Colorectal cancer metastasis marker as well as detection kit and application thereof
By detecting the expression levels of IFI44, CXCL8, and MBL2 biomarkers, a quantitative PCR kit was used to address the time lag in the diagnosis of colorectal cancer metastasis, enabling early and accurate diagnosis of T3 or T4 stages and liver and lung metastases.
Patent Information
- Application Number
- CN202511395928.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-28
- Publication Date
- 2026-01-13
AI Technical Summary
Colorectal cancer is diagnosed late, making metastasis diagnosis difficult, especially in distant metastases outside the lymphatic system. Current technology makes it difficult to perform convenient and targeted metastasis diagnosis.
Three biomarkers, IFI44, CXCL8, and MBL2, were provided as biomarkers for colorectal cancer metastasis. Their expression levels were detected by quantitative PCR kits, and combined with ROC analysis, to achieve the diagnosis of T3 or T4 stage colorectal cancer and liver and lung metastases.
It enables early and accurate diagnosis of colorectal cancer metastases, especially efficient identification of liver and lung metastases, improving the convenience and specificity of diagnosis.
Smart Images
Figure CN121320532A_ABST
Abstract
Description
Field of Invention:
[0001] This application belongs to the field of tumor diagnosis. Specifically, this application provides a set of colorectal cancer metastasis markers, their detection kits, and applications. Background technology:
[0002] Colorectal cancer is one of the most common types of cancer in clinical practice, and its onset is related to a variety of factors, including genetics, diet, and environment. Due to the limited availability of colonoscopy for routine testing, colorectal cancer is often diagnosed at a late stage (T2-T4) and has a high metastasis rate.
[0003] It is generally believed that the main route of metastasis for colorectal cancer is the lymphatic system, with the most common metastases being to the liver, lungs, and bones. Other possible sites for metastasis include the brain, kidneys, and peritoneum. Given the high likelihood of metastasis, the multiple locations, and the considerable distances involved, the diagnosis of metastasis becomes crucial. Using metastasis markers allows for the diagnosis / anticipation of the likelihood of metastasis using blood or lesion samples under laboratory conditions, making the metastasis diagnosis process more convenient and targeted. Summary of the Invention
[0004] In response to the above situation, this application provides a biomarker for colorectal cancer metastasis, wherein the biomarker is one or more of IFI44, CXCL8, and MBL2.
[0005] On the other hand, this application provides the application of reagents for detecting the expression levels of colorectal cancer metastasis markers in the preparation of kits for diagnosing colorectal cancer metastasis. The colorectal cancer metastasis markers are one or more of IFI44, CXCL8, and MBL2.
[0006] Furthermore, the markers for detecting colorectal cancer metastasis are IFI44, CXCL8, and MBL2.
[0007] Furthermore, the kit is a quantitative PCR kit.
[0008] Furthermore, the reagent used to detect the expression level of colorectal cancer metastasis markers is a PCR primer.
[0009] Furthermore, the reagent for detecting the expression level of colorectal cancer metastasis markers is the following PCR primers:
[0010] MBL2:
[0011] Upstream primer: GATAGTAGCCTGGCTGCCTCAG;
[0012] Downstream primer: TTGTTGGGTTCACCCTCGTTC;
[0013] IFI44:
[0014] Upstream primer: ACTTCTTAGAGGATTTGCCTTTTG;
[0015] Downstream primer: GAAATTATCAACTGTGCACAAGGAAA;
[0016] CXCL8:
[0017] Upstream primer: ACTGAGAGTGATTGAGAGTGGAC;
[0018] Downstream primer: AACCCTCTGCACCCAGTTTTC.
[0019] Furthermore, the kit also includes primers for detecting the expression level of an internal reference gene.
[0020] Furthermore, the internal reference gene is GAPDH.
[0021] Furthermore, the diagnosis of colorectal cancer metastasis refers to the diagnosis of metastasis in T3 or T4 stage colorectal cancer.
