Aluminum adjuvant nanoparticles, methods of manufacture, and uses thereof
Aluminum adjuvant nanoparticles, sized between 80-90 nm, enhance immune activation by accumulating in lymph nodes, addressing the limitations of larger adjuvants and improving vaccine efficacy with reduced discomfort and sterilization ease.
Patent Information
- Application Number
- PCT/IB2025/054892
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-14
- Filing Date
- 2025-05-09
- Publication Date
- 2025-11-20
AI Technical Summary
Current aluminum adjuvants used in vaccines are limited in potency due to their large size, which results in localized retention in muscle tissue and reduced immune activation in lymph nodes.
Development of aluminum adjuvant nanoparticles, specifically sized between 80-90 nm with a polydispersity index of less than 0.2, incorporating CpG oligodeoxynucleotide, and optionally polyacrylic acid, to enhance immune activation by accumulating in lymph nodes.
The nanosized adjuvants facilitate stronger immune activation and antigen delivery to lymph nodes, reducing administration discomfort and enabling thinner needle use, while allowing filter sterilization.
Smart Images

Figure IMGF000061_0001 
Figure IMGF000062_0001 
Figure IMGF000062_0002
Abstract
Description
[0001] ALUMINUM ADJUVANT NANOPARTICLES, METHODS OF MANUFACTURE, AND USES THEREOF
[0002] BACKGROUND
[0003] The present disclosure relates to nanosized aluminum (nAI) adjuvant compounds. The disclosure also relates to the preparation of the compounds, compositions containing the compounds, and uses of the compounds, including as adjuvants for antigens of interest within a vaccine.
[0004] Studies and research regarding adjuvant use as a vaccine component has significantly increased nowadays. Adjuvants are compounds that enhance immune system activation and recognition of a vaccine's active component, especially concerning subunit-based vaccines.
[0005] Adjuvants act by enhancing the innate immune system's response magnitude, breadth, and durability. The potency of adjuvants is closely related to their ability to be recognized as pathogens / foreign bodies through pattern recognition receptors (PRRs). It is expected that a vaccine's active component will become recognized, thereby triggering a specific and long- lasting immune response to be mounted through the adaptive immune system (Excler et al., Nat. Med., 27 (2021), pp. 591-600).
[0006] Aluminum-containing adjuvants have been used for over 90 years to enhance the immune response to vaccines (HogenEsch H, et al., NPJ Vaccines. 2018 Oct 10;3:51). The currently used aluminum-adsorbed adjuvants have a size in the micrometer range. However, these large aluminum particles can have limited potency. After intramuscular administration, large aluminum particles anchor small immunopotentiator molecules and these adjuvant complexes are localized and retained in the muscle.
[0007] Accordingly, there remains a need for improved adjuvants targeted to accumulate in the lymph node in order to activate the immune cells in the lymph node.
[0008] SUMMARY
[0009] The present disclosure relates to adjuvant nanoparticles that result in improved immunogenicity, compositions comprising the adjuvant nanoparticles, and uses thereof. For example, in one aspect the present disclosure provides aluminum adjuvant nanoparticles. In another aspect, the present disclosure provides nucleotide adjuvant nanoparticles, for example comprising a CpG oligodeoxynucleotide. In some embodiments, the CpG oligodeoxynucleotide is CpG 24555. In still another aspect, the adjuvant nanoparticles comprise aluminum and CpG 24555 within a complex. In some embodiments, the nanoparticles have an average size less than about 100 nm.
[0010] In an exemplary embodiment, the nanoparticles have an average size between about 80 nm and about 90 nm.
[0011] In some embodiments, the nanoparticles have a polydispersity index (PDI) of less than about 0.2.
[0012] In some embodiments, the nanoparticles further comprise an anionic compound. In particular embodiments, the nanoparticles further comprise polyacrylic acid (PAA).
[0013] In some embodiments, the composition comprising the nanoparticles is obtained by combining a nucleotide and aluminum hydroxide, wherein the ratio of nucleotide to aluminum hydroxide by mass (pg) is between about 2:1 and about 3:1. In a particular embodiment, the composition comprising the nanoparticles is obtained by combining a nucleotide and aluminum hydroxide, wherein the ratio of nucleotide to aluminum hydroxide by mass (pg) is about 2.4:1.
[0014] In some embodiments, the composition comprising the nanoparticles is obtained by combining a nucleotide, aluminum hydroxide, and polyacrylic acid (PAA), wherein the ratio of nucleotide to aluminum hydroxide by mass (pg) is between about 1 :1 and about 1:2. In a particular embodiment, the composition comprising the nanoparticles is obtained by combining a nucleotide, aluminum hydroxide, and polyacrylic acid (PAA), wherein the ratio of nucleotide to aluminum hydroxide by mass (pg) is about 1:1.5.
[0015] In some embodiments, the nucleotide adjuvant nanoparticles comprise or consist of the sequence of SEQ ID NO: 2 or SEQ ID NO: 9.
[0016] The present disclosure further provides a method for sizing adjuvant nanoparticles using a microfluidic device, wherein the nanoparticles are sized to less than about 100 nanometers (nm). In an exemplary embodiment, the nanoparticles are sized to between about 80 nm and about 90 nm.
[0017] DETAILED DESCRIPTION
[0018] The present disclosure relates to an adjuvant comprising aluminum nanoparticles and / or CpG oligodeoxynucleotide nanoparticles that result in improved immunogenicity, compositions comprising the nanoparticles, methods for producing the compositions, and methods of using said compositions.
[0019] Without limiting the present disclosure to a particular mechanism or theory, the compositions described herein may have advantages including the ability of nanosized adjuvants to passively drain and accumulate in the lymph nodes in order to activate the immune cells therein. Accordingly, the nanosized adjuvants described herein may provide a stronger effect to adjuvant a vaccine antigen than the previously used micrometer sized adjuvants. Moreover, aluminum nanoparticles have a larger relative surface area for binding interactions as compared to aluminum microparticles. Therefore, the co-delivery of antigens absorbed on the surface of the nanoparticles into the lymph nodes may be facilitated. Accordingly, aluminum nanoparticle adjuvants may result in an altered biodistribution of both the adjuvant and the antigen that may facilitate stronger immune activation as compared to aluminum microparticle adjuvants. Likewise, nanoparticles comprising aluminum and a second adjuvant can result in aluminum nanoparticles acting as a delivery system to localize the second adjuvant to the lymph nodes.
[0020] Without limiting the present disclosure to a particular mechanism or theory, the compositions described herein may have additional advantages including enhanced resuspension in a syringe due to the smaller size of the aluminum nanoparticles in contrast to aluminum microparticles that are conventionally used. Likewise, another advantage of nanosized adjuvants could be the ability to deliver the adjuvants to a patient via intradermal, intramuscular, or subcutaneous administration using a thinner needle (e.g., 30 gauge) than is required to administer a composition containing adjuvant microparticles (e.g., a 22-25 gauge needle). Thus, the use of the nanosized adjuvants disclosed herein could facilitate vaccine administration with less pain and discomfort for patients. Furthermore, aluminum nanoparticles can be filter sterilized in contrast to aluminum microparticles that need to be prepared by an upstream aseptic process such as autoclaving.
[0021] Recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it was individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as"), provided herein is intended merely to further illustrate the disclosure and does not pose a limitation on the scope of the claims. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the disclosure.
[0022] Several documents are cited throughout the text of this disclosure. Each of the documents cited herein (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, etc.), whether supra or infra, are hereby incorporated by reference in their entirety.
[0023] Definitions
[0024] Unless otherwise defined herein, scientific and technical terms used in connection with the present disclosure have the meanings that are commonly understood by those of ordinary skill in the art. Throughout this application, the term “about” is used according to its plain and ordinary meaning in the area of cell and molecular biology to indicate a deviation of ±10% of the value(s) to which it is attached.
[0025] Recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it was individually recited herein.
[0026] The use of the word “a” or “an” when used in conjunction with the term “comprising” may mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one.”
[0027] The phrase “and / or” means “and” or “or.” To illustrate, A, B, and / or C includes: A alone, B alone, C alone, a combination of A and B, a combination of A and C, a combination of B and C, or a combination of A, B, and C. In other words, “and / or” operates as an inclusive or.
[0028] The phrase “essentially all” is defined as “at least 95%”; if essentially all members of a group have a certain property, then at least 95% of members of the group have that property. In some aspects, essentially all means equal to any one of, at least any one of, or between any two of 95, 96, 97, 98, 99, or 100% of members of the group have that property.
[0029] The compositions and methods for their use may “comprise,” “consist essentially of,” or “consist of” any of the ingredients or steps disclosed throughout the specification. Throughout this specification, unless the context requires otherwise, the words “comprising” (and any form of comprising, such as “comprise” and “comprises”), “having” (and any form of having, such as “have” and “has”), “including” (and any form of including, such as “includes” and “include”) or “containing” (and any form of containing, such as “contains” and “contain”) are inclusive or open- ended and will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements. It is contemplated that aspects described herein in the context of the term “comprising” may also be implemented in the context of the term “consisting of” or “consisting essentially of.” Compositions and methods “consisting essentially of’ any of the ingredients or steps disclosed limits the scope of the claim to the specified materials or steps which do not materially affect the basic and novel characteristic of the claimed disclosure. The words “consisting of” (and any form of consisting of, such as “consist of’ and “consists of”) means including, and limited to, whatever follows the phrase “consisting of.” Thus, the phrase “consisting of” indicates that the listed elements are required or mandatory, and that no other elements may be present.
[0030] Reference throughout this specification to “one aspect,” “an aspect,” “a particular aspect,” “a related aspect,” “a certain aspect,” “an additional aspect,” or “a further aspect” or combinations thereof means that a particular feature, structure or characteristic described in connection with the aspect is included in at least one aspect of the present disclosure. Thus, the appearances of the foregoing phrases in various places throughout this specification are not necessarily all referring to the same aspect. Furthermore, the particular features, structures, or characteristics may be combined in any suitable manner in one or more aspects.
[0031] The terms “inhibiting,” “decreasing,” or “reducing” or any variation of these terms includes any measurable decrease (e.g., a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% decrease) or complete inhibition to achieve a desired result. The terms “improve,” “promote,” or “increase” or any variation of these terms includes any measurable increase (e.g., a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% increase) to achieve a desired result or production of a protein or molecule.
[0032] As used herein, the terms “reference,” “standard,” or “control” describe a value relative to which a comparison is performed. For example, an agent, subject, population, sample, or value of interest is compared with a reference, standard, or control agent, subject, population, sample, or value of interest. A reference, standard, or control may be tested and / or determined substantially simultaneously and / or with the testing or determination of interest for an agent, subject, population, sample, or value of interest and / or may be determined or characterized under comparable conditions or circumstances to the agent, subject, population, sample, or value of interest under assessment.
[0033] The term “isolated” may refer to a nucleic acid or polypeptide that is substantially free of cellular material, bacterial material, viral material, or culture medium (when produced by recombinant DNA techniques) of their source of origin, or chemical precursors or other chemicals (when chemically synthesized). Moreover, an isolated compound refers to one that may be administered to a subject as an isolated compound; in other words, the compound may not simply be considered “isolated” if it is adhered to a column or embedded in an agarose gel. Moreover, an “isolated nucleic acid fragment” or “isolated peptide” is a nucleic acid or protein fragment that is not naturally occurring as a fragment and / or is not typically in the functional state and / or that is altered or removed from the natural state through human intervention. For example, a DNA naturally present in a living animal is not “isolated,” but a synthetic DNA, or a DNA partially or completely separated from the coexisting materials of its natural state is “isolated.” An isolated nucleic acid may exist in substantially purified form, or may exist in a non-native environment such as, for example, a cell into which the nucleic acid has been delivered.
[0034] The term “nucleotide” as used herein refers to a molecule comprising a sugar (e.g., ribose or deoxyribose) linked to a base (e.g., a pyrimidine or a purine). The term “oligonucleotide” as used herein refers to multiple (e.g., more than one) nucleotides linked together by an internucleotide linkage. It may be used interchangeably with the term “polynucleotide.” An oligonucleotide is a polymer comprising or consisting of nucleotide monomers, which are covalently linked to each other by bonds (e.g., phosphodiester or phosphorothioate) of a sugar / phosphate-backbone. Oligonucleotides may encompass modified nucleic acid molecules, such as base-modified, sugar-modified or backbone-modified etc. DNA or RNA molecules. Oligonucleotides may be single-stranded or double-stranded and may comprise RNA and / or DNA nucleotides and artificial variants thereof (e.g., peptide nucleic acids). Oligonucleotides may be recombinant, isolated from total genomic nucleic acid, or synthetically synthesized. Oligonucleotides may be single-stranded (coding or antisense) or double-stranded, and may be RNA, DNA (genomic, cDNA, or synthetic), analogs thereof, or a combination thereof. Additional coding or non-coding sequences may, but need not, be present within an oligonucleotide.
[0035] In certain aspects, there are oligonucleotide variants having substantial identity to the sequences disclosed herein; those comprising equal to any one of, at least any one of, at most any one of, or between any two of 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or higher sequence identity, compared to a oligonucleotide sequence provided herein using the methods described herein (e.g., BLAST analysis using standard parameters).
[0036] In general, the term “engineered” refers to the aspect of having been manipulated by the hand of man. For example, an oligonucleotide is considered to be “engineered” when two or more sequences that are not linked together in that order in nature are manipulated by the hand of man to be directly linked to one another in the engineered oligonucleotide and / or when a particular residue in an oligonucleotide is non-naturally occurring and / or is caused through action of the hand of man to be linked with an entity or moiety with which it is not linked in nature.
[0037] The term “DNA,” as used herein, means a nucleic acid molecule comprising nucleotides such as deoxy-adenosine-monophosphate, deoxy-thymidine-monophosphate, deoxy- guanosine-monophosphate and deoxy-cytidine-monophosphate monomers which are composed of a sugar moiety (deoxyribose), a base moiety and a phosphate moiety, and polymerize by a characteristic backbone structure. The backbone structure is, typically, formed by phosphodiester bonds between the sugar moiety of the nucleotide, e.g., deoxyribose, of a first and a phosphate moiety of a second, adjacent monomer. The specific order of the monomers, e.g., the order of the bases linked to the sugar / phosphate-backbone, is called the DNA sequence. DNA may be single stranded or double stranded. In the double stranded form, the nucleotides of the first strand typically hybridize with the nucleotides of the second strand, e.g. by A / T-base-pairing and G / C- base-pairing. DNA may contain all, or a majority of, deoxyribonucleotide residues. As used herein, the term “deoxyribonucleotide” means a nucleotide lacking a hydroxyl group at the 2' position of a p-D-ribofuranosyl group. Without any limitation, DNA may encompass double stranded DNA, antisense DNA, single stranded DNA, isolated DNA, synthetic DNA, DNA that is recombinantly produced, and modified DNA. DNA may comprise coding or non-coding sequences, or both.
[0038] The term “RNA,” as used herein, means a nucleic acid molecule comprising nucleotides such as adenosine-monophosphate, uridine-monophosphate, guanosine-monophosphate and cytidine-monophosphate monomers which are connected to each other along a so-called backbone. The backbone is typically formed by phosphodiester bonds between the sugar, e.g., ribose, of a first and a phosphate moiety of a second, adjacent monomer. RNA may encompass antisense RNA, single-stranded RNA, double-stranded RNA, isolated RNA, synthetic RNA, RNA that is recombinantly produced, and modified RNA. RNA may comprise coding or non-coding sequences, or both.
[0039] “Prevent” or “prevention,” as used herein when used in connection with the occurrence of a disease, disorder, and / or condition, refers to reducing the risk of developing the disease, disorder and / or condition and / or to delaying onset of one or more characteristics or symptoms of the disease, disorder or condition. Prevention may be considered complete when onset of a disease, disorder, or condition has been delayed for a predefined period of time.
[0040] The terms “protein,” “polypeptide,” or “peptide” are used herein as synonyms and refer to a polymer of amino acid monomers, e.g., a molecule comprising at least two amino acid residues. Polypeptides may include gene products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments and other equivalents, variants, and analogs of the foregoing. Polypeptides may be a single molecule or may be a multi-molecular complex such as a dimer, trimer or tetramer. A protein comprises one or more peptides or polypeptides, and may be folded into a 3-dimensional form, which may be required for the protein to exert its biological function.
[0041] As used herein in the context of molecules, e.g., nucleic acids, proteins, or small molecules, the term “variant” refers to a molecule that shows significant structural identity with a reference molecule but differs structurally from the reference molecule, e.g., in the presence or absence or in the level of one or more chemical moieties as compared to the reference entity. In some aspects, a variant also differs functionally from its reference molecule. In general, whether a particular molecule is properly considered to be a “variant” of a reference molecule is based on its degree of structural identity with the reference molecule. As will be appreciated by those skilled in the art, any biological or chemical reference molecule has certain characteristic structural elements. A variant, by definition, is a distinct molecule that shares one or more such characteristic structural elements but differs in at least one aspect from the reference molecule. In some aspects, a variant polypeptide or nucleic acid may differ from a reference polypeptide or nucleic acid as a result of one or more differences in amino acid or nucleotide sequence and / or one or more differences in chemical moieties (e.g., carbohydrates, lipids, phosphate groups) that are covalently components of the polypeptide or nucleic acid (e.g., that are attached to the polypeptide or nucleic acid backbone). In some aspects, a variant polypeptide or nucleic acid shows an overall sequence identity with a reference polypeptide or nucleic acid that is at least, at most, exactly, or between any two of 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99%. In some aspects, a variant polypeptide or nucleic acid does not share at least one characteristic sequence element with a reference polypeptide or nucleic acid. In some aspects, a reference polypeptide or nucleic acid has one or more biological activities. In some aspects, a variant polypeptide or nucleic acid shares one or more of the biological activities of the reference polypeptide or nucleic acid. In some aspects, a variant polypeptide or nucleic acid lacks one or more of the biological activities of the reference polypeptide or nucleic acid. In some aspects, a variant polypeptide or nucleic acid shows a reduced level of one or more biological activities as compared to the reference polypeptide or nucleic acid. In some aspects, a polypeptide or nucleic acid of interest is considered to be a “variant” of a reference polypeptide or nucleic acid if it has an amino acid or nucleotide sequence that is identical to that of the reference but for a small number of sequence alterations at particular positions. For example, the variant polypeptide or nucleic acid sequence has at least one modification compared to the reference polypeptide or nucleic acid sequence, e.g., from 1 to about 10 modifications. In one aspect, the variant polypeptide or nucleic acid sequence has from 1 to about 5 modifications compared to the reference polypeptide or nucleic acid sequence. In one aspect, the variant polypeptide or nucleic acid sequence has from 1 to about 4 modifications compared to the reference polypeptide or nucleic acid sequence. Typically, fewer than about 20%, about 15%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, or about 2% of the residues in a variant are substituted, inserted, or deleted, as compared to the reference. Often, a variant polypeptide or nucleic acid comprises a very small number (e.g., fewer than about 5, about 4, about 3, about 2, or about 1) number of substituted, inserted, or deleted, functional residues (e.g., residues that participate in a particular biological activity) relative to the reference. In some aspects, a variant polypeptide or nucleic acid comprises not more than about 5, about 4, about 3, about 2, or about 1 addition or deletion, and, in some aspects, comprises no additions or deletions, as compared to the reference.
[0042] “Sequence similarity” indicates the percentage of amino acids that either are identical or that represent conservative amino acid substitutions. “Sequence identity” between two amino acid sequences indicates the percentage of amino acids that are identical between the sequences. “Sequence identity” between two nucleic acid sequences indicates the percentage of nucleotides that are identical between the sequences.
