Treatment of cancers
A combination of methionine-depleting composition and methionine synthase inhibition addresses the ineffectiveness of methionine deprivation in cancer treatment by targeting both methionine-dependent and -independent cells, inducing apoptosis and preventing relapse.
Patent Information
- Application Number
- PCT/EP2025/060392
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-16
- Filing Date
- 2025-04-15
- Publication Date
- 2025-10-23
AI Technical Summary
Existing cancer treatments based on methionine deprivation are ineffective against methionine-independent cancer cells, as these cells can synthesize their own methionine, leading to resistance and relapse.
A combination therapy using a methionine-depleting composition and a methionine synthase inhibitor, either direct or indirect, to reduce both extracellular methionine availability and inhibit intracellular methionine production, targeting both methionine-dependent and methionine-independent cancer cells.
This combination therapy effectively induces apoptosis in cancer cells, including methionine-independent clones, by synergistically reducing methionine availability and inhibiting methionine synthase, even after treatment cessation, thus overcoming resistance and relapse.
Smart Images

Figure IMGF000009_0001 
Figure IMGF000009_0002 
Figure IMGF000009_0003
Abstract
Description
[0001] TITLE OF THE INVENTION
[0002] Treatment of cancers
[0003] FIELD OF THE INVENTION
[0004] This invention lies in the field of cancer treatment, especially of cancers involving the presence of methionine-independent cancer cells.
[0005] BACKGROUND OF THE INVENTION
[0006] Tumorigenesis is accompanied by the reprogramming of cellular metabolism. Among the metabolic changes affecting cancer cells, the dependence of cancer cells on exogenous methionine is known in the art as the Hoffman effect. Methionine dependency of various cancers is known from a long time. The dependence of cancer cell proliferation on methionine was notably highlighted in 1973 by experiments that showed that leukemia cells cannot proliferate in growth media where methionine is substituted with its metabolic precursor homocysteine (Chello et al., 1973, Cancer Res, Vol. 33: 1898-1904). Numerous experimental works during the 70s and the 80s expanded the methionine / homocysteine substitution assays to many cell lines derived from various tumor sites. The results reported in the literature suggested that a majority of cancer cell lines cannot proliferate when methionine is replaced by homocysteine, whereas non-cancer cells are not sensitive to such amino acid replacement (Hoffman et al., 1976, Proc Natl Acad Sci USA, Vol. 73: 1523- 1527; Halpern et al., 1974, Proc Natl Acad Sci USA, Vol. 71 : 1133-1136; Stem et al., 1984, J Cell Physiol, Vol. 119: 29-34; Mecham et al., 1983, Biochem Biophys Res Comm, Vol. 117: 429-434; Booher et al., 2012, Cell Cycle, Vol. 11 : 4414-4423).
[0007] Given the evidence that the Hoffman effect is maintained in the context of the whole organism, methionine restriction has been evaluated as a therapeutic approach for cancer. Preclinical models have shown promise with dietary methionine restriction significantly suppressing tumor growth in multiple models, which include both solid tumors and blood cancers (Breillout et al., 1987, Anticancer Res, Vol. 7: 861-867; Guao et al., 1993, Cancer Res, Vol. 53: 5676-5679; Hoshiya et al., 1995, Anticancer Res, Vol. 15: 717-718; Komminou et al., 2006, Nutr Cancer, Vol. 54: 202-208; Tan et al., 1996, Anticancer Res, Vol. 16: 3931-3936).
[0008] Although identification of key players that sense methionine / SAM (S-Adenosyl Methionine) levels and transmit this information to relevant signaling pathways are still poorly understood, circulating methionine restriction (restriction of the extracellular methionine also called exogenous methionine or plasmatic methionine or plasma methionine) appeared as a promising anticancer treatment. Such methionine restriction in combination with chemotherapy or radiation appeared to represent the most promising path to clinical application. Methionine-restricted diets clearly sensitize tumors to chemotherapeutics and radiation (Gao et al., 2019, Nature, Vol. 572: 397-401). Targeting methionine dependency with methioninase (METase), either alone or in combination with common cancer chemotherapy drugs, has been shown as an effective and safe therapy in various types of cancer cells and animal cancer models. Pilot phase I trials administered METase infusions to patients with terminal phase cancer, who had no side effects even though a dramatic reduction in plasma methionine by 200-fold was achieved (Tan et al., 1996, Anticancer Res, Vol. 16: 3937-3942; Tan et al., 1998, Anticancer Res, Vol. 17: 3857-3860). Illustratively, human clinical trials for cancer treatment have been performed, in combination with radiotherapy, wherein the cancer patients treated with radiation therapy were concomitantly provided with a methionine-restricted diet. Prior phase I clinical trials had demonstrated the safety of the methionine-restricted diet with and without concurrent chemotherapy (See Clinicaltrials.gov - ID NCT03574194).
[0009] US patent n° US9200251B discloses a method of treating neoplastic diseases, coronary heart disease and tumors by administering microcin methionine analogues or microcin methionine synthesis inhibitor or tRNA-methionine synthase inhibitor. Those are administered in combination with methioninase. "Methionine synthesis inhibitor” is used to designate an inhibitor of enzymes (bacterial or animal, but not human) capable of producing extracellular methionine in an organism (not a human) thus resulting in depletion of circulating methionine (methionine outside the cells). The methioninase simply degrades circulating methionine thus also resulting in depletion of circulating methionine. “tRNA-methionine synthase inhibitor” refers to “methionyl-tRNA synthetase” (also known as “aminoacyl- tRNA methionine synthetase”), which is an enzyme that attaches methionine to its transfer RNA. This enzyme is therefore essential for the specific use of methionine in the cell, but not for its production, and its inhibitor therefore does not reduce intracellular methionine concentration. This patent therefore only discloses a method of depleting circulating methionine (also called exogenous methionine or plasmatic methionine), a combination of methods of depleting circulating methionine, and a combination of a method of depleting circulating methionine and the inhibition of enzymes using methionine as a substrate.
[0010] The publication “Methionine Depletion modulates the Antitumor and Antimetastatic Efficacy of Ethionine ” of GUO H. et. al. from September 1st, 1996, discloses the use of ethionine (a methionine analog) in combination with methionine-depletion to obtain an effect on tumor growth arrest in Yoshida sarcoma. Ethionine is a methionine analog that competitively inhibits methionine-utilizing enzymes. It is an inhibitor of enzymes that use methionine to function (all methylation enzymes, for example). This publication therefore discloses a combination of a method of depleting circulating methionine and the inhibition of enzymes using methionine, thus two processes that reduce cells accessibility to the functional circulating methionine.
[0011] However, methionine deprivation has been demonstrated to be ineffective in limiting the cancer cells proliferation in about one third of cancer cell lines, which have been described as methionine-independent due to their resistance to methionine deprivation (Kaiser et al. 2020, Biomolecules, Vol. 10(4) : 568 ; Mecham et al. 1983, Biochemical and Biophysical Research Communications, Vol. 117 : 429-434). Finally, about 1 / 3 of cancer cell lines tested for methionine-dependency were methionine-dependent (unable to proliferate under methionine deprivation conditions), 1 / 3 were partly methionine-dependent (incomplete reduction of cell proliferation under methionine deprivation conditions), and 1 / 3 were classified as methionine-independent due to their ability to proliferate normally even in the absence of methionine in the culture medium.
[0012] In the art, methionine-independent cancer cells were considered as cancer cells requiring a lower amount of methionine for their growth, explaining their resistance to methionine deprivation treatment. However, the mechanism of methionine independency remains unexplored. There remains a need in the art for further therapeutic treatment against cancers, especially against methionine-independent cancers cells and not only against methionine-dependent cancers cells, thus against methionine-independent cancers and in cancers involving the presence of methionine-independent cancer cells.
[0013] SUMMARY OF THE INVENTION
[0014] The inventors unexpectedly discovered and demonstrated that so-called “methionine- independent” cells, previously thought not to need methionine (extra- or intra-cellular) to survive and proliferate, do in fact require it. Indeed, they discovered that these cells actually needed high amount of methionine but were able to synthesize it themselves, their ability to synthesize their own methionine being via methionine synthase (MS), and not via any other enzyme able to synthesize or recycle methionine. They also discovered that even a predominantly methionine-dependent tumor (thus predominantly comprising methioninedependent cancer cells) comprises a proportion of methionine-independent cells (also called methionine-independent clones).
[0015] The inventors also unexpectedly discovered that inhibition of methionine synthase, under conditions of extracellular methionine deprivation, advantageously resulted in cell death of methionine-independent cancer cells, previously considered resistant to methionine deprivation. Furthermore, they also unexpectedly discovered that methionine deprivation alone treatment of cancer cells led to increasing the proliferation of cancer cells when this treatment is temporary stopped, while combination of inhibition of methionine synthase with conditions of extracellular methionine deprivation decreased the proliferation of cancer cells even after the end of treatment with such combination.
[0016] This invention relates to the use of a combination of (i) one or more methionine-depleting composition and of (ii) one or more methionine synthase inhibitors for its use for treating cancer. Methionine-depleting composition is any composition of matter which, when administered to a subject, causes a drastic reduction in the amount of extracellular methionine that is available to the cells, especially to the cancer cells. This combination advantageously both reduces the bioavailability of extracellular methionine to cancer cells and prevents cancer cells from producing intra-cellular methionine (also called endogenous methionine) themselves when they have no access to it in the extracellular environment. The combination acts synergistically against the growth of cancer cells, causing their death.
[0017] In some embodiments, the said combination comprises one methionine-depleting composition.
[0018] In some embodiments, the methionine-depleting composition is a methionine-deprived composition comprising an amount of methionine suitable for a methionine daily intake of about 5 mg or less per kg of body weight, preferably for a methionine daily intake of about 0,1 to 5 mg per kg of body weight.
[0019] In some embodiments, the methionine-depleting composition is a methionine-deprived composition which does not contain methionine.
[0020] In some embodiments, the methionine-depleting composition is a methionine-degrading composition comprising methionine gamma lyase also called methioninase (METase).
[0021] In some embodiments, the methionine synthase inhibitor is a direct methionine synthase inhibitor.
[0022] In some embodiments, the direct methionine synthase inhibitor is selected from an inhibitory antibody directed against methionine synthase, an inhibitor protein aptamer directed against methionine synthase, a nucleic acid aptamer directed against methionine synthase, an antisense oligonucleotide directed against the MTR gene, encoding the methionine synthase, or a siRNA, a shRNA or a IncRNA directed against a AZZR-encoding mRNA.
[0023] In some embodiments, the direct methionine synthase inhibitor is one or more siRNAs directed against a AZZR-encoding mRNA comprising a nucleic acid sequence selected from SEQ ID NO. 1, SEQ ID NO. 2 or SEQ ID NO. 3.
[0024] In some embodiments, the direct methionine synthase inhibitor is selected from:
[0025] (i) a benzimidazole inhibitor, such as selected from 5- methoxybenzimidazole, 5- nitrobenzimidazole and 4-nitro-N-(2-(5-nitro-lH-benzimidazol-2-yl)ethyl)benzamide; (ii) a benzothiazole inhibitor such as 4-nitro-2, 1,3 -benzothiadiazole;
[0026] (iii) a quinoxaline inhibitor such as methyl-3-hydroxy-2-(2-(3-(4-methoxyphenyl)-4-oxo- 3 ,4-dihy droquinazolin-2-ylthio)acetamido propanoate;
[0027] (iv) a N5 substituted tetrahydropteroate, such as N5 -substituted tetrahydropyrido[3,2- d]pyrimidine; and
[0028] (v) a compound selected from N-[4]-[2,4-Diamino-5-formyl-5,6,7,8-tetrahydropyrido[3,2 - d]pyrimidin-6-ylmethyl)acetylamino]benzoyl]-L_glutamic acid and N-[4-((2-[2,4-diamino- 5(2,3-dibromopropane)-5,6,7,8-tetrahydropyrido(3,2-d)pyrimidin-6-yl]methyl)amino)-3- bromo-benzoyl]-L-glutamate.
[0029] In some embodiments, the methionine synthase inhibitor is an indirect methionine synthase inhibitor.
[0030] In some embodiments, the methionine synthase inhibitor is an indirect methionine synthase inhibitor selected from an antibody directed against CD320, one or more siRNAs, shRNAs or IncRNAs directed against a CD320-encoding mRNA comprising a nucleic acid sequence selected from SEQ ID NO. 12, SEQ ID NO. 13 or SEQ ID NO. 14
[0031] In some embodiments, the indirect methionine synthase inhibitor is a vitamin B12 antimetabolite compound selected from an aryl-cobalamin, an alkynyl-cobalamin, 4- ethylphenyl-cobalamin, 2-phenyl-ethynyl-cobalamine, a metal-modified and upper-axial- ligand-modified cobalamin antivitamin, a [c-lactam] derivative of cobalamin, a ring- modified cobalamin, a f-side-chain-modified B12 derivative.
[0032] In some embodiments, the combination of (i) one or more methionine-depleting composition and of (ii) one or more methionine synthase inhibitors is further combined with a chemotherapeutic agent, a radiotherapeutic agent or an immunotherapeutic agent against cancer.
[0033] In some embodiments, the combination of (i) one or more methionine-depleting composition and of (ii) one or more methionine synthase inhibitors is further combined with a chemotherapeutic agent consisting of one or more hypomethylating agents. In some embodiments, the one or more hypomethylating agents are selected from 5- azacytidine (vidaza), 5 -aza-2’ -deoxy cyty dine (decitabine). 6-thioguanine, zebularine, guadecitabine, N-phthaloyl-L-tryptophan 1, shikonnin, psammaplin, isofistularin-3, epigallocatechin-3 -gallate, berberine, 3,3'-Diindolylmethane, harmalin, harmine, mahanine, reserpine, solamargine, tricostatine A, all-trans retinoic acid, hinokitiol, parthenolide, ursolic acid, curcubitacin B, procainamide, hydralazine, temozolomide (temodar), 1’entinostat (syndax) and SGI-110 (guadecitabine).
[0034] In some embodiments the cancer is selected from solid cancers and hematological cancers.
[0035] In some embodiments, the cancer is selected from pancreatic adenocarcinoma, melanoma, colon adenocarcinoma, lung adenocarcinoma, leiomyosarcoma, glioblastoma, bladder cancer and acute myeloid leukemia.
[0036] The present disclosure also relates to a pharmaceutical kit of parts comprising:
[0037] (i) a first container comprising a methionine-depleting composition, and
[0038] (ii) a second container comprising one or more methionine synthase inhibitor.
[0039] Said methionine synthase inhibitor may be direct or indirect methionine synthase inhibitor. They thus respectively may be direct or indirect inhibitor of the intra-cellular methionine production in cells.
[0040] DESCRIPTION OF THE FIGURES
[0041] Figure 1: Heterogeneity of human cancer cells regarding methionine dependence.
[0042] Figure 1A: SKLU1, aCe s methionine-dependent human cancer cell line (human lung adenocarcinoma). In the presence (CTRL - Upper curve with black symbol “-•-“) or absence of methionine (noMet - Lower curve with grey symbol “-•-“).
[0043] Statistical relevance : * : <0.05; ** : <0.01; *** : <0.001; **** : <0.0001 Figure IB: A427, a methionine-independent human cancer cell line (human lung carcinoma). In the presence (CTRL - Upper curve with black symbol “-•-“) or absence of methionine (noMet - Lower curve with grey symbol “-•-“).
[0044] Figure 1C: TH17, a non-cancer cell line (normal human fibroblasts). In the presence (CTRL) or absence (noMet) of methionine. In the presence (CTRL - Upper curve with black symbol “-•-“) or absence of methionine (noMet - Lower curve with grey symbol “-•-“).
[0045] Ordinate: Relative cell density (mean + / - SD). Abscissa: time period of culture, expressed in days.
[0046] Figure 2: Assessment of the methionine-independence mechanism in cancer cells and demonstration of the importance of the methionine synthase pathway for these cells.
[0047] Figure 2A: A427, inhibition of betaine homocysteine S-methyltransferase (BHMT). In the absence of methionine, with (iBHMT - Lower curve with grey symbol “-•-“) or without (vehicle) a BHMT inhibitor (CBHcy: S-(d-carboxybutyl)-D,L-homocysteine) (noMet - Upper curve with black symbol “-•-“).
[0048] Figure 2B: A427, inhibition of methionine synthase, (i) In the absence of methionine (noMet - Upper curve with black symbol or (ii) in the absence of methionine with methionine synthase inhibition by absence of vitamin B12 (noMet + iMS (noB12) - Lower curve with grey symbol “-•-“).
[0049] Ordinate: Relative cell density. Abscissa: time period of culture, expressed in days.
[0050] Figure 3: Inhibition of methionine-independent human cancer cells proliferation thanks to the synergistic combination of methionine deprivation and methionine synthase inhibition. Inhibition of methionine synthase inhibits proliferation of methionine- independent human cancer cells only under conditions of methionine deprivation.
[0051] Figures 3 A and 3B : A427, cell proliferation assessment in (i) control culture (CTRL - Curve with black symbol (ii) by inhibition of methionine synthase (iMS (noB12) - Curve with dark grey symbol (iii) in the absence of methionine (noMet - Curve with medium grey symbol “-•-“) and (iv) in the absence of methionine and by inhibiting methionine synthase (iMS (noB12) - Curve with light grey symbol “-•-“). Figure 3A: Ordinate: Relative cell density. Abscissa: time period of culture, expressed in days.
[0052] Figure 3B: Ordinate: Relative cell density (normalized to reference condition, express as a percentage) after 5 days. Abscissa: bars, from left to right: CTRL, iMS (noB12), noMet and noMet + iMS (noB12).
[0053] Figure 4: Assessment of the methionine-independence mechanism in cancer cells through the methionine synthase. The ability of methionine-independent human cancer cells to compensate for a reduction in exogenous methionine supply by endogenous production of methionine synthase is not related to the cellular level of methionine synthase.
[0054] Figure 4A: (1) upper part, methionine synthase production assessment (Western blot). Ordinate: Relative intensity, expressed as arbitrary units. Abscissa, from left to right: human lung adenocarcinoma (SKLU1), human lung carcinoma (A427). (2) Lower part, photograph of the Western blot with assays in triplicate.
[0055] Figure 4B: Measure of the MTR gene expression. Ordinate: MTR gene expression as expressed in log2(TPM+l) according to the public dataset DepMap (Cancer Cell Line Encyclopedia, Broad Institute). Abscissa, from left to right: (i) Methionine-dependent human cancer cells, (ii) methionine-independent human cancer cells.
[0056] Figure 5: CD320 gene expression in methionine-dependent and -independent cancer cell lines. CD320 gene expression tends to be higher in methionine-independent human cancer cells. CD320 gene expression is predictive of methionine-independence.
[0057] Figure 5A: Measure of CD320 gene expression. CD320 gene expression as expressed in log2(TPM+l) according to the public dataset DepMap. Abscissa, from left to right: (i) Methionine-dependent human cancer cells, (ii) methionine-independent human cancer cells.
[0058] Figure 5B: Analysis of the association between CD320 expression and the likelihood of the human cancer cells being methionine-independent. Ordinate: Sensitivity, as expressed in percentage. Abscissa: 1 -Specificity, as expressed in percentage. AUC 0.70 [95%; CI: 0.49- 0.91], Figure 6: Synergistic activity of the combination of (i) a methionine-depleting composition and (ii) an indirect methionine synthase inhibition on the viability of solid cancer cells.
[0059] Figure 6A: human pancreatic cancer cells (PANCI); Figure 6B: human lung carcinoma (A427; Figure 6C: human melanoma cells (MeWo); Figure 6D: human neuroblastoma cells (SK-N-MC); Figure 6E: human colon carcinoma cells (HT29); Figure 6F: human bladder cancer cells (T-24); Figure 6G: human leiomyosarcoma cells (SK-LMS1).
[0060] Figures 6A-6G: Ordinate: cell viability after three days of treatment, as expressed in percentage. Abscissa, from left to right: (i) control culture (CTRL), (ii) indirect inhibition of methionine synthase through a vitamin B12 deprivation (iMS (noB12)), (iii) methionine deprivation (noMet) and (iv) indirect inhibition of methionine synthase through a vitamin B12 deprivation and methionine deprivation (noMet+iMS (noB12)).
[0061] Figure 7: Synergistic activity of the combination of (i) a methionine-depleting composition and (ii) an indirect methionine synthase inhibition on the viability of blood cancer cells.
[0062] Acute myeloid leukemia cells (Mono-Mac-6). Ordinate: cell viability after three days of treatment, as expressed in percentage. Abscissa, from left to right: (i) control culture (CTRL), (ii) indirect inhibition of methionine synthase through a vitamin B12 deprivation (iMS (noB12)), (iii) methionine deprivation (noMet) and (iv) indirect inhibition of methionine synthase through a vitamin B12 deprivation and methionine deprivation (noMet+iMS (noB12)).
[0063] Figure 8: Tolerance of non-cancer cells to a treatment with a combination of (i) a methionine-depleting composition and (ii) an indirect methionine synthase inhibition.
[0064] Figure 8 A: fibroblasts from a healthy subject (TH17). Ordinate: relative cell density. Abscissa: time period of treatment, as expressed in days. Upper curve with black symbol culture with a methionine-depleting composition; Lower curve with grey symbol
[0065] ‘: culture with a combination of a methionine-depleting composition and a methionine synthase inhibitor. Figure 8B: fibroblasts from a healthy subject (TH16002). Ordinate: cell viability after three days of treatment, as expressed in percentage. Abscissa: from left to right: (i) control culture (CTRL), (ii) indirect inhibition of methionine synthase through a vitamin B12 deprivation (iMS (noB12)), (iii) methionine deprivation (noMet) and (iv) indirect inhibition of methionine synthase through a vitamin B12 deprivation and methionine deprivation (noMet+iMS (noB12)).
[0066] Figure 8C: fibroblasts from a healthy subject (TF15003). Ordinate: cell viability after three days of treatment, as expressed in percentage. Abscissa: from left to right: (i) control culture (CTRL), (ii) indirect inhibition of methionine synthase through a vitamin B12 deprivation (iMS (noB12)), (iii) methionine deprivation (noMet) and (iv) indirect inhibition of methionine synthase through a vitamin B12 deprivation and methionine deprivation (noMet+iMS (noB12)).