[0022] Furthermore, the diagnosis of colorectal cancer metastasis refers to the diagnosis of liver or lung metastasis of colorectal cancer.
[0023] The diagnosis described in this application includes determining the likelihood of metastasis or the likelihood of metastasis occurring.
[0024] The kit described in this application is preferably used to detect the expression level of biomarkers in colorectal cancer tissue, and the tissue can be obtained through interventional or routine surgery.
[0025] The kit in this application may also contain other conventional PCR reagents, including but not limited to RNA extraction reagents, reverse transcription reagents, polymerase, ATP, magnesium ions, dNTPs, etc. Attached Figure Description
[0026] Figure 1 Heatmap for differential gene analysis;
[0027] Figure 2 Volcano plot for differential gene analysis;
[0028] Figure 3 The ROC curves for the three markers during the screening process are shown in Figure A (IFI44), Figure B (CXCL8), and Figure C (MBL2).
[0029] Figure 4 The relative expression of MBL2 in different transfect samples of the two sets of validation samples;
[0030] Figure 5The relative expression of IFI44 in different transfected samples of the two sets of validation samples;
[0031] Figure 6 The relative expression of CXCL8 in different transfected samples of the two validation groups;
[0032] Figure 7 To validate the ROC curves of the three biomarkers in the patients, part A is IFI44, part B is CXCL8, and part C is MBL2. Detailed Implementation
[0033] Example 1: Bioinformatics Screening Process for Biomarkers
[0034] Data source:
[0035] Data from 22 non-metastatic colon cancer patients and 104 metastatic colorectal cancer patients were obtained by screening the colorectal cancer category in the TCGA database. Among them, there were 55 cases of liver metastasis, 23 cases of lung metastasis, 11 cases of bone metastasis, 12 cases of other metastases (ovary, kidney, brain), and 3 cases of multiple metastases.
[0036] Differential gene analysis:
[0037] Use R packages to convert IDs in the data into gene names; use the Limma package for differential expression analysis (P<0.05, logFC>1); use the pheatmap and ggplot packages to plot volcano plots and heatmaps; and take the intersection as differentially expressed genes.
[0038] Functional enrichment analysis:
[0039] GO and KEGG enrichment analyses of differentially expressed genes were performed using the Xiantao Academic (xian-taozi) online bioinformatics analysis tool.
[0040] Hub gene selection:
[0041] STRING was used for PPI network analysis of differentially expressed genes, and the CytoHubba plugin was used to screen hub genes; R2 genomic analysis and visualization platform regression analysis were used; and pROC package was used for ROC analysis.
[0042] Information on markers:
[0043] A total of six feasible biomarkers for colorectal cancer metastasis were obtained. The three cases involved in this application are as follows:
[0044] Table 1. Biomarkers for colorectal cancer metastasis obtained through screening.
[0045]
[0046] ROC curve as follows Figure 3 As shown, where:
[0047] IFI44: AUC=0.823, 95% CI: 0.731-0.907;
[0048] CXCL8: AUC=0.881, 95% CI: 0.804-0.944;
[0049] MBL2: AUC=0.791, 95% CI: 0.699-0.873.
[0050] Example 2: Clinical efficacy verification
[0051] The effectiveness of the biomarker was validated using two sets of validation samples from hospitals in two different locations.
[0052] Validation Sample 1:
[0053] A sample of 52 colorectal cancer patients (diagnosed as T3-T4 stage by colorectal surgery) from Ningxia Medical University General Hospital was analyzed. Among them, 22 patients did not have metastases, 16 had liver metastases, 8 had lung metastases, 3 had bone metastases, and 3 had multiple metastases.
[0054] Validation Sample 2:
[0055] A sample of 43 colorectal cancer patients (diagnosed by relevant departments as T3-T4 stage or more severe T2 stage) from a cooperating tertiary hospital in Guangdong Province was analyzed. During their hospitalization, 20 patients did not show metastasis, 18 had liver metastasis, 4 had lung metastasis, and 1 had bone metastasis.