[0043] The terms “% identical,” “% identity,” or similar terms are intended to refer, in particular, to the percentage of nucleotides or amino acids which are identical in an optimal alignment between the sequences to be compared. Said percentage is purely statistical, and the differences between the two sequences may be but are not necessarily randomly distributed over the entire length of the sequences to be compared. Comparisons of two sequences are usually carried out by comparing the sequences, after optimal alignment, with respect to a segment or “window of comparison,” in order to identify local regions of corresponding sequences. The optimal alignment for a comparison may be carried out manually or with the aid of the local homology algorithm by Smith and Waterman, 1981 , Ads App. Math. 2, 482, with the aid of the local homology algorithm by Neddleman and Wunsch, 1970, J. Mol. Biol. 48, 443, with the aid of the similarity search algorithm by Pearson and Lipman, 1988, Proc. Natl Acad. Sci. USA 88, 2444, or with the aid of computer programs using said algorithms (GAP, BESTFIT, FASTA, BLAST P, BLAST N, and TFASTA in Wisconsin Genetics Software Package, Genetics Computer Group). In some aspects, percent identity of two sequences is determined using the BLASTN or BLASTP algorithm, as available on the United States National Center for Biotechnology Information (NCBI) website.
[0044] Percentage identity is obtained by determining the number of identical positions at which the sequences to be compared correspond, dividing this number by the number of positions compared (e.g., the number of positions in the reference sequence) and multiplying this result by 100.
[0045] A variant of a nucleic acid sequence may be a “functional variant.” The term “functional variant” of a nucleic acid sequence relates to any variant exhibiting one or more functional properties identical or similar to those of the nucleic acid sequence from which it is derived, e.g., it is functionally equivalent. The term “functional variant,” as used herein, in particular refers to a variant molecule or sequence that comprises a nucleic acid sequence that is altered by one or more nucleotides compared to the nucleic acid sequence of the parent molecule or sequence and that is still capable of fulfilling one or more of the functions of the parent molecule or sequence, e.g., adjuvanting an immune response. In one aspect, the modifications in the nucleic acid sequence of the parent molecule or sequence do not significantly affect or alter the characteristics of the molecule or sequence.
[0046] As used herein, the terms “nanosized” or “nanoscale” refer to a particle (or a population of particles) that have a diameter size of less than about 1000 nm. In the case of a population of particles, the z-average particle diameter size, as measured by dynamic light scattering (DLS), is less than about 1000 nm.
[0047] As used herein, the term “vaccination” refers to the administration of an immunogenic composition intended to generate an immune response, for example to a disease-associated (e.g., disease-causing) agent (e.g., a bacteria). In some aspects, vaccination may be administered before, during, and / or after exposure to a disease-associated agent, and in certain aspects, before, during, and / or shortly after exposure to the agent. In some aspects, vaccination includes multiple administrations, appropriately spaced in time, of a vaccine composition. In some aspects, vaccination generates an immune response to an infectious agent. In some aspects, vaccination generates an immune response to a tumor.
[0048] An immune response refers to a humoral response, a cellular response, or both a humoral and cellular response in an organism. An immune response may be measured by assays that include, but are not limited to, assays measuring the presence or amount of antibodies that specifically recognize a protein or cell surface protein, assays measuring T-cell activation or proliferation, and / or assays that measure modulation in terms of activity or expression of one or more cytokines.
[0049] The term “immunogen” as used herein refers to a molecule capable of eliciting an immune response in a subject. Examples of immunogens include polypeptides, peptides, lipids, polysaccharides, and nucleic acids.
[0050] The term “antigen” as used herein refers to a molecule that can be recognized by an antibody. Examples of antigens include polypeptides, peptides, lipids, polysaccharides, and nucleic acids containing antigenic determinants, such as those recognized by an immune cell.
[0051] Those skilled in the art will appreciate that the term “dosing regimen” may be used to refer to a set of unit doses (typically more than one) that are administered individually to a subject, typically separated by periods of time. In some aspects, a given therapeutic agent has a recommended dosing regimen, which may involve one or more doses. In some aspects, a dosing regimen comprises a plurality of doses each of which is separated in time from other doses. In some aspects, individual doses are separated from one another by a time period of the same length; in some aspects, a dosing regimen comprises a plurality of doses and at least two different time periods separating individual doses. In some aspects, all doses within a dosing regimen are of the same unit dose amount. In some aspects, different doses within a dosing regimen are of different amounts. In some aspects, a dosing regimen comprises a first dose in a first dose amount, followed by one or more additional doses in a second dose amount different from the first dose amount. In some aspects, a dosing regimen comprises a first dose in a first dose amount, followed by one or more additional doses in a second dose amount same as the first dose amount. In some aspects, a dosing regimen is correlated with a desired or beneficial outcome when administered across a relevant population (e.g., is a therapeutic dosing regimen).
[0052] Adjuvants
[0053] The present disclosure further provides for immunogenic compositions comprising an adjuvant. An adjuvant is a substance that enhances the immune response when administered together with an immunogen or antigen. Adjuvants may act primarily as a delivery system, primarily as an immune modulator or have strong features of both. Suitable adjuvants include those suitable for use in mammals, including humans. For example, adjuvants augment the intrinsic immune response to an immunogen without causing conformational changes in the immunogen that may affect the qualitative form of the immune response. Suitable adjuvants include an aluminum hydroxide gel such as ALHYDROGEL™ (Brenntag Biosector, Denmark), aluminum salts (such as aluminum hydroxide, aluminum phosphate, aluminum sulfate), and an immunostimulatory oligonucleotide such as a CpG oligonucleotide (see, e.g., WO 1998 / 040100, WO2010 / 067262 and further described herein). Other adjuvants include RC-529, GM-CSF and Complete Freund's Adjuvant (CFA) and Incomplete Freund's Adjuvant (IFA). Yet another class of adjuvants is glycolipid analogues including N-glycosylamides, N-glycosylureas and N-glycosylcarbamates, each of which is substituted in the sugar residue by an amino acid.
[0054] An effective amount of an adjuvant, such as those described herein, refers to the amount necessary or sufficient to realize a desired biologic effect. For example, an effective amount of a adjuvant administered with an antigen for inducing an antigen-specific immune response is that amount necessary to induce an immune response in response to an antigen upon exposure to the antigen. Combined with the teachings provided herein, by choosing among the various adjuvants and weighing factors such as potency, relative bioavailability, subject body weight, severity of adverse side-effects and preferred mode of administration, an effective prophylactic or therapeutic treatment regimen can be planned which does not cause substantial toxicity and yet is effective to treat the particular subject. The effective amount for any particular application can vary depending on such factors as the disease or condition being treated, the particular adjuvant being administered, the size of the subject, or the severity of the disease or condition.
[0055] Nucleotide Adjuvants
[0056] In some aspects, the immunogenic compositions described herein comprise nanoscale nucleotide adjuvants. In some embodiments, the nucleotide adjuvants described herein comprise nanoscale RNA. In some embodiments, the nucleotide adjuvants described herein comprise nanoscale DNA. In some embodiments, the nanoscale nucleotide adjuvants described herein are single-stranded. In some embodiments, the nanoscale nucleotide adjuvants described herein are double-stranded.
[0057] In one aspect, the nanoscale nucleotide adjuvant is a CpG oligonucleotide. A CpG oligonucleotide is a short nucleic acid molecule containing a cytosine followed by a guanine linked by a phosphate bond in which the pyrimidine ring of the cytosine is unmethylated. A CpG motif is a pattern of bases that include an unmethylated central CpG surrounded by at least one base flanking (on the 3' and the 5' side of) the central CpG. The nucleotide length of a CpG motif in a sequence comprising more than one CpG dinucleotide is the total number of nucleotides starting with, and including, the most 5’ C in a CpG dinucleotide and ending with, and including, the most 3’ G in a CpG dinucleotide. CpG oligonucleotides include both D and K oligonucleotides. The entire CpG oligonucleotide may be unmethylated or portions may be unmethylated. Examples of CpG oligonucleotides useful in the methods provided by the present disclosure include those disclosed in U.S. Patent Nos. 6194388, 6207646, 6214806, 628371 , 6239116, and 6339068.
[0058] In one embodiment, the nanoscale oligonucleotide comprises oligodeoxynucleotides (ODN). As used herein, “CpG ODN” refers to cytosine-phosphoguanosine (CpG) motif- containing oligodeoxynucleotide. In some embodiments, the CpG ODN is a toll-like receptor 9 (TLR9) agonist.
[0059] CpG oligonucleotides may encompass various chemical modifications and substitutions, in comparison to natural RNA and DNA, involving a phosphodiester internucleoside bridge, a beta -D-ribose (deoxyhbose) unit and / or a natural nucleoside base (adenine, guanine, cytosine, thymine, uracil). Examples of chemical modifications are known to the skilled person and are described, for example in Uhlmann E. et al. (1990), Chem. Rev. 90:543; "Protocols for Oligonucleotides and Analogs", Synthesis and Properties and Synthesis and Analytical Techniques, S. Agrawal, Ed., Humana Press, Totowa, USA 1993; Crooke, ST. et al. (1996) Annu. Rev. Pharmacol. Toxicol. 36:107-129; and Hunziker J. et al., (1995), Mod. Synth. Methods 7:331 -417. Specifically, a CpG oligonucleotide can contain a modified cytosine. A modified cytosine is a naturally occurring or non-naturally occurring pyrimidine base analog of cytosine which can replace this base without impairing the immunostimulatory activity of the oligonucleotide. Modified cytosines include but are not limited to 5-substituted cytosines (e.g. 5-methyl-cytosine, 5- fluorocytosine, 5-chloro-cytosine, 5-bromo-cytosine, 5-iodo- cytosine, 5-hydroxy-cytosine, 5- hydroxymethyl-cytosine, 5-difluoromethyl-cytosine, and unsubstituted or substituted 5- alkynyl- cytosine), 6-substituted cytosines, N4-substituted cytosines (e.g. N4-ethyl- cytosine), 5-aza- cytosine, 2-mercapto-cytosine, isocytosine, pseudo-isocytosine, cytosine analogs with condensed ring systems (e.g. N,N'-propylene cytosine or phenoxazine), and uracil and its derivatives (e.g. 5-fluoro-uracil, 5-bromo- uracil, 5- bromovinyl-uracil, 4-th io- uracil, 5-hydroxy- uracil, 5-propynyl-uracil). For example, cytosines can include 5-methyl-cytosine, 5-fluoro- cytosine, 5-hydroxy-cytosine, 5- hydroxymethyl-cytosine, and N4-ethyl-cytosine.
[0060] A CpG oligonucleotide can also contain a modified guanine. A modified guanine is a naturally occurring or non-naturally occurring purine base analog of guanine which can replace this base without impairing the immunostimulatory activity of the oligonucleotide. Modified guanines include but are not limited to 7-deeazaguanine, 7-deaza-7-substituted guanine, hypoxanthine, N2-substituted guanines (e.g. N2-methyl-guanine), 5-amino-3-methyl-3H,6H- thiazolo[4,5-d]pyhmidine-2, 7-dione, 2,6-diaminopuhne, 2-aminopuhne, purine, indole, adenine, substituted adenines (e.g. N6-methyl-adenine, 8-oxo-adenine), 8-substituted guanine (e.g. 8- hydroxyguanine and 8-bromoguanine), and 6-thioguanine. In some aspects of the disclosure, the guanine base is substituted by a universal base (e.g. 4-methyl-indole, 5-nitro-indole, and K-base), an aromatic ring system (e.g. benzimidazole or dichloro-benzimidazole, 1 -methyl-1 H- [1 ,2,4]triazole-3-carboxylic acid amide) or a hydrogen atom.
[0061] In certain aspects, the CpG oligonucleotides include modified backbones. It has been demonstrated that modification of the nucleic acid backbone provides enhanced activity of nucleic acids when administered in vivo. Secondary structures, such as stem loops, can stabilize nucleic acids against degradation. Alternatively, nucleic acid stabilization can be accomplished via phosphate backbone modifications. In some embodiments, a stabilized nucleic acid has at least a partial phosphorothioate modified backbone. Phosphorothioates may be synthesized using automated techniques employing either phosphoramidate or H-phosphonate chemistries. Aryl- and alkyl-phosphonates can be made, e.g. as described in U.S. Patent No. 4,469,863; and alkylphosphotriesters (in which the charged oxygen moiety is alkylated as described in U.S. Pat. No. 5,023,243 and European Patent No. 092,574) can be prepared by automated solid phase synthesis using commercially available reagents. Methods for making other DNA backbone modifications and substitutions have been described (Uhlmann, E. and Peyman, A. (1990) Chem. Rev. 90:544; Goodchild, J. (1990) Bioconjugate Chem. 1 :165). 2'-0-methyl nucleic acids with CpG motifs also cause immune activation, as do ethoxy-modified CpG nucleic acids. In fact, no backbone modifications have been found that completely abolish the CpG effect, although it is greatly reduced by replacing the C with a 5-methyl C. Constructs having phosphorothioate linkages provide maximal activity and protect the nucleic acid from degradation by intracellular exo- and endo- nucleases.
[0062] In an embodiment, all the internucleotide linkage of the CpG oligonucleotides disclosed herein are phosphodiester bonds (“soft” oligonucleotides, as described in WO 2007 / 026190). In another embodiment, CpG oligonucleotides of the disclosure are rendered resistant to degradation (e.g., are stabilized) and comprise phosphorothioate linkages.
[0063] The immunostimulatory oligonucleotides may have a chimeric backbone, which have combinations of phosphodiester and phosphorothioate linkages. For purposes of the instant disclosure, a chimeric backbone refers to a partially stabilized backbone, wherein at least one internucleotide linkage is phosphodiester, and wherein at least one other internucleotide linkage is a stabilized internucleotide linkage. When the phosphodiester linkage is located within the CpG motif such molecules are called “semi-soft” as described in WO 2007 / 026190.
[0064] In one aspect of the disclosure, the oligonucleotide includes at least one phosphodiester internucleotide linkage. In one aspect of the disclosure, the oligonucleotide includes at least one phosphorothioate internucleotide linkage. In a further aspect of the disclosure, the oligonucleotide includes a combination of phosphodiester internucleotide linkages and phosphorothioate internucleotide linkages. In another aspect all internucleotide linkages of the oligonucleotide are phosphodiester linkages. In another aspect all internucleotide linkages of the oligonucleotide are phosphorothioate linkages.
[0065] Other modified oligonucleotides include phosphodiester modified oligonucleotides, combinations of phosphodiester and phosphorothioate oligonucleotides, methylphosphonate, methyl phosphorothioate, phosphorordithioate, p-ethoxy, and combinations thereof. Each of these combinations and their particular effects on immune cells is discussed in more detail with respect to CpG nucleic acids in PCT Publication Nos. WO 96 / 02555 and WO 98 / 18810 and in U.S. Pat. Nos. 6,194,388 and 6,239,116. Mixed backbone modified ODN may be synthesized as described in WO 2007 / 026190. In an aspect, the CpG oligonucleotides disclosed herein may comprise substitutions or modifications, such as in the bases and / or sugars as described in WO 2007 / 026190.
[0066] In some aspects of the disclosure, CpG-containing nucleic acids might be mixed with immunogenic carriers according to methods known to those skilled in the art (see, e.g., WO 03 / 024480).
[0067] The CpG oligonucleotides may have one or two accessible 5' ends. It is possible to create modified oligonucleotides having two such 5' ends, for instance, by attaching two oligonucleotides through a 3'-3' linkage to generate an oligonucleotide having one or two accessible 5' ends. The 3'-3'-linkage may be a phosphodiester, phosphorothioate or any other modified internucleoside bridge. Methods for accomplishing such linkages are known in the art. For instance, such linkages have been described in Seliger, H. et al., Nucleosides and Nucleotides (1991), 10(1-3), 469-77 and Jiang, et al., Bioorganic and Medicinal Chemistry (1999), 7(12), 2727-2735.
[0068] Additionally, 3'-3'-linked oligonucleotides where the linkage between the 3'- terminal nucleosides is not a phosphodiester, phosphorothioate or other modified bridge, can be prepared using an additional spacer, such as tri- or tetra-ethyleneglycol phosphate moiety (Durand, M. et al., Biochemistry (1992), 31 (38), 9197-204, US Pat. Nos. 5,658,738 and 5,668,265). Alternatively, the non-nucleotidic linker may be derived from ethanediol, propanediol, or from an abasic deoxyhbose (dSpacer) unit (Fontanel, Marie Laurence et al., Nucleic Acids Research (1994), 22(11), 2022-7) using standard phosphoramidite chemistry. The non-nucleotidic linkers can be incorporated once or multiple times, or combined with each other allowing for any desirable distance between the 3'-ends of the two oligonucleotides to be linked.
[0069] A phosphodiester internucleoside bridge located at the 3' and / or the 5' end of a nucleoside can be replaced by a modified internucleoside bridge, wherein the modified internucleoside bridge is for example selected from phosphorothioate, phosphorodithioate, NR1R2- phosphoramidate, boranophosphate, a- hydroxy benzyl phosphonate, phosphate-(Ci-C2i)-O-alkyl ester, phosphate-[(C6-C2l)aryl-(Ci-C2i)-O-alkyl]ester, (Ci-C8)alkylphosphonate and / or (Ce- Ci2)arylphosphonate bridges, (C7-C-i2)-a-hydroxymethyl-aryl (e.g. disclosed in PCT Publication No. WO 95 / 01363), wherein (Ce-Ci2)aryl, (Ce-C2o)aryl and (Ce-Ci4)aryl are optionally substituted by halogen, alkyl, alkoxy, nitro, cyano, and where R1 and R2are, independently of each other, hydrogen, (Ci-Cis)-alkyl, (Ce-C2o)-aryl, (Ce-Ci4)-aryl, (Ci-Cs)-alkyl, for example, hydrogen, (C1- Cs)-alkyl, for example (Ci-C4)-alkyl and / or methoxyethyl, or R1 and R2form, together with the nitrogen atom carrying them, a 5 to 6-membered heterocyclic ring which can additionally contain a further heteroatom selected from the group O, S and N.
[0070] The replacement of a phosphodiester bridge located at the 3' and / or the 5' end of a nucleoside by a dephospho bridge (dephospho bridges are described, for example, in Uhlmann E. and Peyman A. in "Methods in Molecular Biology", Vol. 20, "Protocols for Oligonucleotides and Analogs", S. Agrawal, Ed., Humana Press, Totowa 1993, Chapter 16, pp. 355 ff), wherein a dephospho bridge is for example selected from the dephospho bridges formacetal, 3'- thioformacetal, methylhydroxylamine, oxime, methylenedimethyl- hydrazo, dimethylenesulfone and / or silyl groups.
[0071] Different classes of CpG immunostimulatory oligonucleotides have been identified and are described in greater detail in WO 2010 / 125480. Compositions and methods of the present disclosure include the use of these different classes of CpG immunostimulatory oligonucleotides, in aspects of the disclosure, the immunostimulatory oligonucleotides include, but are not limited to, oligonucleotides that are A-Class, B-Class, C-Class, T-Class, P-Class or any Class with an E modification.
[0072] In an aspect of the present disclosure, the immunogenic compositions as disclosed herein comprise an A class CpG ODN. In some aspects, the A class CpG oligonucleotide of the present disclosure comprises the nucleic acid sequence: 5’ GGGGACGACGTCGTGGGGGGG 3’ (SEQ ID NO: 1).
[0073] In any of the A class CpG oligonucleotide sequences, all of the linkages may be all phosphorothioate bonds. In another aspect, one or more of the linkages may be phosphodiester, for example between the “C” and the “G” of the CpG motif making a semi-soft CpG oligonucleotide. In any of these sequences, an ethyl-uridine or a halogen may substitute for the 5' T ; examples of halogen substitutions include but are not limited to bromo-uridine or iodo-uridine substitutions.