[0067] Figure 9: Synergistic activity of a combination of (i) a methionine-depleting composition and (ii) a direct methionine synthase inhibitor (4N-BZT).
[0068] Activity on human lung adenocarcinoma cells (A427).
[0069] Ordinate: cell viability after three days of treatment, as expressed in percentage. Abscissa: from left to right: (i) methionine deprivation (noMet) and (ii) inhibition of methionine synthase by a direct methionine synthase inhibitor (iMS 4N-BZT, 4-nitro-2,l,3- benzothiadi azole) and (iii) inhibition of methionine synthase and methionine deprivation (noMet+iMS 4N-BZT).
[0070] Figure 10: Actual mathematical synergistic activity of a combination of (i) a methionine-depleting composition and of (ii) a methionine synthase inhibition with various concentrations, on cancer cell viability (3D representation and FaCI representation).
[0071] Figure 10A: 3D representation of the synergistic activity. First axis: cell viability after three days of treatment, as expressed in percentage. Second axis: methionine synthase inhibition (amount of B12, as expressed in ng / ml). Third axis: methionine deprivation (amount of exogenous methionine supply, as expressed in pM). Figure 10B: Mathematical Fa-CI representation of the synergistic activity. Ordinate: Combination Index (CI) quantifies the nature of the interaction between the two factors. Abscissa: Fraction affected (Fa) represents the proportion of affected cells. CI > 1 suggests antagonism, CI = 1 indicates an additive effect (no interaction), and CI < 1 suggests synergism (an enhanced effect when combined). Different symbols and colors correspond to specific concentrations of methionine (0-100 pM, depicted as circles) and vitamin B12 (0-2000 ng / L, depicted as triangles and squares), as detailed in the legend.
[0072] Figure 11: Cancer cell apoptosis effect of a combination of (i) a methionine-depleting composition and of (ii) an indirect methionine synthase inhibition through a vitamin B12 deprivation.
[0073] Picture showing the results of a flow cytometry effect, after three days of treatment. Quadrant QI : necrosis; Quadrant Q2: late apoptosis; Quadrant Q3: viable cells; Quadrant Q4: early apoptosis.
[0074] Figure 12: Cancer cell apoptosis effect over time during the first 10 days of treatment of a combination of (i) a methionine-depleting composition and of (ii) an indirect methionine synthase inhibition through a vitamin B12 deprivation.
[0075] Left upper part: control culture (CTRL); Right upper part: methionine-depleting composition; Left lower part: methionine synthase inhibition; Right lower part: combination of a methionine-depleting composition and of methionine synthase inhibition.
[0076] In all panels: Ordinate: ratio of apoptotic cells, as expressed in percentage; Abscissa ; time period of treatment, as expressed in days.
[0077] Light grey curve with symbol early apoptosis; Dark curve with symbol late apoptosis; Dark grey curve with symbol early and late apoptosis.
[0078] Figure 13: Cell apoptosis effect of a combination of a methionine-depleting composition and of methionine synthase inhibition restricted to cancer cells, sparing healthy cells.
[0079] Left part: PANCI human cancer cells (a methionine-independent cancer cell line); Right part: non-cancerous human fibroblasts (from healthy subject). Upper part: Ordinate: ratio of apoptotic cells, as expressed in percentage, after ten days of treatment. Abscissa, from left to right: (i) CTRL: control culture, (ii) iMS (noB12): inhibition of methionine synthase, (iii) no Met: methionine-depleting composition, (iv)= noMet + iMS (no B12): combination of a methionine-depleting composition and of methionine synthase inhibition. Grey color: early apoptosis; Black color: late apoptosis.
[0080] Lower part: results of a flow cytometry analysis.
[0081] Figure 14: Anti-cancer effect of a combination of (i) a methionine-depleting composition and of (ii) direct methionine synthase inhibitors, further combined with (iii) a chemical anti-cancer agent, here a hypomethylating agent.
[0082] Figure 14A: Ordinate: Cell viability after three days of treatment. Abscissa, from left to right: (i) no Met: methionine-depleting composition , (ii) 5-aza: 5-azacytidine as the hypomethylating agent, CTRL: (iii) iMS 5M-BZM (5 -methoxybenzimidazole): inhibition of methionine synthase by a direct inhibitor, (iv)= noMet + iMS 5M-BZM + 5-aza: combination of a methionine-depleting composition and of methionine synthase inhibition, further combined with the hypomethylating agent 5-azacytidine. In Figure 14B, the direct methionine synthase inhibitor is 5N-BZM (5 -nitrobenzimidazole). In Figure 14C, the direct methionine synthase inhibitor is 4N-BZT (4-nitro-2,l,3-benzothiadiazole).
[0083] Figure 15: Anti-cancer effect of a combination of (i) a methionine-depleting composition and of (ii) a methionine synthase inhibitor, further combined with (iii) a chemical anti-cancer agent, here a hypomethylating agent on cancer cells exhibiting various status with respect to methionine dependency, and spare of non-cancer cells.
[0084] Figure 15 A. Ordinate: relative cell density in a medium without methionine (i.e. methionine- depleting composition) normalized to the density in the control culture medium after five days of treatment, as expressed in percentage. Abscissa, from left to right: (i) SKLU1 cancer cells, clone p40 before clone selection, (ii) SKLU1 cancer cells, methionine-dependent clone p70, (iii) SKLU1 cancer cells, methionine-independent clone p70, (iv) A427 cancer cells, clone p40 before clone selection, (v) A427 cancer cells, methionine-dependent clone p70, (vi) A427 cancer cells, methionine-independent clone p70. Arrow pointing upwards: towards methionine-independence phenotype; Arrow pointing down: towards methionine- dependence phenotype. Figure 15B. Ordinate: relative cell density in a medium without methionine (i.e. methionine- depleting composition) normalized to the density in the control culture medium after five days of treatment, as expressed in percentage. Abscissa, from left to right: (i) SKLU1 cancer cells, clone p40, (ii) SKLU1 cancer cells, methionine-dependent clone p70, (iii) SKLU1 cancer cells, methionine-independent clone p70, (iv) A427 cancer cells, clone p40, (v) A427 cancer cells, methionine-dependent clone p70, (vi) A427 cancer cells, methionine- independent clone p70, (vii) non-cancerous human fibroblasts. Grey bars: CTRL, control medium; Black bars: combination of a methionine-depleting composition and of a direct methionine synthase inhibitor (4N-BZT, 4-nitro-2, 1,3 -benzothiadiazole), further combined with the hypomethylating agent 5-azacytidine.
[0085] Figure 16: Persistence of the inhibition of methionine-independent human pancreatic cancer cells proliferation after a treatment combining methionine deprivation and methionine synthase inhibition, even after rescue in a standard medium.
[0086] PANCI cell proliferation assessment in a standard medium for rescue, after the following different 3-days treatment exposure: (i) standard as control (STD - Curve with round symbol (ii) medium with inhibition of methionine synthase (iMS (noB12) - Curve with triangle with upward-pointing angle symbol “-A-“), (iii) medium with absence of methionine (noMet - Curve with square symbol “-■-“) and (iv) medium with absence of methionine and with inhibition of methionine synthase (noMetnoB12) - Curve with triangle with downward-pointing angle symbol “-▼-“).
[0087] Ordinate: Relative cell density. Abscissa: time period of culture after seeding, expressed in hours.
[0088] Figure 17: Tumor size study under different treatments in a xenografted nude mice model.
[0089] Nude mice xenografted via intradermal injection of 5* 106PANCI cells. Three weeks later, the mice were randomized into one of four treatment groups for 6 weeks: (i) STD: Standard diet (methionine 0.86%) with continuous subcutaneous injection of vehicle (NaCl), n=7, curve with round symbol (ii) noMet: Methionine-restricted diet (methionine 0.14%) with continuous subcutaneous injection of vehicle (NaCl), n=6, curve with square symbol “- ■ (iii) STD 4EP: Standard diet (methionine 0.86%) with continuous subcutaneous injection of 4EP (Cob-(4-ethylphenyl)-cobalamin: MS inhibitor), n=8, curve with triangle with upward-pointing angle symbol (iv) noMet 4EP: Methionine-restricted diet (methionine 0.14%) with continuous subcutaneous injection of 4EP (MS inhibitor), n=6, curve with triangle with downward-pointing angle symbol Curves present the changes in tumor size, standardized to the tumor size at the first day of treatment.
[0090] Ordinate: ratio of tumor size to tumor size at day zero of treatment. Abscissa: time period of treatment, expressed in days.
[0091] Figure 18: Human primary lung cancer cells apoptosis effect of a combination of a methionine-depleting composition and an indirect methionine synthase inhibition through a vitamin B12 deprivation
[0092] Ordinate: cell viability after three days of treatment, as expressed in percentage, normalized to standard condition. Abscissa: from left to right: (i) standard culture with methionine and vitamin B12 used as control (STD), (ii) indirect inhibition of methionine synthase through a vitamin B 12 deprivation (noB12), (iii) methionine deprivation (noMet) and (iv) combination of indirect inhibition of methionine synthase through a vitamin B12 deprivation and methionine deprivation (noMetnoB12).
[0093] Figure 19: Tumoral heterogeneity of methionine-dependence or -independence in two human tumors of identical histological type
[0094] One graph per patient / tumor (Patient #1 and patient #2) and for each graph:
[0095] Ordinate: cell viability after three days of treatment, as expressed in percentage, normalized to standard condition. Abscissa: from left to right: (i) culture in a standard medium containing 100 pM methionine as control (STD(Met+)), (ii) culture in a methionine-free medium (noMet(Met-)).
[0096] Figure 20: Hemoglobin level after 6 weeks under treatment combining a methionine- depleting composition and inhibition of methionine synthase
[0097] Ordinate: Hemoglobin level, as expressed in g / dL. Abscissa: from left to right: (i) Standard diet (methionine 0.86%) with continuous subcutaneous injection of vehicle (NaCl) used as control, n=4 (STD), (ii) Methionine-restricted diet (methionine 0.14%) with continuous subcutaneous injection of vehicle (NaCl), n=2 (noMet), (iii) Standard diet (methionine 0.86%) with continuous subcutaneous injection of 4EP (Cob-(4-ethylphenyl)-cobalamin: MS inhibitor), n=7 (STD 4EP) and (iv) combination of methionine-restricted diet (methionine 0.14%) with continuous subcutaneous injection of 4EP (MS inhibitor), n=5 (noMet 4EP).
[0098] Figure 21: Mean Corpuscular Volume level after 6 weeks under treatment combining a methionine-depleting composition and inhibition of methionine synthase
[0099] Ordinate: Mean corpuscular volume, as expressed in fl. Abscissa: from left to right: (i) Standard diet (methionine 0.86%) with continuous subcutaneous injection of vehicle (NaCl) used as control, n=4 (STD), (ii) Methionine-restricted diet (methionine 0.14%) with continuous subcutaneous injection of vehicle (NaCl), n=2 (noMet), (iii) Standard diet (methionine 0.86%) with continuous subcutaneous injection of 4EP (Cob-(4-ethylphenyl)- cobalamin: MS inhibitor), n=7 (STD 4EP) and (iv) combination of methionine-restricted diet (methionine 0.14%) with continuous subcutaneous injection of 4EP (MS inhibitor), n=5 (noMet 4EP).
[0100] Figure 22: Proportion of CD8+T cells in spleens of C57BL / 6J mice after 7, 14, and 21 days under treatment combining a methionine-depleting composition and inhibition of methionine synthase
[0101] Ordinate: CD8+ level after seven, fourteen and twenty-one days of treatment, as expressed in percentage, normalized to CD45+ level. Abscissa: for each treatment duration from left to right: (i) Standard diet (methionine 0.86%) with daily subcutaneous injection of vehicle (NaCl) used as control (STD), (ii) Methionine-restricted diet (methionine 0.14%) with daily subcutaneous injection of vehicle (NaCl) (noMet), (iii) Standard diet (methionine 0.86%) with daily subcutaneous injection of 4EP (Cob-(4-ethylphenyl)-cobalamin: MS inhibitor) (STD 4EP) and (iv) combination of methionine-restricted diet (methionine 0.14%) with daily subcutaneous injection of 4EP (MS inhibitor) (noMet 4EP).
[0102] DETAILED DESCRIPTION OF THE INVENTION
[0103] Until now, cancer cells have commonly been classified based on their requirement for methionine, falling strictly into either the category of (i) methionine-dependent or (ii) methionine-independent. However, the mechanism of methionine independency remains unexplored. By definition, methionine-independent cells are resistant to methionine deprivation therapy, and this explains the resistance and relapse observed when methionine restriction therapy is proposed. To explain such resistance, methionine-independent cancer cells were considered in the art as cancer cells requiring a lower amount of methionine for their growth.
[0104] Contrary to what is described in the art, the present inventors have unexpectedly discovered and demonstrated that tumors classified as “methionine-independent” do not owe this characteristic to a low requirement for methionine, but rather to an active mechanism for methionine independence. The inventors have shown that methionine-independent cancer cells possess their methionine independency because these cells produce themselves the high amount of methionine that they require for their growth. Further, the inventors have shown that these methionine-independent cancer cells produce methionine required for their growth through specifically the activity of the methionine synthase (MS).
[0105] The present inventors have also shown that cancer tumors exhibit a composite cell composition concerning their dependence to methionine. The inventors have also shown that tumors containing methionine-dependent tumor cells often evolve by generating cell clones that do no longer require the presence of exogenous methionine for their growth, especially when a methionine deprivation is used. Thus, as a cancer tumor develops, there is an increasing heterogeneity in methionine requirement phenotype, including cells either auxotrophic or prototrophic for methionine, with an unpredictable ratio between these two phenotypes. Indeed, the inventors demonstrated that even a predominantly methioninedependent tumor (thus predominantly comprising methionine-dependent cancer cells) comprises a proportion of methionine-independent cells (methionine-independent clones).
[0106] The inventors have shown that the growth of methionine-independent tumor cells, which is not inhibited by being cultured in a medium without methionine, can be reduced or blocked by inhibiting, directly (direct action on the enzyme) or indirectly (action via its cofactor, the vitamin B 12, cobalamin), the methionine synthase. Otherwise said, the inventors have shown that tumor cells, for which growth proceeds in the absence of exogenous methionine, can be successfully impaired in their growth by additionally inhibiting, directly or indirectly, their methionine synthase. Still further, it is shown herein that tumor cells that display a maintained growth in the absence of exogenous methionine can be driven towards apoptosis when the deprivation in exogenous methionine is combined with a treatment causing a direct or indirect inhibition of the tumor cell methionine synthase. Used alone, a deprivation of exogenous methionine, although it can inhibit, at least partly, tumor growth, does not cause apoptosis of cancer cells. The inventors therefore demonstrated a major synergy between a deprivation of exogenous methionine and a methionine synthase inhibition to induce cancer cell apoptosis. Furthermore, they also demonstrated that methionine deprivation alone treatment of cancer cells led to increasing the proliferation of cancer cells when this treatment is temporary stopped, while combination of inhibition of methionine synthase with conditions of extracellular methionine deprivation decreased the proliferation of cancer cells even after the end of treatment with such combination. This strongly supports both the feasibility of using this treatment sequentially and the superiority of dual therapy over methionine deprivation alone.
[0107] Thus, the inventors’ experimental findings have allowed to explain why therapeutic treatments against cancer based on exogenous (extracellular) methionine deprivation are only partly successful and sometimes even ineffective, either because the whole tumor cells are initially methionine-independent, or because clones of methionine-independent tumor cells emerge with time and with the stage of development of cancer.
[0108] It has been found herein that combining (i) deprivation in extracellular methionine and (ii) inhibition of methionine synthase allows inhibiting cancer growth, either (i) of a tumor cell population comprising exclusively methionine-dependent tumor cells, (ii) or of a tumor cell population comprising exclusively methionine independent tumor cells and (iii) or of a tumor cell population comprising both methionine-dependent tumor cells and methionine independent tumor cells.
[0109] It has been shown herein that combining (i) deprivation in extracellular methionine and (ii) inhibition of methionine synthase acts synergistically against the growth of cancer cells. This synergistic combined action may allow to provide an efficient anti-cancer effect, including when (i) the cancer cells are not totally deprived in exogenous methionine and / or when (ii) inhibition of methionine synthase is not complete. Still further, it is shown herein that combining (i) deprivation in extracellular methionine and (ii) inhibition of methionine synthase does not solely affect cancer cell growth, but importantly also induces the cancer cells to enter into apoptosis.
[0110] These populations of tumor cells, and the resulting cancers affecting subjects, may be termed as being “methionine-self-sufficient” in the present disclosure thanks to their higher methionine synthase activity.
[0111] For the sake of clarity, combining (i) deprivation in extracellular methionine and (ii) inhibition of methionine synthase, according to the present disclosure, allows inhibiting growth either (i) of a tumor cell population comprising exclusively methionine-dependent tumor cells, (ii) a tumor cell population comprising exclusively methionine independent tumor cells and (iii) a tumor cell population comprising both methionine-dependent tumor cells and methionine independent tumor cells, and is consequently useful for treating all cancers, including all methionine-dependent cell-containing cancers and methionine- independent cell-containing cancers.
[0112] Again, as shown in the examples herein, combining deprivation in extracellular methionine and inhibition of methionine synthase has a synergistic effect on reducing or blocking tumor cells growth and on inducing tumor cell apoptosis.
[0113] Yet further, as it is illustrated in the examples, the combined treatment described above is believed to advantageously produce low, or even absent, undesirable effects in vivo. This is because it does not significantly impact the growth or the viability of non-tumor cells, such as skin fibroblasts, which have a lower requirement in methionine.
[0114] The present disclosure relates to a combination of (i) one or more methionine-depleting composition and of (ii) one or more direct or indirect inhibitors of methionine synthase for its use for treating cancer.
[0115] It concerns the combined use of (i) one or more methionine-depleting composition and of (ii) one or more direct or indirect inhibitor of methionine synthase for manufacturing a medicament for treating cancer in a subject. It pertains to a method for treating a cancer in a subject in need thereof comprising a step of depriving the said subject of exogenous methionine and administering to the said subject at least a direct or indirect methionine synthase inhibitor.
[0116] Definitions
[0117] The terms used in the present specification generally have their ordinary meaning in the art. Certain terms are discussed below, or elsewhere in the present disclosure, to provide additional guidance in describing the products and methods of the presently disclosed subject matter.
[0118] The following definitions apply in the context of the present disclosure.
[0119] As used in this specification and the appended claims, the singular forms “a”, “an” and “the” include plural referents unless the content clearly dictates otherwise.
[0120] The term “about” or “approximately” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, e.g., the limitations of the measurement system. For example, "about" can mean within 1 or more than 1 standard deviation, per the practice in the art. Alternatively, "about" can mean a range of up to 10% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5-folds, and more preferably within 2-folds, of a value. Where particular values are described in the application and claims, unless otherwise stated the term "about" meaning within an acceptable error range for the particular value should be assumed.
[0121] It is understood that aspects and embodiments of the present disclosure described herein include “comprising”, “having”, and “consisting of,” aspects and embodiments. The words “have” and “comprise,” or variations such as “has,” “having,” “comprises,” or “comprising,” will be understood to imply the inclusion of the stated element(s), such as a composition of matter or a method step, but not the exclusion of any other elements. The term “consisting of’ implies the inclusion of the stated element(s), to the exclusion of any additional elements. The term “consisting essentially of’ implies the inclusion of the stated elements, and possibly other element(s) where the other element(s) do not materially affect the characteristic(s) of the stated elements. It is understood that the different embodiments of the disclosure using the term “comprising” or equivalent cover the embodiments where this term is replaced with “consisting of’ or “consisting essentially of’.
[0122] As used herein, “administering” or “administered” means administration by any route, such as oral administration, administration as a suppository, topical contact, parenteral, intraperitoneal, intramuscular, intralesional, intrathecal, intranasal, subcutaneous or transmucosal (e.g., buccal, sublingual, palatal, gingival, nasal, vaginal, rectal, or transdermal) administration, or the implantation of a slow-release device, e.g., a mini- osmotic pump, to a subject, including parenteral. Parenteral administration includes intravenous, intramuscular, intra-arteriole, intradermal, subcutaneous, intraperitoneal, intraventricular, and intracranial.
[0123] As used herein, a “methionine-depleting” composition encompasses any composition of matter which, when administered to a subject, causes a drastic reduction in the amount of extracellular methionine that is available to the cells (in the cells environment, for example in the plasma), especially to the cancer cells. In other words, such a composition results in a decrease in plasmatic methionine concentration available to the cells in a subject (circulating methionine, supplied by the diet, known as exogenous methionine). Such composition permits to reduce the bioavailability of extracellular methionine to cells. A methionine- depleting composition according to the invention may be for example a methionine-reduced or -deprived diet. It could be for example, either a methionine-reduced or methionine- deprived parenteral diet, with fasting, or an oral diet reduced or deprived of methionine. According to the present disclosure, a drastic reduction of the amount of extracellular methionine that is available to the cells, especially to the cancer cells, include administering to the subject with a composition comprising, as regards the provision of amino acids, a mixture of amino acids substantially or totally devoid of methionine, the subject being fasting or on a methionine-free diet. A drastic reduction of the amount of extracellular methionine that is available to the cells, especially to the cancer cells, also encompasses a composition which, when administered to a subject, eliminate the methionine that may be present therein, such as for example by enzyme degradation of methionine when present, for example a composition comprising methioninase (that can be also termed “methionine gamma lyase”, “METase” or “MGL” herein) which acts on methionine via an alpha-gamma elimination reaction, that causes lowering extracellular methionine availability to cells, especially cancer cells, when administered to a subject. Typically, methioninase may originate from an organism selected from Clostridium novyi, C. freundii. C. sporogenes, Clostridium lelani. Brevibacterium auranliacum. Aspergillus flavipes and Methyl- obacterium sp. JUBTK33. Methioninase can be a recombinant gamma lyase. Action of methioninase can, in some embodiments, be targeted to specifically reduce free methionine in the tumor tissues without concurrent systemic methionine deprivation by administering to the subject for example an attenuated Salmonella strain engineered as a vehicle for METase over expression, as described by Zhou et al. (2023, Cell Rep Med, Vol. 4: 101070). Another example of a composition which, when administered to a subject, eliminates the extracellular methionine that may be present therein, is a composition comprising methionine synthesis inhibitors as disclosed in US patent n° US9200251B. Methionine synthesis inhibitors are inhibitors of enzymes that actually synthesize methionine de novo without homocysteine for a whole non-human organism. These inhibitors reduce the de novo synthesis of methionine for extracellular delivery. Mammals have no such enzyme, but bacteria do. According to the present disclosure, more that one methionine-depleting composition can be used.
