEQ ID NO: 30), or hSCF (SEQ ID NO: 28) fused to VSIV-G-QQQ (SEQ ID NO: 14) and VSIV-G-QQQ (SEQ ID NO: 14) (aCD117 1 :3 Gqqq-LV-CRE, mSCF-l:3 Gqqq -LV- CRE, or hSCF-1 :3 Gqqq -LV-CRE) were injected intravenously on day 0 in 200 pL PBS to mice in both the HSC mobilized and HSC non-mobilized treatment groups. Mice were further sorted into groups based on the lentivirus treatment they received as shown in Table 6. The body weight of each mouse was measured three times a week, and mice were monitored for any clinical signs of toxicity. On day 7, one mouse from each group was sacrificed for correlative analysis (FIG. 24B). On days 17, 27, 62, and 88 blood samples were collected from each mouse in MiniCollect 0.5 mL K2EDTA tubes (Greiner Bio-One, catalog number 450532) from the submandibular vein, and used for flow cytometry and FACS analysis of tdTomato+ cells (FIGS. 25A-25F). On day 89 the mice were sacrificed and tissue samples were collected for immunostaining (FIG. 24C).Table 6Number of mice used in LV Transduction Efficacy ExperimentsLentivirus Toxicity Analysis

[0261] No severe weight loss was seen in any of the experimental groups, indicating that there was no evidence of any adverse effects on the general health of the mice or systemic toxicity that could be attributed to the administration of the lentiviruses (FIG. 24D).Flow Cytometry Analysis

[0262] Flow cytometry analysis of tdTomato expression in blood samples revealed the presence of tdTomato+ cells on multiple days following lentiviral (LV) delivery (FIG. 24E). These flow cytometry results were an indirect measurement of HSC targeting as transduced HSCs and their progeny become tdTomato+. Notably, the mice treated with the mSCF retargeted lentivirus (mSCF-l :3-Gqqq-LV-CRE) had more tdTomato+ cells (approximately 0.12 - 0.40%), suggesting successful transduction and recombination via SCF retargeting (FIG. 24F). The percentage of tdTomato+ cells gradually increased over time in all three of the mSCF-l :3-Gqqq-LV-CRE treated mice, suggesting a progressive expansion of transduced HSCs and their progenies. Flow cytometry was used to further characterize the transduced cells in the mSCF-1 :3-Gqqq-LV-CRE (FIGS. 26A and 26B). Phenotypic characterization of tdTomato+ cells revealed a mixed population of myeloid and lymphoid cells on day 62, while by day 88, nearly all tdTomato+ cells belonged to the lymphoid lineage.Histopathological and immunohistochemistry analysis

[0263] Tissue samples from sacrificed mice were fixed in 10% neutral buffered formalin (NBF). After 48 hours, the NBF was replaced with DPBS. Tissue samples were sent for paraffin embedding and sectioning. Paraffin-embedded blocks were sent for tdTomato immunostaining and immunofluorescence (IF) assay as shown in Table 7.Table 7Tissue Collection Information

[0264] tdTomato immunostaining of HSC mobilized mice sacrificed on day 7 show no detection of transduced cells in the heart or kidney for mice treated with lentivirus pseudotyped with VSIV-G (LV-Gwt-CRE), VSIV-G-QQQ (Untargeted LV-Gqqq-CRE), or a 1:3 mix of recombinant mSCF-VSIV-G-QQQ and VSIV-G-QQQ (Mouse SCF retargeted LV-Gqqq-CRE) (FIGS. 27C and 27D). Only the Mouse SCF retargeted LV- Gqqq-CRE treated mice showed transduction in the bone marrow and morphological analysis suggests that macrophages, endothelial cells, and HSCs were transduced (FIG. 27A). Mice treated with LV-Gwt-CRE, Untargeted LV-Gqqq-CRE, or Mouse SCF retargeted LV-Gqqq-CRE all showed transduction in the spleen and morphologicalanalysis suggested macrophages had been transduced by all three lentiviruses and that the mSCF retargeted lentivirus also transduced endothelial cells in the spleen (FIG 27B). Immunostaining and morphological analysis of immunostaining in the liver of both HSC mobilized and HSC non-mobilized mice treated with LV-Gwt-CRE showed transduction of hepatocytes and macrophages and the liver of mice treated with the mSCF retargeted lentivirus showed transduction of hepatic sinusoidal endothelial cells (HSECs) (FIG. 28A-28D). This result suggests that the mechanism of mSCF lentivirus targeting the HSEC may be different than the HSC targeting mechanism. These results suggest that the mSCF retargeted lentivirus was specifically targeted to endothelial cells in the liver, spleen, and bone marrow and to HSCs in the bone marrow.Colony Forming Unit (CFU) Assay