[0074] In another aspect of the present disclosure, the immunogenic compositions as disclosed herein comprise a B class CpG ODN that activates B cells. In one aspect, the CpG oligonucleotide of the present disclosure is a B class CpG oligonucleotide represented by at least the formula: 5' X1X2CGX3X4 3’, wherein X1 , X2, X3, and X4 are nucleotides. In one embodiment, X2 is adenine, guanine, or thymine. In another embodiment, X3 is cytosine, adenine, or thymine. The B class CpG oligonucleotide sequences of the present disclosure may include those described in WO 96 / 02555, WO 98 / 18810 and U.S. Patent Nos. 6,194,388; 6,207,646; 6,214,806; 6,218,371 ; 6,239,116 and 6,339,068.
[0075] In some aspects, the B class CpG oligonucleotides of the present disclosure may include, but are not limited to, the following nucleic acid sequences:
[0076] 5’ TCGTCGTTTTTCGGTGCTTTT 3’ (SEQ ID NO: 2; CpG 24555),
[0077] 5’ TGACTGTGAACGTTCGAGATGA 3’ (SEQ ID NO: 3; CpG 1018);
[0078] 5’ TCGTCGTTTTGTCGTTTTGTCGTT 3’ (SEQ ID NO: 4; CpG 7909);
[0079] 5’ TCGTCGTTTTTCGGTCGTTTT 3' (SEQ ID NO: 5; CpG 10103);
[0080] 5:TCCATGACGTTCCTGACGTT 3’ (SEQ ID NO: 6; CpG 1826);
[0081] 5’ TCGTCGTTTCGTCGTTTTGTCGTT 3’ (SEQ ID NO: 7); and 5’ TCGTCGTTTTGTCGTTTTTTTCGA 3’ (SEQ ID NO: 8). In some embodiments, the CpG oligonucleotide described herein contains palindromic repeats. In some embodiments, the CpG oligonucleotide described herein contains palindromic repeats following the formula 5’-purine-purine-CG-pyrimidine-pyrimidine-3’.
[0082] In any of the B class CpG oligonucleotide sequences, all of the linkages may be all phosphorothioate bonds. In another aspect, in any of these sequences, one or more of the linkages may be phosphodiester, for example between the “C” and the “G” of the CpG motif making a semi-soft CpG oligonucleotide. In any of these sequences, an ethyl-uridine or a halogen may substitute for the 5' T ; examples of halogen substitutions include but are not limited to bromouridine or iodo-uridine substitutions.
[0083] In a particular aspect of the disclosure, the CpG ODN comprises the nucleic acid sequence 5’ T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*G*C*T*T*T*T 3’ (SEQ ID NO: 9) wherein * indicates a phosphorothioate linkage. SEQ ID NO: 9 corresponds to the sequence of CpG 24555 wherein each of the internucleotide linkages are phosphorothioate linkages. CpG 24555 is a TLR9 agonist with potent Th1 cell activity that stimulates strong B-cell and NK-cell activation and is described in U.S. Patent No. 8,552,165, incorporated by reference herein.
[0084] As used herein, “CpG 24555” refers to a sequence comprising or consisting of the sequence of either SEQ ID NO: 2 or SEQ ID NO: 9. In some embodiments, at least one CG dinucleotide within CpG 24555 comprises a cytosine that is unmethylated. In some embodiments, at least two or three CG dinucleotides within CpG 24555 comprises a cytosine that is unmethylated. In a particular embodiment, each CG dinculeotide within CpG 24555 comprises a cytosine that is unmethylated.
[0085] In a particular embodiment, the adjuvant described herein comprises nanosized CpG 24555. In another particular embodiment, the adjuvant described herein comprises the sequence of SEQ ID NO: 2, wherein the adjuvant is nanosized. In another particular embodiment, the adjuvant described herein consists of the sequence of SEQ ID NO: 2, wherein the adjuvant is nanosized. In other embodiments, the adjuvant described herein comprises the sequence of SEQ ID NO: 2, wherein the nucleotide comprises one or more phosphorothioate linkages, and wherein the adjuvant is nanosized. In additional embodiments, the adjuvant described herein consists of the sequence of SEQ ID NO: 2, wherein the nucleotide comprises one or more phosphorothioate linkages, and wherein the adjuvant is nanosized. In still other embodiments, the adjuvant described herein comprises the sequence of SEQ ID NO: 9, wherein the adjuvant is nanosized. In yet another embodiment, the adjuvant described herein consists of the sequence of SEQ ID NO: 9, wherein the adjuvant is nanosized.
[0086] In an aspect of the present disclosure, the immunogenic compositions as disclosed herein comprise a C class CpG oligonucleotide. In some aspects, the C class CpG oligonucleotides of the present disclosure may include, but are not limited to, the following nucleic acid sequences: 5’ TCGCGTCGTTCGGCGCGCGCCG 3’ (SEQ ID NO: 10); 5’ TCGTCGACGTTCGGCGCGCGCCG 3’ (SEQ ID NO: 11);
[0087] 5’ TCGGACGTTCGGCGCGCGCCG 3’ (SEQ ID NO: 12);
[0088] 5’ TCGGACGTTCGGCGCGCCG 3’ (SEQ ID NO: 13);
[0089] 5’ TCGCGTCGTTCGGCGCGCCG 3’ (SEQ ID NO: 14);
[0090] 5’ TCGACGTTCGGCGCGCGCCG 3’ (SEQ ID NO: 15);
[0091] 5’ TCGACGTTCGGCGCGCCG 3’ (SEQ ID NO: 16);
[0092] 5’ TCGCGTCGTTCGGCGCCG 3’ (SEQ ID NO: 17);
[0093] 5’ TCGCGACGTTCGGCGCGCGCCG 3’ (SEQ ID NO: 18);
[0094] 5’ TCGTCGTTTTCGGCGCGCGCCG 3’ (SEQ ID NO: 19);
[0095] 5’ TCGTCGTTTTCGGCGGCCGCCG 3’ (SEQ ID NO: 20);
[0096] 5’ TCGTCGTTTTACGGCGCCGTGCCG 3’ (SEQ ID NO: 21); and 5’ TCGTCGTTTTCGGCGCGCGCCGT 3’ (SEQ ID NO: 22).
[0097] In any of the C class CpG oligonucleotide sequences, all of the linkages may be all phosphorothioate bonds. In another embodiment, in any of these sequences, one or more of the linkages may be phosphodiester, for example between the “C” and the “G” of the CpG motif making a semi-soft CpG oligonucleotide. In any of these sequences, an ethyl-uridine or a halogen may substitute for the 5' T ; examples of halogen substitutions include but are not limited to bromouridine or iodo-uridine substitutions.
[0098] In an aspect of the present disclosure, the immunogenic compositions as disclosed herein comprise a P class CpG Oligonucleotide. In some aspects, the CpG oligonucleotides of the present disclosure may include a P class CpG oligonucleotide containing a 5' TLR activation domain and at least two palindromic regions, one palindromic region being a 5' palindromic region of at least 6 nucleotides in length and connected to a 3' palindromic region of at least 8 nucleotides in length either directly or through a spacer, wherein the oligonucleotide includes at least one YpR dinucleotide. In one aspect, the P class CpG oligonucleotide includes at least one unmethylated CpG dinucleotide. In another aspect, the TLR activation domain is TCG, TTCG, TTTCG, TYpR, TTYpR, TTTYpR, UCG, UUCG, UUUCG, TTT, or TTTT. In yet another aspect, the TLR activation domain is within the 5' palindromic region. In another aspect, the TLR activation domain is immediately 5' to the 5' palindromic region. In some aspects, the P class CpG oligonucleotides of the disclosure comprise the nucleic acid sequence: 5’ TCGTCGACGATCGGCGCGCGCCG 3’ (SEQ ID NO: 23).
[0099] In any of the P class CpG oligonucleotide sequences, all of the linkages may be all phosphorothioate bonds. In another aspect, one or more of the linkages may be phosphodiester, for example between the “C” and the “G” of the CpG motif making a semi-soft CpG oligonucleotide. In any of these sequences, an ethyl-uridine or a halogen may substitute for the 5' T ; examples of halogen substitutions include but are not limited to bromo-uridine or iodo-uridine substitutions. In one aspect, the CpG ODN adjuvants described herein comprise between 15 and 30 nucleotides. For example, in some embodiments, the CpG ODN adjuvant comprises 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, the CpG ODN adjuvant comprises 20, 21 , 22, or 24 nucleotides. In a particular embodiment, the CpG ODN adjuvant comprises 21 nucleotides and is nanosized.
[0100] In another aspect, the CpG ODN adjuvants described herein comprise a CpG motif consisting of 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, or 24 nucleotides. In a particular embodiment, the CpG ODN adjuvants comprises a CpG consisting of 16 nucleotides.
[0101] In some embodiments, the CpG ODN adjuvant described herein comprises the sequence of any one of SEQ ID Nos: 1-23 and is nanosized. In some embodiments, the CpG ODN adjuvant described herein consists of the sequence of any one of SEQ ID Nos: 1-23 and is nanosized. In some embodiments, the CpG ODN adjuvant described herein comprises the sequence of any one of SEQ ID Nos: 1-23, wherein at least one of the CG dinucleotides within the sequence contains an unmethylated cytosine, and wherein the adjuvant is nanosized. In some embodiments, the CpG ODN adjuvant described herein comprises the sequence of any one of SEQ ID Nos: 1-23, wherein each of the CG dinucleotides within the sequence contains an unmethylated cytosine, and wherein the adjuvant is nanosized. In some embodiments, the CpG ODN adjuvant described herein consists of the sequence of any one of SEQ ID Nos: 1-23, wherein at least one of the CG dinucleotides within the sequence contains an unmethylated cytosine, and wherein the adjuvant is nanosized. In some embodiments, the CpG ODN adjuvant described herein consists of the sequence of any one of SEQ ID Nos: 1-23, wherein each of the CG dinucleotides within the sequence contains an unmethylated cytosine, and wherein the adjuvant is nanosized.
[0102] In some embodiments, the CpG ODN adjuvant is nanosized and comprises a nucleic acid sequence that is a functional variant of the sequence of any one of SEQ ID Nos: 1-23. In some embodiments, the functional variant of the CpG ODN nanosized adjuvant comprises a nucleic acid sequence that varies from the sequence of any one of SEQ ID Nos: 1-23 by between 1 and 10 nucleotides. In some embodiments, the CpG ODN adjuvant is nanosized and comprises a nucleic acid sequence that varies from the sequence of any one of SEQ ID Nos: 1-23 by 1 , 2, 3, 4, or 5 nucleotides.
[0103] In a particular embodiment, the CpG ODN adjuvant described herein comprises the sequence of SEQ ID NO: 2, wherein at least one of the CG dinucleotides within the sequence contains an unmethylated cytosine, and wherein the adjuvant is nanosized. In another particular embodiment, the CpG ODN adjuvant described herein consists of the sequence of SEQ ID NO: 2, wherein at least one of the CG dinucleotides within the sequence contains an unmethylated cytosine. In another particular embodiment, the CpG oligonucleotide adjuvant described herein comprises the sequence of SEQ ID NO: 2, wherein each of the CG dinucleotides within the sequence contains an unmethylated cytosine, and wherein the adjuvant is nanosized. In another particular embodiment, the CpG ODN adjuvant described herein consists of the sequence of SEQ ID NO: 2, wherein each of the CG dinucleotides within the sequence contains an unmethylated cytosine.
[0104] In some embodiments, the CpG ODN adjuvant is nanosized and comprises a nucleic acid sequence that is a functional variant of SEQ ID NO: 2. In some embodiments, the functional variant of the CpG ODN nanosized adjuvant comprises a nucleic acid sequence that varies from the sequence of SEQ ID NO: 2 by between 1 and 10 nucleotides. In some embodiments, the CpG ODN adjuvant is nanosized and comprises a nucleic acid sequence that varies from the sequence of SEQ ID NO: 2 by 1 , 2, 3, 4, or 5 nucleotides.
[0105] In a particular embodiment, the CpG ODN adjuvant described herein comprises the sequence of SEQ ID NO: 9, wherein at least one of the CG dinucleotides within the sequence contains an unmethylated cytosine, and wherein the adjuvant is nanosized. In another particular embodiment, the CpG ODN adjuvant described herein consists of the sequence of SEQ ID NO: 9, wherein at least one of the CG dinucleotides within the sequence contains an unmethylated cytosine. In another particular embodiment, the CpG ODN adjuvant described herein comprises the sequence of SEQ ID NO: 9, wherein each of the CG dinucleotides within the sequence contains an unmethylated cytosine, and wherein the adjuvant is nanosized. In another particular embodiment, the CpG ODN adjuvant described herein consists of the sequence of SEQ ID NO: 9, wherein each of the CG dinucleotides within the sequence contains an unmethylated cytosine.
[0106] In some embodiments, the CpG ODN adjuvant is nanosized and comprises a nucleic acid sequence that is a functional variant of SEQ ID NO: 9. In some embodiments, the functional variant of the CpG ODN nanosized adjuvant comprises a nucleic acid sequence that varies from the sequence of SEQ ID NO: 9 by between 1 and 10 nucleotides. In some embodiments, the CpG ODN adjuvant is nanosized and comprises a nucleic acid sequence that varies from the sequence of SEQ I D NO: 9 by 1 , 2, 3, 4, or 5 nucleotides.
[0107] Nanosized Adjuvants
[0108] The present disclosure provides adjuvants that are sized to nanoscale ( / .e, less than 1 micrometer). For example, nanoscale adjuvants can be used to increase the efficacy or potency of an immunogenic composition, ( / .e., a vaccine). In particular embodiments, the nanosized adjuvant comprises aluminum. In other particular embodiments, the nanosized adjuvant comprises CpG oligonucleotides. In some embodiments, the nanosized adjuvant comprises CpG 24555.
[0109] In one aspect, a nanoparticle comprising more than one type of adjuvant molecule is disclosed. In particular embodiments, a nanoparticle comprising two types of adjuvant molecules is disclosed. In other particular embodiments, a nanoparticle comprising aluminum and CpG oligonucleotides is disclosed. In some embodiments, a nanoparticle comprising aluminum and CpG 24555 is disclosed.
[0110] The diameter of the nanoparticles described herein can be determined using methods known within the art, such as dynamic light scattering (DLS) (See e.g., Stetefeld et al. Biophys Rev. 2016 Dec;8(4):409-427), transmission electron microscopy (TEM) (See e.g., Keck et al. Int J Pharm. 2008 May 1 ;355(1-2): 150-63) and laser diffraction (See e.g., Filippov et al. Mater Horiz. 2023 Nov 27;10(12):5354-5370).
[0111] In one aspect, provided herein are adjuvants that are nanosized wherein the particle size of the adjuvant is less than about 1 micrometer (pM) in diameter. As used herein, in reference to a population of particles, the particle size provided is the z-average diameter of the population of particles as measured by dynamic light scattering (DLS) (See e.g., Yeap et al. J Nanosci Nanotechnol. 2018 Oct 1;18(10):6957-6964).
[0112] In some embodiments, the average particle size of the adjuvant is between about 0.1 nanometer (nm) and about 1 pM in diameter. In other embodiments, the average particle size of the adjuvant is between about 1 nanometer (nm) and about 1 pM in diameter. In some embodiments, the average particle size of the adjuvant is about 1 nm, about 50 nm, about 100 nm, about 150 nm, about 200 nm, about 250 nm, about 300 nm, about 350 nm, about 400 nm, about 450 nm, about 500 nm, about 550 nm, about 600 nm, about 650 nm, about 700 nm, about 750 nm, about 800 nm, about 850 nm, about 900 nm, about 950 nm, or about 1000 nm in diameter.
[0113] In particular embodiments, the average particle size of the adjuvant is less than about 100 nm in diameter. In some embodiments, the average particle size of the adjuvant is between about 0.1 nm and about 100 nm in diameter. In other embodiments, the average particle size of the adjuvant is between about 1 nm and about 100 nm in diameter. In some embodiments, the average particle size of the adjuvant is about 1 nm, about 5 nm, about 10 nm, about 15 nm, about 20 nm, about 25 nm, about 30 nm, about 35 nm, about 40 nm, about 45 nm, about 50 nm, about 55 nm, about 60 nm, about 65 nm, about 70 nm, about 75 nm, about 80 nm, about 85 nm, about 90 nm, about 95 nm, or about 100 nm in diameter.
[0114] In particular embodiments, the average particle size of the adjuvant is between about 80 nm and about 90 nm in diameter. In some embodiments, the average particle size of the adjuvant is about 80 nm, about 81 nm, about 82 nm, about 83 nm, about 84 nm, about 85 nm, about 86 nm, about 87 nm, about 88 nm, about 89 nm, or about 90 nm in diameter.
[0115] In one aspect, provided herein are adjuvants comprising aluminum that are nanosized wherein the average particle size of the aluminum is less than about 1 micrometer (pM) in diameter. In some embodiments, the average particle size of the aluminum is between about 0.1 nanometer (nm) and about 1 pM in diameter. In other embodiments, the average particle size of the aluminum is between about 1 nanometer (nm) and about 1 pM in diameter. In some embodiments, the average particle size of the aluminum is about 1 nm, about 50 nm, about 100 nm, about 150 nm, about 200 nm, about 250 nm, about 300 nm, about 350 nm, about 400 nm, about 450 nm, about 500 nm, about 550 nm, about 600 nm, about 650 nm, about 700 nm, about 750 nm, about 800 nm, about 850 nm, about 900 nm, about 950 nm, or about 1000 nm in diameter.
[0116] In particular embodiments, the average particle size of the aluminum is less than about 100 nm in diameter. In some embodiments, the average particle size of the aluminum is between about 0.1 nm and about 100 nm in diameter. In other embodiments, the average particle size of the aluminum is between about 1 nm and about 100 nm in diameter. In some embodiments, the average particle size of the aluminum is about 1 nm, about 5 nm, about 10 nm, about 15 nm, about 20 nm, about 25 nm, about 30 nm, about 35 nm, about 40 nm, about 45 nm, about 50 nm, about 55 nm, about 60 nm, about 65 nm, about 70 nm, about 75 nm, about 80 nm, about 85 nm, about 90 nm, about 95 nm, or about 100 nm in diameter.
[0117] In particular embodiments, the average particle size of the aluminum is between about 80 nm and about 90 nm in diameter. In some embodiments, the average particle size of the aluminum is about 80 nm, about 81 nm, about 82 nm, about 83 nm, about 84 nm, about 85 nm, about 86 nm, about 87 nm, about 88 nm, about 89 nm, or about 90 nm in diameter.
[0118] In one aspect, provided herein are adjuvants comprising nucleotides (nucleotide adjuvants) that are nanosized wherein the average particle size of the adjuvant comprising a nucleotide is less than about 1 micrometer (pM) in diameter. In some embodiments, the average particle size of the nucleotide is between about 0.1 nanometer (nm) and about 1 pM in diameter. In other embodiments, the average particle size of the nucleotide is between about 1 nanometer (nm) and about 1 pM in diameter. In some embodiments, the average particle size of the nucleotide is about 1 nm, about 50 nm, about 100 nm, about 150 nm, about 200 nm, about 250 nm, about 300 nm, about 350 nm, about 400 nm, about 450 nm, about 500 nm, about 550 nm, about 600 nm, about 650 nm, about 700 nm, about 750 nm, about 800 nm, about 850 nm, about 900 nm, about 950 nm, or about 1000 nm in diameter.
[0119] In particular embodiments, the average particle size of the nucleotide adjuvant is less than about 100 nm in diameter. In some embodiments, the average particle size of the nucleotide is between about 0.1 nm and about 100 nm in diameter. In other embodiments, the average particle size of the nucleotide is between about 1 nm and about 100 nm in diameter. In some embodiments, the average particle size of the nucleotide is about 1 nm, about 5 nm, about 10 nm, about 15 nm, about 20 nm, about 25 nm, about 30 nm, about 35 nm, about 40 nm, about 45 nm, about 50 nm, about 55 nm, about 60 nm, about 65 nm, about 70 nm, about 75 nm, about 80 nm, about 85 nm, about 90 nm, about 95 nm, or about 100 nm in diameter.