[0124] The term “methionine gamma-lyase” and “methioninase” are interchangeable herein and mean the METase enzyme classified as EC 4.4.1.11. Methioninase catalyzes a reaction by starting from L-methionine as the substrate that is degraded into methanethiol, 2- oxonutanoate and NH3, respectively. More precisely, the two substrates of MGL are L- methionine and H2O, whereas its three products are methanethiol, NH3, and 2-oxobutanoate. This enzyme belongs to the family of lyases, specifically the class of carbon-sulfur lyases. The systematic name of this enzyme class is L-methionine methanethiol-lyase (deaminating 2-oxobutanoate-forming) or L-methionine-alpha-deamino-gamma-mercaptomethane-lyase. Other names in common use include L-methioninase, methionine lyase, methioninase, methionine dethiomethylase, L-methionine-gamma-lyase, and L-methionine methanethiol- lyase (deaminating). This enzyme participates in seleno-amino acid metabolism. It employs one cofactor, pyridoxal-5 '-phosphate.
[0125] The term “methionine synthase”, as used herein, means the cobalamin-dependent cytosolic enzyme methionine synthase classified as EC.2.1.1.13. Methionine synthase catalyzes the remethylation of homocysteine to methionine using 5-methyltetrahydrofolate as the methyl donor. As it is known in the art, methionine synthase activity requires the presence of methylcobalamin as a cofactor. Methionine synthase is an enzyme which enables the endogenous production of methionine within the cell. By “endogenous” production of methionine it is meant intra-cellular production of methionine.
[0126] As used herein, “inhibitor of methionine synthase” means an agent that causes reduction of the level of expression of the gene encoding methionine synthase (mammal, especially human, MTR gene) or of the synthesis of methionine synthase, or an agent that causes the inhibition of the enzymatic activity of methionine synthase. Thus, inhibitors of methionine synthase have the effect of reducing or stopping the production of endogenous methionine in cells (cell-autonomous synthesis of methionine). Illustratively, inhibitors of the level of production of methionine synthase include antisense oligonucleotides, such as siRNAs, shRNAs and IncRNA directed against the MTR messenger RNA. Further illustratively, inhibitors of methionine synthase include compounds of natural origin obtainable by extraction and purification and compounds obtained by chemical synthesis. Methionine synthase inhibitors also encompass compounds targeting its vitamin B12 cofactor availability or its association with the methionine synthase.
[0127] As used herein, a “direct inhibitor” of an enzyme, such as of methionine synthase, means an agent that causes inhibition of the activity of the said enzyme by direct interaction of the said inhibitor agent with this enzyme. Direct inhibitors of an enzyme also encompass agents that cause reduction of the level of expression of the gene encoding methionine synthase (human MTR gene) or of the synthesis of methionine synthase, such as antisense nucleotide, including siRNAs, shRNAs and IncRNA directed against the MTR messenger RNA. Further illustratively, direct inhibitors of an enzyme also include antibodies directed against the said enzyme and which inhibit its activity upon binding thereto.
[0128] As used herein, an “indirect inhibitor” of an enzyme, such as methionine synthase, means an agent that causes inhibition of the said enzyme by an indirect mechanism, such as acting for example on an inactive competitive cofactor of the said enzyme, or preventing the binding or effect of the active cofactor on the enzyme. Illustratively, indirect inhibitors of methionine synthase include direct inhibitors of CD320 which is the transcobalamin II receptor (also termed “TCblR”) which is responsible for the uptake of cobalamin (also termed “vitamin B12”), cobalamin (B12) consisting of the active cofactor of methionine synthase. Indirect inhibitors of methionine synthase also encompass B12 antagonists, which include vitamin B12-like antagonist agents, lactam derivatives, etc.
[0129] A “short hairpin RNA” or “shRNA” includes a short RNA sequence that makes a tight hairpin turn that can be used to silence gene expression via RNA interference. The shRNAs of the disclosure may be chemically synthesized or transcribed from a transcriptional cassette in a DNA plasmid or vector. Non-limiting examples of shRNA include a doublestranded polynucleotide molecule assembled from a single-stranded molecule, where the sense and antisense regions are linked by a nucleic acid-based or non-nucleic acid-based linker; and a double-stranded polynucleotide molecule with a hairpin secondary structure having self-complementary sense and antisense regions. In preferred embodiments, the sense and antisense strands of the shRNA are linked by a loop structure comprising from about 1 to about 25 nucleotides, from about 2 to about 20 nucleotides, from about 4 to about 15 nucleotides, from about 5 to about 12 nucleotides, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more nucleotides. Additional shRNA sequences include, but are not limited to, asymmetric shRNA precursor polynucleotides such as those described in PCT Publication Nos. WO 2006 / 074108 and WO 2009 / 076321. Suitable shRNA sequences can be identified, synthesized, and modified using any means known in the art for designing, synthesizing, and modifying siRNA sequences. In certain embodiments, shRNAs may silence one or more methionine synthesis pathway genes, such as the MTR gene.
[0130] A “small-interfering RNA” or “siRNA,” includes interfering RNA of about 15-60, 15-50, or 15-40 (duplex) nucleotides in length. Examples of siRNA include, without limitation, a double-stranded polynucleotide molecule assembled from two separate stranded molecules, wherein one strand is the sense strand and the other is the complementary antisense strand; a double-stranded polynucleotide molecule assembled from a single stranded molecule, where the sense and antisense regions are linked by a nucleic acid-based or non-nucleic acidbased linker; a double-stranded polynucleotide molecule with a hairpin secondary structure having self-complementary sense and antisense regions; and a circular single-stranded polynucleotide molecule with two or more loop structures and a stem having self- complementary sense and antisense regions, where the circular polynucleotide can be processed in vivo or in vitro to generate an active double-stranded siRNA molecule. As used herein, the term “siRNA” includes RNA-RNA duplexes as well as DNA-RNA hybrids (see, e.g., PCT Publication No. WO 2004 / 078941). siRNA may be chemically synthesized. siRNA can also be generated by cleavage of longer dsRNA (e.g., dsRNA greater than about 25 nucleotides in length) with the E. coli RNase III or Dicer. Preferably, dsRNA are at least 50 nucleotides to about 100, 200, 300, 400, or 500 nucleotides in length. The dsRNA can encode for an entire gene transcript or a partial gene transcript. In certain instances, siRNA may be encoded by a plasmid (e.g., transcribed as sequences that automatically fold into duplexes with hairpin loops).
[0131] A “long non coding RNA” or “IncRNA” includes a long RNA sequence that adopt a structure that can be used to silence gene expression via RNA interference.
[0132] As used herein, “CD320” is the transcobalamin II receptor (also termed “TCblR”) which is responsible for the uptake of circulating cobalamin (also termed “vitamin B12”). CD320 amino acid sequence may be found in UniprotK database under the acess n° Q9NPF0 - CD320 HUMAN. Human CD320-encoding nucleic acid sequence may be found in the HUGO database under the access n° HGNC-16692.
[0133] As used herein, the term “aptamer” refers to oligonucleic acid or peptide molecules that bind to a specific target molecule. Aptamers are small molecules that bind to one or more analyte members. Aptamers are SELEX (Stoltenburg, R. et al. (2007), Biomolecular Engineering 24, pages 381-403; Tuerk, C. et al., Science 249, pages 505-510; Bock, LC et al. (1992), Nature 355, 564-566) or non-SELEX (Berezovski, M. et al. (2006), Journal of the American Chemical Society 128, 1410-1411). The aptamer is preferably a peptide aptamer or an oligonucleotide aptamer.
[0134] The term “oligonucleotide aptamer” as used herein refers to a DNA or RNA oligonucleotide that: 1) is typically identified originally using an in vitro selection process, for example but not limited to the “systematic evolution of ligands by exponential enrichment” (SELEX) process or a variation thereof, and 2) recognizes and binds to a binding partner, for example but not limited to an enzyme, such as methionine synthase, in a highly specific, conformation-dependent manner. As used herein, the term “gene” refers to a nucleic acid (e.g., DNA or RNA) sequence that comprises partial length or entire length coding sequences necessary for the production of a polypeptide or precursor polypeptide, in particular involved in the production of methionine.
[0135] As used herein, "antibody" refers to immunoglobulins or immunoglobulin-like molecules including by way of example and without limitation, IgA, IgD, IgE, IgG and IgM, combinations thereof, and similar molecules produced during an immune response in any vertebrate, for example, in mammals such as humans, camelidaes, goats, rabbits and mice, as well as non-mammalian species, such as shark immunoglobulins. The term “antibody” includes both naturally occurring and non-naturally occurring antibodies. Specifically, "antibody" includes polyclonal and monoclonal antibodies, and monovalent and divalent fragments or portions thereof. Furthermore, "antibody" includes chimeric antibodies, wholly synthetic antibodies, single chain antibodies, and fragments or portions thereof. The antibody may be a human or nonhuman antibody. A nonhuman antibody may be humanized by recombinant methods to reduce its immunogenicity in human.
[0136] As used herein, "pharmaceutically" or "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to a mammal, especially a human, as appropriate. A pharmaceutically acceptable carrier or excipient refers to a non-toxic solid, semi-solid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type. By way of example of pharmaceutically acceptable carrier, sterile water, saccharides such as sucrose or saccharose, starches, sugar alcohols such as sorbitol, polymers such as PVP or PEG, lubricating agents, such as magnesium stearate, preservatives, dyeing agents or flavors can be mentioned.
[0137] As used herein, the term “subject” refers to a mammal. Mammals include, but are not limited to, domesticated animals (e.g., cows, sheep, cats, dogs, and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats). Preferably, the subject refers to a human.
[0138] As used herein, “subject in need thereof’ refers to a living organism suffering from or prone to a cancer disease or condition that can be treated by a method according to the present disclosure. Typically, a subject in need thereof according to the disclosure refers to any subject, preferably a human, affected by, or susceptible to be affected by, a cancer exhibiting 1 independence to methionine, including independence to exogenous methionine and / or independence to exogenous methionine and dependence to endogenous tumor cell production of methionine. In some embodiments, the term “subject” refers to any subject affected by, or susceptible to be affected by, cancer types dependent to both exogenous methionine and tumor cell production of methionine (which may also be termed “methionine-self-sufficient” cancer herein) and including, among other cancers, pancreatic adenocarcinoma, melanoma, colon adenocarcinoma, lung adenocarcinoma, leiomyosarcoma, glioblastoma, bladder cancer and acute myeloid leukemia.
[0139] By a "therapeutically effective amount" of an active agent of the present disclosure is meant a sufficient amount of the said active agent for treating cancer at a reasonable benefit / risk ratio applicable to any medical treatment. The specific amount that is therapeutically effective can be readily determined by an ordinary medical practitioner and may vary depending on factors such as the type and stage of pathological processes considered, the subject’s medical history and age, and the administration of other therapeutic agents. The specific therapeutically effective dose level for any particular subject will depend upon a variety of factors including the disorder being treated and the severity of the disorder; activity of the specific active agent employed; the specific composition employed, the age, body weight, general health, comorbidities (like renal or hepatic insufficiency), sex and diet of the subject; the time of administration, route of administration, and rate of excretion of the specific active agent employed; the duration of the treatment; drugs used in combination or coincidental with the specific active agent employed; and like factors well known in the medical arts. For example, it is well within the skill of the art to start doses of the active agent at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. For example, treatment of cancer may involve a reduction in the size of a tumor, a reduction in the invasiveness of a tumor, reduction in the growth rate of the cancer, or prevention of metastasis. Treatment of cancer may also refer to prolonging survival of a subject with cancer.
[0140] The terms “treat” or “treatment” or “therapy” in the present disclosure refer to the administration or consumption in a subject in need thereof of combination of (i) a methionine-depleting composition and of (ii) one or more direct or indirect inhibitor of methionine synthase and (iii) optionally a further cancer treatment such as a hypomethylating agent, or a pharmaceutical composition adapted for the administration of a combination of (i) a methionine-depleting composition and of (ii) one or more direct or indirect inhibitor of methionine synthase and (iii) optionally a further cancer treatment such as a hypomethylating agent of the present disclosure, thus with an exogenous and endogenous methionine deprivation of cancer cells according to the present disclosure, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve, or affect a cancer disorder as described herein, the symptoms of the condition, or to prevent or delay the onset of the symptoms, complications, or otherwise arrest or inhibit further development of the cancer disorder. More particularly, “treating” or “treatment” includes any approach for obtaining beneficial or desired results in a subject’s cancer condition. The treatment may be administered to a subject having a cancer exhibiting both exogenous and endogenous methionine dependance or who ultimately may acquire the cancer exhibiting both exogenous and endogenous methionine dependance as it grows. Beneficial or desired clinical results can include, but are not limited to alleviation or amelioration of one or more cancer symptoms or conditions, diminishment or reduction of the extent of a cancer disease or of a cancer symptom, stabilizing, z.e., not worsening, the state of a cancer disease or of a cancer symptom, prevention of a cancer disease or of a cancer symptom’s spread, delay or slowing of cancer disease or cancer symptom progression, amelioration or palliation of the cancer disease state, diminishment of the reoccurrence of cancer disease, and remission, whether partial or total and whether detectable or undetectable. In other words, "treatment" as used herein includes any cure, amelioration, or reduction of a cancer disease or symptom. A “reduction” of a symptom or a disease means decreasing of the severity or frequency of the disease or symptom, or elimination of the disease or symptom.
[0141] The list of sources, ingredients and components set forth in the present disclosure are understood to be described such that all combinations and mixtures thereof are also contemplated within the scope of the present disclosure.
[0142] It is understood that each maximum numerical limitation given in the disclosure encompasses each lower numerical limitation, as if such lower numerical limitations were expressly written. Each minimum numerical limitation given throughout the description encompasses each higher numerical limitation, as if such higher numerical limitations were expressly written herein. Each numerical range given throughout the present disclosure encompasses each narrower numerical range included within such wider numerical range, as if such narrower numerical ranges were all expressly written therein.
[0143] It may be referred to trade names of components comprising various ingredients used in the present description. The present disclosure does not intend to be limited to materials under any particular trade name. Equivalent materials (e.g., those obtained from a different source under a different name or reference number) to those indicated herein by trade name may be substituted and used in the present disclosure.
[0144] Description
[0145] The present disclosure relates to a combination of (i) one or more methionine-depleting composition and of (ii) one or more direct or indirect inhibitors of methionine synthase for their combined use for treating cancer.
[0146] Methionine-depleting compositions
[0147] According to the present disclosure, a methionine-depleting composition consists of a composition which, when administered to a subject in need thereof who is affected with cancer, deprives in methionine the said subject and thus the cancer cells of the said subject, or at least substantially deprives the said subject and thus the cancer cells of the said subject, of an exogenous supply of methionine. In other words, such methionine-depleting composition, when administered to a subject in need thereof who is afflicted with cancer, decreases the extracellular methionine levels (plasma methionine levels) in the subject and thus deprives the said subject and its cancer cells, of an extracellular supply of methionine.
[0148] In some embodiments, a combination according to the present disclosure comprises one methionine-depleting composition.
[0149] In some other embodiments, a combination according to the present disclosure comprises more than one methionine-depleting composition, such as two methionine- depleting compositions. For example, a combination according to the present disclosure can comprise (i) a methionine-deprived composition and (ii) a methionine degrading composition. Methionine-deprived compositions and methionine-degrading compositions are described elsewhere in the present specification. A methionine-deprived composition according to the invention may be for example a methionine-reduced or a methionine-deprived (methionine- free) diet. Such a diet is preferably the only diet of the subject in need thereof. It could be for example, either a methionine-reduced or methionine-deprived parenteral diet, with fasting, or an oral diet reduced or free of methionine.
[0150] As used herein, a cancer cell deprived of methionine means that the extracellular environment of the cancer cell fails to provide an adequate supply of methionine needed to allow a normal development of a methionine-dependent tumor in the subject.
[0151] According to the present disclosure, a deprivation of cancer cells in extracellular supply in methionine may be performed according to any method known by the skilled person that avoid or limit the entry of extracellular methionine molecule within cancer cell. In some embodiments, a methionine deprivation of cancer cells of a subject may comprise a deprivation or reduction of any source of methionine in a subject, by (i) an administration of a methionine-deprived composition to a subject, and / or (ii) an administration of a composition that causes methionine degradation in the body and / or an administration of a composition that limits and / or prevents methionine’s entry into the cells.
[0152] Embodiments of methionine-depleting compositions according to the disclosure are selected from (i) methionine-deprived compositions and (ii) methionine-degrading compositions.
[0153] Methionine-deprived compositions
[0154] In some embodiments, cancer cells of a subject in need thereof may be deprived of extracellular methionine. In some embodiments, a methionine-deprived composition may be administered to a subject in need thereof. In some embodiments, a unique methionine- deprived composition may be administered the subject during a certain period of treatment, possibly by another route than the oral route, such as by a parenteral route like by the intravenous route.
[0155] According to some embodiments of a methionine-depleting composition of the present disclosure, the cancer subject to be treated is given a composition comprising the normal requirements in amino acids, especially in the essential amino acids except for methionine, which methionine is provided in an amount substantially lower that the commonly admitted nutritional requirements in methionine, so as to at least partly deplete the subject’s body, and thus the cancer cells present in the subject’s body, of extracellular methionine.
[0156] In some embodiments, a methionine-depleting composition consists of a composition for providing, including by parenteral administration, an amino acid-containing diet to a subject affected with a cancer, wherein the said amino acid-containing diet comprises a mixture of amino acids containing a very low amount of methionine or even no methionine. This methionine-depleting composition is preferably the only diet of said subject, meaning that the subject, preferably a fasting subject, doesn't eat anything other than this diet.
[0157] As it is recurrently admitted in the art, nine amino acids, i.e. histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan and valine, are known as dietarily essential or indispensable nutriments.
[0158] In some embodiments, a methionine-depleting composition according to the present disclosure comprises at least (i) histidine, isoleucine, leucine, lysine, phenylalanine, threonine, tryptophan and valine in a respective amount suitable for providing a daily intake of each of these amino acids as it is physiologically required for ensuring nutritional need and (ii) methionine in an amount substantially lower than the amount necessary for providing a daily intake of methionine that is physiologically required.
[0159] Illustratively, as it is admitted in the art, the estimated daily supply requirement in essential amino acids for human subjects, partly determined by the World Health Organization (WHO, 1985 Energy and Protein Requirements. Report of a Joint FAO / WHO / UNU Expert Consultation. Technical Report Series 724. World Health Organization, Geneva. 206 pp.) can be about the requirement that is described in table 1 hereunder.
[0160] Table 1 : essential amino acid requirements
[0161] (a) derived from Fomon and Filer (1967, Amino acid requirements for normal growth: 391-401 in W.L. Nyhan, Editor, ed. Amino Acid Metabolism and Genetic Variation. McGraw-Hill, New York)
[0162] (b) derived from Pineda et al. (1981, Protein quality in relation to estimates of essential amino acids requirements. Pp. 29-42 in C.E. Bodwell, editor; , J.S. Adkins, editor; , and D.T. Hopkins, editor. , eds. Protein Quality in Humans: Assessment and In Vitro Estimation. AVI Publishing, Westport, Conn)
[0163] (c) from Williams et al. (1974, Nitrogen and amino acid requirements. Pp. 23-63 in Improvement of Protein Nutriture. Report of the Committee on Amino Acids, Food and Nutrition Board. National Academy of Sciences, Washington, D.C)
[0164] (d) from several investigators (reviewed in FAO / WHO, 1973, Energy and Protein Requirements. Report of a Joint FAO / WHO Ad Hoc Expert Committee. Technical Report Series No. 552; FAO Nutrition Meetings
[0165] Report Series 52. World Health Organization, Rome. 118 pp.)
[0166] ND : Not Determined
[0167] In some embodiments, a methionine-depleting composition is a methionine-deficient composition comprising an amount of methionine suitable for a methionine daily intake of about 5 mg or less per kg of body weight, preferably for a methionine daily intake of about 0,1 to 5 mg per kg of body weight. Preferably, the said methionine-depleting composition further comprises at least an amount of each of histidine, isoleucine, leucine, lysine, phenylalanine, threonine, tryptophan and valine in an amount sufficient for a daily intake of each of these amino acids providing a regular nutritional need, as known by the skilled artisan.
[0168] In some embodiments, the methionine-depleting composition does not comprise methionine.
[0169] As it is known in the art, the non-essential amino acids are alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, proline, serine and tyrosine, respectively.
[0170] In some embodiments, a methionine-depleting composition according to the present disclosure further comprises a combination of one or more non-essential amino acids selected from alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, proline, serine and tyrosine.
[0171] In some of these embodiments, a methionine-depleting composition according to the present disclosure further comprises a combination of each of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, proline, serine and tyrosine.
[0172] In some other embodiments, a methionine-depleting composition further comprises a combination of one or more non-essential amino acids selected from alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, proline, serine and tyrosine. Such a combination of non-essential amino acids can comprise from one to all non- essential amino acids, such as can comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 of the listed non- essential amino acids. In some of these other embodiments, a methionine-depleting composition can comprise one or more non-essential amino acids except for arginine. According to such other embodiments, a methionine-depleting composition encompasses a composition further comprising each of alanine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, proline, serine and tyrosine, and thus does not comprise arginine, or alternatively comprises a low amount of arginine.
[0173] Providing a subject affected with a cancer with a methionine-depleting composition causes the cancer cells to be deprived, or at least substantially deprived, of a source of exogenous methionine. Thus, providing a methionine-depleting composition to the said cancer subject involves a drastic or substantial reduction in the plasma methionine level of said subject and thus, in the provision of extracellular methionine to cancer cells.
[0174] Thus, in some embodiments, cancer cells of a subject in need thereof may be deprived of extracellular methionine, including substantially deprived in extracellular methionine and totally deprived in extracellular methionine. In some embodiments, a subject in need thereof may be fed, including by parenteral administration, with a methionine-deprived composition. In some embodiments, the subject may be fed, including by parenteral administration, with a unique methionine-deprived composition which is, except for the supply in methionine, nutritionally complete, during a selected period of time of treatment.
