Use of the b3GLCT-1 gene as a biomarker in breast tumor- associated liver metastasis

Abstract

The invention is related to the use of the B3GLCT1 gene and / or the Beta-1, 3- glucosyltransferase protein expressed by the B3GLCT1 gene as a biomarker in the detection of breast tumor-associated liver metastasis.

Description

[0001] DESCRIPTION

[0002] USE OF THE B3GLCT-1 GENE AS A BIOMARKER IN BREAST TUMOR- ASSOCIATED LIVER METASTASIS

[0003] Technical Field of the Invention

[0004] The present invention is related to the use of the B3GLCT1 gene and / or the Beta-1, 3- glucosyltransferase (B3Glc-T) protein expressed by the B3GLCT1 gene as a biomarker in the detection of breast tumor-associated liver metastasis.

[0005] State of the Art of the Invention (Prior Art)

[0006] Breast cancer is one of the leading causes of death worldwide. It is a heterogeneous disease with specific molecular subtypes associated with different prognosis and response to treatment.

[0007] Approximately 50% of all women diagnosed with breast cancer develop metastatic disease. Common metastatic sites include liver, lung, bone tissue, and brain. Approximately 50% of all patients with metastatic breast cancer have liver metastases. In addition, 5-12% of patients develop liver metastases as the primary site of breast cancer recurrence. The following are already used for the diagnosis of liver metastasis of breast cancer:

[0008] • Surgical examination,

[0009] • Investigation with radiological imaging methods [liver X-ray, ultrasonography (USG), computed tomography (CT), magnetic resonance (MR) and positron emission tomography (PET)],

[0010] • Biopsy (fine-tipped needle biopsy and sampling with laparoscopic methods) and pathological examination techniques. The use of these techniques in the diagnosis of breast cancer-associated liver metastasis slows down the process of diagnosing the disease, delays treatment, and leads to high costs and increased workload in hospitals.

[0011] Patent document no. JP4936379B2 relates to producing an animal model of lung or liver metastasis useful for analyzing the mechanism or cause of metastasis of breast cancer to the lung or liver, and providing new means for screening an agent that inhibits metastasis of breast cancer to the lung or liver.

[0012] Patent document no. CN108977547A describes an application of the TSPAN1 gene in the diagnosis, prognosis, and treatment of breast cancer metastasis. Said present invention provides the application of a reagent for detecting the expression level of the TSPAN1 gene in the preparation of a kit for detecting whether breast cancer metastasis has occurred and / or a prognosis kit for predicting the propensity for breast cancer metastasis.

[0013] Membrane glycoproteins are a promising target for a better understanding of breast cancer metastasis. Glycans can regulate different aspects of tumor progression, including proliferation, invasion, and metastasis. Glycans serve as one of the first points of contact during cell-cell interactions, therefore disease-associated changes in glycan biosynthesis may be more pronounced than changes in disease-associated proteins. Monitoring glycoproteins plays an important role in detecting and evaluating tumor progression in addition to assessing tumor burden and treatment. Due to the role of glycoproteins in cellular processes and disease progression, it is important to specifically study this class of proteins and their gene regions. Glycoproteins play critical roles in many biological functions and have been implicated as molecular targets in disease progression and for drug discovery. Glycoproteins are also used as tumor biomarkers for diagnosis and tumor monitoring.

[0014] Glycoproteins can be ideal biomarkers as they enter the circulation from tissues or blood cells through active secretion, making them evaluable for analysis via serum. Glycoproteins are known as various clinical cancer biomarkers and therapeutic targets. However, in the literature, there is no evidence of B3GLCT1 gene in the diagnosis of experimental breast tumor liver metastasis.

[0015] Summary and Objects of the Invention

[0016] The present invention is related to the use of the B3GLCT1 gene and / or the Beta-1, 3- glucosyltransferase (B3Glc-T) protein (Seq No:l) expressed by the B3GLCT1 gene as a biomarker in the detection of breast tumor-associated liver metastasis. The invention also relates to a biomarker analysis method for the detection of breast tumor- associated liver metastasis using the B3GLCT1 gene and / or Beta-1, 3 -glucosyltransferase (B3Glc-T) protein (Seq No: 1) expressed by the B3GLCT1 gene as a biomarker.

[0017] As a result of the studies conducted within the scope of the invention, the expression level of the B3GLCT1 gene was found to be 54.845 times higher in experimental breast tumor- associated metastatic liver tissues compared to healthy liver tissues.

[0018] Also herein, the Beta-1, 3 -glucosyltransferase (B3Glc-T) protein (Seq No: 1) expressed by the B3GLCT1 gene was not detected in healthy liver tissues in the studies performed within the scope of the invention, but was identified experimental breast tumor-associated metastatic liver tissues.