[0120] In particular embodiments, the average particle size of the nucleotide is between about 80 nm and about 90 nm in diameter. In some embodiments, the average particle size of the nucleotide is about 80 nm, about 81 nm, about 82 nm, about 83 nm, about 84 nm, about 85 nm, about 86 nm, about 87 nm, about 88 nm, about 89 nm, or about 90 nm in diameter.
[0121] In one aspect, provided herein are adjuvants comprising CpG oligodeoxynucleotides (CpG ODN) that are nanosized wherein the average particle size of the adjuvant comprising a nucleotide is less than about 1 micrometer (pM) in diameter. In some embodiments, the average particle size of the CpG ODN is between about 0.1 nanometer (nm) and about 1 pM in diameter. In other embodiments, the average particle size of the CpG ODN is between about 1 nanometer (nm) and about 1 pM in diameter. In some embodiments, the average particle size of the CpG ODN is about 1 nm, about 50 nm, about 100 nm, about 150 nm, about 200 nm, about 250 nm, about 300 nm, about 350 nm, about 400 nm, about 450 nm, about 500 nm, about 550 nm, about 600 nm, about 650 nm, about 700 nm, about 750 nm, about 800 nm, about 850 nm, about 900 nm, about 950 nm, or about 1000 nm in diameter.
[0122] In particular embodiments, the average particle size of the CpG ODN is less than about 100 nm in diameter. In some embodiments, the average particle size of the CpG ODN is between about 0.1 nm and about 100 nm in diameter. In other embodiments, the average particle size of the CpG ODN is between about 1 nm and about 100 nm in diameter. In some embodiments, the average particle size of the CpG ODN is about 1 nm, about 5 nm, about 10 nm, about 15 nm, about 20 nm, about 25 nm, about 30 nm, about 35 nm, about 40 nm, about 45 nm, about 50 nm, about 55 nm, about 60 nm, about 65 nm, about 70 nm, about 75 nm, about 80 nm, about 85 nm, about 90 nm, about 95 nm, or about 100 nm in diameter.
[0123] In particular embodiments, the average particle size of the CpG ODN is between about 80 nm and about 90 nm in diameter. In some embodiments, the average particle size of the CpG ODN is about 80 nm, about 81 nm, about 82 nm, about 83 nm, about 84 nm, about 85 nm, about 86 nm, about 87 nm, about 88 nm, about 89 nm, or about 90 nm in diameter.
[0124] In one aspect, provided herein are adjuvants comprising CpG 24555 that are nanosized wherein the average particle size of the adjuvant comprising a nucleotide is less than about 1 micrometer (pM) in diameter. In some embodiments, the average particle size of CpG 24555 is between about 0.1 nanometer (nm) and about 1 pM in diameter. In other embodiments, the average particle size of CpG 24555 is between about 1 nanometer (nm) and about 1 pM in diameter. In some embodiments, the average particle size of CpG 24555 is about 1 nm, about 50 nm, about 100 nm, about 150 nm, about 200 nm, about 250 nm, about 300 nm, about 350 nm, about 400 nm, about 450 nm, about 500 nm, about 550 nm, about 600 nm, about 650 nm, about 700 nm, about 750 nm, about 800 nm, about 850 nm, about 900 nm, about 950 nm, or about 1000 nm in diameter.
[0125] In particular embodiments, the average particle size of CpG 24555 is less than about 100 nm in diameter. In some embodiments, the average particle size of CpG 24555 is between about 0.1 nm and about 100 nm in diameter. In other embodiments, the average particle size of CpG 24555 is between about 1 nm and about 100 nm in diameter. In some embodiments, the average particle size of CpG 24555 is about 1 nm, about 5 nm, about 10 nm, about 15 nm, about 20 nm, about 25 nm, about 30 nm, about 35 nm, about 40 nm, about 45 nm, about 50 nm, about 55 nm, about 60 nm, about 65 nm, about 70 nm, about 75 nm, about 80 nm, about 85 nm, about 90 nm, about 95 nm, or about 100 nm in diameter.
[0126] In particular embodiments, the average particle size of CpG 24555 is between about 80 nm and about 90 nm in diameter. In some embodiments, the average particle size of CpG 24555 is about 80 nm, about 81 nm, about 82 nm, about 83 nm, about 84 nm, about 85 nm, about 86 nm, about 87 nm, about 88 nm, about 89 nm, or about 90 nm in diameter.
[0127] In particular embodiments, a nanoparticle is provided that comprises more than one type of adjuvant molecule. In some embodiments, a nanoparticle comprises 1, 2, 3, or more types of adjuvant molecules. In a particular embodiment, a nanoparticle comprises 2 types of adjuvant molecules.
[0128] In one aspect, provided herein are nanoparticles comprising two types of adjuvant molecules. In some embodiments, the average particle size of the nanoparticle comprising two types of adjuvants is between about 0.1 nanometer (nm) and about 1 pM in diameter. In other embodiments, the average particle size of the nanoparticle comprising two types of adjuvants is between about 1 nanometer (nm) and about 1 pM in diameter. In some embodiments, the average particle size of the nanoparticle comprising two types of adjuvants is about 1 nm, about 50 nm, about 100 nm, about 150 nm, about 200 nm, about 250 nm, about 300 nm, about 350 nm, about 400 nm, about 450 nm, about 500 nm, about 550 nm, about 600 nm, about 650 nm, about 700 nm, about 750 nm, about 800 nm, about 850 nm, about 900 nm, about 950 nm, or about 1000 nm in diameter.
[0129] In particular embodiments, the average particle size of the nanoparticle comprising two types of adjuvants is less than about 100 nm in diameter. In some embodiments, the average particle size of the nanoparticle comprising two types of adjuvants is between about 0.1 nm and about 100 nm in diameter. In other embodiments, the average particle size of the nanoparticle comprising two types of adjuvants is between about 1 nm and about 100 nm in diameter. In some embodiments, the average particle size of the nanoparticle comprising two types of adjuvants is about 1 nm, about 5 nm, about 10 nm, about 15 nm, about 20 nm, about 25 nm, about 30 nm, about 35 nm, about 40 nm, about 45 nm, about 50 nm, about 55 nm, about 60 nm, about 65 nm, about 70 nm, about 75 nm, about 80 nm, about 85 nm, about 90 nm, about 95 nm, or about 100 nm in diameter.
[0130] In particular embodiments, the average particle size of the nanoparticle comprising two types of adjuvants is between about 80 nm and about 90 nm in diameter. In some embodiments, the average particle size of the nanoparticle comprising two types of adjuvants is about 80 nm, about 81 nm, about 82 nm, about 83 nm, about 84 nm, about 85 nm, about 86 nm, about 87 nm, about 88 nm, about 89 nm, or about 90 nm in diameter.
[0131] In particular embodiments, a nanoparticle is provided that comprises aluminum and at least one other type of adjuvant molecule. In some embodiments, a nanoparticle comprises aluminum and 1 , 2, 3, or more types of adjuvant molecules. In a particular embodiment, a nanoparticle comprises aluminum and 1 other type of adjuvant molecule.
[0132] In one aspect, provided herein are nanoparticles comprising aluminum and one other type of adjuvant molecule. In some embodiments, the average particle size of the nanoparticle comprising aluminum and one other type of adjuvant molecule is between about 0.1 nanometer (nm) and about 1 pM in diameter. In other embodiments, the average particle size of the nanoparticle comprising aluminum and one other type of adjuvant molecule is between about 1 nanometer (nm) and about 1 pM in diameter. In some embodiments, the average particle size of the nanoparticle comprising aluminum and one other type of adjuvant molecule is about 1 nm, about 50 nm, about 100 nm, about 150 nm, about 200 nm, about 250 nm, about 300 nm, about 350 nm, about 400 nm, about 450 nm, about 500 nm, about 550 nm, about 600 nm, about 650 nm, about 700 nm, about 750 nm, about 800 nm, about 850 nm, about 900 nm, about 950 nm, or about 1000 nm in diameter.
[0133] In particular embodiments, the average particle size of the nanoparticle comprising aluminum and one other type of adjuvant molecule is less than about 100 nm in diameter. In some embodiments, the average particle size of the nanoparticle comprising aluminum and one other type of adjuvant molecule is between about 0.1 nm and about 100 nm in diameter. In other embodiments, the average particle size of the nanoparticle comprising aluminum and one other type of adjuvant molecule is between about 1 nm and about 100 nm in diameter. In some embodiments, the average particle size of the nanoparticle comprising aluminum and one other type of adjuvant molecule is about 1 nm, about 5 nm, about 10 nm, about 15 nm, about 20 nm, about 25 nm, about 30 nm, about 35 nm, about 40 nm, about 45 nm, about 50 nm, about 55 nm, about 60 nm, about 65 nm, about 70 nm, about 75 nm, about 80 nm, about 85 nm, about 90 nm, about 95 nm, or about 100 nm in diameter.
[0134] In particular embodiments, the average particle size of the nanoparticle comprising aluminum and one other type of adjuvant molecule is between about 80 nm and about 90 nm in diameter. In some embodiments, the average particle size of the nanoparticle comprising aluminum and one other type of adjuvant molecule is about 80 nm, about 81 nm, about 82 nm, about 83 nm, about 84 nm, about 85 nm, about 86 nm, about 87 nm, about 88 nm, about 89 nm, or about 90 nm in diameter.
[0135] In some embodiments, a charge-charge interaction between positively charged aluminum and a negatively charged nucleotide molecule allows for the formation of a nanoparticle complex comprising aluminum and a nucleotide. In particular embodiments, a nanoparticle is provided that comprises aluminum and a nucleotide adjuvant. In some embodiments, a nanoparticle comprises aluminum and 1, 2, 3, or more nucleotide adjuvants.
[0136] In one aspect, provided herein are nanoparticles comprising aluminum and a nucleotide adjuvant. In some embodiments, the average particle size of the nanoparticle comprising aluminum and a nucleotide is between about 0.1 nanometer (nm) and about 1 pM in diameter. In other embodiments, the average particle size of the nanoparticle comprising aluminum and a nucleotide is between about 1 nanometer (nm) and about 1 pM in diameter. In some embodiments, the average particle size of the nanoparticle comprising aluminum and a nucleotide is about 1 nm, about 50 nm, about 100 nm, about 150 nm, about 200 nm, about 250 nm, about 300 nm, about 350 nm, about 400 nm, about 450 nm, about 500 nm, about 550 nm, about 600 nm, about 650 nm, about 700 nm, about 750 nm, about 800 nm, about 850 nm, about 900 nm, about 950 nm, or about 1000 nm in diameter.
[0137] In particular embodiments, the average particle size of the nanoparticle comprising aluminum and a nucleotide adjuvant is less than about 100 nm in diameter. In some embodiments, the average particle size of the nanoparticle comprising aluminum and a nucleotide is between about 0.1 nm and about 100 nm in diameter. In other embodiments, the average particle size of the nanoparticle comprising aluminum and a nucleotide is between about 1 nm and about 100 nm in diameter. In some embodiments, the average particle size of the nanoparticle comprising aluminum and a nucleotide is about 1 nm, about 5 nm, about 10 nm, about 15 nm, about 20 nm, about 25 nm, about 30 nm, about 35 nm, about 40 nm, about 45 nm, about 50 nm, about 55 nm, about 60 nm, about 65 nm, about 70 nm, about 75 nm, about 80 nm, about 85 nm, about 90 nm, about 95 nm, or about 100 nm in diameter.
[0138] In particular embodiments, the average particle size of the nanoparticle comprising aluminum and a nucleotide is between about 80 nm and about 90 nm in diameter. In some embodiments, the average particle size of the nanoparticle comprising aluminum and a nucleotide is about 80 nm, about 81 nm, about 82 nm, about 83 nm, about 84 nm, about 85 nm, about 86 nm, about 87 nm, about 88 nm, about 89 nm, or about 90 nm in diameter.
[0139] In particular embodiments, a nanoparticle is provided that comprises aluminum and a CpG oligodeoxynucleotide (CpG ODN).
[0140] In one aspect, provided herein are nanoparticles comprising aluminum and CpG ODN. In some embodiments, the average particle size of the nanoparticle comprising aluminum and CpG ODN is between about 0.1 nanometer (nm) and about 1 pM in diameter. In other embodiments, the average particle size of the nanoparticle comprising aluminum and CpG ODN is between about 1 nanometer (nm) and about 1 pM in diameter. In some embodiments, the average particle size of the nanoparticle comprising aluminum and CpG ODN is about 1 nm, about 50 nm, about 100 nm, about 150 nm, about 200 nm, about 250 nm, about 300 nm, about 350 nm, about 400 nm, about 450 nm, about 500 nm, about 550 nm, about 600 nm, about 650 nm, about 700 nm, about 750 nm, about 800 nm, about 850 nm, about 900 nm, about 950 nm, or about 1000 nm in diameter.
[0141] In particular embodiments, the average particle size of the nanoparticle comprising aluminum and CpG ODN is less than about 100 nm in diameter. In some embodiments, the average particle size of the nanoparticle comprising aluminum and CpG ODN is between about 0.1 nm and about 100 nm in diameter. In other embodiments, the average particle size of the nanoparticle comprising aluminum and CpG ODN is between about 1 nm and about 100 nm in diameter. In some embodiments, the average particle size of the nanoparticle comprising aluminum and CpG ODN is about 1 nm, about 5 nm, about 10 nm, about 15 nm, about 20 nm, about 25 nm, about 30 nm, about 35 nm, about 40 nm, about 45 nm, about 50 nm, about 55 nm, about 60 nm, about 65 nm, about 70 nm, about 75 nm, about 80 nm, about 85 nm, about 90 nm, about 95 nm, or about 100 nm in diameter.
[0142] In particular embodiments, the average particle size of the nanoparticle comprising aluminum and CpG ODN is between about 80 nm and about 90 nm in diameter. In some embodiments, the average particle size of the nanoparticle comprising aluminum and CpG ODN is about 80 nm, about 81 nm, about 82 nm, about 83 nm, about 84 nm, about 85 nm, about 86 nm, about 87 nm, about 88 nm, about 89 nm, or about 90 nm in diameter.
[0143] In particular embodiments, a nanoparticle is provided that comprises aluminum and CpG 24555.
[0144] In one aspect, provided herein are nanoparticles comprising aluminum and CpG 24555. In some embodiments, the average particle size of the nanoparticle comprising aluminum and CpG 24555 is between about 0.1 nanometer (nm) and about 1 pM in diameter. In other embodiments, the average particle size of the nanoparticle comprising aluminum and CpG 24555 is between about 1 nanometer (nm) and about 1 pM in diameter. In some embodiments, the average particle size of the nanoparticle comprising aluminum and CpG 24555 is about 1 nm, about 50 nm, about 100 nm, about 150 nm, about 200 nm, about 250 nm, about 300 nm, about 350 nm, about 400 nm, about 450 nm, about 500 nm, about 550 nm, about 600 nm, about 650 nm, about 700 nm, about 750 nm, about 800 nm, about 850 nm, about 900 nm, about 950 nm, or about 1000 nm in diameter.
[0145] In particular embodiments, the average particle size of the nanoparticle comprising aluminum and CpG 24555 is less than about 100 nm in diameter. In some embodiments, the average particle size of the nanoparticle comprising aluminum and CpG 24555 is between about 0.1 nm and about 100 nm in diameter. In other embodiments, the average particle size of the nanoparticle comprising aluminum and CpG 24555 is between about 1 nm and about 100 nm in diameter. In some embodiments, the average particle size of the nanoparticle comprising aluminum and CpG 24555 is about 1 nm, about 5 nm, about 10 nm, about 15 nm, about 20 nm, about 25 nm, about 30 nm, about 35 nm, about 40 nm, about 45 nm, about 50 nm, about 55 nm, about 60 nm, about 65 nm, about 70 nm, about 75 nm, about 80 nm, about 85 nm, about 90 nm, about 95 nm, or about 100 nm in diameter.
[0146] In particular embodiments, the average particle size of the nanoparticle comprising aluminum and CpG 24555 is between about 80 nm and about 90 nm in diameter. In some embodiments, the average particle size of the nanoparticle comprising aluminum and CpG 24555 is about 80 nm, about 81 nm, about 82 nm, about 83 nm, about 84 nm, about 85 nm, about 86 nm, about 87 nm, about 88 nm, about 89 nm, or about 90 nm in diameter.
[0147] Without being confined to a particular method or mechanism, it is hypothesized that an anionic compound can be added to a nanoparticle formulation to maintain the particles at nanosize and prevent the aggregation of the particles. For example, an anionic compound (with a negative charge) has a binding interaction with positively charged aluminum. When an anionic compound is included within a particle complex, this charge-charge interaction can stabilize the particles at nanosize. Numerous anionic compounds can be suitably used within the nanoparticles, such as, polyacrylic acid (PAA), phytic acid (PA), and polyglutamic acid (PGA). In a particular embodiment, provided herein are nanoparticles comprising aluminum and an anionic compound. In another embodiment, provided herein are nanoparticles comprising polyacrylic acid (PAA) and aluminum. In still another embodiment, provided herein are nanoparticles comprising phytic acid (PA) and aluminum. In yet another embodiment, provided herein are nanoparticles comprising polyglutamic acid (PGA) and aluminum.
[0148] In a particular embodiment, provided herein are nanoparticles comprising aluminum and PAA. Without being confined to a particular method or mechanism, it is hypothesized that PAA adsorption to aluminum nanoparticles enhances the ability of the nanoparticles to maintain a reduced size, and therefore induce an enhanced immunogenic response when used as an adjuvant. In some embodiments, the nanoparticles comprise aluminum and PAA.
[0149] In some embodiments, the nanoparticles comprise aluminum, a nucleotide, and PAA. In other embodiments, the nanoparticles comprise aluminum, a CpG ODN, and PAA. In still other embodiments, the nanoparticles comprise aluminum, CpG 24555, and PAA.
[0150] In additional embodiments, the nanoparticles comprise aluminum, a nucleotide, and PAA. In other embodiments, the nanoparticles comprise aluminum, a CpG ODN, and PAA. In still other embodiments, the nanoparticles comprise aluminum, CpG 24555, and PAA.
[0151] In one aspect, provided herein are nanoparticles comprising aluminum, a nucleotide, and an anionic compound. In some embodiments, the average particle size of the nanoparticle comprising aluminum, a nucleotide, and an anionic compound is between about 0.1 nanometer (nm) and about 1 pM in diameter. In other embodiments, the average particle size of the nanoparticle comprising aluminum, a nucleotide, and an anionic compound is between about 1 nanometer (nm) and about 1 pM in diameter. In some embodiments, the average particle size of the nanoparticle comprising aluminum, a nucleotide, and an anionic compound is about 1 nm, about 50 nm, about 100 nm, about 150 nm, about 200 nm, about 250 nm, about 300 nm, about 350 nm, about 400 nm, about 450 nm, about 500 nm, about 550 nm, about 600 nm, about 650 nm, about 700 nm, about 750 nm, about 800 nm, about 850 nm, about 900 nm, about 950 nm, or about 1000 nm in diameter.
[0152] In particular embodiments, the average particle size of the nanoparticle comprising aluminum, a nucleotide, and an anionic compound is less than about 100 nm in diameter. In some embodiments, the average particle size of the nanoparticle comprising aluminum, a nucleotide, and an anionic compound is between about 0.1 nm and about 100 nm in diameter. In other embodiments, the average particle size of the nanoparticle comprising aluminum, a nucleotide, and an anionic compound is between about 1 nm and about 100 nm in diameter. In some embodiments, the average particle size of the nanoparticle comprising aluminum, a nucleotide, and an anionic compound is about 1 nm, about 5 nm, about 10 nm, about 15 nm, about 20 nm, about 25 nm, about 30 nm, about 35 nm, about 40 nm, about 45 nm, about 50 nm, about 55 nm, about 60 nm, about 65 nm, about 70 nm, about 75 nm, about 80 nm, about 85 nm, about 90 nm, about 95 nm, or about 100 nm in diameter.