[0175] In some embodiments, a methionine-deprived composition of the present disclosure may be on purpose manufactured by mixing the desired required amounts of each of histidine, isoleucine, leucine, lysine, phenylalanine, threonine, tryptophan and valine, and a desired low amount of methionine. In some embodiments, one or more of alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, proline, serine and tyrosine are also mixed in respective desired amounts.
[0176] In some other embodiments, a methionine-deprived composition of the present disclosure may be on purpose manufactured by hydrolyzing a protein source, e.g.by a known method of enzyme or chemical protein hydrolysis, and then depleting the resulting amino acid mixture in methionine by any known method, such as by (i) enzymatically degrading methionine, such as by using methioninase, (ii) by fractional precipitation, (iii) or by chromatography such as by ion exchange chromatography or high performance liquid chromatography (HPLC).
[0177] In some embodiments, a methionine-deprived composition according to the present disclosure can be a nutritionally complete composition, except as regards the reduced amount of, or absence of, methionine.
[0178] A methionine-deprived composition according to the present disclosure may comprise one or more of a variety of additional components. Non-limiting examples of components that can be incorporated in the methionine-deprived composition may be selected from: carbohydrates, fatty acids, water, crude fat, crude fibers, nitrogen-free extract (NFE), ash, minerals, vitamins, oligo-elements, electrolytes, or condiments.
[0179] Carbohydrate comprised in the methionine-deprived composition of the present disclosure encompasses a mixture of polysaccharides and sugars. Carbohydrates can be supplied under the form of any of a variety of carbohydrate sources known by those skilled in the art, including starch (any kinds, corn, wheat, barley, etc.) beet pulp (which contain a bit of sugars), and psyllium.
[0180] Vitamins comprised in the methionine-deprived composition of the present disclosure may encompass vitamin A, vitamins B, vitamin C, vitamin D, vitamin E, vitamin K or a mixture thereof. Vitamins B encompass vitamin Bl, vitamin B2, vitamins B3 (PP), vitamin B5, vitamin B6, vitamin B8, vitamin B9, vitamin B 12, or a mixture thereof.
[0181] Illustratively, a source of vitamins may be the Cemevit® composition which comprises vitamin A, vitamin Bl, vitamin B2, vitamin B3, vitamin B5, vitamin B6, vitamin B8, vitamin B9, vitamin B12, vitamin C, vitamin D, and vitamin E.
[0182] Oligo-elements comprised in the methionine-deprived composition of the present disclosure may encompass arsenic, bore, chlore, chrome, cobalt, copper, iron, fluor, iodine, lithium, manganese, molybdenum, nickel, selenium, silicon, sulfur, vanadium, zinc, or a mixture thereof.
[0183] Illustratively, a source of oligo-elements may be the Nutryelt® composition which comprises iron, copper, manganese, zinc, fluor, iodine, selenium, chrome and molybdenum.
[0184] Electrolytes comprised in the methionine-deprived composition of the present disclosure may encompass potassium, sodium, calcium, magnesium, chloride, phosphorus, salt thereof, or a mixture thereof.
[0185] Illustratively, electrolytes which may be present in the methionine-deprived composition of the present disclosure may be NaCl and / or KC1.
[0186] In some embodiments, a methionine-deprived composition of the present disclosure may further comprise additional components such as, antioxidants, chelating agents, osmolality modifiers, buffers, neutralization agents and the like that improve the stability, uniformity and / or other properties of the methionine-deprived composition.
[0187] Thus, when used in combination with a methionine synthase inhibitor of the present disclosure, the methionine-deprived composition according to the present disclosure is preferably administered to a subject at a methionine dosage suitable for a methionine daily intake of less than about 5 mg / kg of body weight, such as suitable for a methionine daily intake of less than about 2 mg / kg of body weight. In some embodiments, the methionine- deprived composition according to the present disclosure, when used in combination with a methionine synthase inhibitor of the present disclosure, can be administered at a methionine dosage suitable for a methionine daily intake ranging from 0 mg / kg of body weight to about 5 mg / kg of body weight, which includes from about 0.1 mg / kg of body weight to about 4 mg / kg of body weight.
[0188] Particularly, the methionine-deprived composition according to the present disclosure may be administered, when methionine is present, at a dosage of suitable for a methionine daily intake of about 0.1 mg / kg, about 0.2 mg / kg, about 0.3 mg / kg, about 0.4 mg / kg, about 0.5 mg / kg, about 0.6 mg / kg, about 0.7 mg / kg, about 0.8 mg / kg, about 0.9 mg / kg, about 1.0 mg / kg, about 1.1 mg / kg, about 1.2 mg / kg, about 1.3 mg / kg, about 1.4 mg / kg, about 1.5 mg / kg, about 1.6 mg / kg, about 1.7 mg / kg, about 1.8 mg / kg, about 1.9 mg / kg, about 2.0 mg / kg, about 2.1 mg / kg, about 2.2 mg / kg, about 2.3 mg / kg, about 2.4 mg / kg, about 2.5 mg / kg, about 2.6 mg / kg, about 2.7 mg / kg, about 2.8 mg / kg, about 2.9 mg / kg, about 3.0 mg / kg, about 3.1 mg / kg, about 3.2 mg / kg, about 3.3 mg / kg, about 3.4 mg / kg, about 3.5 mg / kg, about 3.6 mg / kg, about 3.7 mg / kg, about 3.8 mg / kg, about 3.9 mg / kg, about 4.0 mg / kg, about 4.1 mg / kg, about 4.2 mg / kg, about 4.3 mg / kg, about 4.4 mg / kg, about 4.5 mg / kg, about 4.6 mg / kg, about 4.7 mg / kg, about 4.8 mg / kg, about 4.9 mg / kg, or about 5.0 mg / kg of body weight.
[0189] It is intended that a skilled person knows how to adjust the dosage of methionine-deprived composition depending on the route of administration, the weight, age, gender of the patient to be treated, as well as depending on possible preexisting conditions to consider, and possible additional treatment administered. In some embodiments, the methionine-deprived composition of the disclosure may be administered by infusion, subcutaneous, intradermal, intramuscular, or intraperitoneal injection, inhalation, or oral administration, in particular by infusion.
[0190] Most preferably, a methionine-deprived composition according to the present disclosure is administered parenterally, especially by the intravenous route.
[0191] Most preferably, a subject who is administered a methionine-deprived composition according to the present disclosure, is subjected to fasting during the time period of administration of the composition.
[0192] In certain embodiments, the methionine-deprived composition of the disclosure may be administered to a subject once or twice a day.
[0193] In embodiments wherein the methionine-deprived composition is administered parenterally, such as by the intravenous route, once a day, the said composition may be administered for a time period ranging from 5h to 24h, such as ranging from 8h to 12h.
[0194] In particular, a methionine-deprived composition may be a feeding regime determined by the skilled person which may adapt the feeding regime each day of the subject in order to limit the intake of methionine in the diet administered to the subject during a given period of treatment.
[0195] In certain embodiments, the methionine-deprived composition is provided as a separate food ingredient.
[0196] In certain other embodiments, the methionine-deprived composition is comprised in a mixture comprising one or more other food ingredients, in a methionine-deprived food composition.
[0197] All or part of the particular features and embodiments relating to the methionine-deprived composition according to the present disclosure, also apply to the intended uses and methods of the present disclosure.
[0198] Methionine-degrading compositions In some embodiments, a methionine-depleting composition according to the present disclosure consists of a methionine-degrading composition.
[0199] A methionine-degrading composition according to the present disclosure comprises one or more agents that degrade methionine, such as one or more enzymes that degrade methionine.
[0200] Most preferably, a methionine-depleting composition according to the present disclosure comprises methionine gamma-lyase (EC 4.4.1.11).
[0201] In some embodiments, the methionine gamma-lyase is purified from a natural source.
[0202] According to these embodiments, the methionine gamma-lyase can be purified from the culture of a variety of microorganisms, for example microorganism selected from (i) bacteria such as Clostridium porogenes, Pseudomonas ovalis. Pseudomonas putida, Aeromonas sp., Citrobacter intermedins, Brevibacterium linens, Citrobacter freundii, Porphyromonas gingivalis , Micrococcus luteus, Arthrobacter sp., Corynebacterium glutamicum and Staphylococcus equorum and Treponema denticola , (ii) parasitic protozoa such as Trichomonas vaginalis, Entamoeba histolytica and (iii) a model plant Arabidopsis thaliana.
[0203] In some other embodiments, the methionine gamma-lyase is obtained by genetic engineering techniques, i.e. is a recombinant methionine gamma-lyase. Recombinant methionine gamma-lyase compositions are preferred because they comprise a highly purified enzyme that is substantially devoid of impurities.
[0204] Illustratively, the gene encoding methionine gamma-lyase from Pseudomonas putida has been cloned into A. coli and the protein was expressed at a high protein yield (Tan et al., 1997a, Protein Express. Purif., Vol. 9: 233-245, Hori et al., 1996, Cancer Res, Vol. 56: 2116- 2122).
[0205] Production of L-m ethionine gamma-lyase using gene recombinant technique is known in the art. A plurality of recombinant methionine gamma-lyase are commercially available. It may be cited the following (i) Creative Biogene company, under catalog number MBS-0675, (ii) Creative Enzymes company, under catalog number NATE-0414 or (iii) Abeam company, under catalog number ab286034. According to the prior art knowledge of the skilled artisan, no toxicity was detected at effective doses of methionine gamma-lyase, as was determined notably by an absence of weight loss in the animals.
[0206] In accordance with certain aspects of the present disclosure, a composition comprising methionine gamma-lyase is in a from suitable for being administered intravenously, intradermally, intraarterially, intraperitoneally, intratumorally, intracranially, intraarticularly, intraprostaticaly, intrapleurally, intrasynovially, intratracheally, intranasally, intravitreally, intravaginally, intrarectally, intramuscularly, subcutaneously, subconjunctival, intravesicularly, mucosally, intrapericardially, intraumbilically, intraocularly, orally, topically, by inhalation, infusion, continuous infusion, localized perfusion, via a catheter, via a lavage, in lipid compositions (e.g., liposomes), pegylated, encapsulated, e.g. encapsulated in erythrocytes such as described in WO 2015 / 121348, or by other method or any combination of the forgoing as would be known to one of ordinary skill in the art.
[0207] In preferred embodiments, a methionine-depleting composition according to the present disclosure is a methionine-degrading composition comprising methionine gamma-lyase and is under a form suitable for parenteral administration, such as by the intravenous route.
[0208] The amount of gamma-lyase to be comprised in this embodiment of a methionine-depleting composition according to the present disclosure can be easily determined by the skilled person according to its general technical background knowledge. Further, methods for quantifying the amount of gamma-lyase in a composition are also known in the art.
[0209] Determination of methionine gamma-lyase activity may be achieved using assays familiar to those of skill in the art, particularly with respect to the protein enzymatic activity. For example, the methionine gamma-lyase activity may be determined by any assay to detect the production of any substrates resulting from conversion of methionine, such as alphaketobutyrate, methanethiol, and / or ammonia.
[0210] A therapeutically effective amount of methionine gamma-lyase is a predetermined amount calculated to achieve the desired effect, z.e., to deplete methionine in the tumor tissue or in a patient's circulation, and thereby, when used in combination with a methionine synthase inhibitor, cause the tumor cells to stop dividing, and possibly induce tumor cell apoptosis. Thus, the dosage ranges for the administration of methionine gamma-lyase are those large enough, when used in combination with a methionine synthase inhibitor, to produce the desired effect in which the symptoms of tumor cell division and cell cycling are reduced. The dosage should not be so large as to cause adverse side effects, such as hyperviscosity syndromes, pulmonary edema, congestive heart failure, and the like. The dosage will typically vary based on patient’s age, sex, overall health condition, and extent of the disease and can be determined by one of skill in the art. The dosage can be adjusted by the individual physician in the event of any complication.
[0211] For example, a therapeutically effective amount of a methionine gamma-lyase, when expressed on a daily basis for oral administration, can range from 50 to 1000 units, such as from 100 to 500 units, which therapeutically effective amount can be administered as a single dose or instead be administered through a plurality of fractionated doses, such as for an oral administration twice daily.
[0212] Also illustratively, a therapeutically effective amount of a methionine gamma lyase, when expressed on a daily basis for parenteral administration, especially for intravenous administration, can range from 5000 to 20000 units.
[0213] Such a dose range generally allows reaching a gamma lyase plasma concentration ranging from 0.1 to 0.4 units / mL plasma.
[0214] In other embodiments, it can also be used agents that degrade methionine synthase by targeting methionine synthase to the lysosome or to the proteasome, such as signal peptides, ubiquitnylating agents, chemical protein trafficking inhibitors, etc.
[0215] All or part of the particular features and embodiments relating to the methionine-degrading composition according to the present disclosure, also apply to the intended uses and methods of the present disclosure.
[0216] Methionine synthase inhibitors
[0217] According to the present disclosure, the methionine-depleting composition is combined with one or more methionine synthase inhibitors, to treat subjects afflicted with cancer. As already explained in the description, methionine synthase inhibitors have the effect of reducing or stopping the production of intra-cellular methionine in cells for their own use.
[0218] In some embodiments, the said methionine synthase inhibitors consist of direct methionine synthase inhibitors. In some other embodiments, the said methionine synthase inhibitors consist of indirect methionine synthase inhibitors.
[0219] Direct methionine synthase inhibitors
[0220] In some embodiments, the methionine synthase inhibitor is a direct methionine synthase inhibitor.
[0221] Direct methionine synthase inhibitors encompass agents that prevent, at least partly, the expression of the methionine synthase-encoding gene (the MTR gene), agents that prevent, at least partly, the production of the protein from the gene expression products thereof (e.g. messenger RNAs thereof) and agents that inhibit, at least partly, the enzymatic activity of the methionine synthase.
[0222] Numerous methionine synthase inhibitors known in the art may be used in accord with the present disclosure.
[0223] The direct methionine synthase inhibitors can be selected from an inhibitory antibody directed against methionine synthase, an inhibitory protein aptamer directed against methionine synthase, a nucleic acid aptamer directed against methionine synthase, an antisense oligonucleotide directed against the MTR gene, or a siRNA directed against a A / ZR-encoding mRNA.
[0224] In some embodiments, the direct methionine synthase inhibitor is an antisense oligonucleotide directed against MTR gene or a transcription product thereof.
[0225] The anti-sense oligonucleotides have the biological effect to inhibit the expression of a gene, in particular a gene coding for the expression of methionine synthase, i.e. the MTR gene. Anti-sense oligonucleotides, including anti-sense RNA molecules, such as siRNAs, shRNAs, IncRNA, and anti-sense DNA molecules, would act to directly block the translation of, or degrade the mRNA by binding thereto and thus preventing protein translation or increasing mRNA degradation, thus decreasing the level of proteins, and thus activity, in a cell. For example, antisense oligonucleotides of at least about 15 bases and complementary to unique regions of the mRNA transcript sequence encoding methionine synthase can be synthesized, e.g, by conventional phosphodiester techniques and administered by e.g, intravenous injection or infusion. Methods for using anti-sense techniques for specifically alleviating gene expression of genes whose sequence is known are well known in the art (e.g. see U.S. Pat. Nos. 6,566,135; 6,566,131; 6,365,354; 6,410,323; 6,107,091; 6,046,321; and 5,981,732).
[0226] Further, anti-sense oligonucleotides may be a single guide RNA (sgRNA). A custom sgRNA is used in the CRISPR / Cas system, especially the CRISPR / Cas9 system. CRISPR / Cas9 is a flexible gene editing tool, allowing the genome to be manipulated in diverse ways. For instance, CRISPR / Cas9 has been successfully used to knockout genes, knock-in mutations, overexpress or inhibit gene activity, and provide scaffolding for recruiting specific epigenetic regulators to individual genes and gene regions. A custom single guide RNA (sgRNA) contains a targeting sequence (crRNA) and a Cas9 nuclease-recruiting sequence (tracrRNA). The crRNA region is a 20-nucleotide sequence that is homologous to a region in the target gene, in particular the MTR gene, and will direct Cas9 nuclease activity (see e.g. Gilbert etal., Cell. 2013 Jul 18; 154(2):442-51, Platt etal., Cell. 2014 Oct 9; 159(2):440-55). Indeed, other CAS nucleases can be used, such as Cas 12a, Cas 12b, Cast 2c and Cas 13.
[0227] In some embodiments, the direct methionine synthase inhibitor of the present disclosure may be an anti-sense oligonucleotide, in particular an anti-sense oligonucleotide directed to the gene or mRNA coding for methionine synthase, i.e. the MTR gene.
[0228] In some embodiments, an anti-sense oligonucleotide according to the present disclosure may be a siRNA, a shRNA, IncRNA or a sgRNA,
[0229] In some preferred embodiments, an anti-sense oligonucleotide according to the present disclosure is a shRNA.
[0230] In some embodiments, the direct methionine synthase inhibitor is a siRNA directed against a AZZ -encoding mRNA. In some embodiments, the said siRNA comprises a nucleic acid sequence selected from SEQ ID NO. 1, SEQ ID NO. 2 or SEQ ID NO. 3 In some embodiments, the said direct methionine-synthase inhibitor comprises two of the three specified siRNAs or even the three specified siRNAs.
[0231] Anti-sense oligonucleotides of the present disclosure may be delivered in vivo alone or in association with a vector. In its broadest sense, a "vector" is any vehicle capable of facilitating the transfer of the anti-sense oligonucleotide or ribozyme nucleic acid to the cells, preferably cancer cells expressing methionine synthase. Preferably, the vector transports the nucleic acid to cells with reduced degradation relative to the extent of degradation that would result in the absence of the vector. In general, the vectors useful in the present disclosure include, but are not limited to, plasmids, phagemids, viruses, exosomes, nanoparticles, as well as other vehicles derived from viral or bacterial sources that have been manipulated by the insertion or incorporation of the anti-sense oligonucleotide or ribozyme nucleic acid sequences. Viral vectors are a preferred type of vector and include, but are not limited to nucleic acid sequences from the following viruses: retrovirus, such as moloney murine leukemia virus, harvey murine sarcoma virus, murine mammary tumor virus, and rouse sarcoma virus; adenovirus, adeno-associated virus; SV40-type viruses; polyoma viruses; Epstein-Barr viruses; papilloma viruses; herpes virus; vaccinia virus; polio virus; and RNA virus such as a retrovirus. One can readily employ other vectors not named but known to the art.
[0232] Preferred viral vectors may be based on non-cytopathic eukaryotic viruses in which non- essential genes have been replaced with the gene of interest, the adenoviruses and adeno- associated viruses.
[0233] Other preferred vectors may be plasmid vectors. Plasmid vectors have been extensively described in the art and are well known to those of skill in the art. See e.g., SANBROOK et al, "Molecular Cloning: A Laboratory Manual," Second Edition, Cold Spring Harbor Laboratory Press, 1989.
[0234] Preferably, the selected anti-MTR antibody is used in combination with one or more cellpenetrating agents. Cell-penetrating agents may be selected from the trans-activating transcriptional activator peptide (TAT peptide - Becker-Hapak et al., 2001, Methods, Vol. 24(3) : 247-256), penetratin, arginin-riche peptides, transportan, lipophilic peptides, cell- penetrating peptide (CPP), octa-arginine (R8), cholesterol-based agents and antennapedia- homeodomain-derived peptide (antp).
[0235] In further embodiments, the direct methionine synthase inhibitor can be a compound obtained by a method in the field of chemistry, i.e. can consist of a chemical compound.
[0236] Numerous chemical compounds are known in the art as direct inhibitors of methionine synthase. Illustrations of known compounds usable according to the present disclosure include (i) the benzimadazole derivatives described in the PCT publication n° WO 2009 / 014150, (ii) the benzoxazole, the benzothiazole and the benzimidazole derivatives disclosed in the PCT publication n° W02004 / 066952, (iii) the 2, 1,3 -benzothiadiazole derivatives and especially the 5-(2-imidazolin-2-ylamino-2,l,3-benzothiadiazole derivatives disclosed in the French patent application published under n° FR 2 321 287, (iv) the 6-O- substituted benzoxazole and benzothiazole compounds described in the PCT publication n° WO 2007 / 121484, (v) the 2,l,3-benzothia(oxa)diazole derivatives described in the PCT publication n° WO 97 / 30982, (vi) the dihydropyrimido-quinoxalines and dihydropyrimido- pyridopyrazines disclosed in the PCT publication n° WO 93 / 00904 and (vii) the benzimidazole compounds described in the PCT publication n° WO 2008 / 108741.
[0237] Other methionine synthase inhibitors useful according to the present disclosure are described in the PCT publication n° WO 2006 / 066974 and in the PCT publication n° WO 2021 / 001825.
[0238] In preferred embodiments, the direct methionine synthase inhibitor is selected from:
[0239] (i) a benzimidazole inhibitor, such as selected from 5 -methoxybenzimidazole, 5- nitrobenzimidazole and 4-nitro-N-(2-(5-nitro-lH-benzimidazol-2-yl)ethyl)benzamide;
[0240] (ii) a benzothiazole inhibitor such as 4-nitro-2, 1,3 -benzothiadiazole;
[0241] (iii) a quinoxaline inhibitor such as methyl-3-hydroxy-2-(2-(3-(4-methoxyphenyl)-4-oxo- 3 ,4-dihy droquinazolin-2-ylthio)acetamido propanoate;
[0242] (iv) a N5 substituted tetrahydropteroate, such as N5 -substituted tetrahydropyrido[3,2- d]pyrimidine; and (v) a compound selected from N-[4]-[2,4-Diamino-5-formyl-5,6,7,8-tetrahydropyrido[3,2 - d]pyrimidin-6-ylmethyl)acetylamino]benzoyl]-L_glutamic acid and N-[4-((2-[2,4-diamino- 5(2,3-dibromopropane)-5,6,7,8-tetrahydropyrido(3,2-d)pyrimidin-6-yl]methyl)amino)-3- bromo-benzoyl]-L-glutamate.
[0243] The above methionine synthase inhibitors can be prepared according to a method disclosed in one or more of WO 2009 / 014150, W02004 / 066952, FR 2 321 287, WO 2007 / 121484, WO 97 / 30982, WO 93 / 00904 and WO 2008 / 108741.