[0019] Therefore, the object of the present invention is to use the B3GLCT1 gene and / or the Beta- 1,3 -glucosyltransferase (B3Glc-T) protein (Seq No: l) expressed by the B3GLCT1 gene as a biomarker in the detection of breast tumor-associated liver metastasis.

[0020] Detailed Description of the Invention

[0021] The B3GLCT1 gene provides instructions for the construction of an enzyme called Beta-1, 3- glucosyltransferase (B3Glc-T), which is involved in the complex process of adding sugar molecules to proteins (glycosylation). The B3Glc-T enzyme is involved in a two-step glycosylation pathway that results in the formation of a sugar structure consisting of fucose and glucose sugars at a specific position of several different proteins. The enzyme B3Glc-T is responsible for the second step, which adds a glucose molecule to the fucose molecule already bound to the protein. The B3GLCT1 gene is normally active in most cells of the body, suggesting that the B3Glc-T enzyme plays an important role in many cell types.

[0022] As a result of the studies conducted within the scope of the invention, the expression level, in other words, the expression, of the B3GLCT1 gene was found to be 54.845 times higher in experimental breast tumor-associated metastatic liver tissues compared to healthy liver tissues. Again, the results of the proteomics study carried out within the scope of the invention support the use of the B3GLCT1 gene as a biomarker on a protein basis within the results of the above-mentioned gene expression levels, and also show the use of the B3Glc-T protein (Seq No: 1) expressed by the B3GLCT1 gene as a biomarker alone. Because the B3Glc-T protein (Seq No: 1) expressed by the B3GLCT1 gene was not detected in healthy liver tissues, whereas in said B3Glc-T protein was identified in experimental breast tumor-associated metastatic liver tissues on chromosome 5, with a molecular weight of 55.32 kDa and a peptide sequence of NH2-YGYGLGTGGYSYVTGGGGMVFSR (Seq No: l)-COOH. Here, Seq No: l represents the amino acid sequence of the B3Glc-T protein, i.e., the sequence YGYGLGTGGYS YVTGGGGMVF SR.

[0023] Therefore, the object of said invention is to use the B3GLCT1 gene and / or the Beta-1, 3- glucosyltransferase (B3Glc-T) protein (Seq No: l) expressed by the B3GLCT1 gene as a biomarker in the detection of experimental breast tumor-associated liver metastasis.

[0024] In the present invention, the use of the B3GLCT1 gene as a biomarker for the detection of breast tumor-associated liver metastasis is based on the determination and analysis of the expression level of the B3GLCT1 gene in liver tissue samples from healthy subjects and subjects with breast tumors.

[0025] In a biomarker analysis method for the detection of breast tumor-associated liver metastasis, RNA is first isolated from liver tissue samples taken from healthy subjects and subjects with breast tumors. Then, cDNA, which is complementary DNA, is synthesized from the isolated RNAs. The synthesized cDNAs and at least one specific primer of the B3GLCT1 gene are subjected to polymerase chain reaction and the B3GLCT1 gene is amplified. At the same time, the expression levels of this amplified gene are measured.

[0026] In the preferred embodiment of the invention, liver tissue samples taken from Balb / C albino mice with experimental mammary tumors and from healthy mice were used and RNA was isolated from these tissue samples. Then cDNA was synthesized from the isolated RNAs. B3GLCT1 gene was amplified by polymerase chain reaction with the synthesized cDNAs and specific forward primer (Seq No: 2) and reverse primer (Seq No: 3) of B3GLCT1 gene and the expression level of the target gene B3GLCT1 gene was measured by determining the relative fold increases of B3GLCT1 gene by real-time polymerase chain reaction (qRT-PCR) method. qRT-PCR analysis results were statistically evaluated. Firstly, the Ct value of the relevant gene to be investigated was normalized by subtracting from the Ct value of the reference gene, and the delta Ct (ACt) value was calculated. Then, the ACt values of the control group were subtracted from the ACt values of the experimental group to find the AACt value. Increasing or decreasing values of gene expression in folds were calculated as 2'AACt.

[0027] ACt = Ct (control) - Ct (reference)

[0028] AACt = ACt (target)- ACt (control)

[0029] Fold change = 2'AACt

[0030] Within the scope of the invention, the gene expression value of the B3GLTC1 gene in experimental breast tumor-associated metastatic liver tissues was calculated as follows in accordance with the above formulation.