[0153] In particular embodiments, the average particle size of the nanoparticle comprising aluminum, a nucleotide, and an anionic compound is between about 80 nm and about 90 nm in diameter. In some embodiments, the average particle size of the nanoparticle comprising aluminum, a nucleotide, and an anionic compound is about 80 nm, about 81 nm, about 82 nm, about 83 nm, about 84 nm, about 85 nm, about 86 nm, about 87 nm, about 88 nm, about 89 nm, or about 90 nm in diameter.
[0154] In one aspect, provided herein are nanoparticles comprising aluminum, a nucleotide, and PAA. In some embodiments, the average particle size of the nanoparticle comprising aluminum, a nucleotide, and PAA is between about 0.1 nanometer (nm) and about 1 pM in diameter. In other embodiments, the average particle size of the nanoparticle comprising aluminum, a nucleotide, and PAA is between about 1 nanometer (nm) and about 1 pM in diameter. In some embodiments, the average particle size of the nanoparticle comprising aluminum, a nucleotide, and PAA is about 1 nm, about 50 nm, about 100 nm, about 150 nm, about 200 nm, about 250 nm, about 300 nm, about 350 nm, about 400 nm, about 450 nm, about 500 nm, about 550 nm, about 600 nm, about 650 nm, about 700 nm, about 750 nm, about 800 nm, about 850 nm, about 900 nm, about 950 nm, or about 1000 nm in diameter.
[0155] In particular embodiments, the average particle size of the nanoparticle comprising aluminum, a nucleotide, and PAA is less than about 100 nm in diameter. In some embodiments, the average particle size of the nanoparticle comprising aluminum, a nucleotide, and PAA is between about 0.1 nm and about 100 nm in diameter. In other embodiments, the average particle size of the nanoparticle comprising aluminum, a nucleotide, and PAA compound is between about 1 nm and about 100 nm in diameter. In some embodiments, the average particle size of the nanoparticle comprising aluminum, a nucleotide, and PAA is about 1 nm, about 5 nm, about 10 nm, about 15 nm, about 20 nm, about 25 nm, about 30 nm, about 35 nm, about 40 nm, about 45 nm, about 50 nm, about 55 nm, about 60 nm, about 65 nm, about 70 nm, about 75 nm, about 80 nm, about 85 nm, about 90 nm, about 95 nm, or about 100 nm in diameter.
[0156] In particular embodiments, the average particle size of the nanoparticle comprising aluminum, a nucleotide, and PAA is between about 80 nm and about 90 nm in diameter. In some embodiments, the average particle size of the nanoparticle comprising aluminum, a nucleotide, and PAA is about 80 nm, about 81 nm, about 82 nm, about 83 nm, about 84 nm, about 85 nm, about 86 nm, about 87 nm, about 88 nm, about 89 nm, or about 90 nm in diameter.
[0157] In one aspect, provided herein are nanoparticles comprising aluminum, CpG ODN, and PAA. In some embodiments, the average particle size of the nanoparticle comprising aluminum, CpG ODN, and PAA is between about 0.1 nanometer (nm) and about 1 pM in diameter. In other embodiments, the average particle size of the nanoparticle comprising aluminum, CpG ODN, and PAA is between about 1 nanometer (nm) and about 1 pM in diameter. In some embodiments, the average particle size of the nanoparticle comprising aluminum, CpG ODN, and PAA is about 1 nm, about 50 nm, about 100 nm, about 150 nm, about 200 nm, about 250 nm, about 300 nm, about 350 nm, about 400 nm, about 450 nm, about 500 nm, about 550 nm, about 600 nm, about 650 nm, about 700 nm, about 750 nm, about 800 nm, about 850 nm, about 900 nm, about 950 nm, or about 1000 nm in diameter.
[0158] In particular embodiments, the average particle size of the nanoparticle comprising aluminum, CpG ODN, and PAA is less than about 100 nm in diameter. In some embodiments, the average particle size of the nanoparticle comprising aluminum, CpG ODN, and PAA is between about 0.1 nm and about 100 nm in diameter. In other embodiments, the average particle size of the nanoparticle comprising aluminum, CpG ODN, and PAA compound is between about 1 nm and about 100 nm in diameter. In some embodiments, the average particle size of the nanoparticle comprising aluminum, CpG ODN, and PAA is about 1 nm, about 5 nm, about 10 nm, about 15 nm, about 20 nm, about 25 nm, about 30 nm, about 35 nm, about 40 nm, about 45 nm, about 50 nm, about 55 nm, about 60 nm, about 65 nm, about 70 nm, about 75 nm, about 80 nm, about 85 nm, about 90 nm, about 95 nm, or about 100 nm in diameter.
[0159] In particular embodiments, the average particle size of the nanoparticle comprising aluminum, CpG ODN, and PAA is between about 80 nm and about 90 nm in diameter. In some embodiments, the average particle size of the nanoparticle comprising aluminum, CpG ODN, and PAA is about 80 nm, about 81 nm, about 82 nm, about 83 nm, about 84 nm, about 85 nm, about 86 nm, about 87 nm, about 88 nm, about 89 nm, or about 90 nm in diameter.
[0160] In one aspect, provided herein are nanoparticles comprising aluminum, CpG 24555, and PAA. In some embodiments, the average particle size of the nanoparticle comprising aluminum, CpG 24555, and PAA is between about 0.1 nanometer (nm) and about 1 pM in diameter. In other embodiments, the average particle size of the nanoparticle comprising aluminum, CpG 24555, and PAA is between about 1 nanometer (nm) and about 1 pM in diameter. In some embodiments, the average particle size of the nanoparticle comprising aluminum, CpG 24555, and PAA is about 1 nm, about 50 nm, about 100 nm, about 150 nm, about 200 nm, about 250 nm, about 300 nm, about 350 nm, about 400 nm, about 450 nm, about 500 nm, about 550 nm, about 600 nm, about 650 nm, about 700 nm, about 750 nm, about 800 nm, about 850 nm, about 900 nm, about 950 nm, or about 1000 nm in diameter.
[0161] In particular embodiments, the average particle size of the nanoparticle comprising aluminum, CpG 24555, and PAA is less than about 100 nm in diameter. In some embodiments, the average particle size of the nanoparticle comprising aluminum, CpG 24555, and PAA is between about 0.1 nm and about 100 nm in diameter. In other embodiments, the average particle size of the nanoparticle comprising aluminum, CpG 24555, and PAA compound is between about 1 nm and about 100 nm in diameter. In some embodiments, the average particle size of the nanoparticle comprising aluminum, CpG 24555, and PAA is about 1 nm, about 5 nm, about 10 nm, about 15 nm, about 20 nm, about 25 nm, about 30 nm, about 35 nm, about 40 nm, about 45 nm, about 50 nm, about 55 nm, about 60 nm, about 65 nm, about 70 nm, about 75 nm, about 80 nm, about 85 nm, about 90 nm, about 95 nm, or about 100 nm in diameter.
[0162] In particular embodiments, the average particle size of the nanoparticle comprising aluminum, CpG 24555, and PAA is between about 80 nm and about 90 nm in diameter. In some embodiments, the average particle size of the nanoparticle comprising aluminum, CpG 24555, and PAA is about 80 nm, about 81 nm, about 82 nm, about 83 nm, about 84 nm, about 85 nm, about 86 nm, about 87 nm, about 88 nm, about 89 nm, or about 90 nm in diameter.
[0163] In one aspect, provided herein are adjuvants that are nanosized wherein the adjuvant particles have a polydispersity index (PDI) less than about 0.5. Polydispersity is measured by a polydispersity index (PDI). Calculations used for the determination of size and PDI parameters may be found in the ISO standard documents 13321:1996 E and ISO 22412:2008 (See Worldwide M.l. Dynamic Light Scattering, Common Terms Defined. Malvern Instruments Limited; Malvern, UK: 2011. Pp. 1-6. Inform White Paper). In some embodiments, the adjuvant particles have a PDI of about 0.1, about 0.2, about 0.3, about 0.4, or about 0.5. In particular embodiments, the adjuvant particles have a PDI less than about 0.2. In some embodiments, the adjuvants have a PDI of about 0.1 , about 0.11 , about 0.12, about 0.13, about 0.14, about 0.15, about 0.16, about 0.17, about 0.18, about 0.19, or about 0.2.
[0164] In another aspect, provided herein are adjuvants comprising aluminum that are nanosized wherein the aluminum particles have a PDI less than about 0.5. In some embodiments, the aluminum particles have a PDI of about 0.1 , about 0.2, about 0.3, about 0.4, or about 0.5. In particular embodiments, the aluminum particles have a PDI less than about 0.2. In some embodiments, the aluminum particles have a PDI of about 0.1, about 0.11 , about 0.12, about 0.13, about 0.14, about 0.15, about 0.16, about 0.17, about 0.18, about 0.19, or about 0.2.
[0165] In another aspect, provided herein are adjuvants comprising nucleotides that are nanosized wherein the nucleotide particles have a PDI less than about 0.5. In some embodiments, the nucleotide particles have a PDI of about 0.1 , about 0.2, about 0.3, about 0.4, or about 0.5. In particular embodiments, the nucleotide particles have a PDI less than about 0.2. In some embodiments, the nucleotide particles have a PDI of about 0.1, about 0.11 , about 0.12, about 0.13, about 0.14, about 0.15, about 0.16, about 0.17, about 0.18, about 0.19, or about 0.2.
[0166] In another aspect, provided herein are adjuvants comprising CpG oligodeoxynucleotides (CpG ODN) that are nanosized wherein the CpG ODN particles have a PDI less than about 0.5. In some embodiments, the CpG ODN particles have a PDI of about 0.1, about 0.2, about 0.3, about 0.4, or about 0.5. In particular embodiments, the CpG ODN particles have a PDI less than about 0.2. In some embodiments, the CpG ODN particles have a PDI of about 0.1, about 0.11, about 0.12, about 0.13, about 0.14, about 0.15, about 0.16, about 0.17, about 0.18, about 0.19, or about 0.2.
[0167] In another aspect, provided herein are nanoparticles comprising two types of adjuvant molecules that have a PDI of less than about 0.5. In some embodiments, the nanoparticles comprising two types of adjuvant molecules have a PDI of about 0.1 , about 0.2, about 0.3, about 0.4, or about 0.5. In particular embodiments, the nanoparticles comprising two types of adjuvant molecules have a PDI less than about 0.2. In some embodiments, the nanoparticles comprising two types of adjuvant molecules have a PDI of about 0.1 , about 0.11, about 0.12, about 0.13, about 0.14, about 0.15, about 0.16, about 0.17, about 0.18, about 0.19, or about 0.2.
[0168] In another aspect, provided herein are nanoparticles comprising aluminum and at least one other type of adjuvant molecule that have a PDI of less than about 0.5. In some embodiments, the nanoparticles comprising aluminum and at least one other type of adjuvant molecule have a PDI of about 0.1, about 0.2, about 0.3, about 0.4, or about 0.5. In particular embodiments, the nanoparticles comprising aluminum and at least one other type of adjuvant molecule have a PDI less than about 0.2. In some embodiments, the nanoparticles comprising aluminum and at least one other type of adjuvant molecule have a PDI of about 0.1 , about 0.11, about 0.12, about 0.13, about 0.14, about 0.15, about 0.16, about 0.17, about 0.18, about 0.19, or about 0.2.
[0169] In another aspect, provided herein are nanoparticles comprising aluminum and a nucleotide that have a PDI of less than about 0.5. In some embodiments, the nanoparticles comprising aluminum and a nucleotide have a PDI of about 0.1 , about 0.2, about 0.3, about 0.4, or about 0.5. In particular embodiments, the nanoparticles comprising aluminum and a nucleotide have a PDI less than about 0.2. In some embodiments, the nanoparticles comprising aluminum and a nucleotide have a PDI of about 0.1 , about 0.11 , about 0.12, about 0.13, about 0.14, about 0.15, about 0.16, about 0.17, about 0.18, about 0.19, or about 0.2.
[0170] In another aspect, provided herein are nanoparticles comprising aluminum and a CpG oligodeoxynucleotide (CpG ODN) that have a PDI of less than about 0.5. In some embodiments, the nanoparticles comprising aluminum and a CpG ODN have a PDI of about 0.1, about 0.2, about 0.3, about 0.4, or about 0.5. In particular embodiments, the nanoparticles comprising aluminum and a CpG ODN have a PDI less than about 0.2. In some embodiments, the nanoparticles comprising aluminum and a CpG ODN have a PDI of about 0.1 , about 0.11 , about 0.12, about 0.13, about 0.14, about 0.15, about 0.16, about 0.17, about 0.18, about 0.19, or about 0.2.
[0171] In another aspect, provided herein are nanoparticles comprising aluminum and CpG 24555 that have a PDI of less than about 0.5. In some embodiments, the nanoparticles comprising aluminum and CpG 24555 have a PDI of about 0.1 , about 0.2, about 0.3, about 0.4, or about 0.5. In particular embodiments, the nanoparticles comprising aluminum and CpG 24555 have a PDI less than about 0.2. In some embodiments, the nanoparticles comprising aluminum and CpG 24555 have a PDI of about 0.1, about 0.11, about 0.12, about 0.13, about 0.14, about 0.15, about 0.16, about 0.17, about 0.18, about 0.19, or about 0.2.
[0172] In another aspect, provided herein are nanoparticles comprising an anionic compound. In some embodiments, an anionic compound is part of a nanoparticle complex comprising aluminum and a nucleotide.
[0173] Methods of Producing Nanosized Adjuvants
[0174] The nanoparticles provided herein can be synthesized using any of the numerous methods known within the art (See e.g., Nam et al. Nanoparticles: synthesis and applications. Materials for Biomedical Engineering. 2019:211-40). In some embodiments, the nanoparticles provided herein are produced using a microfluidic device. As used herein, a “microfluidic device” refers to a device with at least one channel having micron-scale dimensions ( / .e., a dimension less than 1 mm) for processing ( / .e., flowing, mixing, etc.) a fluid sample. In some embodiments, the microfluidic device is a passive device that contains no moving parts and has no requirement for energy input other than the pressure used to drive fluid flow through the device. In some embodiments, the microfluidic device comprises an interaction chamber, wherein compounds within a composition collide to form nanoparticles. A key advantage of using a microfluidic device is that the method of producing the nanoparticles can be easily scaled to industrial volumes.
[0175] In one aspect, the nanoparticles provided herein are produced using microfluidization. Microfluidization can be performed in a microfluidic device wherein fluids are forced to pass through microchannels under high-pressure (for example, between 500 and 30,000 psi) (See Kumar et al. Prev Nutr Food Sci. 2019 Sep;24(3):225-234). The microfluidization process also involves the collision of various compounds in a fluid composition within an interaction chamber. In the interaction chamber, compounds within the fluid collide at high velocity to form stable particles at nanoscale.
[0176] In one aspect, the nanoparticles provided herein are produced by between about 1 and about 40 passes through a microfluidic device. In some embodiments, the nanoparticles provided herein are produced by between about 2 and about 30 passes through a microfluidic device. For example, in some embodiments, the nanoparticles provided herein are produced by about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, or about 25 passes through a microfluidic device.
[0177] In one aspect, the nanoparticles provided herein are downsized by passing through a microfluidic device to an average size between about 0.1 nanometer (nm) and about 1 pM in diameter. In other embodiments, the nanoparticles provided herein are downsized by passing through a microfluidic device to an average size between about 1 nanometer (nm) and about 1 pM in diameter. In some embodiments, the nanoparticles provided herein are downsized by passing through a microfluidic device to an average size of about 1 nm, about 50 nm, about 100 nm, about 150 nm, about 200 nm, about 250 nm, about 300 nm, about 350 nm, about 400 nm, about 450 nm, about 500 nm, about 550 nm, about 600 nm, about 650 nm, about 700 nm, about 750 nm, about 800 nm, about 850 nm, about 900 nm, about 950 nm, or about 1000 nm in diameter.
[0178] In particular embodiments, the nanoparticles provided herein are downsized by passing through a microfluidic device to an average size of less than about 100 nm in diameter. In some embodiments, the nanoparticles provided herein are downsized by passing through a microfluidic device to an average size between about 0.1 nm and about 100 nm in diameter. In other embodiments, the nanoparticles provided herein are downsized by passing through a microfluidic device to an average size between about 1 nm and about 100 nm in diameter. In some embodiments, the nanoparticles provided herein are downsized by passing through a microfluidic device to an average size of about 1 nm, about 5 nm, about 10 nm, about 15 nm, about 20 nm, about 25 nm, about 30 nm, about 35 nm, about 40 nm, about 45 nm, about 50 nm, about 55 nm, about 60 nm, about 65 nm, about 70 nm, about 75 nm, about 80 nm, about 85 nm, about 90 nm, about 95 nm, or about 100 nm in diameter.
[0179] In particular embodiments, the nanoparticles provided herein are downsized by passing through a microfluidic device to an average size between about 80 nm and about 90 nm in diameter. In some embodiments, the nanoparticles provided herein are downsized by passing through a microfluidic device to an average size of about 80 nm, about 81 nm, about 82 nm, about 83 nm, about 84 nm, about 85 nm, about 86 nm, about 87 nm, about 88 nm, about 89 nm, or about 90 nm in diameter.
[0180] Microfluidic devices are commercially available, those skilled in the art will appreciate the specifications required in order to produce the nanoparticles disclosed herein based on the desired nanoparticle size and production scale. In one aspect, the nanoparticles disclosed herein are produced using a low-volume microfluidic device. For example, in one embodiment, the nanoparticles disclosed herein are produced using a low-volume microfluidic device having a minimum sample size of about 250 pl, about 500 pl, about 750 pl, about 1000 pl, or less.
[0181] In some embodiments, the nanoparticles disclosed herein are produced using a high- volume microfluidic device. For example, in one embodiment, the nanoparticles disclosed herein are produced using a high-volume microfluidic device having a minimum sample size of about 10 ml, about 20 ml, about 30 ml, about 40 ml, about 50 ml, or more.
[0182] In another embodiment, the nanoparticles disclosed herein are produced using a microfluidic device that is a microfluidizer. Those skilled in the art will appreciate the specifications required in order to produce the nanoparticles disclosed herein based on the desired nanoparticle size and production scale. Exemplary microfluidizers that are commercially available include the LV1 Microfluidizer® Homogenizer (Microfluidics™) and the LM10 Microfluidizer® Processor (Microfluidics™). In one aspect, the nanoparticles disclosed herein are produced using a low volume microfluidizer. For example, in one embodiment, the nanoparticles disclosed herein are produced using a low-volume microfluidizer having a minimum sample size of about 250 pl, about 500 pl, about 750 pl, about 1000 pl, or less. In some embodiments, the nanoparticles disclosed herein are produced using a high-volume microfluidizer. For example, in one embodiment, the nanoparticles disclosed herein are produced using a high-volume microfluidizer having a minimum sample size of about 10 ml, about 20 ml, about 30 ml, about 40 ml, about 50 ml, or more.
[0183] In one aspect, the nanoparticles disclosed herein are produced using a microfluidizer with a pound per square inch (PSI) pressure between about 500 PSI and about 50,000. For example, in some embodiments, the nanoparticles disclosed herein are produced using a microfluidizer with PSI pressure of about 500 PSI, about 1,000 PSI, about 5,000 PSI, about 10,000 PSI, about 15,000 PSI, about 20,000 PSI, about 25,000 PSI, about 30,000 PSI, about 35,000 PSI, about 40,000 PSI, about 45,000 PSI, or about 50,000 PSI. In a particular embodiment, the nanoparticles disclosed herein are produced using a microfluidizer with a pressure of about 500 PSI. In another particular embodiment, the nanoparticles disclosed herein are produced using a microfluidizer with a pressure of about 30,000 PSI.