[0244] In further preferred embodiments, the direct methionine synthase inhibitor is selected from the benzimidazole derivatives 5-methoxybenzimidazole (CAS n° 4887-80-3, also termed “5M-BZM” herein, commercially available, synthesis method described notably by Wurm et al., 1975, Eur J Biochem, Vol. 56: 427-432), 5-nitrobenzimidazole (CAS n° 94-52-0 also termed “5N-BZM” herein, commercially available) and the 4-nitro-2,l,3-benzothiadiazole (CAS n° 273-13-2, also termed “4N-BZT” herein, commercially available, synthesis method described notably by Neto et al., 2013, Eur J Organic Chem, DOI: 10.1002 / ejoc.201201161).
[0245] Generally, methionine synthase inhibitors are used, according to the present disclosure, at an amount wherein they cause 20% or more inhibition of the methionine synthase activity.
[0246] Methods for measuring methionine synthase activity are known in the art. According to the present disclosure, methionine synthase activity is preferably measured according to a method comprising monitoring the transfer of a radiolabeled methyl group [14C]methytetrahydrofolate to methionine. Such an assay is notably disclosed in Danishpajooh et al. (2001, J Biol Chem, Vol. 276 (29): 27296-27303) or in Banks et al. (2007, The FEBS Journal, Vol. 274(1): 287-299).
[0247] In some preferred embodiments, a methionine synthase inhibitor is used, according to the present disclosure, at an amount that causes an inhibition of the methionine synthase activity of 30% or more, 35% or more, 40% or more, 45% or more, or 50% or more.
[0248] The more active is the selected methionine synthase direct inhibitor, the less amount thereof is required for reaching the desired level of methionine synthase inhibition. Further, the less amount of direct methionine synthase inhibitor is present, the less risk of causing an undesirable effect upon administration to the subject in need thereof is expected.
[0249] IC50 values from methionine synthase inhibitors are known in the art.
[0250] Illustratively, Banks et al. (2007, FEBS J, Vol. 274: 287-299) disclose the in vitro IC50 values of (i) 5-Nitrobenzimidazole (molecule 1c) as being 120 pM, of (ii) 5-Methoxybenzimidazole (molecule le) as being higher than 150 pM and of (iii) 4-nitro-2,l,3-benzothiadiazole (molecule 2b) as being 80 pM.
[0251] Further illustratively, Wang et al. (2020, Eur J Med Chem, Vol. 190: 112-113) disclose the IC50 values of (i) 6-(4-methylphenethyl)-5-chloracetyl-5,6,7,8-tetrahydropyrido[3,2- d]pyrimidine-2,4-diamine (molecule 6a5) as being 5.6 pM and of (ii) 6-(4-ethylphenethyl)- 5-chloracetyl-5,6,7,8-tetrahydropyrido[3,2-d]pyrimidine-2,4-diamine (molecule 6c) as being 12.1 pM.
[0252] Still illustratively, Alsihawi et al. (2014, Bioorg Med Chem, Vol. 22: 550-558) disclose the IC50 values of (i) 4-Nitro-N-(2-(5-nitro-lH-benzimidazol-2-yl)ethyl)benzamide (molecule 3j) as being 18 pM, of (ii) N-((5-Nitro-lH-benzimidazole-2-yl)methyl)benzamide as being 20 pM and of (iii) 4-(7-Nitroquinaxolin-2-yl)benzoic acid as being of 9 pM /
[0253] Yet illustratively, Tang et al. (2008, Anticancer Drugs, Vol. 19: 697-704) disclose the IC50 values of (i) diethyl N-[4- ■{ (2-[2, 4-diamino-5-(2,3-dibromopropane)-5, 6,7,8- tetrahydropyrodi(3,2-d)pyrimidin-6-yl]methyl)amino f>3-bromo-benzoyl]-L-glutamate (molecule ZL31) as being 10 pM and of (ii) N-[4-<! (2-[2,4-diamino-5-(2,3- dibromopropane)-5,6,7,8-tetrahydropyrodi(3,2-d)pyrimidin-6-yl]methyl)amino f>3-bromo- benzoyl]-L-glutamate (molecule ZL33) as being of 1.4 pM.
[0254] Also illustratively, Zhang et al. (2012, Eur J Med Chem, Vol. 58: 228-236) disclose the IC50 values of (i) N-[4[2-(2,4-diamino-5-formyl-5,6,7,8-tetrahydropyrido[3,2-d]pyrimidin-6- ylmethyl)acetylamino]benzoyl]-L-glutamic acid (molecule 12b) as being of 1.7 pM , of (ii) N-[4[2-(2,4-diamino-5-formyl-5,6,7,8-tetrahydropyrido[3,2-d]pyrimidin-6- ylmethyl)methylamino]benzoyl]-L-glutamic acid (molecule 11b) as being 8.1 pM and of (iii) (2S)-2-[[3-bromo-4[[2,4-diamino-5-(2,3-dibromopropyl)-7,8-dihydro-6H-pyrido[3,2- d]pyrimidin-6-yl)methylamino]benzoyl]amino)pentanedioic acid (molecule 16, identical to molecule ZL33 described by Tang et al., 2008-See above) as being 1.4 pM.
[0255] Preferably, direct methionine synthase inhibitors are selected from those having an IC50 (half maximal inhibitory concentration) of 100 pM or less, such as 50 pM or less.
[0256] Most preferably, direct synthase inhibitors are selected from those having an IC50 of 10 pM or less.
[0257] A direct methionine synthase inhibitor is conditioned according to any method known in the art, as soon as the selected conditioning method complies with the use that is contemplated according to the present disclosure.
[0258] Indirect methionine synthase inhibitors
[0259] Indirect methionine synthase inhibitors are selected among agents that cause inhibition of the said enzyme by an indirect mechanism, such as acting for example on a cofactor of the said enzyme. Illustratively, indirect inhibitors of methionine synthase include direct inhibitors of CD320 which is the transcobalamin II receptor (also termed “TCBLR”) which is responsible for the uptake of cobalamin (also termed “vitamin B12”), CD320 consisting of a cofactor of methionine synthase.
[0260] The effect of an inhibitor of CD320 on cancer cells, when combined with a methionine- depleting composition, is notably simulated in the examples herein by in vitro cultivating cancer cells in the absence of vitamin B 12.
[0261] According to the present disclosure, an indirect methionine synthase inhibitor may be selected from an antibody directed against CD320, a siRNA directed against a CD320- encoding mRNA and a vitamin B 12 antimetabolite compound.
[0262] Anti-CD320 antibodies may be polyclonal or monoclonal antibodies. Anti-CD320 monoclonal antibodies are preferred.
[0263] A selected anti-CD320 monoclonal antibody may be one of the monoclonal antibodies described by Jiang et al. (2011, Drug Delivery, Vol. 18(1): 74-78). Other antibodies against the transcobalamin receptor are described in the PCT publications n° WO 2007 / 117657, WO 2013 / 015821, WO 1993 / 023557 and WO 1996 / 008515. Numerous antibodies directed against CD320 are known in the art. It may be cited the anti- CD320 inhibitor antibody described by Jiang et al. (2011, Drug Delivery, Vol. 18: 74-78).
[0264] In some embodiments, the indirect methionine synthase inhibitor is a siRNA directed against CD320 mRNA.
[0265] As a siRNA directed against CD320 mRNA, it may be cited the siRNA described by Lai et al. (2011, Exp Cell Res, Vol. 317: 1603-1607).
[0266] In some further embodiments, the indirect methionine synthase inhibitor is a vitamin B12 antimetabolite compound.
[0267] In preferred embodiments, the vitamin B12 antimetabolite compound is selected from an aryl-cobalamin, an alkynyl-cobalamin, 4-ethylphenyl-cobalamin, 2-phenyl-ethynyl- cobalamine, a metal-modified and upper-axial-ligand-modified cobalamin antivitamin, a [c- lactam] derivative of cobalamin, a ring-modified cobalamin, a f-side-chain-modified B12 derivative.
[0268] Nitric oxide and nitrous oxide are indirect methionine synthase inhibitor but are toxic for humans. Thus, in preferred embodiments, the combination of the present invention comprises one or more methionine synthase inhibitors but not nitric oxide and not nitrous oxide.
[0269] For illustration, the activity of 4-ethylphenyl-cobalamin was described by Mutti et al. (2013, PLoS One, 8:e75312) and by Ruetz et al. (2013, Angex Chem Int (Ed Engl), Vol. 52: 2606- 2610).
[0270] Additional embodiments
[0271] In further embodiments, the method for treating cancer according to the present disclosure may also comprise administering at least a second kind of anticancer therapy to the subject affected with a cancer, especially with a cancer that has previously diagnosed as being methionine-self-sufficient. The second anticancer therapy may be surgical therapy, chemotherapy, radiation therapy, cryotherapy, hormone therapy, immunotherapy or cytokine therapy. Thus, in some embodiments, the combination of (i) one or more methionine-depleting composition and of (ii) one or more methionine synthase inhibitors, for its use for treating a cancer, can be associated to one or more anti-cancer therapeutic treatments. According to these embodiments, the anti-cancer treatment according to the present disclosure further comprises subjecting the treated subject to one or more further anti-cancer treatments, which further anti-cancer treatments include chemotherapy, radiotherapy immunotherapy and surgery.
[0272] Combined chemotherapeutic treatment.
[0273] Thus, according to such other embodiments, the anti-cancer treatment with a combination of (i) one or more methionine-depleting composition and of (ii) one or more methionine synthase inhibitor further comprises the administration of one or more further anti-cancer active ingredients to the subject affected with a cancer.
[0274] Thus, according to some embodiments of a combination of (i) one or more methionine- depleting composition and of (ii) one or more methionine synthase inhibitors, for its use as described herein, the said combination is further combined with another anti-cancer treatment, such as combined with one or more other anti-cancer active agents.
[0275] An “anticancer agent” is defined herein as any molecule that can either interfere with the biosynthesis of macromolecules (DNA, RNA, proteins, etc.) or inhibit cellular proliferation, or lead to cell death by apoptosis or cytotoxicity for example. Among the anticancer agents, there may be mentioned alkylating agents, topoisomerase inhibitors and intercalating agents, anti-metabolites, cleaving agents, agents interfering with tubulin, monoclonal antibodies.
[0276] Combination with hypomethylation agents
[0277] In some embodiments, a further anticancer agent can be a hypomethylation agent.
[0278] As shown in the examples herein, the therapeutic effect of the combined use of (i) a methionine-depleting composition and of (ii) one or more methionine synthase inhibitor for treating a subject affected with a cancer is further potentiated by further administering one or more hypomethylating agents. Thus, in some embodiments, the combination according to the present disclosure further comprises a hypomethylating agent.
[0279] Thus, in some embodiments, the subject may be further administered one or more hypomethylating agents.
[0280] In some embodiments, the one or more hypomethylating agents can be selected from 5- azacytidine (vidaza), 5 -aza-2’ -deoxy cyty dine (decitabine). 6-thioguanine, zebularine, guadecitabine, N-phthaloyl-L-tryptophan 1, shikonnin, psammaplin, isofistularin-3, epigallocatechin-3 -gallate, berberine, 3,3'-Diindolylmethane, harmalin, harmine, mahanine, reserpine, solamargine, tricostatine A, all-trans retinoic acid, hinokitiol, parthenolide, ursolic acid, curcubitacin B, procainamide, hydralazine, temozolomide (temodar), 1’entinostat (syndax) and SGI-110 (guadecitabine).
[0281] Hypomethylating agents are compounds for which a therapeutic use, especially in the field of cancer therapy, is well known in the art.
[0282] The dosage of hypomethylating agents for cancer treatment can vary depending on several factors, including the specific agent being used, the type and stage of cancer, the patient's overall health and tolerance to the medication, and the treatment protocol established by the healthcare provider. Two common hypomethylating agents used in cancer treatment are azacitidine and decitabine.
[0283] Illustratively, for 5-azacitidine (notably marketed under the brand name Vidaza®), typical dosages might range from 75 mg / m2 / day to 100 mg / m2 / day, administered subcutaneously or intravenously for 7 days in a 28-day cycle. However, dosages and schedules can vary based on the specific cancer being treated and the patient's individual response and tolerance.
[0284] Further illustratively, for decitabine (marketed under the brand name Dacogen®), typical dosages might range from 15 mg / m2to 20 mg / m2, administered intravenously over 1 hour every 8 hours for 3 consecutive days in a 28-day cycle. Again, dosages and schedules may be adjusted based on individual patient factors and treatment goals.
[0285] The precise dosage and treatment regimen should be determined by the patient's oncologist or healthcare provider based on a thorough assessment of the patient's condition and other relevant factors. It's important for patients to follow their healthcare provider's instructions carefully and to communicate any concerns or side effects experienced during treatment. Other chemotherapeutic agents
[0286] The chemotherapeutic agents include platinum salts, intercalating agents (blocking of DNA replication and transcription), such as the anthracyclines (doxorubicin, pegylated liposomal doxorubicin), topoisomerase inhibitors (camptothecin and derivatives: Karenitecin, topotecan, irinotecan), or else SJG-136, inhibitors of histone deacetylase (vorinostat, belinostat, valproic acid), alkylating agents (bendamustine, glufosfamide, temozolomide), anti-mitotic plant alkaloids, such as the taxanes (docetaxel, paclitaxel), vinca alkaloids (vinorelbine), epothilones (ZK-Epothilone, ixabepilone), anti-metabolites (gemcitabine, elacytarabine, capecitabine) and kinesin spindle protein (KSP) inhibitors (ispinesib), trabectedin or else ombrabulin (combretastatin A-4 derivative).
[0287] Among the anti-cancer agents consisting of small molecules, there may be cited the poly(ADP-ribose)polymerase (PARP) inhibitors: olaparib, iniparib, veliparib, rucaparib, CEP-9722, MK-4827, BMN-673, the kinase inhibitors, such as the tyrosine kinase inhibitors (TKI) among which there may be mentioned the anti-VEGFR molecules (sorafenib, sunitinib, cediranib, vandetanib, pazopanib, BIBF 1120, semaxanib, Cabozantinib, motesanib), the anti-HER2 / EGFR molecules (erlotinib, gefitinib, lapatinib), the anti-PDGFR molecules (imatinib, BIBF 1120), the anti-FGFR molecules (BIBF 1120), the aurora kinase / tyrosine kinase inhibitors (ENMD-2076), the Src / Abl kinase inhibitor (Saracatinib), or also Perifosine, Temsirolimus (mTOR inhibitor), alvocidib (cyclin-dependent kinase inhibitor), Volasertib (inhibitor of PLK1 (polo-like kinase 1) protein, LY2606368 (inhibitor of checkpoint kinase 1 (chk 1), GDC-0449 (Hedgehog Pathway Inhibitor), Zibotentan (antagonist of the ETA-receptor), Bortezomib and Carfilzomib (proteasome inhibitor).
[0288] Combined radiotherapeutic treatment
[0289] In some embodiments, the combination of (i) one or more methionine-depleting composition, of (ii) one or more methionine synthase inhibitor and optionally (iii) one or more hypomethylating agents is further combined with a radiotherapeutic treatment or agent against cancer.
[0290] Radiotherapy that causes DNA damage and has been used extensively includes what are commonly known as y-rays, X-rays, and / or the directed delivery of radioisotopes to tumor cells. Other forms of DNA damaging factors are also contemplated, such as microwaves, proton beam irradiation (U.S. Pat. Nos. 5,760,395 and 4,870,287), and UV-irradiation. It is most likely that all of these factors affect a broad range of damage on DNA, on the precursors of DNA, on the replication and repair of DNA, and on the assembly and maintenance of chromosomes. Dosage ranges for X-rays range from daily doses of 50 to 200 roentgens for prolonged periods of time (3 to 4 wk), to single doses of 2000 to 6000 roentgens. Dosage ranges for radioisotopes vary widely, and depend on the half-life of the isotope, the strength and type of radiation emitted, and the uptake by the neoplastic cells.
[0291] Combined immunotherapeutic treatment
[0292] In some embodiments, the combination of (i) one or more methionine-depleting composition, of (ii) one or more methionine synthase inhibitor and optionally (iii) one or more hypomethylating agents is further combined with immunotherapeutic treatment or agent against cancer.
[0293] The skilled artisan will understand that immunotherapies may be used in combination or in conjunction with methods of the embodiments. In the context of cancer treatment, immunotherapeutics, generally, rely on the use of immune checkpoint inhibitors, immune effector cells and molecules to target and destroy cancer cells.
[0294] A variety of immune checkpoint inhibitors are known in the art and encompass PD-1 (Programmed Cell Death Protein 1) inhibitors, PD-L1 (Programmed Death-Ligand 1) inhibitors and CTLA-4 (Cytotoxic-T -Lymphocyte Antigen 4) inhibitors. PD-1 inhibitors incluse pembrolizumab, nivolumab and cemiplimab. PD-L1 inhibitors include atezolizumab, avelumab and durvalumab. CTLA-4 inhibitors include iplimumab.
[0295] Rituximab (RITUXAN®) is such an example. The immune effector may be, for example, an antibody specific for some marker on the surface of a tumor cell. The antibody alone may serve as an effector of therapy or it may recruit other cells to actually promote cell killing. The antibody also may be conjugated to a drug or toxin (chemotherapeutic, radionuclide, ricin A chain, cholera toxin, pertussis toxin, etc.) and serve merely as a targeting agent. Alternatively, the effector may be a lymphocyte carrying a surface molecule that interacts, either directly or indirectly, with a tumor cell target. Various effector cells include cytotoxic T cells and NK cells. In one aspect of immunotherapy, the tumor cell must bear some marker that is amenable to targeting, i.e., is not present on the majority of other cells. Many tumor markers exist and any of these may be suitable for targeting in the context of the present embodiments. Common tumor markers include CD20, carcinoembryonic antigen, tyrosinase (p97), gp68, TAG-72, HMFG, Sialyl Lewis Antigen, MucA, MucB, PLAP, laminin receptor, erb B, and pl 55. An alternative aspect of immunotherapy is to combine anticancer effects with immune stimulatory effects. Immune stimulating molecules can also be used, which includes cytokines, such as IL-2, IL-4, IL-12, GM-CSF, gamma-IFN, chemokines, such as MIP-1, MCP-1, IL-8, and growth factors, such as FLT3 ligand.
[0296] Treatment by surgery
[0297] In some embodiments, the combination of (i) one or more methionine-depleting composition, of (ii) one or more methionine synthase inhibitor and optionally (iii) one or more hypomethylating agents is further combined with surgery treatment or agent against cancer.
[0298] Tumor resection refers to physical removal of at least part of a tumor. In addition to tumor resection, treatment by surgery includes laser surgery, cryosurgery, electrosurgery, chemoembolization and microscopically-controlled surgery (Mohs’ surgery).
[0299] Approximately 60% of people with cancer will undergo surgery of some type, which includes preventative, diagnostic or staging, curative, and palliative surgery. Curative surgery includes resection in which all or part of cancerous tissue is physically removed, excised, and / or destroyed and may be used in conjunction with a combination of (i) one or more methionine-depleting composition, of (ii) one or more methionine synthase inhibitor and of (iii) optionally a hypomethylating agent according to the present disclosure.
[0300] Pharmaceutical compositions
[0301] In a further aspect, the present disclosure relates to a method for treating a cancer in a subject in need thereof, especially a cancer that has been previously diagnosed as being methionine- self-sufficient, comprising administering to the said subject a combination of (i) one or more methionine-depleting composition and (ii) one or more methionine synthase inhibitor and optionally (iii) one or more anti-cancer treatments as described herein. The present disclosure also relates to pharmaceutical compositions comprising a combination of (i) one or more methionine-depleting composition and (ii) one or more methionine synthase inhibitor and optionally (iii) one or more anti-cancer treatments as described herein.
[0302] In some embodiments, the combination of the present disclosure is comprised in the same pharmaceutical composition, wherein the methionine-depleting composition further comprises one or more methionine synthase inhibitors and optionally one or more anticancer treatments.
[0303] In some other embodiments, the combination of the present disclosure is comprised in more than one composition, such as in (i) the methionine-depleting composition on the one hand and in (ii) a composition comprising one or more methionine synthase inhibitors, and optionally one or more anti-cancer treatments, on the other hand.
[0304] Typically, in a pharmaceutical composition according to the present disclosure, the one or more active agents may be combined with pharmaceutically or physiologically acceptable excipients or carriers, and optionally sustained-release matrices, such as biodegradable polymers, to form therapeutic compositions.
[0305] These pharmaceutical compositions may comprise one or more pharmaceutically acceptable excipients or carriers. Suitable carriers and excipients and their formulations are described, for example, in Remington: The Science and Practice of Pharmacy, 21st Edition, David B. Troy, ed., Lippicott Williams & Wilkins (2005). By pharmaceutically acceptable carrier is meant a material that is not biologically or otherwise undesirable, i.e., the material is administered to a subject without causing undesirable biological effects or interacting in a deleterious manner with the other components of the pharmaceutical composition in which it is contained.
[0306] Pharmaceutical compositions provided herein comprise the active agents, in a therapeutically effective amount, i.e., in an amount effective to achieve its intended purpose. As exposed above, the actual effective amount for a particular application will depend, inter alia, on the condition being treated and various other factors well-known in the art such as the age, the weight, the sex of the patient, the presence of other potential aggravating conditions, or the diet. The pharmaceutical compositions may be presented in single dose or multi-dose containers, for example, sealed ampoules or vials, and may be stored in lyophilized condition requiring only the addition of the sterile liquid carrier, for example water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from powders or granules.
[0307] In the case of parenteral administration, the composition may also be provided with the active ingredients in separate containers that can be suitably administered according to the desired dosage taking into account the weight, age, gender and health status of the patient in need thereof.
[0308] In all cases, the pharmaceutical compositions must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi.
[0309] The present disclosure further relates to a pharmaceutical kit of parts comprising:
[0310] (i) a first container comprising a methionine-depleting composition, and
[0311] (ii) a second container comprising one or more methionine synthase inhibitors.
[0312] According to one embodiment, said one or more methionine synthase inhibitors in the second container are one or more direct or indirect methionine synthase inhibitors, thus one or more direct or indirect inhibitors of endogenous methionine production in the cells of a patient in need thereof.
[0313] In some embodiments, the said kit of parts further comprises, in the first container, in the second container, or alternatively in an additional third container, one or more hypomethylating agents.
[0314] In some other embodiments, the said kit of parts further comprises, in the first container, in the second container, or alternatively in an additional third container, one or more anti-cancer agents.