[0265] BMCs were collected from mice on day 7 and 88 and sorted using flow cytometry for tdTomato+ cells and then either immediately seeded for culturing (FIGS. 29A and 29B) or incubated in a lineage cocktail and then sorted into lineage negative cells (HSC like cells) (FIGS. 30A and 30B) or lineage positive (differentiated cells) (FIGS. 31A and 3 IB) and then cultured for CFU assay with le4 or 2e4 cells as shown in Table 7. Only the mSCF retargeted lentivirus showed tdTomato positive cells. The CFU assay for the day 7 HSC mobilized and non-mobilized cells showed no colony formation in in non-mobilized cells the lineage positive cells, which are CD1 lb+ (FIG. 32A). However, the HSC mobilized lineage negative cells did show colony formation (FIGS. 32A and 32B). The CFU assay for the day 88 HSC mobilized and non-mobilized cells showed no colony formation in non-mobilized cells or in the lineage positive cells (FIG. 33B). However, the HSC mobilized lineage negative cells did show colony formation (FIG. 33B). These results suggest that transduction of cells in vivo by the SCF retargeted lentivirus does not affect the proliferative ability of the cell. Additionally, the results of the day 88 CFU assay suggest that the SCF retargeted lentivirus transduced LT- HSCs in vivo.

[0266] These results suggest that an enveloped delivery vehicle, such as a lentivirus or virus like particle (VLP) pseudotyped with a recombinant protein of a c-KIT targeting molecule fused N terminal to a receptor blinded rhabdoviral G glycoprotein would be able to specifically target human HSCs and be useful for in vivo applications.Table 7CFU Assay Treatments

[0267] All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein.

[0268] The use of the terms “a” and “an” and “the” and “at least one” and similar referents in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The use of the term “at least one” followed by a list of one or more items (for example, “at least one of A and B”) is to be construed to mean one item selected from the listed items (A or B) or any combination of two or more of the listed items (A and B), unless otherwise indicated herein or clearly contradicted by context. The terms “comprising,” “having,” “including,” and “containing” are to be construed as open-ended terms (i.e., meaning “including, but not limited to,”) unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”) provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.

[0269] Preferred embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possiblevariations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.SEQUENCESIll

Claims

CLAIMS:

1. A recombinant fusion protein comprising (a) a rhabdoviral G glycoprotein or a functional fragment or derivative thereof and (b) a targeting molecule, wherein the targeting molecule targets the recombinant fusion protein to a hematopoietic stem cell (HSC).

2. The recombinant fusion protein of claim 1, wherein the HSC is a long-term HSC.

3. A recombinant fusion protein comprising (a) a rhabdoviral G glycoprotein or a functional fragment or derivative thereof and (b) a targeting molecule, wherein the targeting molecule targets the recombinant fusion protein to a hepatic sinusoidal endothelial cell (HSEC).

4. A recombinant fusion protein comprising (a) a rhabdoviral G glycoprotein or a functional fragment or derivative thereof and (b) a targeting molecule, wherein the targeting molecule comprises: (1) stem cell factor (SCF), (2) an anti-c-KIT binding domain, (3) thrombopoietin (TPO), (4) epidermal growth factor (EGF), or (5) a functional fragment or derivative of (1), (2), (3) or (4).

5. The recombinant fusion protein of claim 4, wherein the targeting molecule comprises: SCF or a functional fragment or derivative thereof.

6. The recombinant fusion protein of claim 5, wherein the SCF has a substitution ofF63A.

7. The recombinant fusion protein of claim 5 or 6, wherein the SCF has a 6mut substitution.

8. The recombinant fusion protein of claim 5, wherein the SCF has a substitution of N6D, D77H, K81I, V87F, L88F, and / or S101F.

9. The recombinant fusion protein of claim 4, wherein the targeting molecule comprises: an anti-c-KIT binding domain or a functional fragment or derivative thereof.

10. The recombinant fusion protein of claim 4, wherein the targeting molecule comprises: TPO or a functional fragment or derivative thereof.

11. The recombinant fusion protein of claim 4, wherein the targeting molecule comprises: EGF or a functional fragment or derivative thereof.