[0184] In one aspect, the nanoparticles provided herein are produced by microfluidization. For example, in some embodiments, the nanoparticles provided herein are produced by downsizing particles in a starting sample with a microfluidizer. In some embodiments, a micrometer sized adjuvant is downsized into a nanometer sized adjuvant using a microfluidizer. In a particular embodiment, micrometer sized aluminum is downsized into nanometer sized aluminum by microfluidization. In another embodiment, a micrometer sized nucleotide is downsized into nanometer sized nucleotide by microfluidization. In another embodiment, a micrometer sized CpG ODN is downsized into nanometer sized CpG ODN by microfluidization. In another embodiment, micrometer sized CpG 24555 is downsized into nanometer sized CpG 24555 by microfluidization.
[0185] In other embodiments, the nanoparticles disclosed herein are produced using high pressure homogenization. For example, in some embodiments, the nanoparticles provided herein are produced by downsizing particles in a starting sample with a high pressure homogenizer. In some embodiments, the nanoparticles disclosed herein are produced using high-pressure valve homogenization (HPVH). In some embodiments, a micrometer sized adjuvant is downsized into a nanometer sized adjuvant using a high pressure homogenizer.
[0186] In other embodiments, the nanoparticles disclosed herein are produced using extrusion. For example, in some embodiments, the nanoparticles provided herein are produced by downsizing particles in a starting sample with an extruder. In some embodiments, a micrometer sized adjuvant is downsized into a nanometer sized adjuvant using extrusion.
[0187] In other embodiments, the nanoparticles disclosed herein are produced by milling. For example, in some embodiments, the nanoparticles provided herein are produced by downsizing particles in a starting sample with a ball mill. In some embodiments, a micrometer sized adjuvant is downsized into a nanometer sized adjuvant using milling.
[0188] In one aspect, the nanoparticles provided herein are produced using sonication. For example, in some embodiments, the nanoparticles provided herein are produced by downsizing particles in a starting sample with a sonic dismembrator. In some embodiments, a micrometer sized adjuvant is downsized into a nanometer sized adjuvant using a sonic dismembrator. In a particular embodiment, micrometer sized aluminum is downsized into nanometer sized aluminum by sonication.
[0189] In another aspect, the nanoparticles provided herein are produced by a chemical method. Numerous chemical methods of forming nanoparticles are well known in the art, for example chemical reduction (See Nam et al. Materials for Biomedical Engineering. 2019:211- 40). In some embodiments, the nanoparticles provided herein are produced by downsizing particles in a starting sample by chemical reduction. In some embodiments, a micrometer sized adjuvant is downsized into a nanometer sized adjuvant using chemical reduction.
[0190] In another aspect, the nanoparticles provided herein are produced by coprecipitation. Numerous coprecipitation methods of forming nanoparticles are well known in the art (See Id.). In some embodiments, the nanoparticles provided herein are produced by downsizing particles in a starting sample by coprecipitation. In some embodiments, a micrometer sized adjuvant is downsized into a nanometer sized adjuvant by coprecipitation.
[0191] In another aspect, the nanoparticles provided herein are produced by microemulsion. Numerous microemulsion methods of forming nanoparticles are well known in the art (See Id.). In some embodiments, the nanoparticles provided herein are produced by downsizing particles in a starting sample by microemulsion. In some embodiments, a micrometer sized adjuvant is downsized into a nanometer sized adjuvant by microemulsion.
[0192] In some embodiments, nanoparticles comprising aluminum are provided herein. In some embodiments, nanoparticles comprising aluminum are produced using a composition comprising aluminum hydroxide (AI(OH)3). In some embodiments, nanoparticles comprising aluminum are produced using a composition comprising aluminum phosphate. In other embodiments, nanoparticles comprising aluminum are produced using a composition comprising aluminum oxyhydroxide, aluminum hydroxyphosphate, aluminum hydroxyphosphate sulfate, potassium aluminum sulfate, or aluminum monostearate.
[0193] In some embodiments, nanoparticles comprising aluminum are produced using a gel suspension comprising aluminum. In some embodiments, nanoparticles comprising aluminum are produced using a gel suspension comprising aluminum hydroxide. In some embodiments, nanoparticles comprising aluminum are produced using Alhydrogel® (Croda®), a gel suspension comprising aluminum hydroxide.
[0194] In some embodiments, nanoparticles comprising aluminum are produced using Alhydrogel® (Croda®) with a stock concentration between about 1 mg / mL and about 100 mg / mL. In other embodiments, nanoparticles comprising aluminum are produced using Alhydrogel® (Croda®) with a stock concentration between about 1 mg / mL and about 20 mg / mL. In some embodiments, nanoparticles comprising aluminum are produced using Alhydrogel® (Croda®) with a stock concentration of about 1 mg / mL, about 2 mg / mL, about 3 mg / mL, about 4 mg / mL, about 5 mg / mL, about 6 mg / mL, about 7 mg / mL, about 8 mg / mL, about 9 mg / mL, about 10 mg / mL, about 11 mg / mL, about 12 mg / mL, about 13 mg / mL, about 14 mg / mL, or about 15 mg / mL. In a particular embodiment, nanoparticles comprising aluminum are produced using Alhydrogel® (Croda®) with a stock concentration of about 10 mg / mL.
[0195] In another aspect, an adjuvant molecule is combined with 1 , 2, 3, or more different adjuvant molecules using a microfluidic device to form a nanoparticle that comprises 2, 3, 4, or more types of adjuvant molecules. In another embodiment, aluminum is combined with 1 other type of adjuvant molecule using a microfluidic device to form a nanoparticle that comprises aluminum and 1 other type of adjuvant molecule. In another embodiment, aluminum is combined with a nucleotide using a microfluidic device to form a nanoparticle that comprises aluminum and a nucleotide. In another embodiment, aluminum is combined with CpG ODN using a microfluidic device to form a nanoparticle that comprises aluminum and CpG ODN. In another embodiment, aluminum is combined with CpG 24555 using a microfluidic device to form a nanoparticle that comprises aluminum and CpG 24555.
[0196] In another aspect, a nanoparticle adjuvant is combined with 1 , 2, 3, or more adjuvants using chemical conjugation. In a further aspect, a nanoparticle adjuvant is combined with an antigen using chemical conjugation. Numerous methods of chemical conjugation are known in the art, for example azide-alkyne cycloaddition, carbodiimide chemistry, N-hydroxysuccinimide (NHS) chemistry, glutaraldehyde chemistry, maleimide-thiol chemistry, thiol-disulfide exchange, tresyl chloride activation, and isothiocyanate chemistry (See e.g., Lu L, et al. Chemical Conjugation Strategies for the Development of Protein-Based Subunit Nanovaccines. Vaccines (Basel) 2021 May 28;9(6):563). Those skilled in the art will appreciate which chemical conjugation methods are applicable given the starting substrates.
[0197] Compositions Comprising Nanoparticles
[0198] In one aspect, disclosed herein is a composition comprising a nanosized adjuvant. In another aspect, disclosed herein is a composition comprising 1 , 2, 3, 4, or more different nanosized adjuvants. In further embodiments, disclosed herein is a composition comprising 1 , 2, 3, 4, or more nanosized adjuvants and 1 , 2, 3, 4, or more adjuvants that are not nanosized.
[0199] In one embodiment, disclosed herein is a composition comprising a nanosized aluminum adjuvant. In another aspect, disclosed herein is a composition comprising a nanosized aluminum adjuvant and 1 , 2, 3, 4, or more different types of nanosized adjuvants. In further embodiments, disclosed herein is a composition a nanosized aluminum adjuvant and 1 , 2, 3, 4, or more adjuvants that are not nanosized.
[0200] In a further embodiment, disclosed herein is a composition comprising a nanosized nucleotide adjuvant. In another aspect, disclosed herein is a composition comprising a nanosized nucleotide adjuvant and 1 , 2, 3, 4, or more different types of nanosized adjuvants. In further embodiments, disclosed herein is a composition a nanosized nucleotide adjuvant and 1 , 2, 3, 4, or more adjuvants that are not nanosized.
[0201] In a further embodiment, disclosed herein is a composition comprising a nanosized CpG ODN adjuvant. In another aspect, disclosed herein is a composition comprising a nanosized CpG ODN adjuvant and 1 , 2, 3, 4, or more different types of nanosized adjuvants. In further embodiments, disclosed herein is a composition a nanosized CpG ODN adjuvant and 1, 2, 3, 4, or more adjuvants that are not nanosized.
[0202] In a further embodiment, disclosed herein is a composition comprising a nanosized CpG 24555 adjuvant. In another aspect, disclosed herein is a composition comprising a nanosized CpG 24555 adjuvant and 1, 2, 3, 4, or more different types of nanosized adjuvants. In further embodiments, disclosed herein is a composition a nanosized CpG 24555 adjuvant and 1, 2, 3, 4, or more adjuvants that are not nanosized.
[0203] In a particular embodiment, disclosed herein is a composition comprising a nanosized adjuvant comprising aluminum and a nucleotide. In a further particular embodiment, disclosed herein is a composition comprising a nanosized adjuvant comprising aluminum and CpG ODN. In a further particular embodiment, disclosed herein is a composition comprising a nanosized adjuvant comprising aluminum and CpG 24555.
[0204] In one aspect, provided herein is a composition comprising nanoparticles, wherein the composition comprising the nanoparticles is obtained by combining a nucleotide and aluminum, wherein the ratio of nucleotide to aluminum by mass (pg) is between about 0.5:1 and about 3:1. For example, in some embodiments, the composition comprising the nanoparticles is obtained by combining a nucleotide and aluminum, wherein the ratio of nucleotide to aluminum by mass (pg) is about 0.5:1 , about 0.6:1, about 0.7:1 , about 0.8:1, about 0.9:1 , about 1 :1, about 1.1 :1, about 1.2:1, about 1.3:1 , about 1.4:1, about 1.5:1 , about 1.6:1, about 1.7:1 , about 1.8:1, about 1.9:1 , about 2:1 , about 2.1:1, about 2.2:1 , about 2.3:1, about 2.4:1 , about 2.5:1, about 2.6:1 , about 2.7:1, about 2.8:1, about 2.9:1 , or about 3:1. In a particular embodiment, the composition comprising the nanoparticles is obtained by combining a nucleotide and aluminum, wherein the ratio of nucleotide to aluminum by mass (pg) is about 2.4:1.
[0205] In one aspect, provided herein is a composition comprising nanoparticles, wherein the composition comprising the nanoparticles is obtained by combining a nucleotide and aluminum hydroxide, wherein the ratio of nucleotide to aluminum hydroxide by mass (pg) is between about 0.5:1 and about 3:1. For example, in some embodiments, the composition comprising the nanoparticles is obtained by combining a nucleotide and aluminum hydroxide, wherein the ratio of nucleotide to aluminum hydroxide by mass (pg) is about 0.5:1, about 0.6:1 , about 0.7:1, about 0.8:1, about 0.9:1, about 1 :1 , about 1.1:1, about 1.2:1 , about 1.3:1, about 1.4:1 , about 1.5:1 , about 1.6:1, about 1.7:1 , about 1.8:1, about 1.9:1 , about 2:1 , about 2.1:1, about 2.2:1 , about 2.3:1, about 2.4:1, about 2.5:1 , about 2.6:1, about 2.7:1 , about 2.8:1, about 2.9:1 , or about 3:1. In a particular embodiment, the composition comprising the nanoparticles is obtained by combining a nucleotide and aluminum hydroxide, wherein the ratio of nucleotide to aluminum by mass (pg) is about 2.4:1.
[0206] In one aspect, provided herein is a composition comprising nanoparticles, wherein the composition comprising the nanoparticles is obtained by combining CpG ODN and aluminum hydroxide, wherein the ratio of CpG ODN to aluminum hydroxide by mass (pg) is between about 0.5:1 and about 3:1. For example, in some embodiments, the composition comprising the nanoparticles is obtained by combining CpG ODN and aluminum hydroxide, wherein the ratio of CpG ODN to aluminum hydroxide by mass (pg) is about 0.5:1 , about 0.6:1, about 0.7:1 , about 0.8:1 , about 0.9:1, about 1:1, about 1.1 :1 , about 1.2:1, about 1.3:1 , about 1.4:1, about 1.5:1 , about 1.6:1, about 1.7:1, about 1.8:1 , about 1.9:1, about 2:1 , about 2.1:1, about 2.2:1 , about 2.3:1 , about 2.4:1, about 2.5:1 , about 2.6:1, about 2.7:1 , about 2.8:1, about 2.9:1, or about 3:1. In a particular embodiment, the composition comprising the nanoparticles is obtained by combining CpG ODN and aluminum hydroxide, wherein the ratio of CpG ODN to aluminum by mass (pg) is about 2.4:1.
[0207] In one aspect, provided herein is a composition comprising nanoparticles, wherein the composition comprising the nanoparticles is obtained by combining CpG 24555 and aluminum hydroxide, wherein the ratio of CpG 24555 to aluminum hydroxide by mass (pg) is between about 0.5:1 and about 3:1. For example, in some embodiments, the composition comprising the nanoparticles is obtained by combining CpG 24555 and aluminum hydroxide, wherein the ratio of CpG 24555 to aluminum hydroxide by mass (pg) is about 0.5:1, about 0.6:1 , about 0.7:1, about 0.8:1, about 0.9:1, about 1 :1 , about 1.1:1, about 1.2:1 , about 1.3:1, about 1.4:1 , about 1.5:1 , about 1.6:1, about 1.7:1 , about 1.8:1, about 1.9:1 , about 2:1 , about 2.1:1, about 2.2:1 , about 2.3:1, about 2.4:1, about 2.5:1 , about 2.6:1, about 2.7:1 , about 2.8:1, about 2.9:1 , or about 3:1. In a particular embodiment, the composition comprising the nanoparticles is obtained by combining CpG 24555 and aluminum hydroxide, wherein the ratio of CpG 24555 to aluminum by mass (pg) is about 2.4:1.
[0208] In another embodiment, provided herein is a composition comprising nanoparticles, wherein the composition comprising the nanoparticles is obtained by combining nucleotides, aluminum, and an anionic compound, wherein the ratio of nucleotides to aluminum by mass (pg) is between about 1:0.5 and about 1:2. For example, in some embodiments, the composition comprising the nanoparticles is obtained by combining nucleotides, aluminum, and an anionic compound, wherein the ratio of nucleotides to aluminum by mass (pg) is about 1:0.5, about 1 :0.6, about 1:0.7, about 1 :0.8, about 1:0.9, about 1:1 , about 1:1.1 , about 1 :1.2, about 1:1.3, about 1 :1.4, about 1:1.5, about 1 :1.6, about 1:1.7, about 1 :1.8, about 1:1.9, or about 1 :2. In a particular embodiment, the composition comprising the nanoparticles is obtained by combining nucleotides, aluminum, and an anionic compound, wherein the ratio of nucleotides to aluminum by mass (pg) is about 1:1.5.
[0209] In another embodiment, provided herein is a composition comprising nanoparticles, wherein the composition comprising the nanoparticles is obtained by combining nucleotides, aluminum, and polyacrylic acid (PAA), wherein the ratio of nucleotides to aluminum by mass (pg) is between about 1:0.5 and about 1 :2. For example, in some embodiments, the composition comprising the nanoparticles is obtained by combining nucleotides, aluminum, and PAA, wherein the ratio of nucleotides to aluminum by mass (pg) is about 1:0.5, about 1 :0.6, about 1 :0.7, about 1:0.8, about 1:0.9, about 1 :1, about 1:1.1 , about 1 :1.2, about 1:1.3, about 1:1.4, about 1 :1.5, about 1:1.6, about 1 :1.7, about 1:1.8, about 1:1.9, or about 1 :2. In a particular embodiment, the composition comprising the nanoparticles is obtained by combining nucleotides, aluminum, and PAA, wherein the ratio of nucleotides to aluminum by mass (pg) is about 1 :1.5.
[0210] In another embodiment, provided herein is a composition comprising nanoparticles, wherein the composition comprising the nanoparticles is obtained by combining nucleotides, aluminum hydroxide, and an anionic compound, wherein the ratio of nucleotides to the anionic compound by mass (pg) is between about 1:0.25 and about 1:1.5. For example, in some embodiments, the composition comprising the nanoparticles is obtained by combining nucleotides, aluminum hydroxide, and an anionic compound, wherein the ratio of nucleotides to aluminum hydroxide by mass (pg) is about 1:0.5, about 1 :0.6, about 1:0.7, about 1 :0.8, about 1:0.9, about 1 :1 , about 1:1.1, about 1 :1.2, about 1:1.3, about 1 :1.4, about 1:1.5, about 1 :1.6, about 1 :1.7, about 1:1.8, about 1 :1.9, or about 1:2. In a particular embodiment, the composition comprising the nanoparticles is obtained by combining nucleotides, aluminum hydroxide, and an anionic compound, wherein the ratio of nucleotides to aluminum hydroxide by mass (pg) is about 1 :1.5.
[0211] In another embodiment, provided herein is a composition comprising nanoparticles, wherein the composition comprising the nanoparticles is obtained by combining nucleotides, aluminum hydroxide, and polyacrylic acid (PAA), wherein the ratio of nucleotides to aluminum hydroxide by mass (pg) is between about 1 :0.5 and about 1 :2. For example, in some embodiments, the composition comprising the nanoparticles is obtained by combining nucleotides, aluminum hydroxide, and PAA, wherein the ratio of nucleotides to aluminum hydroxide by mass (pg) is about 1:0.5, about 1 :0.6, about 1:0.7, about 1:0.8, about 1 :0.9, about 1:1, about 1 :1.1 , about 1:1.2, about 1 :1.3, about 1:1.4, about 1 :1.5, about 1:1.6, about 1 :1.7, about 1 :1.8, about 1:1.9, or about 1 :2. In a particular embodiment, the composition comprising the nanoparticles is obtained by combining nucleotides, aluminum hydroxide, and PAA, wherein the ratio of nucleotides to aluminum hydroxide by mass (pg) is about 1 :1.5.
[0212] In another embodiment, provided herein is a composition comprising nanoparticles, wherein the composition comprising the nanoparticles is obtained by combining CpG ODN, aluminum hydroxide, and polyacrylic acid (PAA), wherein the ratio of CpG ODN to aluminum hydroxide by mass (pg) is between about 1 :0.5 and about 1 :2. For example, in some embodiments, the composition comprising the nanoparticles is obtained by combining CpG ODN, aluminum hydroxide, and PAA, wherein the ratio of CpG ODN to aluminum hydroxide by mass (pg) is about 1 :0.5, about 1:0.6, about 1 :0.7, about 1:0.8, about 1:0.9, about 1 :1, about 1:1.1 , about 1 :1.2, about 1:1.3, about 1 :1.4, about 1:1.5, about 1:1.6, about 1 :1.7, about 1:1.8, about 1 :1.9, or about 1:2. In a particular embodiment, the composition comprising the nanoparticles is obtained by combining CpG ODN, aluminum hydroxide, and PAA, wherein the ratio of CpG ODN to aluminum hydroxide by mass (pg) is about 1:1.5.
[0213] In another embodiment, provided herein is a composition comprising nanoparticles, wherein the composition comprising the nanoparticles is obtained by combining CpG 24555, aluminum hydroxide, and polyacrylic acid (PAA), wherein the ratio of CpG 24555 to aluminum hydroxide by mass (pg) is between about 1 :0.5 and about 1 :2. For example, in some embodiments, the composition comprising the nanoparticles is obtained by combining CpG 24555, aluminum hydroxide, and PAA, wherein the ratio of CpG 24555 to aluminum hydroxide by mass (pg) is about 1 :0.5, about 1:0.6, about 1 :0.7, about 1:0.8, about 1 :0.9, about 1:1, about 1:1.1 , about 1 :1.2, about 1:1.3, about 1 :1.4, about 1:1.5, about 1:1.6, about 1 :1.7, about 1:1.8, about 1 :1.9, or about 1:2. In a particular embodiment, the composition comprising the nanoparticles is obtained by combining CpG 24555, aluminum hydroxide, and PAA, wherein the ratio of CpG 24555 to aluminum hydroxide by mass (pg) is about 1 :1.5.