[0315] All or part of the particular features and embodiments relating to pharmaceutical compositions according to the present disclosure, also apply to the intended uses and methods of the present disclosure. Therapeutic uses and methods of treatment
[0316] In another aspect of the present disclosure, a combination of (i) one or more methionine- depleting composition and of (ii) one or more methionine synthase inhibitors may be for use in a method for treating cancer in a subject in need thereof, especially a method for treating a cancer wherein the subject has been previously diagnosed or classified as being affected with a cancer methionine-independent and optionally (iii) one or more anti-cancer treatments, such as one or more anti-cancer agents.
[0317] In some embodiments, the cancer which is treated with a combination of (i) one or more methionine-depleting composition and of (ii) one or more methionine synthase inhibitor according to the present disclosure is selected from a solid cancer and a hematological cancer.
[0318] The cancer may specifically be of the following histological type, though it is not limited to these: neoplasm, malignant; carcinoma; carcinoma, undifferentiated; giant and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; pilomatrix carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; gastrinoma, malignant; cholangiocarcinoma; hepatocellular carcinoma; combined hepatocellular carcinoma and cholangiocarcinoma; trabecular adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma in adenomatous polyp; adenocarcinoma, familial polyposis coli; solid carcinoma; carcinoid tumor, malignant; branchiolo-alveolar adenocarcinoma; papillary adenocarcinoma; chromophobe carcinoma; acidophil carcinoma; oxyphilic adenocarcinoma; basophil carcinoma; clear cell adenocarcinoma; granular cell carcinoma; follicular adenocarcinoma; papillary and follicular adenocarcinoma; nonencapsulating sclerosing carcinoma; adrenal cortical carcinoma; endometroid carcinoma; skin appendage carcinoma; apocrine adenocarcinoma; sebaceous adenocarcinoma; ceruminous adenocarcinoma; mucoepidermoid carcinoma; cystadenocarcinoma; papillary cystadenocarcinoma; papillary serous cystadenocarcinoma; mucinous cystadenocarcinoma; mucinous adenocarcinoma; signet ring cell carcinoma; infiltrating duct carcinoma; medullary carcinoma; lobular carcinoma; inflammatory carcinoma; Paget’s disease, mammary; acinar cell carcinoma; adenosquamous carcinoma; adenocarcinoma w / squamous metaplasia; thymoma, malignant; ovarian stromal tumor, malignant; thecoma, malignant; granulosa cell tumor, malignant; androblastoma, malignant; sertoli cell carcinoma; leydig cell tumor, malignant; lipid cell tumor, malignant; paraganglioma, malignant; extramammary paraganglioma, malignant; pheochromocytoma; glomangiosarcoma; malignant melanoma; amelanotic melanoma; superficial spreading melanoma; malignant melanoma in giant pigmented nevus; epithelioid cell melanoma; blue nevus, malignant; sarcoma; fibrosarcoma; fibrous histiocytoma, malignant; myxosarcoma; liposarcoma; leiomyosarcoma; rhabdomyosarcoma; embryonal rhabdomyosarcoma; alveolar rhabdomyosarcoma; stromal sarcoma; mixed tumor, malignant; mullerian mixed tumor; nephroblastoma; hepatoblastoma; carcinosarcoma; mesenchymoma, malignant; Brenner tumor, malignant; phyllodes tumor, malignant; synovial sarcoma; mesothelioma, malignant; dysgerminoma; embryonal carcinoma; teratoma, malignant; struma ovarii, malignant; choriocarcinoma; mesonephroma, malignant; hemangiosarcoma; hemangioendothelioma, malignant; Kaposi’s sarcoma; hemangiopericytoma, malignant; lymphangiosarcoma; osteosarcoma; juxtacortical osteosarcoma; chondrosarcoma; chondroblastoma, malignant; mesenchymal chondrosarcoma; giant cell tumor of bone; Ewing’s sarcoma; odontogenic tumor, malignant; ameloblastic odontosarcoma; ameloblastoma, malignant; ameloblastic fibrosarcoma; pinealoma, malignant; chordoma; glioma, malignant; ependymoma; astrocytoma; protoplasmic astrocytoma; fibrillary astrocytoma; astroblastoma; glioblastoma; oligodendroglioma; oligodendroblastoma; primitive neuroectodermal; cerebellar sarcoma; ganglioneuroblastoma; neuroblastoma; retinoblastoma; olfactory neurogenic tumor; meningioma, malignant; neurofibrosarcoma; neurilemmoma, malignant; granular cell tumor, malignant; malignant lymphoma; Hodgkin’s disease; paragranuloma; malignant lymphoma, small lymphocytic; malignant lymphoma, large cell, diffuse; malignant lymphoma, follicular; mycosis fungoides; other specified non-Hodgkin’s lymphomas; malignant histiocytosis; multiple myeloma; mast cell sarcoma; immunoproliferative small intestinal disease; leukemia; lymphoid leukemia; plasma cell leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryoblastic leukemia; myeloid sarcoma; and hairy cell leukemia. In some preferred embodiments, the cancer to be treated according to the present disclosure is selected from pancreatic adenocarcinoma, melanoma, colon adenocarcinoma, lung adenocarcinoma, leiomyosarcoma, glioblastoma, bladder cancer and acute myeloid leukemia.
[0319] In some embodiments, the present disclosure relates to the use a combination of (i) one or more methionine-depleting composition, of (ii) one or more methionine synthase inhibitors and of (iii) optionally one or more hypomethylating agents, for the manufacture of a medicament for the prevention and / or treatment of a cancer in a subject in need thereof, wherein the subject has been previously diagnosed or classified as being affected with a cancer, optionally a cancer exhibiting methionine independency (self-sufficiency).
[0320] In some other embodiments, the combination of (i) one or more methionine-depleting composition, of (ii) one or more methionine synthase inhibitor and optionally of (iii) one or more hypomethylating agents according to the present disclosure may be for use in a synergistic prevention and / or treatment of a cancer, optionally a cancer exhibiting methionine independency (self-sufficiency).
[0321] In some embodiments, the present disclosure relates to combination of (i) one or more methionine-depleting composition and of (ii) one or more methionine synthase inhibitors and (iii) optionally one or more hypomethylating agents and further possibly one or more anti-cancer treatments such as one or more anti-cancer agents, for use in a method for treating and / or preventing a cancer in a subject in need thereof, especially wherein the subject has been previously diagnosed or classified as being affected with a cancer, optionally a cancer exhibiting methionine independency (self-sufficiency).
[0322] In some embodiments, the treatment method described above also comprises a step of administering one or more other anti-cancer treatments such as one or more anti-cancer agents to the said subject, which encompasses one or more hypomethylating agents to the said subject.
[0323] In some embodiments, the treatment method described above also comprises a step of administering one or more hypomethylating agents to the said subject.
[0324] In some embodiments, the present disclosure also relates to a method of synergistically treating a cancer exhibiting methionine self-sufficiency in a subject in need thereof, wherein the said method includes administering to the subject a combination of (i) a methionine- depleting composition and of (ii) one or more methionine synthase inhibitors, thereby treating the cancer disease in said subject.
[0325] In some embodiments, a combination of (i) one or more methionine-depleting composition and of (ii) one or more methionine synthase inhibitors may be simultaneously, separately or sequentially administered to the subject in need thereof.
[0326] In some particular embodiments, a combination of (i) one or more methionine-depleting composition and of (ii) one or more methionine synthase inhibitors may be simultaneously administered to the subject in need thereof.
[0327] In some other embodiments, a combination of (i) one or more methionine-depleting composition and of (ii) one or more methionine synthase inhibitors as described herein may be administered separately to the subject.
[0328] In the following paragraphs, when it is referred to a composition that may be administered in a certain way or at a certain dosage, etc., it shall be understood that the present disclosure also describes the said composition that is under a form suitable for administration in a certain way or at a certain dosage, etc.
[0329] In some embodiments, a combination of (i) one or more methionine-depleting composition and of (ii) one or more methionine synthase inhibitors may be administered to a cancer subject according to an overall treatment time period of several months, such as for a time period of 24 months or less, including for a period of time of 15 months or less. According to these embodiments, a combination of (i) a methionine-depleting composition and of (ii) one or more methionine synthase inhibitors may be administered to a cancer subject according to an overall time period of treatment of 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 13 months, 14 months or 15 months.
[0330] According to these embodiments wherein the said combination is administered for a long period of time, the said methionine-depleting composition, when it consists of a methionine- deprived composition, preferably comprises a low amount of methionine, the said methionine-deprived composition being suitable for a methionine daily intake of less than 5 mg / kg of body weight, such as a methionine daily intake of less than 2 mg / kg of body weight, as recommended by the Nutritional Oncology Research Institute (NORI) protocol (available at http s : / / nutriti onal oncol ogy . net) .
[0331] According to these embodiments wherein the said combination is administered for a long period of time, the said methionine-depleting composition, when it consists of a methioninedegrading composition, preferably comprises methionine gamma-lyase for an administration of a therapeutically effective amount that, when expressed on a daily basis for oral administration, can range from 50 to 1000 units, such as from 100 to 500 units, which therapeutically effective amount can be administered as a single dose or instead be administered through a plurality of fractionated doses, such as for an oral administration twice daily.
[0332] Also illustratively, a therapeutically effective amount of a methionine gamma lyase, when expressed on a daily basis for parenteral administration, especially for intravenous administration, can range from 5000 to 20000 units.
[0333] For the sake of clarity, a given time period of treatment, e.g. of 24 months, does not mean that the combination of (i) a methionine-depleting composition and of (ii) one or more methionine synthase inhibitors is administered continuously, e.g. daily, during the said time period of treatment. Instead, irrespective of the administration schedule, this means that the said combination is administered to the subject in need thereof at given time periods of administration, or at given time points of administration, during the overall time period of treatment.
[0334] In some embodiments, the combination of (i) a methionine-depleting composition and of (ii) one or more methionine synthase inhibitors may be administered to a cancer subject for a given time period of administration, such as from 1 day to 15 days, which encompasses for an administration time period of at least 3 days to at most 15 days. According to the present disclosure, an administration time period of the combination of 1 day to 30 days encompasses administration time periods of 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days and 15 days.
[0335] In embodiments, the methionine-depleting composition may be firstly administered during about 1 day to about 7 days before the administration of the selected methionine synthase inhibitor to the subject in need thereof. Particularly, the methionine-deprived composition may be firstly administered for 1, 2, 3, 4, 5, 6, or 7 days before the administration of the selected methionine synthase inhibitor. According to these embodiments, the one or more methionine synthase inhibitors can be administered to the subject 1, 2 or 3 days after the start of the administration of the methionine-depleting composition to the said subject. Preferably, the combination of both (i) the methionine-deprived composition and (ii) one or more methionine synthase inhibitors are administered the same day, at least one day during the respective time periods of administration.
[0336] In some other embodiments, one or more methionine synthase inhibitors, or the pharmaceutical composition comprising the one or more methionine synthase inhibitors as described herein may be firstly administered to the subject in need thereof and subsequently the methionine-deprived composition may be administered.
[0337] In particular, one or more methionine synthase inhibitors, or the pharmaceutical composition comprising one or more methionine synthase inhibitors as described herein, may be firstly administered during about 1 day to about 7 days before the administration of the methionine- deprived composition as described herein to the subject in need thereof. Particularly, the methionine synthase inhibitor, or the pharmaceutical composition may be firstly administered for 1, 2, 3, 4, 5, 6, or 7 days before the administration of the methionine- deprived composition as described herein. Preferably, the combination of both (i) the methionine-deprived composition and (ii) one or more methionine synthase inhibitors are administered the same day, at least one day during the respective time periods of administration.
[0338] In some other embodiments, the one or more methionine synthase inhibitor, or the pharmaceutical composition comprising one or more methionine synthase inhibitor as described herein, and a methionine-deprived composition as disclosed herein may be simultaneously administered to the subject in need thereof.
[0339] In particular, the one or more methionine synthase inhibitor, or the pharmaceutical composition comprising one or more methionine synthase inhibitor as described herein, and a methionine-deprived composition as disclosed herein may be simultaneously administered for about 1 day to about 15 days to the subject in need thereof.
[0340] In some embodiments, a given period of time of treatment comprises (a) one or more periods of time of administration of (i) the methionine-deprived composition and (ii) the methionine synthase inhibitor and (b) and one or more intermediate pause periods of time wherein (i) the methionine-deprived composition and (ii) the methionine synthase inhibitor are not administered to the subject.
[0341] Illustratively, a cycle of period of time of treatment of about 28 days may comprise, in a chronological order, (i) a period of administration of 14 days and (ii) a pause period of 14 days, the said cycle being possibly reiterated for the desired cycle numbers. Further illustratively, a cycle of period of time of treatment of about 28 days may comprise, in a chronological order, (i) a period of administration of 7 days and (ii) a pause period of 21 days, the said cycle being possibly reiterated for the desired cycle numbers When used herein generically, a “period of administration” starts the first day of administration of the first of either (i) the methionine- deprived composition or (ii) the methionine synthase inhibitor, or both if administered simultaneously, and ends the last day of administration of either (i) the methionine-deprived composition or (ii) the methionine synthase inhibitor, or both if administered simultaneously.
[0342] The following examples are provided for purpose of illustration and not limitation.
[0343] EXAMPLES
[0344] A. MATERIAL AND METHODS
[0345] A.l. Cell lines
[0346] SKLU 1 : Human lung adenocarcinoma cell line (methionine-dependent)
[0347] A427: Human lung adenocarcinoma cell line (methionine-independent)
[0348] PANCI : Pancreatic adenocarcinoma cell line
[0349] MeWo: Melanoma cell line
[0350] HT29: Colorectal adenocarcinoma cell line
[0351] SK-LMS1 : Leiomyosarcoma cell line SK-N-MC: Glioblastoma cell line
[0352] T24: Urothelial bladder cancer cell line
[0353] SKLU1 (p70) Met-dep: Methionine-dependent clone derived from the SKLU1 cell line
[0354] SKLU1 (p70) Met-indep: Methionine-independent clone derived from the SKLU1 cell line
[0355] A427 (p70) Met-dep: methionine-dependent clone derived from A427 cell line
[0356] A427 (p70) Met-indep: Methionine-independent clone derived from A427 cell line
[0357] TH17001 : Primary fibroblast cell line derived from a skin biopsy of a healthy man TH16002: Primary fibroblast cell line derived from a skin biopsy of a healthy man
[0358] TF 15003: Primary fibroblast cell line derived from a skin biopsy of a healthy woman
[0359] A.2. Selection of emerging methionine-dependent and methionine-independent cell clones
[0360] In order to select methionine-dependent and methionine-independent clones from SKLU1 and A427 cell lines, each cell line was cultured from passage 40 (p40) until passage 70 (p70) in a medium progressively deprived of methionine and in a medium containing a high level of methionine (200pmol / l). Indeed, it has been demonstrated that methionine-independent cell lines tend to become methionine-dependent at high passages when cultured in a medium that contains methionine, and that methionine-dependent lines could become methionine- independent using a progressive methionine restriction protocol. The medium used to select the methionine-independent clones was progressively deprived of methionine according to the following steps: lOOpM during week 1, 50pM during week 2, 25pM during week 3, 12.5pM during week 4, 6.25pM during week 5 and 3.125pM during week 6, followed by complete methionine deprivation. The clones were isolated after a total of 6 months.
[0361] Relevant literature
[0362] - Fiskerstrand, T.; Christensen, B.; Tysnes, O.B.; Ueland, P.M.; Refsum, H. Development and Reversion of Methionine Dependence in a Human Glioma Cell Line: Relation to Homocysteine Remethylation and Cobalamin Status. Cancer Res 1994, 54, 4899-4906.
[0363] - Borrego, S.L.; Lin, D.-W.; Kaiser, P. Isolation and Characterization of Methionine- Independent Clones from Methionine-Dependent Cancer Cells. In Methionine Dependence of Cancer and Aging; Hoffman, R.M., Ed.; Methods in Molecular Biology; Springer New York: New York, NY, 2019; Vol. 1866, pp. 37-48 ISBN 978-1-4939-8795-5.
[0364] - Vanhamme, L.; Szpirer, C. Spontaneous and 5-Azacytidine-Induced Revertants of Methionine-Dependent Tumor-Derived and H-Ras-1 -Transformed Cells. Experimental Cell Research 1989, 181, 159-168, doi: 10.1016 / 0014-4827(89)90190-0.
[0365] A.3. Cell culture and culture media
[0366] 1. The cells were incubated in a humid atmosphere at 37°C with 5% CO2, under sterile conditions and without antibiotics.
[0367] For experiments evaluating the effect of methionine and / or vitamin B12 deprivation, we prepared a base culture medium consisting of DMEM (Dulbecco's Modified Eagle Medium) with a high glucose content (4.5g / l) and no methionine or cystine, supplemented with 10% SVF (fetal bovine serum) dialysed with a lOkDa dialysis membrane, 4mM glutamine and ImM sodium pyruvate. The folate concentration was adjusted to lOOpM, and the medium was supplemented with cystine 131pM and L-homocysteine lOOpM. Depending on the experimental conditions required, the base medium was supplemented with lOOpM L- methionine and / or 1.5pM (2000pg / l) cyanocobalamin, to obtain either a complete medium or a medium lacking methionine and / or vitamin B12. The concentrations used for these different compounds correspond to those used in previous studies.
[0368] Relevant literature
[0369] - Mecham, J.O.; Rowitch, D.; Wallace, C.D.; Stern, P.H.; Hoffman, R.M. The Metabolic Defect of Methionine Dependence Occurs Frequently in Human Tumor Cell Lines. Biochemical and Biophysical Research Communications 1983, 117, 429-434, doi : 10.1016 / 0006-291 X(83)91218-4.
[0370] - Hoffman, R.M.; Jacobsen, S.J. Reversible Growth Arrest in Simian Virus 40-Transformed Human Fibroblasts. Proc Natl Acad Sci U S A 1980, 77, 7306-7310, doi: 10.1073 / pnas.77.12.7306.
[0371] - Fiskerstrand, T.; Ueland, P.M.; Refsum, H. Response of the Methionine Synthase System to Short-Term Culture with Homocysteine and Nitrous Oxide and Its Relation to Methionine Dependence. Int J Cancer 1997, 72, 301-306, doi: 10.1002 / (sici)1097-
[0372] 0215 ( 19970717)72 : 2<301 : : aid-ij c 17>3.0. co;2-i .
[0373] 2. The 'CTRL' (control) medium therefore contained L-methionine and cyanocobalamin, the 'noMet' medium contained only cyanocobalamin (without methionine) and the 'noB12' medium contained only methionine (without cyanocobalamin).
[0374] 3. To assess the importance of exogeneous methionine supply, we compared the cell proliferation according to the presence (CTRL, control methionine-containing medium) or absence of methionine (noMet) in the culture medium.
[0375] Relevant literature
[0376] - Mecham, J.O.; Rowitch, D.; Wallace, C.D.; Stern, P.H.; Hoffman, R.M. The Metabolic Defect of Methionine Dependence Occurs Frequently in Human Tumor Cell Lines. Biochemical and Biophysical Research Communications 1983, 117, 429-434, doi : 10.1016 / 0006-291 X(83)91218-4.
[0377] 4. To assess the importance of intracellular methionine synthesis via the betainehomocysteine S-methyltransferase (BHMT), we compared cell proliferation according to whether or not BHMT inhibitor S-(5-carboxybutyl)-DL-homocysteine (CBHcy) had been added to a methionine-deprivated (noMet) medium. CBHcy was added to the culture medium at a concentration of 50 pM twice a day, reducing BHMT activity by >99% even in the presence of homocysteine concentrations higher than those we were using (100 pM).
[0378] Relevant literature
[0379] - Collinsova, M.; Strakova, J.; Jiracek, J.; Garrow, T.A. Inhibition of Betaine-Homocysteine S-Methyltransferase Causes Hyperhomocysteinemia in Mice. J Nutr 2006, 136, 1493-1497, doi: 10.1093 / jn / 136.6.1493.
[0380] 5. To assess the importance of intracellular methionine synthesis via methionine synthase (MS), we inhibited MS by two ways: indirectly by depriving MS of its B12 cofactor ('iMS (noB12)' medium); or directly with enzymatic inhibitors ('iMS (name of inhibitor)' medium). Among the direct inhibitors of MS, we tested various drugs from the benzimidazole and benzothiazole class, which have already been shown to inhibit MS: 5- methoxybenzimidazole (5M-BZM), 5-nitrobenzimidazole (5N-BZM) and 4-nitro-2,l,3- benzothiadi azole (4N-BZT). 5M-BZM inhibited 5-10% of MS activity at lOOpM with an IC50 >150pM, 5N-BZM inhibited 50-55% of MS activity at lOOpM competitively with 5- MTHF with an IC50 of 120pM, and 4N-BZT inhibited 55-60% of MS activity at lOOpM non-competitively and with an IC50 of 80pM.
[0381] Relevant literature
[0382] - Banks, E.C.; Doughty, S.W.; Toms, S.M.; Wheelhouse, R.T.; Nicolaou, A. Inhibition of Cobalamin-Dependent Methionine Synthase by Substituted Benzo-Fused Heterocycles. FEBS J 2007, 274, 287-299, doi: 10.1111 / j.l742-4658.2006.05583.x
[0383] A.4. Cell proliferation
[0384] To assess cell proliferation, cells were seeded in 96-well plates (2000 cells / well for TH17, 2000 cells / well for SKLU1, 4500 cells / well for A427) to achieve 80% confluence in 4 to 7 days in complete culture medium without treatment. Confluence was quantified every 2 hours using Incucyte S3 technology (Sartorius, Gottingen, Germany). Analysis of the proliferation of a cell type was stopped when confluence reached 80% in one of the groups. Cell proliferation was quantified by the relative cell density, corresponding to confluence normalised by initial confluence (once the cells had adhered to the support, i.e., 2 to 8h after seeding). We compared proliferation between 2 conditions by comparing relative cell densities at the end of the experiment.