[0031] ACt = 16.776-16.917

[0032] ACt = -0.141

[0033] AACt =-8.909-(-0.141)

[0034] AACt =-8.768

[0035] 2'AACt— 2-(-8.768)

[0036] 2-AACt= 434.364

[0037] As a result of the statistical evaluation of qRT-PCR analysis results, the B3GLCT1 gene was found 54.845 times higher in experimental breast tumor-associated metastatic liver tissues (434.364 relative fold) compared to healthy liver tissues (7.925 relative fold). In the preferred embodiment of the invention, sequencing of the B3GLCT1 gene was also performed to determine the base sequence of the target region and to determine whether there was a difference in gene sequence compared to the control group.

[0038] Below, the biomarker analysis method in the preferred embodiment of the invention for the detection of breast tumor-associated metastatic liver metastasis is described in detail along with the method steps under the headings of RNA isolation, cDNA synthesis, and determination of gene expression levels.

[0039] • RNA Isolation

[0040] For total RNA isolation, liver tissue samples taken from Balb / C albino mice with experimental mammary tumors and from healthy mice were weighed as 1 g and lysed in a tissue homogenizer. Lysis buffer (±1% mercaptoethanol) was added to the samples to accelerate the protein denaturation process.

[0041] Following this process, the same volume of 70% ethanol was added to the samples to remove the water from the homogenates. Samples were taken into the spin column tubes in the kit and centrifuged at 12000 g for 20 seconds. 700 pL of wash buffer- 1 was added and centrifuged at 12000 g for 20 seconds. 500 pL of wash buffer-2 was added and centrifuged again at 12000 g for 20 seconds. This process was repeated twice. Finally, 50 pL of RNase-free water composition was added to each tube and centrifuged at 12000 g for 2 minutes and 30 seconds. RNA amounts were determined using the NanoDrop (NaNoQ®) device.

[0042] • cDNA Synthesis

[0043] In this step, cDNA synthesis was performed by enzymatic reaction. For the cDNA synthesis protocol, 10 pL total RNA, 1 pL Multi Scribe Reverse Transcriptase, 2 pL 10 X RT Random Primer, 2 pL 10 X RT buffer, 4.2 pL nuclease free water, 0.8 pL 25 X dNTP mix (100 mM) were prepared with a final volume of 20 pL. PCR conditions were set as Step 1 : 25°C, 10 min; Step 2: 37°C, 120 min; Step 3: 85°C, 5 min. Determination of Gene Expression Levels

[0044] B3GLCT1 gene expression levels were measured by real-time polymerase chain reaction, i.e., real-time PCR (qRT - PCR) method. In gene expression studies, the cDNAs synthesized as above were used. cDNAs were amplified with B3GLCT1 specific primers (Seq No:2-Seq No:3) according to the SYBR Green qPCR Mastermix protocol. The qRT-PCR mixture was standardized as 2 pL RNase free water, 6 pL SYBR Green Master Mix, 2 pL cDNA, 0.5 pL forward primer (Seq No:2), and 0.5 pL reverse primer (Seq No:3) and loaded into 384-well plates.

[0045] The PCR program was set to: 1 cycle of 2 min at 50 °C and 10 min at 95 °C, 50 cycles of denaturation (95 °C, 15 sec), and annealing and extension (1 min at 60 °C). The GAPDH primer was used as calibration and correction factor.

[0046] The forward primer nucleotide sequence used here is GCAACTACCCACCGTTCTGT, represented by Seq No: 2. The reverse primer nucleotide sequence used here is TGTGGAGCGAGGTCTTGTAA, represented by Seq No: 3.

[0047] Forward Primer: GCAACTACCCACCGTTCTGT (Seq No:2)

[0048] Reverse Primer: TGTGGAGCGAGGTCTTGTAA (Seq No:3)

[0049] In this step, B3GLCT1 gene expression levels in tissues were measured by qRT-PCR and the results of the analysis were statistically evaluated.

[0050] A gene product is a biochemical (DNA or protein) substance resulting from the expression of a gene. The amount of gene product obtained is sometimes also used to understand the quality of the relevant gene. Most molecules with biomarker potential are of protein form. Proteomics studies are also needed to identify or validate these proteins. To this end, in the preferred embodiment of the invention, glycoproteomics analysis was performed on liver tissue samples taken from Balb / C albino mice with experimental mammary tumors and from healthy mice. The results of the glycoproteomics analysis conducted support the results of gene expression levels on a protein basis; Beta-1, 3 -glucosyltransferase (B3Glc-T) protein (Seq No: 1) expressed by the B3GLCT1 gene was not detected in healthy liver tissues, while the peptide sequence of said B3Glc-T protein (Seq No: 1) was identified in experimental breast tumor- associated metastatic liver tissues. The peptide sequence identified is NH2- YGYGLGTGGYSYVTGGGGMVFSR (Seq No: l)-COOH. Here, Seq No:l represents the amino acid sequence of the B3Glc-T (Beta-1, 3 -glucosyltransferase) protein, i.e., the sequence YGYGLGTGGYS YVTGGGGMVF SR.