[0214] In another embodiment, provided herein is a composition comprising nanoparticles, wherein the composition comprising the nanoparticles is obtained by combining nucleotides, aluminum, and an anionic compound, wherein the ratio of nucleotides to the anionic compound by mass (pg) is between about 1:0.5 and about 1:2. For example, in some embodiments, the composition comprising the nanoparticles is obtained by combining nucleotides, aluminum, and an anionic compound, wherein the ratio of nucleotides to the anionic compound by mass (pg) is about 1 :0.5, about 1:0.75, about 1:1, about 1:1.25, about 1:1.5, about 1 :1.75, or about 1 :2. In a particular embodiment, the composition comprising the nanoparticles is obtained by combining nucleotides, aluminum, and an anionic compound, wherein the ratio of nucleotides to the anionic compound by mass (pg) is about 1:0.75.
[0215] In another embodiment, provided herein is a composition comprising nanoparticles, wherein the composition comprising the nanoparticles is obtained by combining nucleotides, aluminum, and PAA, wherein the ratio of nucleotides to PAA by mass (pg) is between about 1:0.5 and about 1:2. For example, in some embodiments, the composition comprising the nanoparticles is obtained by combining nucleotides, aluminum, and PAA, wherein the ratio of nucleotides to PAA by mass (pg) is about 1:0.5, about 1 :0.75, about 1 :1 , about 1 :1.25, about 1:1.5, about 1 :1.75, or about 1:2. In a particular embodiment, the composition comprising the nanoparticles is obtained by combining nucleotides, aluminum, and PAA, wherein the ratio of nucleotides to PAA by mass (pg) is about 1:0.75.
[0216] In another embodiment, provided herein is a composition comprising nanoparticles, wherein the composition comprising the nanoparticles is obtained by combining nucleotides, aluminum hydroxide, and PAA, wherein the ratio of nucleotides to PAA by mass (pg) is between about 1 :0.5 and about 1:2. For example, in some embodiments, the composition comprising the nanoparticles is obtained by combining nucleotides, aluminum hydroxide, and PAA, wherein the ratio of nucleotides to PAA by mass (pg) is about 1:0.5, about 1:0.75, about 1:1 , about 1 :1.25, about 1 :1.5, about 1:1.75, or about 1:2. In a particular embodiment, the composition comprising the nanoparticles is obtained by combining nucleotides, aluminum hydroxide, and PAA, wherein the ratio of nucleotides to PAA by mass (pg) is about 1:0.75.
[0217] In another embodiment, provided herein is a composition comprising nanoparticles, wherein the composition comprising the nanoparticles is obtained by combining CpG ODN, aluminum hydroxide, and PAA, wherein the ratio of CpG ODN to PAA by mass (pg) is between about 1 :0.5 and about 1:2. For example, in some embodiments, the composition comprising the nanoparticles is obtained by combining CpG ODN, aluminum hydroxide, and PAA, wherein the ratio of CpG ODN to PAA by mass (pg) is about 1:0.5, about 1 :0.75, about 1 :1 , about 1 :1.25, about 1 :1.5, about 1:1.75, or about 1:2. In a particular embodiment, the composition comprising the nanoparticles is obtained by combining CpG ODN, aluminum hydroxide, and PAA, wherein the ratio of CpG ODN to PAA by mass (pg) is about 1:0.75.
[0218] In another embodiment, provided herein is a composition comprising nanoparticles, wherein the composition comprising the nanoparticles is obtained by combining CpG 24555, aluminum hydroxide, and PAA, wherein the ratio of CpG 24555 to PAA by mass (pg) is between about 1:0.5 and about 1:2. For example, in some embodiments, the composition comprising the nanoparticles is obtained by combining CpG 24555, aluminum hydroxide, and PAA, wherein the ratio of nucleotides to PAA by mass (pg) is about 1:0.5, about 1 :0.75, about 1:1, about 1 :1.25, about 1:1.5, about 1 :1.75, or about 1:2. In a particular embodiment, the composition comprising the nanoparticles is obtained by combining CpG 24555, aluminum hydroxide, and PAA, wherein the ratio of CpG 24555 to PAA by mass (pg) is about 1 :0.75.
[0219] The compositions comprising the nanoparticles may further comprise a buffer. Exemplary buffers include phosphate (such as potassium phosphate, sodium phosphate); acetate (such as sodium acetate); succinate (such as sodium succinate); glycine; histidine; carbonate, Tris (tris(hydroxymethyl)aminomethane), and / or bicarbonate (such as ammonium bicarbonate) buffers.
[0220] In one embodiment, the compositions comprising the nanoparticles further comprises a histidine buffer. In some embodiments, the composition comprising the nanoparticles further comprises a histidine buffer at a concentration of about 1 mM, about 2 mM, about 3 mM, about 4 mM, about 5 mM, about 6 mM, about 7 mM, about 8 mM, about 9 mM, about 10 mM, about 11 mM, about 12 mM, about 13 mM, about 14 mM, about 15 mM, about 16 mM, about 17 mM, about 18 mM, about 19 mM, about 20 mM, about 50 mM, or about 100 mM histidine. In an exemplary embodiment, the compositions comprising the nanoparticles further comprises a histidine buffer at a concentration of about 10 mM histidine. In some embodiments, the composition comprising the nanoparticles further comprises a histidine buffer at a pH between about 5 and about 8. In other embodiments, the composition comprising the nanoparticles further comprises a histidine buffer at a pH of about 6.0, about 6.1 , about 6.2, about 6.3, about 6.4, about 6.5, about 6.6, about 6.7, about 6.8, about 6.9, or about 7.0. In still other embodiments, the composition comprising the nanoparticles further comprises a histidine buffer at a concentration of between about 5 mM and about 20 mM histidine and a pH of about 6.0, about 6.1 , about 6.2, about 6.3, about 6.4, about 6.5, about 6.6, about 6.7, about 6.8, about 6.9, or about 7.0. In further embodiments, the composition comprising the nanoparticles further comprises a histidine buffer at a concentration of about 10 mM histidine and a pH of about 6.0, about 6.1 , about 6.2, about 6.3, about 6.4, about 6.5, about 6.6, about 6.7, about 6.8, about 6.9, or about 7.0.
[0221] In an exemplary embodiment, the composition comprising the nanoparticles further comprises a histidine buffer at a concentration of about 10 mM histidine and a pH of about 6.5. In some embodiments, the composition comprises aluminum nanoparticles and further comprises a histidine buffer at a concentration of about 10 mM histidine and a pH of about 6.5. In some embodiments, the composition comprises nanoparticles comprising aluminum and PAA, and further comprises a histidine buffer at a concentration of about 10 mM histidine and a pH of about 6.5. In some embodiments, the composition comprises nanoparticles comprising aluminum and a nucleotide, and further comprises a histidine buffer at a concentration of about 10 mM histidine and a pH of about 6.5. In some embodiments, the composition comprises nanoparticles comprising aluminum and CpG ODNs, and further comprises a histidine buffer at a concentration of about 10 mM histidine and a pH of about 6.5. In some embodiments, the composition comprises nanoparticles comprising aluminum and CpG 24555, and further comprises a histidine buffer at a concentration of about 10 mM histidine and a pH of about 6.5. In some embodiments, the composition comprises nanoparticles comprising aluminum, nucleotides, and PAA and further comprises a Tris buffer at a concentration of about 10 mM histidine and a pH of about 6.5. In some embodiments, the composition comprises nanoparticles comprising aluminum, CpG ODNs, and PAA and further comprises a Tris buffer at a concentration of about 10 mM histidine and a pH of about 6.5. In some embodiments, the composition comprises nanoparticles comprising aluminum, CpG 24555, and PAA and further comprises a Tris buffer at a concentration of about 10 mM histidine and a pH of about 6.5.
[0222] In one embodiment, the compositions comprising the nanoparticles further comprises a Tris buffer. In some embodiments, the composition comprising the nanoparticles further comprises a Tris buffer at a concentration of about 1 mM, about 2 mM, about 3 mM, about 4 mM, about 5 mM, about 6 mM, about 7 mM, about 8 mM, about 9 mM, about 10 mM, about 11 mM, about 12 mM, about 13 mM, about 14 mM, about 15 mM, about 16 mM, about 17 mM, about 18 mM, about 19 mM, about 20 mM, about 50 mM, or about 100 mM Tris. In an exemplary embodiment, the compositions comprising the nanoparticles further comprises a Tris buffer at a concentration of about 10 mM Tris. In some embodiments, the composition comprising the nanoparticles further comprises a Tris buffer at a pH between about 6 and about 9. In other embodiments, the composition comprising the nanoparticles further comprises a Tris buffer at a pH of about 7.0, about 7.1, about 7.2, about 7.3, about 7.4, about 7.5, about 7.6, about 7.7, about 7.8, about 7.9, or about 8.0. In still other embodiments, the composition comprising the nanoparticles further comprises a Tris buffer at a concentration of between about 5 mM and about 20 mM T ris and a pH of about 7.0, about 7.1 , about 7.2, about 7.3, about 7.4, about 7.5, about 7.6, about 7.7, about 7.8, about 7.9, or about 8.0. In further embodiments, the composition comprising the nanoparticles further comprises a Tris buffer at a concentration of about 10 mM Tris and a pH of about 7.0, about 7.1, about 7.2, about 7.3, about
[0223] 7.4, about 7.5, about 7.6, about 7.7, about 7.8, about 7.9, or about 8.0.
[0224] In an exemplary embodiment, the composition comprising the nanoparticles further comprises a Tris buffer at a concentration of about 10 mM Tris and a pH of about 7.4. In some embodiments, the composition comprises aluminum nanoparticles and further comprises a Tris buffer at a concentration of about 10 mM Tris and a pH of about 7.4. In some embodiments, the composition comprises nanoparticles comprising aluminum and PAA, and further comprises a Tris buffer at a concentration of about 10 mM Tris and a pH of about 7.4. In some embodiments, the composition comprises nanoparticles comprising aluminum and a nucleotide, and further comprises a Tris buffer at a concentration of about 10 mM Tris and a pH of about
[0225] 7.4. In some embodiments, the composition comprises nanoparticles comprising aluminum and CpG ODNs, and further comprises a Tris buffer at a concentration of about 10 mM Tris and a pH of about 7.4. In some embodiments, the composition comprises nanoparticles comprising aluminum, CpG 24555, and further comprises a Tris buffer at a concentration of about 10 mM Tris and a pH of about 7.4. In some embodiments, the composition comprises nanoparticles comprising aluminum, nucleotides, and PAA and further comprises a Tris buffer at a concentration of about 10 mM Tris and a pH of about 7.4. In some embodiments, the composition comprises nanoparticles comprising aluminum, CpG ODNs, and PAA and further comprises a Tris buffer at a concentration of about 10 mM Tris and a pH of about 7.4. In some embodiments, the composition comprises nanoparticles comprising aluminum, CpG 24555, and PAA and further comprises a Tris buffer at a concentration of about 10 mM Tris and a pH of about 7.4.
[0226] In some embodiments, the size of the nanoparticles is determined at time zero (TO), wherein TO is the time when the formulation of the composition comprising the nanoparticles is completed. In some embodiments, the PDI of the nanoparticles is determined at time zero (TO), wherein TO is the time when the formulation of the composition comprising the nanoparticles is completed. In some embodiments, the composition comprising the nanoparticles further comprises a buffer, wherein the nanoparticles are stable as determined by maintaining about the same average size (nm) over the course of a given time period. In some embodiments, the composition comprising the nanoparticles further comprises a buffer, wherein the nanoparticles maintain an average size (nm) that deviates by no more than about 5%, about 10%, about 15%, about 20%, about 25%, or about 30% of the value of their average size at time zero (TO) over the course of at least about 5 days, about 10 days, about 15 days, about 20 days, about 25 days, about 30 days, about 35 days, about 40 days, about 45 days, about 50 days, about 55 days, about 60 days, about 65 days, about 70 days, about 75 days, about 80 days, about 85 days, about 90 days, about 95 days, or about 100 days after TO. In some embodiments, the composition comprising the nanoparticles further comprises a buffer, wherein the nanoparticles maintain an average size (nm) that deviates by no more than about 5%, about 10%, about 15%, about 20%, about 25%, or about 30% of the value of their average size at time zero (TO) over the course of at least about 1 month, about 2 months, about 3 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, or about 12 months after TO. In a particular embodiment, the composition comprising the nanoparticles further comprises a buffer, wherein the nanoparticles maintain an average size (nm) that deviates by no more than about 10% of the value of their average size at time zero (TO) for at least about 3 months after TO.
[0227] In some embodiments, the composition comprising the nanoparticles further comprises a Tris buffer, wherein the nanoparticles are stable as determined by maintaining about the same average size (nm) over the course of a given time period. In some embodiments, the composition comprising the nanoparticles further comprises a Tris buffer, wherein the nanoparticles maintain an average size (nm) that deviates by no more than about 5%, about 10%, about 15%, about 20%, about 25%, or about 30% of the value of their average size at time zero (TO) over the course of at least about 5 days, about 10 days, about 15 days, about 20 days, about 25 days, about 30 days, about 35 days, about 40 days, about 45 days, about 50 days, about 55 days, about 60 days, about 65 days, about 70 days, about 75 days, about 80 days, about 85 days, about 90 days, about 95 days, or about 100 days after TO. In some embodiments, the composition comprising the nanoparticles further comprises a Tris buffer, wherein the nanoparticles maintain an average size (nm) that deviates by no more than about 5%, about 10%, about 15%, about 20%, about 25%, or about 30% of the value of their average size at time zero (TO) over the course of at least about 1 month, about 2 months, about 3 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, or about 12 months after TO. In a particular embodiment, the composition comprising the nanoparticles further comprises a Tris buffer, wherein the nanoparticles maintain an average size (nm) that deviates by no more than about 10% of the value of their average size at time zero (TO) for at least about 3 months after TO.
[0228] In some embodiments, the composition comprising the nanoparticles further comprises a histidine buffer, wherein the nanoparticles are stable as determined by maintaining about the same average size (nm) over the course of a given time period. In some embodiments, the composition comprising the nanoparticles further comprises a histidine buffer, wherein the nanoparticles maintain an average size (nm) that deviates by no more than about 5%, about 10%, about 15%, about 20%, about 25%, or about 30% of the value of their average size at time zero (TO) over the course of at least about 5 days, about 10 days, about 15 days, about 20 days, about 25 days, about 30 days, about 35 days, about 40 days, about 45 days, about 50 days, about 55 days, about 60 days, about 65 days, about 70 days, about 75 days, about 80 days, about 85 days, about 90 days, about 95 days, or about 100 days after TO. In some embodiments, the composition comprising the nanoparticles further comprises a histidine buffer, wherein the nanoparticles maintain an average size (nm) that deviates by no more than about 5%, about 10%, about 15%, about 20%, about 25%, or about 30% of the value of their average size at time zero (TO) over the course of at least about 1 month, about 2 months, about 3 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, or about 12 months after TO. In a particular embodiment, the composition comprising the nanoparticles further comprises a histidine buffer, wherein the nanoparticles maintain an average size (nm) that deviates by no more than about 10% of the value of their average size at time zero (TO) for at least about 3 months after TO.
[0229] In some embodiments, the composition comprising the nanoparticles further comprises a buffer, wherein the nanoparticles are stable as determined by maintaining about the same PDI over the course of a given time period. In some embodiments, the composition comprising the nanoparticles further comprises a buffer, wherein the nanoparticles maintain a PDI that deviates by no more than about 5%, about 10%, about 15%, about 20%, about 25%, or about 30% of the value of their PDI at time zero (TO) over the course of at least about 5 days, about 10 days, about 15 days, about 20 days, about 25 days, about 30 days, about 35 days, about 40 days, about 45 days, about 50 days, about 55 days, about 60 days, about 65 days, about 70 days, about 75 days, about 80 days, about 85 days, about 90 days, about 95 days, or about
[0230] 100 days after TO. In some embodiments, the composition comprising the nanoparticles further comprises a buffer, wherein the nanoparticles maintain a PDI that deviates by no more than about 5%, about 10%, about 15%, about 20%, about 25%, or about 30% of the value of their PDI at time zero (TO) over the course of at least about 1 month, about 2 months, about 3 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, or about 12 months after TO. In a particular embodiment, the composition comprising the nanoparticles further comprises a buffer, wherein the nanoparticles maintain a PDI that deviates by no more than about 20% of the value of their PDI at time zero (TO) for at least about 3 months after TO.
[0231] In some embodiments, the composition comprising the nanoparticles further comprises a Tris buffer, wherein the nanoparticles are stable as determined by maintaining about the same PDI over the course of a given time period. In some embodiments, the composition comprising the nanoparticles further comprises a Tris buffer, wherein the nanoparticles maintain a PDI that deviates by no more than about 5%, about 10%, about 15%, about 20%, about 25%, or about 30% of the value of their PDI at time zero (TO) over the course of at least about 5 days, about 10 days, about 15 days, about 20 days, about 25 days, about 30 days, about 35 days, about 40 days, about 45 days, about 50 days, about 55 days, about 60 days, about 65 days, about 70 days, about 75 days, about 80 days, about 85 days, about 90 days, about 95 days, or about 100 days after TO. In some embodiments, the composition comprising the nanoparticles further comprises a Tris buffer, wherein the nanoparticles maintain a PDI that deviates by no more than about 5%, about 10%, about 15%, about 20%, about 25%, or about 30% of the value of their PDI at time zero (TO) over the course of at least about 1 month, about 2 months, about 3 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, or about 12 months after TO. In a particular embodiment, the composition comprising the nanoparticles further comprises a Tris buffer, wherein the nanoparticles maintain a PDI that deviates by no more than about 20% of the value of their PDI at time zero (TO) for at least about 3 months after TO.
[0232] In some embodiments, the composition comprising the nanoparticles further comprises a histidine buffer, wherein the nanoparticles are stable as determined by maintaining about the same PDI over the course of a given time period. In some embodiments, the composition comprising the nanoparticles further comprises a histidine buffer, wherein the nanoparticles maintain a PDI that deviates by no more than about 5%, about 10%, about 15%, about 20%, about 25%, or about 30% of the value of their PDI at time zero (TO) over the course of at least about 5 days, about 10 days, about 15 days, about 20 days, about 25 days, about 30 days, about 35 days, about 40 days, about 45 days, about 50 days, about 55 days, about 60 days, about 65 days, about 70 days, about 75 days, about 80 days, about 85 days, about 90 days, about 95 days, or about 100 days after TO. In some embodiments, the composition comprising the nanoparticles further comprises a histidine buffer, wherein the nanoparticles maintain a PDI that deviates by no more than about 5%, about 10%, about 15%, about 20%, about 25%, or about 30% of the value of their PDI at time zero (TO) over the course of at least about 1 month, about 2 months, about 3 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, or about 12 months after TO. In a particular embodiment, the composition comprising the nanoparticles further comprises a histidine buffer, wherein the nanoparticles maintain a PDI that deviates by no more than about 20% of the value of their PDI at time zero (TO) for at least about 3 months after TO.