[0385] A.5. Cell viability
[0386] Cell viability after treatment was assessed using PrestoBlue reagent (Thermo Fisher Scientific, Waltham, MA, USA), according to the protocol indicated by the supplier. Cells were seeded in a 96-well plate (6000 cells / well for A427, 4000 cells / well for PANCI and 2000 cells / well for TH I 7) and incubated overnight in 45 pl of untreated medium. The following day, the treatment was added to the wells, diluted in 45 pl of culture medium to twice the desired concentration. When assessing cell viability according to the composition of the culture medium, such as methionine or vitamin B12 deprivation, the protocol was identical, with the exception that the cells were directly seeded in the medium of interest. We added lOpl of PrestoBlue to the 90pl of medium after 72h of treatment, then the plate was incubated at 37°C in the dark (for 3h for A427 and PANCI, 8h for TH17), before quantifying fluorescence (excitation 560nm, emission 590nm) using Clariostar Microplate Reader (BMG Labtech, Champigny-sur-Mame, France). The measured fluorescence was blank corrected, and the viability in each condition was compared to that observed in the control condition (100% viable cells), corresponding to complete medium (CTRL) without drugs. The quantity of vehicle (DMSO) was adjusted to be identical in each condition, including in the no-treatment control condition.
[0387] A.6. Cell death and apoptosis quantification using flow cytometry
[0388] Apoptosis of PANCI cancer cells or control fibroblasts treated for 3, 7 and 10 days was quantified using a commercial Annexin V / Propidium Iodide kit (Molecular Probes, Eugene, OR; # V13241). Cells treated for 24 hours with IpM Staurosporine (Sigma-Aldrich) were considered as positive controls. The supernatant and cells were harvested, centrifuged at 650g for 5min and resuspended in cold IX PBS for rinsing. Cells were then counted and diluted to a concentration of 106cells / ml in Annexin V-Binding Buffer IX. 105cells were then labelled with 5 pl FITC-Annexin V and I l Propidium Iodide working solution, incubated for 15min in the dark and diluted in 400pl Annexin V-Binding Buffer IX. Samples were kept on ice until analysis. Cells are then analysed using the BD FACS-Canto™ flow cytometer (BD Bioscience, Mountain View, CA) measuring fluorescence emission at 530nm and >575nm with data analysis of 10,000 events from a Pl population excluding cell doublets and debris. The population was separated into 4 distinct groups: living unlabelled cells, cells at an early stage of apoptosis (positive for Annexin only), cells at a late stage of apoptosis (double positive) and a population of necrotic cells (positive for Propidium Iodide).
[0389] A.7. siRNA transfection
[0390] Methionine synthase expression was decreased in PANC-1 cancer cells using a combination of 3 siRNA duplexes (MTR Human siRNA Oligo Duplex; OriGene Technologies Inc., Rockville, MD, USA, #SR303001) with the following sequences:
[0391] SR303001 A - AUGUCACAUGAUUAAAGGUAAGCAUUG (SEQ ID NO. 1)
[0392] SR303001B - UGCUCUUGGUAUGCUUCAACAAGCUCA (SEQ ID NO. 2) SR303001C - UUGAUUGCAUGGUAAAGGAAAACCCCA (SEQ ID NO. 3)
[0393] PANCI cells were trypsinised, counted and plated at a density of 50,000 cells / well in a 6- well plate 24h prior to transfection. Cells were transfected using 5 pl per well of Lipofectamine™ RNAiMAX (Lipofectamine™ RNAiMAX Transfection Reagent; Invitrogen; #13778150) and 30pmol of control or MTR siRNA according to the manufacturers' instructions. Lipofectamine and siRNAs were diluted in transfection medium (DMEM not supplemented with SVF) mixed together volume to volume and left to incubate at room temperature for 30min. The mix was then applied to the cells in SVF-supplemented medium and the plates were left to incubate in a humid atmosphere at 37°C and 5% CO2. Transfection efficiency was checked by RTqPCR and Western blot analysis after 72h.
[0394] A.8. RT-qPCR
[0395] After 72h of transfection of PANCI cells with anti -MTR and control siRNAs, cells were harvested and washed in PBS IX before RNA was extracted using the RNeasy Mini Kit (Qiagen; Cat.#74104). The cells were solubilised in RLT lysis buffer. Several wash steps and an elution step were performed on a column according to the manufacturer's recommendations. After extraction, the RNA was stored at -80°C until use. After spectrophotometric determination of the quantity and quality of RNA present in each sample (NanoDrop 2000, ThermoFisher Scientific), RT-qPCR was performed. Reverse transcription into complementary DNA (cDNA) is performed using a reverse transcriptase kit (SuperScript™ II Reverse Transcriptase; Invitrogen; #18064022) according to the manufacturer's instructions. The reverse transcription program contains a cycle of 30min at 42°C and 3min at 95°C to dissociate the enzyme. The cDNAs obtained are diluted to lOpg / pl and stored at -20°C.
[0396] Transcripts of genes of interest and reference genes were quantified by real-time quantitative PCR using an intercalating agent: SybrGreen (SYBR® Select Master Mix - ThermoFisher Scientific). The primer sequences used are described below. For each condition, a reaction mix was prepared comprising: 2pl of diluted cDNA; 0.5pl of Forward (F) sense primer (lOpM); 0.5pl of Reverse (R) anti-sense primer (lOpM); 5pl of SybrGreen mix (iQ Sybr green Supermix) and 2 pl of sterile water and placed in a 96-well plate. For amplification, the plate was then centrifuged and placed in the Chromo 4 real-time PCR Detector thermocycler. The amplification programme used was as follows: Activation: 95°C for lOmin; Denaturation: 95°C - 10s; Hybridization: 59°C - 15s; Elongation: 72°C - 20s - Number of cycles: 45 cycles. The fluorescence emitted, detected by a spectrofluorometer, is proportional to the amount of DNA synthesised and therefore to the mRNA expression of the gene of interest in a sample. Analyses are carried out in triplicates and the values of at least 4 measurements are used for statistical analysis.
[0397] Table 2: PCR amplification primer sequences
[0398] A.9. Western blot
[0399] The cell pellets were lysed using RIPA buffer. We added 20pl of lysis solution per million cells contained in the samples, then they were incubated at 4°C for lOmin and regularly shaken for homogenisation. The cell lysates were then centrifuged at 16,000rpm for Imin at 4°C to pellet the nuclear elements, and only the supernatant was kept.
[0400] The total protein concentration of the samples was quantified using the PierceTM BCA Thermo ScientificTM assay kit (Thermo Fisher Scientific, Waltham, MA, USA). The plate was incubated at 37°C for Ih. Absorbance was then measured using a Clariostar® Microplate Reader (BMG Labtech, Champigny-sur-Mame, France).
[0401] To prepare the Western blot samples, the volume of cell lysate containing 30pg of total protein was mixed with water and anti-protease for a total volume of 24pl, then 8pl of a solution comprising 10% P-mercaptoethanol and 90% Laemmli 4x was added for a final volume of 32JJ,1. The samples were heated at 90°C for 5min before being placed in the migration gel. After migration, proteins were transferred from the gel to the membrane using the iBlot 2 gel transfer device (InvitrogenTM, Thermo Fisher Scientific, Waltham, MA, USA). The nitrocellulose membrane was placed in an opaque dish and incubated for 2h at room temperature in a saturation solution consisting of 50% TBS blocking buffer and 50% TBS (total volume 10ml). After 3 washes with TBS, the membrane was incubated with the solution containing the primary antibody diluted 1 : 1000. The anti-actin antibody, used as a loading marker, was diluted to 1 :2000. After incubation overnight at 4°C, the membrane was washed 3 times with TBS-tween, then incubated for 2h at room temperature with the secondary antibody (anti -mouse IgG or anti -rabbit IgG) diluted to 1 : 10,000. Finally, the membrane was washed twice with TBS-tween and twice with TBS before reading the fluorescence. Fluorescence was quantified using the Odyssey® XF Imaging system (LI- COR Biosciences - GmbH, Bad Homburg vor der Hbhe, Germany).
[0402] A.10. Synergy analysis
[0403] The synergy between 2 treatments was investigated using two methods:
[0404] When two treatments "A" and "B" were studied at a single concentration for each compound (present at a given concentration or absent), the theoretical effect of "A" and "B" together was calculated using Webb's method (Webb, J.Leyden. Enzyme and Metabolic Inhibitors; Academic Press: New York, 1963), called the product fractionation method by Chou and Talalay, by multiplying the effect observed after treatment A and that of treatment B. We define as an additive effect between two treatments A and B when the effect of the combination "A+B" was equal to the cumulative effect of "A" and "B", and a synergy effect when the effect of the combination "A+B" was greater than the additive effect of "A" and "B" (Roell, K.R.; Reif, D.M.; Motsinger-Reif, A.A. An Introduction to Terminology and Methodology of Chemical Synergy — Perspectives from Across Disciplines. Front Pharmacol 2017, 8, 158, doi: 10.3389 / fphar.2017.00158).
[0405] With the analysis of a concentration range of each of the two compounds "A" and "B" and the construction of a FaCI plot (Chou, T.-C. Theoretical Basis, Experimental Design, and Computerized Simulation of Synergism and Antagonism in Drug Combination Studies. Pharmacol Rev 2006, 58, 621-681, doi: 10.1124 / pr.58.3.10). The "A" and "B" molecules were said to be synergistic if the combination index (CI) was <1, additive if the CI was =1 and antagonistic if the CI was >1.
[0406] A.ll. Methionine synthase activity assay
[0407] Methionine synthase activity was determined using the assay described by Kenyon et al. (2002, Biochem Pharmacol, Vol. 63: 381-391). Briefly, reactions contained 50 mM phosphate buffer (pH 7.4), 227 pM 14C-5 -methyltetrahydrofolate [2077 disintegrations per min (dpm).nmol)-l], 23 mM diothiothreitol, 40 pM S-AdoMet, 60 pM hydroxycobalamin, the enzyme source and (when applicable) dimethylsulfoxide solutions of the inhibitors (maximum volume 5 pL) in a total volume of 300 pL. Incubations were performed in lightexcluding sealed serum vials under nitrogen. The reaction mixture was pre-incubated for 5 min, the reaction was initiated by the addition of 500 pm (DL)-homocysteine and incubated at 37°C for a further 30 min, unless otherwise stated. The reaction was terminated by the addition of ice-cold water (400 pL). The reaction mixture was passed through a 0.5 x 5 cm AG1-X8 resin column, [14C] methionine was eluted with 2 mL of water and quantified using a liquid scintillation counter (Packard Tricarb 1900CA; Perkin Elmer).
[0408] Further relevant literature includes:
[0409] (i) Inhibition of cobalamin-dependent methionine synthase by substituted benzo-fused heterocycles. FEBS J. 2007 Jan;274(l):287-99. doi: 10.1111 / j. l742-4658.2006.05583.x.
[0410] (ii) Metabolic derangement of methionine and folate metabolism in mice deficient in methionine synthase reductase. Mol Genet Metab. 2007 May;91(l):85-97. doi: 10.1016 / j.ymgme.2007.02.001. Epub 2007 Mar 21.
[0411] (iii) (Gulati S, Chen Z, Brody LC, Rosenblatt DS, Banerjee R. Defects in auxiliary redox proteins lead to functional methionine synthase deficiency. J Biol Chem 1997;272: 19171— 19175. [PubMed: 9235907]
[0412] A.ll. Statistical analyses Quantitative data were presented as mean + / -SEM and compared between 2 groups using the Mann-Whitney test. The alpha risk was set at 5%. Statistical analyses were carried out using GraphPad Prism v6.01 software (GraphPad Software, Inc., La Jolla, CA 92037 USA).
[0413] A.13. Primary cell lines
[0414] Surgical resection of a lung adenocarcinoma was achieved. Cell dissociation and leukocyte sorting were then carried out. Cancer cells (primary line) were seeded in treatment media to assess their viability after 3 days of culture.
[0415] A.14. In vivo analyses
[0416] Nude mouse model with intradermal xenograft of PANCI cancer cells (pancreatic adenocarcinoma) were used. Treatment or vehicle was administered 21 days after xenograft, when tumor is in growth phase. Treatment (or vehicle) continued for 6 weeks. Extracellular methionine deprivation was achieved by a reduced methionine diet (0.12%), while the standard diet is similar in all respects except for a normal amount of methionine (0.86%). Methionine synthase (MS) inhibition is achieved by continuous subcutaneous pump administration of Cob-(4-ethylphenyl)-cobalamin (4EP) which is a MS inhibitor (dose: 167,04 nmol / day). Tumor size was measured 3 times a week with precision calipers.
[0417] A.15. Flow cytometry analysis of splenocytes for assessment of CD8+ T cells
[0418] Spleens of immunocompetent C57BL / 6J mice were mechanically dissociated into small fragments (~0.2 cm2) and passed through a 70 pm cell strainer to obtain single-cell suspensions. Red blood cells were lysed using ACK lysis buffer. The final cell concentration was adjusted to 1 x 106cells / mL in a total volume of 3 mL.
[0419] Prior to staining, Fc receptors were blocked by adding 10 pL of FcR Blocking Reagent to prevent non-specific antibody binding. Cells were then incubated with a viability dye (Viakrome 808, 2.5 pL per sample) and a panel of fluorochrome-conjugated monoclonal antibodies. For CD8+ T-cell identification, the following markers were used by adding 2.5 pl of each antibody to sample: CD45 (BUV395), CD3 (APC-Vio770), CD4 (PerCP-Vio700) and CD 8 (VioGreen). Samples were acquired using a CytoFLEX flow cytometer (Beckman Coulter) and analyzed with CytoExpert software. A compensation matrix was established prior to acquisition using MACS Comp Bead anti -REA and anti -rat IgK kits, according to the manufacturer’s instructions (Miltenyi Biotec, France). Acquisition settings were as follows: FSC set to 40, SSC set to 100, with 50,000 events acquired in the CD45+leukocyte gate.
[0420] Doublets were excluded using an FSC-A vs. FSC-H plot, and dead cells were excluded based on Viakrome 808 staining. CD8+T lymphocytes were defined as live CD45+CD3+CD4 CD8+cells.
[0421] Example 1: Heterogeneity of cancer cells as regards methionine dependence
[0422] Methods:
[0423] SKLU1 and A427 are two commercial lines of human lung adenocarcinoma. They are therefore cancer lines derived from the same type of cancer, but from two different patients. TH17 is a primary fibroblast cell line from healthy subject.
[0424] Culture conditions: CTRL medium (complete composition) and noMet medium (0 pM methionine).
[0425] Study of cell proliferation, relative to initial cell density, during the 5 days following seeding.
[0426] Results:
[0427] The results are depicted in Figure 1.
[0428] It is shown in this example that the SKLU1 cell line (Figure 1A) is methionine-dependent, as its proliferation is greatly slowed down in case of methionine deprivation, whereas A427 cell line (Figure IB) is methionine-independent, as this cell line is able to proliferate in both the presence and absence of methionine. TH17 (healthy cells - Figure 1C) is methionine- independent. These results are in line with previous published data and demonstrate the heterogeneity of methionine-dependence / independence in cancer cells from a same type of cancer. Example 2: Inhibition of methionine-dependent and methionine-independent human lung adenocarcinoma cells by a combination of a methionine-depleting composition and methionine synthase inhibition
[0429] Methods:
[0430] A427 is a "methionine-independent" cancer line (lung adenocarcinoma), which was therefore considered to have lower needs of methionine to proliferate.
[0431] We analysed the cell proliferation, relative to initial cell density, in methionine-deprived conditions (noMet), and with inhibition of either BHMT (by CBHcy), or methionine synthase (by deprivation of vitamin B12, its obligatory cofactor).
[0432] Results:
[0433] The results are depicted in Figure 2.
[0434] Under methionine-deprived conditions, the inhibition of the BHMT by addition of CBHcy did not limit the cell proliferation (figure 2A). As a consequence, either A427 has less methionine requirement, as assumed so far in the literature, or its intracellular synthesis is not dependent on BHMT. To distinguish between these two hypotheses, we analyzed what happens upon inhibition of methionine synthase (Figure 2B). Under methionine-deprived conditions, deprivation of the methionine synthase cofactor leads to cell proliferation arrest. This demonstrated that without functional methionine synthase, A427 cannot proliferate in the absence of methionine. Thus, either A427 is dependent on a functional methionine synthase whatever the methionine concentration in the medium, or A427 needs a functional methionine synthase to compensate for the absence of methionine in the culture medium.
[0435] Example 3: Synergistic inhibition of cancer cells proliferation only with a combination of a methionine-depleting composition and inhibition of methionine synthase.
[0436] Methods:
[0437] A427 is a "methionine-independent" cancer line (lung adenocarcinoma). We analysed the A427 cell proliferation in standard medium (CTRL), in the presence of MS inhibition by vitamin B12 deprivation (iMS (noB12)), in methionine-deprived condition (noMet), and the 2 associated conditions.
[0438] Results:
[0439] The results are depicted in Figure 3 (Figures, 3A, 3B).
[0440] Inhibiting MS did not slow down A427 proliferation when the amount of methionine in the culture medium was normal, whereas it inhibited its proliferation in the absence of methionine. We concluded that, contrary to what was previously reported in the literature, A427 actually requires methionine but was able to meet its own needs, via MS, to produce methionine endogenously. We then hypothesized that A427 and the other methionine- independent cancer cell lines either had a greater quantity of MS, or a greater capacity to activate this enzyme, notably via its B12 cofactor. We also hypothesised that the combination of methionine deprivation and MS inhibition was not toxic for non-cancer methionine-independent cells due to lower methionine needs.
[0441] Example 4: Methionine-independent cancer cells produce intra-cellular methionine
[0442] Methods:
[0443] A: Western blot comparison of methionine synthase protein levels between A427 (a methionine-independent cancer cell line), and SKLU1 (a methionine-dependent cancer cell line).
[0444] B: Comparison of MTR encoding the MS gene expression between known methioninedependent and known methionine-independent cell lines, based on RNAseq data from the Broad Institute Cancer Cell Line Encyclopedia (CCLE).
[0445] Results:
[0446] The results are depicted in Figure 4.
[0447] A427 and SKLU1 contain a similar amount of MS protein (Figure 4A), and MTR gene expression (Figure 4B) does not differ between methionine-dependent and -independent cell lines, at least under normal culture conditions, in the presence of methionine. The phenotypic difference between methionine-dependent and -independent cells is therefore not related to a simple increase in the amount of MS in methionine-independent cells. We then hypothesised that either methionine-independent cells are able to increase their MTR gene expression under methionine starvation conditions, or are able to have greater MS activity via greater access to its cofactor, vitamin B 12. These results show that the difference between Methionine-dependent and Methionine-independent cells with respect to Methionine synthase (MS) is a qualitative difference (more active enzyme in Methionine-independent cells) and not a quantitative one (enzyme present in greater quantity). This shows the value of inhibiting methionine synthase in methionine-independent cancer cells.
[0448] Example 5: Level of CD320 gene expression as a predictive marker of methionine- independence.
[0449] Methods:
[0450] Comparison of CD320 gene expression between known methionine-dependent and known methionine-independent cell lines, based on RNAseq data from the Broad Institute Cancer Cell Line Encyclopedia (CCLE), and analysis of the association between CD320 expression and the likelihood of the cancer cell line being methionine-independent.
[0451] Results:
[0452] The results are depicted in Figure 5 (Figures 5A, 5B).
[0453] RNAseq gene expression, including under standard culture conditions (without methionine deprivation), shows that methionine-independent cells tend to transcribe CD320 more than methionine-dependent cells. CD320 gene expression is even associated with predictive performance for methionine-independence at the limit of significance, but without sufficient performance to be used routinely to attest to methionine-independence. Above all, all methionine-independent cell lines have a high expression of CD320, which therefore seems to be a necessary condition for methionine-independence. Example 6: Synergistic activity of a combination of methionine-depleting composition and inhibition of methionine synthase on various cancer cells viability.
[0454] Methods:
[0455] PANCI is a pancreatic cancer cell line, A427 is a lung cancer cell line, MeWo is a melanoma cell line, SKNMC is a glioblastoma cell line, HT29 is a colon cancer cell line, T24 is a urothelial cancer cell line and SKLMS1 is a leiomyosarcoma cell line.
[0456] We analysed the cell viability with PrestoBlue after 3 days of treatment exposure.
[0457] Results:
[0458] The results are depicted in Figure 6.
[0459] In addition to limiting cell proliferation as seen previously, we demonstrate here that the combined action of methionine deprivation and MS inhibition performed, here via vitamin B12 deprivation, induces a drastic reduction in cell viability. Furthermore, we demonstrate that this is not limited to A427 (Figure 6B), but is transferable to other cancer cell lines from various types of cancers, such as PANCI (Figure 6A), MeWo (Figure 6C), SK-N-MC (Figure 6D), HT-29 (Figure 6E), T-24 (Figure 6F) and SK-LMS1 (Figure 6G). Finally, we demonstrate the synergy between the two treatments for all these cancer cell lines. In conclusion, the combination of methionine deprivation and methionine synthase inhibition, here by vitamin B12 deprivation, is synergistically effective in reducing cell viability, irrespective of the cancer types.
[0460] Example 7: Synergistic activity of a combination of methionine-depleting composition and inhibition of methionine synthase on the viability of cancer cells from haematological cancers.
[0461] Methods:
[0462] Mono-Mac-6 is an acute myeloid leukaemia cell line.
[0463] Cell viability was analysed by PrestoBlue after 3 days of exposure to treatment. Results:
[0464] The results are depicted in Figure 7.
[0465] In addition to demonstrating its benefits and synergistic efficacy in solid cancers, our combination of methionine deprivation and MS inhibition is also effective and synergistic in haematological cancers, which are often much more methionine-dependent.
[0466] Example 8: Absence of undesirable effects of a combination of methionine-depleting composition and inhibition of methionine synthase on non-cancerous cells.
[0467] Methods:
[0468] TH17, TH16002 and TF 15003 are fibroblasts from healthy subjects.
[0469] 8A: Analysis of cell proliferation.
[0470] 8B and 8C: Analysis of cell viability by PrestoBlue after 3 days of exposure to treatment.
[0471] Results:
[0472] The results are depicted in Figure 8 (Figures 8A, 8B, 8C).
[0473] In addition to being effective and synergistic on cancer cells regardless of the origin of the cancers, our combination of methionine deprivation and MS inhibition does not reduce the viability of various healthy fibroblast cell lines (Figures 8A-8C). Synergistic efficacy is therefore not correlated with synergistic toxicity.
[0474] Example 9: Synergistic activity of a combination of methionine-depleting composition and inhibition of methionine synthase by a chemical compound as a direct inhibitor of methionine synthase, on the viability of cancer cells
[0475] Methods:
[0476] A427 is a lung adenocarcinoma cancer cell line.