[0051] These results show that the B3Glc-T protein (Seq No: 1) expressed by the B3GLCT1 gene can be used as a biomarker for the detection of breast tumor-associated liver metastasis, individually and independent of the use of the B3GLCT1 gene as a biomarker, in addition to confirming the expression results of the B3GLCT1 gene.

[0052] In order to confirm the results of the analysis of gene expression levels and the use of the B3GLCT1 gene as a biomarker and / or to demonstrate the use of the Beta-1, 3- glucosyltransferase (B3Glc-T) protein (Seq No: l) expressed by the B3GLCT1 gene as a biomarker individually, under the heading of glycoproteomics analysis below, in a preferred embodiment of the invention, the identification of Beta- 1,3 -glucosyltransferase (B3Glc-T) protein (Seq No: 1) expressed by the B3GLCT1 gene by glycoproteomics analysis in liver tissue samples taken from Balb / C albino mice with experimental mammary tumors and from healthy mice is described in detail.

[0053] • Glycoproteomics Analysis

[0054] Liver tissues were weighed to be in the range of 0.5-10.0 g. Urea solution (i.e. urea solution with DTT) was added to the prepared samples and incubated at room temperature for 1-2 hours for denaturation. Then 1.5 pL of 200 mM iodoacetamide (IAA) was added to prevent the formation of disulfide bonds and incubated for 1 hour at room temperature in the dark.

[0055] To reduce the urea concentration, 20 pL of 50 mM ABC / 2 mM CaCh reaction mixture was added to 100 pL.

[0056] To separate glycans; 2 pL of PNGaseF enzyme was added and incubated at 37 °C for 3-4 hours. Trypsinization process was performed to break the proteins into small fragments, for which trypsin solution was added to the reaction mixture at a ratio of 1 : 30- 1 :40. It was slowly vortexed and incubated overnight (16-18 hours) at 37 °C for digestion. At the end of incubation, 10% formic acid (FA) was added to stop the reaction and pH was adjusted to ~5.

[0057] Purification was performed in a SEPPAK Cl 8 solid phase extraction system for the purification process. The column conditioned with methanol was washed with 5%, 10%, 20%, 50%, 75%, and 100% acetonitrile and the fractions were collected and evaporated under nitrogen. After evaporation, it was solubilized with 1% FA, injected into LC-QTOF / MS system, and analyzed with high throughput to characterize fragmentation ions.

[0058] As a result of glycoproteomics analysis, the peptide sequence of B3Glc-T (Beta-1,3- glucosyltransferase) protein was detected in the experimental group. The detected peptide sequence is NH2-YGYGLGTGGYSYVTGGGGMVFSR (Seq No: l)-COOH. Here, Seq No:l represents the amino acid sequence of the B3Glc-T (Beta-1, 3 -glucosyl transferase) protein, i.e., the sequence YGYGLGTGGYSYVTGGGGMVFSR. All these studies and results support the use of B3GLCT1 gene and / or B3Glc-T protein (Seq No: 1) expressed by B3GLCT1 gene as a biomarker for the detection of breast tumor- associated liver metastasis.

Claims

CLAIMS1. B3GLCT1 gene and / or Beta-1, 3 -glucosyltransferase (B3Glc-T) protein (Seq No:l) expressed by the B3GLCT1 gene for use as a biomarker for the detection of breast tumor-associated liver metastasis.

2. A biomarker analysis method for the detection of breast tumor-associated liver metastasis, characterized in that it comprises the steps of: i. RNA isolation from liver tissue samples taken from healthy subjects and from subjects with breast tumors, ii. cDNA synthesis from isolated RNAs, iii. Measurement of expression levels of B3GLCT1 gene amplified with synthesized cDNAs and at least one specific primer for B3GLCT1 gene.

3. The biomarker analysis method according to claim 2, characterized in that the primers used are primer pairs having Seq No:2 and Seq No:3.

4. The biomarker analysis method according to claim 2, characterized in that the expression levels of the B3GLCT1 gene are measured by real-time PCR (qRT- PCR) method.

5. A biomarker analysis method for the detection of breast tumor-associated liver metastasis, characterized in that it comprises the step of identifying the Beta-1, 3- glucosyltransferase (B3Glc-T) protein (Seq No: 1) expressed by the B3GLCT1 gene in liver tissue samples taken from healthy subjects and from subjects with breast tumors.