12. The recombinant fusion protein of any one of claims 1-11, wherein the targeting molecule is N-terminal to the rhabdoviral G glycoprotein or functional fragment or derivative thereof.

13. The recombinant fusion protein of any one of claims 1-12, wherein the recombinant fusion protein comprises a linker between the targeting molecule and the rhabdoviral G glycoprotein or functional fragment or derivative thereof.

14. The recombinant fusion protein of claim 13, wherein the linker is flexible.

15. The recombinant fusion protein of claim 14, wherein the linker isAAASGGSGGGGSGGGGSGP (SEQ ID NO: 49),AAASGGSGGGGSGGGGS (SEQ ID NO: 50),GGGGSGGGGSGGGGSGGGGS (SEQ ID NO: 51),GGGGSGGGGSGGGGS (SEQ ID NO: 17),GGGGSGGGGS (SEQ ID NO: 52),GGGGS (SEQ ID NO: 53),GGGGGGGG (SEQ ID NO: 54),GGGGGG (SEQ ID NO: 55),GSAGSAAGSGEF (SEQ ID NO: 56), andVPGVGVPGVG (SEQ ID NO: 57).

16. The recombinant fusion protein of claim 13, wherein the linker is rigid.

17. The recombinant fusion protein of claim 16, wherein the linker isPAPAP (SEQ ID NO: 58),EAAAKEAAAKEAAAK (SEQ ID NO: 59),EAAAKEAAAK (SEQ ID NO: 60),EAAAK (SEQ ID NO: 61), AEAAAKEAAAKEAAAKEAAAKALEAEAAAKEAAAKEAAAKEAAAKA (SEQ ID NO: 62),AEAAAKEAAAKA (SEQ ID NO: 63),ESKYGPPCPPCP (SEQ ID NO: 64),CPPCPAPELLGGPSVF (SEQ ID NO: 65), and alanine-proline (AP) repeated for a total of 10 to 34 amino acids (SEQ ID NO: 66).

18. The recombinant fusion protein of any one of claims 1-17, wherein the rhabdoviral G glycoprotein or functional fragment or derivative thereof is of a Flanders virus glycoprotein (FLAV-G) (SEQ ID NO: 1), a Chandipura virus glycoprotein (CHPV-G) (SEQ ID NO: 2), a Perinet virus glycoprotein (PERV-G) (SEQ ID NO: 3), a Piry virus glycoprotein (PIRYV-G) (SEQ ID NO: 4), a Fukuoka virus glycoprotein (FUKV-G) (SEQ ID NO: 5), a Joinjakaka virus glycoprotein (JOIV-G) (SEQ ID NO: 6), a Kumasi virus glycoprotein (KRV-G) (SEQ ID NO: 7), a Keuraliba virus glycoprotein (KEUV-G) (SEQ ID NO: 8), an Isfahan glycoprotein (ISFV-G), a Jurona glycoprotein (JURV-G), a Mediterranean Bat glycoprotein (MBV-G), a Malpais Spring glycoprotein (MSPV-G), a Radi glycoprotein (RADV-G), a Rhinolophus affinis-G, a Yug Bugdanavoc glycoprotein (YBV-G), a Yinshui Bat glycoprotein (YSBV-G), a Kimberley glycoprotein (KIMV-G), a Kanyawara glycoprotein (KYAV-G), a La Joya glycoprotein (LJV-G), a Mosquiero glycoprotein (MQOV-G), a Parry Creek glycoprotein (PCV-G), a Bas Congo glycoprotein (BASV-G), aBovine Ephemeral fever glycoprotein (BEFV-G), a Curionopolis glycoprotein (CURV-G), a Drosophila melanogaster sigmavirus glycoprotein (DMelSV-G), a Niakha glycoprotein (NIAV-G), a Puerto almandras glycoprotein (PTAMV-G), or a Tupaia rhabdovirus (TUPTV- G).

19. The recombinant fusion protein of any one of claims 1-17, wherein the rhabdoviral G glycoprotein or functional fragment or derivative thereof is of a Vesiculovirus glycoprotein or a functional fragment or derivative thereof.

20. The recombinant fusion protein of any one of claims 1-17, wherein the rhabdoviral G glycoprotein or functional fragment or derivative thereof is of Vesiculovirus Indiana, Vesiculovirus newjersey, Vesiculovirus carajas, or Vesiculovirus alagoas.

21. The recombinant fusion protein of claim 20, wherein the rhabdoviral G glycoprotein or functional fragment or derivative thereof is of Vesiculovirus indiana (SEQ ID NO: 9).