[0056] Total RNA was extracted from colorectal cancer tissue samples and reverse transcribed, followed by qRT-PCR. GAPDH gene was used as an internal control, and non-metastatic patients were used as the 1.0 standard. The relative expression levels of MBL2, IFI44, and CXCL8 were calculated. The primers used are as follows:
[0057] GAPDH:
[0058] GCACCGTCAAGGCTGAGAAC(SEQ ID NO.1);
[0059] TGGTGAAGACGCCAGTGGA(SEQ ID NO.2);
[0060] MBL2: GATAGTAGCCTGGCTGCCTCAG (SEQ ID NO.3);
[0061] TGTTGGGTTCACCCTCGTTC(SEQ ID NO.4);
[0062] IFI44:ACTTCTTAGAGGATTTGCCTTTTG(SEQ ID NO.5);
[0063] GAAATTATCAACTGTGCACAAGGAAA(SEQ ID NO.6);
[0064] CXCL8:ACTGAGAGTGATTGAGAGTGGAC(SEQ ID NO.7);
[0065] AACCCTCTGCACCCAGTTTTC (SEQ ID NO. 8).
[0066] Expression situation as follows Figure 4-6 The results showed that MBL2 expression levels were 40%-50% lower in metastatic patients compared to non-metastatic patients, especially in liver metastases where levels were more than 60% lower. IFI44 expression levels were 40-60% lower in various metastatic patients compared to non-metastatic patients. CXCL8 expression levels were 2.5-3 times higher in metastatic patients than in non-metastatic patients, particularly in lung metastases where levels were nearly 5 times higher.
[0067] After merging the two sets of data, the AUC values for the three groups were calculated to be IFI44: 0.831, CXCL8: 0.949, and MBL2: 0.833. Figure 7 Based on the expression data above, MBL2 should be more effective in diagnosing liver metastases or CXCL8 in diagnosing lung metastases.
[0068] The data above indicate that using three biomarkers alone or in combination, with appropriate thresholds selected for diagnosis, can achieve good sensitivity and specificity.
Claims
1. A marker for colorectal cancer metastasis, characterized in that, The marker is one or more of IFI44, CXCL8, and MBL2.
2. Application of reagents for detecting the expression levels of colorectal cancer metastasis markers in the preparation of kits for diagnosing colorectal cancer metastasis. The colorectal cancer metastasis markers are one or more of IFI44, CXCL8, and MBL2.
3. The application according to claim 2, wherein the markers for detecting colorectal cancer metastasis are IFI44, CXCL8 and MBL2.
4. The application according to claim 2 or 3, wherein the kit is a quantitative PCR kit.
5. In the application according to claim 4, the reagent for detecting the expression level of colorectal cancer metastasis markers is a PCR primer.
6. In the application according to claim 5, the reagent for detecting the expression level of colorectal cancer metastasis markers is the following PCR primers: MBL2: Upstream primer: GATAGTAGCCTGGCTGCCTCAG; Downstream primer: TTGTTGGGTTCACCCTCGTTC; IFI44: Upstream primer: ACTTCTTAGAGGATTTGCCTTTTG; Downstream primer: GAAATTATCAACTGTGCACAAGGAAA; CXCL8: Upstream primer: ACTGAGAGTGATTGAGAGTGGAC; Downstream primer: AACCCTCTGCACCCAGTTTTC.
7. The application according to claim 6, wherein the kit further comprises primers for detecting the expression level of an internal reference gene.
8. The application according to claim 7, wherein the internal reference gene is GAPDH.
9. In the application according to claim 2, the diagnosis of colorectal cancer metastasis is the diagnosis of metastasis in T3 or T4 stage colorectal cancer.
10. The application according to claim 2, wherein the diagnosis of colorectal cancer metastasis is the diagnosis of liver or lung metastasis of colorectal cancer.