[0477] 4N-BZT is a direct inhibitor of methionine synthase. Cell viability was analysed by PrestoBlue after 3 days of exposure to treatment.
[0478] The dotted line represents the limit below which a synergistic, not just additive, effect is observed.
[0479] Results:
[0480] The results are depicted in Figure 9.
[0481] The mean for the combination of the present invention is below the line of additive effect, so it proves that there is synergy. The results are a representation of a mean + / - standard deviation (SD), not a 95% confidence interval, so the proximity of the SD bar to the dotted line has no influence on the synergy assessment. The combination of methionine deprivation and direct inhibition of MS by 4N-BZM results in a synergistic reduction in cell viability.
[0482] Example 10: Mathematical model of the anti-cancer synergistic activity of a combination of methionine-depleting composition and inhibition of methionine synthase.
[0483] Methods:
[0484] PANCI is a pancreatic adenocarcinoma cell line.
[0485] We analysed the cell viability with PrestoBlue after 3 days of treatment exposure, according to different methionine and vitamin B12 concentration pairs, i.e., different degrees of methionine deprivation and MS inhibition. A 3D representation and a Fa-CI (Fraction Affected - Combination Index) plot illustrating the interaction between methionine deprivation and vitamin B12 deprivation at various concentrations on cell viability were created.
[0486] Results:
[0487] The results are depicted in Figure 10A (3D representation of the synergistic activity) and
[0488] 10B There is a synergistic effect between the two treatments for any methionine concentration lower than 1 pM associated with a vitamin B12 concentration lower than 200 ng / 1 (Figure 10A).
[0489] At higher Fa values (> 0.4), most data points fall below CI = 1, indicating a synergistic interaction between methionine deprivation and vitamin B12 deprivation at elevated effect levels. The combination appears to enhance the biological effect at high fractions of affected cells, as evidenced by the clustering of data points in the synergism region (Figure 10B). This analysis demonstrates that the interplay between methionine and vitamin B 12 is dosedependent, with synergistic effects becoming increasingly pronounced as methionine and vitamin B 12 levels decrease.
[0490] Example 11: Synergistic induction of cancer cell apoptosis by a combination of methionine-depleting composition and an indirect inhibition of methionine synthase through a vitamin B12 deprivation.
[0491] Methods:
[0492] PANCI is a pancreatic adenocarcinoma cell line.
[0493] We analysed cell death by flow cytometry with annexin V and propidium iodide labelling, after 3 days of treatment.
[0494] Quadrant Q3 corresponds to viable cells, QI to necrosis, Q4 to early apoptosis and Q2 to late apoptosis.
[0495] Results:
[0496] The results are depicted in Figure 11.
[0497] Results demonstrate that under the combination of methionine deprivation and MS inhibition, here via B 12 deprivation, cancer cells die by apoptosis. We therefore demonstrate that, in addition to inhibiting proliferation and reducing the viability of cancer cells, our combination does indeed result in cell death. This cell death is caused by apoptosis. Example 12: Progressive cancer cell apoptosis induced only by a combination of methionine-depleting composition and an indirect inhibition of methionine synthase through a vitamin B12 deprivation.
[0498] Methods:
[0499] PANCI is a pancreatic adenocarcinoma cell line.
[0500] We analysed cell death by flow cytometry with annexin V and propidium iodide labelling. We quantified the proportion of cells that died from apoptosis according to the culture medium: CTRL, MS inhibition via B12 deprivation, methionine deprivation and the combination of methionine deprivation and MS inhibition.
[0501] Results:
[0502] The results are depicted in Figure 12.
[0503] While cell death by apoptosis was similar over 10 days between the control (CTRL), methionine deprivation (noMet, alone) and MS inhibition via B12 deprivation (noB12, alone) treatments, the combination of methionine deprivation and MS inhibition synergistically led to cell death by apoptosis, with over 60% of cells dying after 10 days of treatment.
[0504] Example 13: Cell apoptosis induction by a combination of methionine-depleting composition and inhibition of methionine synthase is restricted to cancer cells.
[0505] Methods:
[0506] We analysed cell death by flow cytometry on the PANCI cancer cell line and on a healthy fibroblast cell line, after 10 days of treatment.
[0507] Results:
[0508] The results are depicted in Figure 13.
[0509] The combination of methionine deprivation and MS inhibition does not increase cell death in fibroblasts (Figure 13, right part, upper and lower panels), whereas it increases cell death in PANCI cancer cells (Figure 13, left part, upper and lower panels). We demonstrate the synergy of both treatment on PANCI cell death and an excellent tolerance on healthy cells.
[0510] Example 14: Effect on viability of human cancer cells of a combination of methionine- depleting composition and inhibition of methionine synthase, further combined to a chemical anti-cancer agent, here a hypomethylating agent.
[0511] Methods:
[0512] We analysed the cell viability with PrestoBlue after 72h of treatment.
[0513] 5M-BZM, 5N-BZM and 4N-BZT are direct MS inhibitors.
[0514] 5-aza (5-azacytidine) is a hypomethylating agent.
[0515] The dotted line represents the limit below which a synergistic, not just additive, effect is observed.
[0516] Results:
[0517] The results are depicted in Figure 14 (Figures 14A, 14B, 14C).
[0518] We demonstrate that the combination of methionine deprivation, MS inhibition and a third agent, like 5-azacytidine, is effective to synergistically reduce the cancer cell viability.
[0519] Example 15: Effect on viability of various human cancer cells of a combination of methionine-depleting composition and inhibition of methionine synthase, further combined to a chemical anti-cancer agent, here a hypomethylating agent.
[0520] Methods:
[0521] Figure 15A represents the degree of methionine-dependence or -independence of each cancer clone, determined by the ratio between the cell proliferation in the presence or absence of methionine. Figure 15B shows the analysis of cell proliferation by the mean of measuring the confluence achieved after 5 days, and normalised to the control condition.4N-BZT is a direct MS inhibitor.
[0522] 5-azacytidine is an example of an agent that can be coupled with the combination of methionine deprivation and MS inhibition; it is a hypomethylating agent.
[0523] Results:
[0524] The results are depicted in Figure 15 (Figures 15A, 15B).
[0525] In figure A, we confirm that the clone selection method resulted in different methionine- dependence or -independence profiles for each cancer cell line.
[0526] The combination of methionine deprivation and MS inhibition, here directly with 4N-BZT, with a third agent, here 5-azacytidine, results in a drastic reduction in cell proliferation, irrespective of the level of methionine-dependence or -independence of the line and clone under study. Thus, regardless of the proportion of each cell population within the same cancerous tumour, the treatment is effective in inhibiting the proliferation of each cancer clone.
[0527] Conversely, no reduction in cell proliferation was observed in healthy cells, in this case, fibroblast primary cell lines.
[0528] Example 16: Persistence of the inhibition of pancreatic cancer cells proliferation after a treatment combining a methionine-depleting composition and inhibition of methionine synthase, even after rescue in standard medium.
[0529] Methods:
[0530] After a 72-hour treatment of PANCI cells with one of four media (standard (STD), methionine deprivation (noMet), MS inhibition (noB12), or dual therapy (noMetnoB12)) the surviving cells were seeded in a standard (STD) medium for rescue.
[0531] Results:
[0532] The results are depicted in Figure 16. We observed that while the post-rescue proliferative capacity increased following prior exposure to noMet alone, the dual therapy (noMetnoB12) produced a prolonged reduction in proliferation. This strongly supports both the feasibility of using this treatment sequentially and the superiority of dual therapy over methionine deprivation alone.
[0533] Example 17: Tumor size under treatment combining a methionine-depleting composition and inhibition of methionine synthase in a xenografted nude mice model.
[0534] Methods:
[0535] Nude mice were xenografted via intradermal injection of 5* 106PANCI cells. Three weeks later, the mice were randomized into one of four treatment groups for 6 weeks:
[0536] STD: Standard diet (methionine 0.86%) with continuous subcutaneous injection of vehicle (NaCl), n=7 noMet: Methionine-restricted diet (methionine 0.14%) with continuous subcutaneous injection of vehicle (NaCl), n=6
[0537] STD 4EP: Standard diet (methionine 0.86%) with continuous subcutaneous injection of 4EP (Cob-(4-ethylphenyl)-cobalamin: MS inhibitor), n=8 noMet 4EP: Methionine-restricted diet (methionine 0.14%) with continuous subcutaneous injection of 4EP (MS inhibitor), n=6
[0538] Results:
[0539] The results are depicted in Figure 17.
[0540] Curves present the changes in tumor size, standardized to the tumor size at the first day of treatment.
[0541] We observed that tumors grew in the STD, noMet, and STD 4EP groups, but not in the dual therapy group (noMet 4EP). This demonstrates in vivo the efficacy and synergy of this dual therapy. Example 18: Synergistic reduction of viability of human primary lung cancer cells under the combination of a methionine-depleting composition and inhibition of methionine synthase.
[0542] Methods:
[0543] After surgical resection of lung adenocarcinomas from a patient, we dissociated the cells and removed CD45 cells (leukocytes) to obtain the cancer cells suspension. These cells were seeded into 384-well plates and cultured in four culture media for three days: Standard (STD), MS inhibition via B 12 deprivation (noB12), methionine deprivation (noMet) and the combination of methionine deprivation and MS inhibition (noMetnoB12).
[0544] After 3 days of treatment, cell viability was assessed using Resazurin. Viability was calculated relative to that observed in the control (STD) medium.
[0545] Results:
[0546] The results are depicted in Figure 18
[0547] We observed that the tumor contains around 70% of cells resistant to methionine deprivation (noMet). This confirms tumor heterogeneity with respect to methionine independence (it comprises methionine independent cancer cells and methionine-dependent cancer cells). While the viability of cancer cells increased following exposure to methionine synthase (MS) inhibition alone (noB12), the combination (noMetnoB12) caused a sharp decrease in cancer cell viability, far greater than the decrease caused by methionine deprivation alone (noMet). This demonstrates in vivo the efficacy and synergy of the combination of methionine deprivation and methionine synthase inhibition.
[0548] Example 19: Tumoral heterogeneity of methionine-dependence or -independence in two human tumors of identical histological type.
[0549] Methods:
[0550] After surgical resection of lung adenocarcinomas from two patients (patient #1 and patient #2), we dissociated the cells and removed CD45 cells (leukocytes) to obtain the cancer cells suspension. These cells were seeded into 384-well plates and cultured in various media, including a standard medium containing 100 pM methionine (STD / Met+) and a methionine- free medium (noMet / Met-). After 3 days of treatment, cell viability was assessed using Resazurin. Viability was calculated relative to that observed in the control medium (100 pM Methionine).
[0551] Results:
[0552] The results are depicted in Figure 19
[0553] The tumor from patient #2 contains methionine-dependent tumor clones, affected by methionine deprivation, whereas the tumor from patient #1 is essentially composed of methionine-independent clones. This newly highlights that methionine-dependence heterogeneity, previously known in commercial secondary cell lines, is now also observed in the diverse clones present within human tumors. In the absence of predictive markers for methionine-dependence, this highlights the importance of identifying treatments targeting methionine-independent cells, as the methionine deprivation only acts on a few cancer cell populations. Furthermore, even though it contains methionine-dependent cells, the tumor from patient #2 consists mostly of cells capable of surviving without circulating methionine, this again highlights the importance of targeting these cells.
[0554] Example 20: Hemoglobin level after 6 weeks under treatment combining a methionine- depleting composition and inhibition of methionine synthase
[0555] Methods:
[0556] Nude mice which were xenografted with PANCI cells were randomized into one of four treatment groups for 6 weeks:
[0557] STD: Standard diet (methionine 0.86%) with continuous subcutaneous injection of vehicle (NaCl), n=4 noMet: Methionine-restricted diet (methionine 0.14%) with continuous subcutaneous injection of vehicle (NaCl), n=2 STD 4EP: Standard diet (methionine 0.86%) with continuous subcutaneous injection of 4EP (Cob-(4-ethylphenyl)-cobalamin: MS inhibitor), n=7 noMet 4EP: Methionine-restricted diet (methionine 0.14%) with continuous subcutaneous injection of 4EP (MS inhibitor), n=5
[0558] At the end of the 6-week treatment period, blood samples were collected for complete blood count analysis.
[0559] Results:
[0560] The results are depicted in Figure 20.
[0561] Hemoglobin levels remained stable across all four groups after 6 weeks of treatment. Notably, the combination of methionine restriction and methionine synthase inhibition (4EP treatment: noMet 4EP) did not induce anemia, despite the potential risk associated with vitamin B 12 deficiency (4EP is a vitamin B 12 antagonist). These findings suggest that this therapeutic strategy does not result in the main anticipated hematologic toxicity (anemia due to vitamin B12 deficiency). This also means that dual therapy (combination of the present invention) allows the use of lower doses of methionine synthase inhibitor (4EP) than those that cause the undesired hematological effects of B12 deficiency (anemia), thanks to the synergistic efficacy of the two treatments.
[0562] Example 21: Mean Corpuscular Volume level after 6 weeks under treatment combining a methionine-depleting composition and inhibition of methionine synthase
[0563] Methods:
[0564] Nude mice which were xenografted with PANCI cells were randomized into one of four treatment groups for 6 weeks:
[0565] STD: Standard diet (methionine 0.86%) with continuous subcutaneous injection of vehicle (NaCl), n=4 noMet: Methionine-restricted diet (methionine 0.14%) with continuous subcutaneous injection of vehicle (NaCl), n=2 STD 4EP: Standard diet (methionine 0.86%) with continuous subcutaneous injection of 4EP (Cob-(4-ethylphenyl)-cobalamin: MS inhibitor), n=7 noMet 4EP: Methionine-restricted diet (methionine 0.14%) with continuous subcutaneous injection of 4EP (MS inhibitor), n=5
[0566] At the end of the 6-week treatment period, blood samples were collected for complete blood count analysis.
[0567] Results:
[0568] The results are depicted in Figure 21.
[0569] Mean Corpuscular Volume (MCV) levels remained stable across all four groups after 6 weeks of treatment. Notably, the combination of methionine restriction and 4EP treatment (noMet 4EP) did not induce macrocytosis, despite the potential risk associated with vitamin B12 deficiency. These findings suggest that this therapeutic strategy does not result in the main anticipated hematologic toxicity (macrocytosis due to vitamin B12 deficiency). This also means that dual therapy (combination of the present invention) allows the use of lower doses of 4EP than those that cause the hematological effects of B12 deficiency (macrocytosis), thanks to the synergistic efficacy of the two treatments.
[0570] Example 22: Proportion of CD8+T cells in spleens of C57BL / 6J mice after 7, 14, and 21 days under treatment combining a methionine-depleting composition and inhibition of methionine synthase
[0571] Methods:
[0572] C57BL / 6J mice were randomized into one of four treatment groups:
[0573] STD: Standard diet (methionine 0.86%) with daily subcutaneous injection of vehicle (NaCl) noMet: Methionine-restricted diet (methionine 0.14%) with daily subcutaneous injection of vehicle (NaCl) STD 4EP: Standard diet (methionine 0.86%) with daily subcutaneous injection of 4EP (Cob-(4-ethylphenyl)-cobalamin: MS inhibitor) noMet 4EP: Methionine-restricted diet (methionine 0.14%) with daily subcutaneous injection of 4EP (MS inhibitor)
[0574] Spleens were collected at days 7, 14, and 21 for flow cytometry analysis.
[0575] Results:
[0576] The results are depicted in Figure 22.
[0577] On day 7, a significant increase in the proportion of CD8+T cells was observed in the LowMet+4EP group compared to the STD group, whereas no significant change was observed in either monotherapy group (LowMet or 4EP alone). On days 14 and 21, CD8+T- cell levels remained stable and comparable to the control condition.
[0578] These results demonstrate that the combination treatment (LowMet+4EP) transiently increases the proportion of CD8+T cells at early time points (day 7), an effect not observed with either of the monotherapies. Importantly, this CD8+T-cell elevation is maintained at levels comparable to controls at later time points (days 14 and 21), indicating the absence of toxicity on this cell population that is of high interest for anti-tumor immune response. This suggests that treatment combining a methionine-depleting composition and inhibition of methionine synthase does not interfere with CD8-mediated immune responses, which are critical for the efficacy of many immunotherapies, and the early increase in CD8+T cells may even enhance immunotherapeutic efficacy, potentially boosting antitumor immunity when used in combination with this treatment.
[0579] Table of sequences
Claims
CLAIMS1. A combination of (i) one or more methionine-depleting compositions and of (ii) one or more methionine synthase inhibitors for use in treating cancer, wherein methionine- depleting composition is any composition of matter which, when administered to a subject, causes a drastic reduction in the amount of extracellular methionine that is available to the cells, especially to the cancer cells.
2. The combination for its use according to claim 1, wherein the methionine-depleting composition is a methionine-deprived composition comprising an amount of methionine suitable for a daily intake of about 0,1 to 5 mg per kg of body weight.
3. The combination for its use according to claim 1, wherein the methionine-depleting composition is a methionine-deprived composition which does not contain methionine.
4. The combination for its use according to claim 1, wherein the methionine-depleting composition is a methionine-degrading composition which contains methionine gamma lyase.
5. The combination for its use according to any one of claims 1 to 4, wherein the methionine synthase inhibitor is a direct methionine synthase inhibitor.
6. The combination for its use according to claim 5, wherein the direct methionine synthase inhibitor is selected from an inhibitory antibody directed against methionine synthase, an inhibitory protein aptamer directed against methionine synthase, a nucleic acid aptamer directed against methionine synthase, an antisense oligonucleotide directed against the MTR gene, or a siRNA directed against a AZZR-encoded mRNA.
7. The combination for its use according to claim 5, wherein the direct methionine synthase inhibitor is one or more siRNAs, shRNAs or IncRNAs directed against a AZZR-encoded mRNA.
8. The combination for its use according to claim 5, wherein the direct methionine synthase inhibitor is a siRNA comprising a nucleic acid sequence selected from SEQ ID NO. 1, SEQ ID NO. 2 or SEQ ID NO. 3.
9. The combination for its use according to claim 5, wherein the direct methionine synthase inhibitor is selected from:(i) a benzimidazole inhibitor, such as selected from 5- methoxybenzimidazole, 5- nitrobenzimidazole and 4-nitro-N-(2-(5-nitro-lH-benzimidazol-2-yl)ethyl)benzamide;(ii) a benzothiazole inhibitor such as 4-nitro-2, 1,3 -benzothiadiazole;(iii) a quinoxaline inhibitor such as methyl-3-hydroxy-2-(2-(3-(4-methoxyphenyl)-4-oxo- 3 ,4-dihy droquinazolin-2-ylthio)acetamido propanoate;(iv) a N5 substituted tetrahydropteroate, such as N5 -substituted tetrahydropyrido[3,2- d]pyrimidine; and(v) a compound selected from N-[4]-[2,4-Diamino-5-formyl-5,6,7,8-tetrahydropyrido[3,2 - d]pyrimidin-6-ylmethyl)acetylamino]benzoyl]-L_glutamic acid and N-[4-((2-[2,4-diamino- 5(2,3-dibromopropane)-5,6,7,8-tetrahydropyrido(3,2-d)pyrimidin-6-yl]methyl)amino)-3- bromo-benzoyl]-L-glutamate.
10. The combination for its use according to any one of claims 1 to 4, wherein the methionine synthase inhibitor is an indirect methionine synthase inhibitor.
11. The combination for its use according to any one of claims 1 to 4, wherein the methionine synthase inhibitor is an indirect methionine synthase inhibitor selected from an antibody directed against CD320, one or more siRNAs, shRNAs or IncRNAs directed against a CD320-encoding mRNA or a vitamin B 12 antimetabolite compound.
12. The combination for its use according to claim 10 or 11, wherein the indirect methionine synthase inhibitor is a siRNA comprising a nucleic acid sequence selected from SEQ ID NO. 12, SEQ ID NO. 13 or SEQ ID NO. 1413. The combination for its use according to claim 11, wherein the vitamin B12 antimetabolite compound is selected among an aryl-cobalamin, an alkynyl-cobalamin, 4- ethylphenyl-cobalamin, 2-phenyl-ethynyl-cobalamine, a metal-modified and upper-axial- ligand-modified cobalamin antivitamin, , a [c-lactam] derivative of cobalamin, a ring- modified cobalamin, a f-side-chain-modified B12 derivative.
14. The combination for its use according to any one of claims 1 to 13, which is further combined with a chemotherapeutic agent, a radiotherapeutic agent or an immunotherapeutic agent against cancer.
15. The combination for its use according to claim 14, which is combined with a chemotherapeutic agent consisting of one or more hypomethylating agents.
16. The combination for its use according to claim 15, wherein the one or more hypomethylating agents are selected from 5-azacytidine (vidaza), 5 -aza-2’ -deoxy cyty dine (decitabine), 6-thioguanine, zebularine, guadecitabine, N-phthaloyl-L-tryptophan 1, shikonnin, psammaplin, isofistularin-3, epigallocatechin-3 -gallate, berberine, 3,3'- Diindolylmethane, harmalin, harmine, mahanine, reserpine, solamargine, tricostatine A, all- trans retinoic acid, hinokitiol, parthenolide, ursolic acid, curcubitacin B, procainamide, hydralazine, temozolomide (temodar), 1’entinostat (syndax) and SGI-110 (guadecitabine).
17. The combination for its use according to any one of claims 1 to 16, wherein the cancer is selected from solid cancers and hematological cancers.
18. The combination for its use according to any one of claims 1 to 16, wherein the cancer is selected from pancreatic adenocarcinoma, melanoma, colon adenocarcinoma, lung adenocarcinoma, leiomyosarcoma, glioblastoma, bladder cancer and acute myeloid leukemia.
19. Pharmaceutical kit of parts comprising:(i) a first container comprising one or more methionine-depleting composition, and(ii) a second container comprising one or more methionine synthase inhibitors.
Citation Information
Patent Citations
new DERIVATIVES OF 2,1,3-BENZOTHIADIAZOLE, THEIR PREPARATION AND THEIR APPLICATION AS MEDICINES
FR2321287A1
Multi-station proton beam therapy system
US4870287A
Method and apparatus for laser-controlled proton beam radiology
US5760395A
Antisense modulation of G-alpha-13 expression
US5981732A
Antisense modulation of G-alpha-i1 expression
US6046321A