22. The recombinant fusion protein of claim 20, wherein the rhabdoviral G glycoprotein or functional fragment or derivative thereof is of Vesiculovirus newjersey (SEQ ID NO: 10).

23. The recombinant fusion protein of any one of claims 1-22, wherein the rhabdoviral G glycoprotein is a functional fragment or derivative thereof.

24. The recombinant fusion protein of claim 23, wherein the cytoplasmic tail of the glycoprotein is truncated, deleted, or replaced with another sequence.

25. The recombinant fusion protein of any one of claims 1-22, wherein the rhabdoviral G glycoprotein is substantially intact.

26. The recombinant fusion protein of any one of claims 1-25, wherein the rhabdoviral G glycoprotein is engineered to reduce or abolish its natural receptor binding specificity.

27. The recombinant fusion protein of claim 26, wherein the rhabdoviral G glycoprotein is engineered to have a mutation to reduce or abolish its natural receptor binding specificity.

28. The recombinant fusion protein of claim 27, wherein the rhabdoviral G glycoprotein comprises a mutation at one or more positions corresponding to H8, K47, Y209, and K354 on the Vesiculovirus Indiana glycoprotein (SEQ ID NO: 9).

29. The recombinant fusion protein of claim 27 or 28, wherein the mutation is a substitution.

30. The recombinant fusion protein of claim 29, wherein the substitution is with a Q31. The recombinant fusion protein of any one of claims 27-30, wherein the mutation is a substitution at two or more positions.

32. The recombinant fusion protein of claim 27 or 28, wherein the mutation is a deletion.

33. The recombinant fusion protein of claim 32, wherein the mutation is a single deletion at the position corresponding to K47 on the Vesiculovirus indiana glycoprotein (SEQ ID NO: 9).

34. The recombinant fusion protein of any one of claims 1-33, wherein the recombinant fusion protein is inactivated to a lesser degree by serum, LDL, or vLDL compared to a rhabdoviral G glycoprotein without the targeting molecule.

35. The recombinant fusion protein of any one of claims 1-34, wherein the recombinant fusion protein comprises a signal peptide N-terminal to the targeting molecule.

36. The recombinant fusion protein of claim 35, wherein the signal peptide comprises the amino acid sequence of SEQ ID NO: 60.

37. The recombinant fusion protein of claim 35 or 36, wherein the signal sequence is cleaved off.

38. A membraned vesicle comprising the recombinant fusion protein of any one of claims 1-37.

39. The membraned vesicle of claim 38, wherein the vesicle is a gesicle or an exosome.

40. The membraned vesicle of claim 38 or 39, wherein the membraned vesicle comprises a mixed trimer, wherein the mixed trimer comprises (a) at least one of the recombinant fusion protein, and (b) at least one rhabdoviral G glycoprotein or functional fragment or derivative thereof that is not within a fusion protein.

41. The membraned vesicle of any one of claims 38-40, wherein the membraned vesicle comprises an unmixed trimer, wherein the unmixed trimer comprises only rhabdoviral G glycoprotein or a functional fragment or derivative thereof that is not within a fusion protein.

42. The membraned vesicle of any one of claims 38-41, wherein the membraned vesicle comprises the maximum number of the recombinant fusion proteins possible to be accommodated within the membrane of the membraned vesicle.

43. The membraned vesicle of any one of claims 38-42, wherein the membraned vesicle comprises at least two recombinant fusion proteins, each recombinant fusion protein comprising (a) a rhabdoviral G glycoprotein or a functional fragment or derivative thereof and (b) a targeting molecule, and wherein the at least two recombinant fusion proteins have different targeting moieties.

44. The membraned vesicle of any one of claims 38-43, wherein the membraned vesicle comprises a gene editing system.

45. The membraned vesicle of claim 44, wherein the gene editing system comprises Cas9 or CasMINI.

46. An enveloped viral particle comprising the recombinant fusion protein of any one of claims 1-37.

47. The enveloped viral particle of claim 46, wherein the enveloped viral particle comprises a mixed trimer, wherein the mixed trimer comprises (a) at least one of the recombinant fusion protein, and (b) at least one rhabdoviral G glycoprotein or functional fragment or derivative thereof that is not within a fusion protein.

48. The enveloped viral particle of claim 46 or 47, wherein the enveloped viral particle comprises an unmixed trimer, wherein the unmixed trimer comprises only rhabdoviral G glycoprotein or a functional fragment or derivative thereof that is not within a fusion protein.

49. The enveloped viral particle of any one of claims 46-48, wherein the enveloped viral particle comprises the maximum number of the recombinant fusion proteins possible to be accommodated within the membrane of the enveloped viral particle.

50. The enveloped viral particle of any one of claims 46-49, wherein the enveloped viral particle comprises at least two recombinant fusion proteins, each recombinant fusion protein comprising (a) a rhabdoviral G glycoprotein or a functional fragment or derivative thereof and (b) a targeting molecule, and wherein the at least two recombinant fusion proteins have different targeting moieties.

51. The enveloped viral particle of any one of claims 46-50, wherein the enveloped viral particle comprises a gene editing system.

52. The enveloped viral particle of claim 51, wherein the gene editing system comprises Cas9 or CasMINI.

53. A recombinant viral vector comprising a nucleotide encapsulated by the membraned vesicle of any one of claims 38-45 or the enveloped viral particle of any one of claims 46-52.

54. A composition comprising a pharmaceutically acceptable carrier and the membraned vesicle of any one of claims 38-45, the enveloped viral particle of any one of claims 46-52, or the recombinant viral vector of claim 53.

55. A method of delivering a payload to a hematopoietic stem cell or hepatic sinusoidal endothelial cell, the method comprising contacting the target cell with the membraned vesicle of any one of claims 38-45, the enveloped viral particle of any one of claims 46-52, the recombinant viral vector of claim 53, or the composition of claim 54.

56. The method of claim 55, wherein the target cell in in vitro or ex vivo.

57. The method of claim 55, wherein the target cell in in vivo.

58. A retroviral vector expression system comprising one or more nucleotide sequences encoding the recombinant fusion protein of any one of claims 1-37.

59. The retroviral vector expression system of claim 58, wherein the retroviral vector expression system comprises a vector construct and helper constructs that are each on separate plasmids.

60. The retroviral vector expression system of claim 58 or 59, wherein the retroviral vector expression system is a lentiviral vector expression system.

61. The retroviral vector expression system of any one of claims 58-60, wherein the retroviral vector expression system comprises a gene editing system.

62. The retroviral vector expression system of claim 61, wherein the gene editing system comprises Cas9 or CasMINI.

63. A method of making a membraned vesicle, an enveloped viral particle, a virus-like particle, or a recombinant viral vector, the method comprising: a) Transfecting or transducing a packaging host cell with the retroviral vector expression system of any one of claims 58-62; and b) recovering the membraned vesicle, enveloped viral particle, virus-like particle, or recombinant viral vector produced by the transfected or transduced packaging host cell.

64. A plasmid comprising one or more nucleotide sequences encoding the recombinant fusion protein of any one of claims 1-37.

65. The composition of claim 54 or the retroviral vector expression system of any one of claims 57-61 for use in treating a disease in a mammal.

66. The composition or retroviral vector expression system of claim 65, wherein the mammal is a human.

67. The composition or retroviral vector expression system of claim 65 or 66, wherein the disease is a genetic disease.

68. The composition or retroviral vector expression system of claim 65 or 66, wherein the disease is a cancer.

69. The composition or retroviral vector expression system of any one of claims 65-68, wherein the composition is administered intravenously.

70. The composition or retroviral vector expression system of any one of claims 65-68, wherein the composition is administered intraperitoneally.

71. A method of making a mixed rhabdoviral G glycoprotein trimer, the method comprising:a) transfecting or transducing a packaging host cell with the retroviral vector expression system of any one of claims 58-62; and b) recovering the mixed rhabdoviral G glycoprotein trimer.

72. A method of reducing inactivation of a rhabdoviral G glycoprotein or a functional fragment or derivative thereof by serum, LDL, or vLDL, the method comprising producing the rhabdoviral G glycoprotein or functional fragment or derivative thereof as the recombinant fusion protein of any one of claims 1-37, and exposing the recombinant fusion protein to serum, LDL, or vLDL, wherein inactivation by serum, LDL, or vLDL is reduced.

Citation Information

Patent Citations

  • Viral targeting of hematopoietic stem cells

    CA3216882A1

  • Cell-type specific membrane fusion proteins

    WO2023158487A1

  • Compositions and methods for virotherapy

    WO2024057315A1

  • Modified rhabdovirus glycoproteins and uses thereof

    WO2024159071A1

  • Rhabdovirus g proteins having one or more cysteine-rich regions and uses thereof

    WO2025102013A1