[0233] In some embodiments, the compositions comprising the nanoparticles disclosed herein are sterilized. In one embodiment, the compositions comprising the nanoparticles disclosed herein are sterilized using a filter. A person skilled in the art will appreciate that numerous types of filters will be suitable for sterile filtering said compositions. For example, in one embodiment, the compositions comprising the nanoparticles are filter sterilized with a filter comprising polysulfone. In one embodiment, the compositions comprising the nanoparticles are filter sterilized with a filter comprising polyphenylene sulfone. In an embodiment, the compositions comprising the nanoparticles are filter sterilized with a filter comprising polyethersulfone (PES). In a particular embodiment, the compositions comprising the nanoparticles are filter sterilized with a filter comprising polyvinylidene difluoride (PVDF). In a particular embodiment, the compositions comprising the nanoparticles are filter sterilized with a filter comprising a PVDF monolayer membrane. In another particular embodiment, the compositions comprising the nanoparticles are filter sterilized with a filter comprising a PVDF bilayer membrane.
[0234] In another embodiment, the compositions comprising the nanoparticles disclosed herein are sterilized using a filter wherein the pore size is between about 0.1 pm and about 1 pm. In some embodiments, the compositions comprising the nanoparticles disclosed herein are sterilized using a filter wherein the pore size is between about 0.2 pm and about 0.3 pm. For example, in some embodiments, the compositions comprising the nanoparticles disclosed herein are sterilized using a filter wherein the pore size is about 0.2 pm, about 0.21 pm, about 0.22 pm, about 0.23 pm, about 0.24 pm, or about 0.25 pm. In an exemplary embodiment, the compositions comprising the nanoparticles are filter sterilized with a filter comprising PVDF wherein the pore size is about 0.22 pm. In other embodiments, the compositions comprising the nanoparticles are filter sterilized with a filter wherein the pore size is between about 0.4 pm and about 0.6 pm. For example, in some embodiments, the compositions comprising the nanoparticles are filter sterilized with a filter wherein the pore size is about 0.4 pm, about 0.41 pm, about 0.42 pm, about 0.43 pm, about 0.44 pm, about 0.45 pm, about 0.46 pm, about 0.47 pm, about 0.48 pm, about 0.49 pm, or about 0.50 pm. In an exemplary embodiment, the compositions comprising the nanoparticles are filter sterilized with a filter comprising PVDF wherein the pore size is about 0.45 pm. In another particular embodiment, the compositions comprising the nanoparticles are filter sterilized with a bilayer filter comprising two separate membranes with different pore sizes. In one embodiment, the compositions comprising the nanoparticles are filter sterilized with a bilayer filter comprising two separate membranes of different pore sizes wherein the membrane with a smaller pore size comprises a pore size of about 0.2 pm. In a particular embodiment, the compositions comprising the nanoparticles are filter sterilized with a bilayer filter wherein one membrane comprises a pore size of about 0.2 pm and one membrane comprises a pore size of about 0.45 pm. In another particular embodiment, the compositions comprising the nanoparticles are filter sterilized with a bilayer filter comprising PVDF wherein one membrane comprises a pore size of about 0.2 pm and one membrane comprises a pore size of about 0.45 pm.
[0235] In another aspect, the compositions comprising the nanoparticles disclosed herein are sterilized using a filter wherein the VmaxOf the composition through the filter is between about 50 L / m2(the maximum volume in liters (L) that can be filtered through 1 square meter (m) of filter area) and about 100 L / m2. In some embodiments, the compositions comprising the nanoparticles disclosed herein are sterilized using a filter wherein the VmaxOf the composition through the filter is between about 60 L / m2and about 80 L / m2. In some embodiments, the compositions comprising the nanoparticles disclosed herein are sterilized using a filter wherein the VmaxOf the composition through the filter is about 60 L / m2, about 61 L / m2, about 62 L / m2, about 63 L / m2, about 64 L / m2, about 65 L / m2, about 66 L / m2, about 67 L / m2, about 68 L / m2, about 69 L / m2, about 70 L / m2, about 71 L / m2, about 72 L / m2, about 73 L / m2, about 74 L / m2, or about 75 L / m2. In a particular embodiment, the compositions comprising the nanoparticles disclosed herein are sterilized using a monolayer PVDF filter wherein the VmaxOf the composition through the filter is between about 65 L / m2and about 66 L / m2. In a particular embodiment, the compositions comprising the nanoparticles disclosed herein are sterilized using a bilayer PVDF filter wherein the VmaxOf the composition through the filter is between about 71 L / m2and about 72 L / m2.
[0236] In another aspect, the compositions described herein are pharmaceutical compositions. A "pharmaceutical composition" refers to a mixture of one or more of the compounds of the disclosure, or a pharmaceutically acceptable salt, solvate or hydrate thereof as an active ingredient, and at least one pharmaceutically acceptable excipient.
[0237] The term ’excipient’ is used herein to describe any ingredient other than the compound(s) of the disclosure. The choice of excipient will to a large extent depend on factors such as the mode of administration, the effect of the excipient on solubility and stability, and the nature of the dosage form.
[0238] As used herein, "excipient” includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, carriers, diluents and the like that are physiologically compatible. Examples of excipients include one or more of water, saline, phosphate buffered saline, dextrose, glycerol, ethanol and the like, as well as combinations thereof, and may include isotonic agents, for example, sugars, sodium chloride, or polyalcohols such as mannitol, or sorbitol in the composition. Examples of excipients also include various organic solvents (such as hydrates and solvates). The pharmaceutical compositions may, if desired, contain additional excipients such as flavorings, binders / binding agents, lubricating agents, disintegrants, sweetening or flavoring agents, coloring matters or dyes, and the like. For example, for oral administration, tablets containing various excipients, such as citric acid may be employed together with various disintegrants such as starch, alginic acid and certain complex silicates and with binding agents such as sucrose, gelatin and acacia. Examples, without limitation, of excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols. Additionally, lubricating agents such as magnesium stearate, sodium lauryl sulfate and talc are often useful for tableting purposes. Solid compositions of a similar type may also be employed in soft and hard filled gelatin capsules. Non-limiting examples of excipients, therefore, also include lactose or milk sugar and high molecular weight polyethylene glycols. When aqueous suspensions or elixirs are desired for oral administration the active compound therein may be combined with various sweetening or flavoring agents, coloring matters or dyes and, if desired, emulsifying agents or suspending agents, together with additional excipients such as water, ethanol, propylene glycol, glycerin, or combinations thereof.
[0239] Examples of excipients also include pharmaceutically acceptable substances such as wetting agents or minor amounts of auxiliary substances such as wetting or emulsifying agents, preservatives, or buffers, which enhance the shelf life or effectiveness of the compound.
[0240] The compositions of this disclosure may be in a variety of forms. These include, for example, liquid, semi-solid and solid dosage forms, such as liquid solutions (e.g., injectable and infusible solutions), dispersions or suspensions, tablets, capsules, pills, powders, liposomes, lipid nanoparticles and suppositories. The form depends on the intended mode of administration and therapeutic application.
[0241] Typical compositions are in the form of injectable or infusible solutions, such as compositions similar to those used for passive immunization of humans with antibodies in general. One mode of administration is parenteral (e.g., intravenous, subcutaneous, intraperitoneal, intramuscular). In another embodiment, the compound is administered by intravenous infusion or injection. In yet another embodiment, the compound is administered by intramuscular or subcutaneous injection.
[0242] Oral administration of a solid dosage form may be, for example, presented in discrete units, such as hard or soft capsules, pills, cachets, lozenges, or tablets, each containing a predetermined amount of at least one compound of the disclosure. In another embodiment, the oral administration may be in a powder or granule form. In another embodiment, the oral dosage form is sub-lingual, such as, for example, a lozenge. In such solid dosage forms, the compounds of the disclosure are ordinarily combined with one or more adjuvants. Such capsules or tablets may comprise a controlled release formulation. In the case of capsules, tablets, and pills, the dosage forms also may comprise buffering agents or may be prepared with enteric coatings. In another embodiment, oral administration may be in a liquid dosage form. Liquid dosage forms for oral administration include, for example, pharmaceutically acceptable emulsions, solutions, suspensions, syrups, and elixirs containing inert diluents commonly used in the art (e.g., water). Such compositions also may comprise adjuvants, such as one or more of wetting, emulsifying, suspending, flavoring (e.g., sweetening), or perfuming agents.
[0243] In another embodiment, the disclosure comprises a parenteral dosage form. "Parenteral administration" includes, for example, subcutaneous injections, intravenous injections, intraperitoneally, intramuscular injections, intrasternal injections, and infusion. Injectable preparations (i.e. , sterile injectable aqueous or oleaginous suspensions) may be formulated according to the known art using one or more of suitable dispersing, wetting agents, or suspending agents.
[0244] In another embodiment, the disclosure comprises a topical dosage form. "Topical administration" includes, for example, dermal and transdermal administration, such as via transdermal patches or iontophoresis devices, intraocular administration, or intranasal or inhalation administration. Compositions for topical administration also include, for example, topical gels, sprays, ointments, and creams. A topical formulation may include a compound which enhances absorption or penetration of the active ingredient through the skin or other affected areas. When the compounds of this disclosure are administered by a transdermal device, administration will be accomplished using a patch either of the reservoir and porous membrane type or of a solid matrix variety. Typical formulations for this purpose include gels, hydrogels, lotions, solutions, creams, ointments, dusting powders, dressings, foams, films, skin patches, wafers, implants, sponges, fibers, bandages and microemulsions. Liposomes may also be used. Typical excipients include alcohol, water, mineral oil, liquid petrolatum, white petrolatum, glycerin, polyethylene glycol and propylene glycol. Penetration enhancers may be incorporated - see, for example, B. C. Finnin and T. M. Morgan, J. Pharm. Sci. , vol. 88, pp. OSS- OSS, 1000.
[0245] Formulations suitable for topical administration to the eye include, for example, eye drops wherein the compound of this disclosure is dissolved or suspended in a suitable excipient. A typical formulation suitable for ocular or aural administration may be in the form of drops of a micronized suspension or solution in isotonic, pH-adjusted, sterile saline. Other formulations suitable for ocular and aural administration include ointments, biodegradable (i.e., absorbable gel sponges, collagen) and non-biodegradable (i.e., silicone) implants, wafers, lenses and particulate or vesicular systems, such as niosomes or liposomes. A polymer such as crossed linked polyacrylic acid, polyvinyl alcohol, hyaluronic acid, a cellulosic polymer, for example, hydroxypropylmethylcellulose, hydroxyethylcellulose, or methylcellulose, or a heteropolysaccharide polymer, for example, gelan gum, may be incorporated together with a preservative, such as benzalkonium chloride. Such formulations may also be delivered by iontophoresis.
[0246] For intranasal administration, the compounds of the disclosure are conveniently delivered in the form of a solution or suspension from a pump spray container that is squeezed or pumped by the patient or as an aerosol spray presentation from a pressurized container or a nebulizer, with the use of a suitable propellant. Formulations suitable for intranasal administration are typically administered in the form of a dry powder (either alone, as a mixture, for example, in a dry blend with lactose, or as a mixed component particle, for example, mixed with phospholipids, such as phosphatidylcholine) from a dry powder inhaler or as an aerosol spray from a pressurized container, pump, spray, atomizer (for example, an atomizer using electrohydrodynamics to produce a fine mist), or nebulizer, with or without the use of a suitable propellant, such as 1 ,1 ,1 ,2-tetrafluoroethane or 1 ,1,1,2,3,3,3-heptafluoropropane. For intranasal use, the powder may comprise a bioadhesive agent, for example, chitosan or cyclodextrin.
[0247] In another embodiment, the disclosure comprises a rectal dosage form. Such rectal dosage form may be in the form of, for example, a suppository. Cocoa butter is a traditional suppository base, but various alternatives may be used as appropriate.
[0248] Other excipients and modes of administration known in the pharmaceutical art may also be used. Pharmaceutical compositions of the disclosure may be prepared by any of the well- known techniques of pharmacy, such as effective formulation and administration procedures. The above considerations in regard to effective formulations and administration procedures are well known in the art and are described in standard textbooks. Formulation of drugs is discussed in, for example, Hoover, John E., Remington’s Pharmaceutical Sciences, Mack Publishing Co., Easton, Pennsylvania, 1975; Liberman et al., Eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, N.Y., 1980; and Kibbe et al., Eds., Handbook of Pharmaceutical Excipients (3rd Ed.), American Pharmaceutical Association, Washington, 1999.
[0249] Acceptable excipients are nontoxic to subjects at the dosages and concentrations employed, and may comprise one or more of the following: 1) buffers such as phosphate, citrate, or other organic acids; 2) salts such as sodium chloride; 3) antioxidants such as ascorbic acid or methionine; 4) preservatives such as octadecyldimethylbenzyl ammonium chloride, hexamethonium chloride, benzalkonium chloride, benzethonium chloride, phenol, butyl or benzyl alcohol; 5) alkyl parabens such as methyl or propyl paraben, catechol, resorcinol, cyclohexanol, 3-pentanol, or m-cresol; 6) low molecular weight (less than about 10 residues) polypeptides; 7) proteins such as serum albumin, gelatin, or immunoglobulins; 8) hydrophilic polymers such as polyvinylpyrrolidone; 9) amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; 10) monosaccharides, disaccharides, or other carbohydrates including glucose, mannose, or dextrins; 11) chelating agents such as EDTA; 12) sugars such as sucrose, mannitol, trehalose or sorbitol; 13) salt-forming counter-ions such as sodium, metal complexes (e.g., Zn-protein complexes), or 14) non-ionic surfactants such as polysorbates (e.g., polysorbate 20 or polysorbate 80), poloxamers or polyethylene glycol (PEG).
[0250] Sustained-release preparations may be used. Suitable examples of sustained-release preparations include semi-permeable matrices of solid hydrophobic polymers containing a compound of the disclosure, which matrices are in the form of shaped articles, e.g., films, or microcapsules. Examples of sustained-release matrices include polyesters, hydrogels (for example, poly(2-hydroxyethyl-methacrylate), or 'poly(vinylalcohol)), polylactides, copolymers of L-glutamic acid and 7 ethyl-L-glutamate, non-degradable ethylene-vinyl acetate, degradable lactic acid-glycolic acid copolymers such as those used in leuprolide acetate for depot suspension (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate), sucrose acetate isobutyrate, and poly-D-(-)-3-hydroxybutyric acid.
[0251] The formulations to be used for intravenous administration must be sterile. This is readily accomplished by, for example, filtration through sterile filtration membranes. Compounds of the disclosure are generally placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle.
[0252] Suitable emulsions may be prepared using commercially available fat emulsions, such as a lipid emulsions comprising soybean oil, a fat emulsion for intravenous administration (e.g., comprising safflower oil, soybean oil, egg phosphatides and glycerin in water), emulsions containing soya bean oil and medium-chain triglycerides, and lipid emulsions of cottonseed oil. The active ingredient may be either dissolved in a pre-mixed emulsion composition or alternatively it may be dissolved in an oil (e.g., soybean oil, safflower oil, cottonseed oil, sesame oil, corn oil or almond oil) and an emulsion formed upon mixing with a phospholipid (e.g., egg phospholipids, soybean phospholipids or soybean lecithin) and water. It will be appreciated that other ingredients may be added, for example glycerol or glucose, to adjust the tonicity of the emulsion. Suitable emulsions will typically contain up to 20% oil, for example, between 5 and 20%. The fat emulsion may comprise fat droplets between 0.1 and 1.0 pm, particularly 0.1 and 0.5 pm, and have a pH in the range of 5.5 to 8.0.
[0253] For example, the emulsion compositions may be those prepared by mixing a compound of the disclosure with a lipid emulsions comprising soybean oil or the components thereof (soybean oil, egg phospholipids, glycerol and water).
[0254] Compositions for inhalation or insufflation include solutions and suspensions in pharmaceutically acceptable aqueous or organic solvents, or mixtures thereof, and powders. The liquid or solid compositions may contain suitable pharmaceutically acceptable excipients as set out above. In some embodiments, the compositions are administered by the oral or nasal respiratory route for local or systemic effect. Compositions in sterile pharmaceutically acceptable solvents may be nebulized by use of gases. Nebulized solutions may be breathed directly from the nebulizing device or the nebulizing device may be attached to a face mask, tent or intermittent positive pressure breathing machine. Solution, suspension or powder compositions may be administered, for example orally or nasally, from devices which deliver the formulation in an appropriate manner.
[0255] A drug product intermediate (DPI) is a partly processed material that must undergo further processing steps before it becomes bulk drug product. Compounds of the disclosure may be formulated into drug product intermediate DPI containing the active ingredient in a higher free energy form than the crystalline form. One reason to use a DPI is to improve oral absorption characteristics due to low solubility, slow dissolution, improved mass transport through the mucus layer adjacent to the epithelial cells, and in some cases, limitations due to biological barriers such as metabolism and transporters. Other reasons may include improved solid state stability and downstream manufacturability. In one embodiment, the drug product intermediate contains a compound of the disclosure isolated and stabilized in the amorphous state (for example, amorphous solid dispersions (ASDs)). There are many techniques known in the art to manufacture ASD’s that produce material suitable for integration into a bulk drug product, for example, spray dried dispersions (SDD’s), melt extrudates (often referred to as HME’s), co-precipitates, amorphous drug nanoparticles, and nano-adsorbates. In one embodiment amorphous solid dispersions comprise a compound of the disclosure and a polymer excipient. Other excipients as well as concentrations of said excipients and the compound of the disclosure are well known in the art and are described in standard textbooks. See, for example, “Amorphous Solid Dispersions Theory and Practice" by Navnit Shah et al.
[0256] Administration and Dosing
[0257] The term "treating", "treat" or "treatment" as used herein embraces both preventative, i.e., prophylactic, and palliative treatment, i.e., relieve, alleviate, or slow the progression of the patient’s disease (or condition) or any tissue damage associated with the disease.
[0258] As used herein, the terms, “subject, “individual” or “patient,” used interchangeably, refer to any animal, including mammals. Mammals according to the disclosure include canine, feline, bovine, caprine, equine, ovine, porcine, rodents, lagomorphs, primates, humans and the like, and encompass mammals in utero. In an embodiment, humans are suitable subjects. Human subjects may be of any gender and at any stage of development.
[0259] As used herein, the phrase “therapeutically effective amount” refers to the amount of active compound or pharmaceutical agent that elicits the biological or medicinal response in a tissue, system, animal, individual or human that is being sought by a researcher, veterinarian, medical doctor or other clinician, which may include one or more of the following: (1) preventing the disease; for example, preventing a disease, condition or disorder in an individual that may be predisposed to the disease, condition or disorder but does not yet experience or display the pathology or symptomatology of the disease;
[0260] (2) inhibiting the disease; for example, inhibiting a disease, condition or disorder in an individual that is experiencing or displaying the pathology or symptomatology of the disease, condition or disorder (i.e., arresting (or slowing) further development of the pathology or symptomatology or both); and
[0261] (3) ameliorating the disease; for example, ameliorating a disease, condition or disorder in an individual that is experiencing or displaying the pathology or symptomatology of the disease, condition or disorder (i.e., reversing the pathology or symptomatology or both).
[0262] Typically, a compound of the disclosure is administered in an amount effective to treat a condition as described herein. The compounds of the disclosure may be administered as compound per se, or alternatively, as a pharmaceutically acceptable salt. For administration and dosing purposes, the compound per se or pharmaceutically acceptable salt thereof will simply be referred to as the compounds of the disclosure.
[0263] The compounds of the disclosure are administered by any suitable route in the form of a pharmaceutical composition adapted to such a route, and in a dose effective for the treatment intended. The compounds of the disclosure may be administered orally, rectally, vaginally, parenterally, topically, intranasally, or by inhalation.
[0264] The compounds of the disclosure may be administered orally. Oral administration may involve swallowing, so that the compound enters the gastrointestinal tract, or buccal or sublingual administration may be employed by which the compound enters the bloodstream directly from the mouth.
[0265] In another embodiment, the compounds of the disclosure may also be administered parenterally, for example directly into the bloodstream, into muscle, or into an internal organ. Suitable means for parenteral administration include intravenous, intraarterial, intraperitoneal, intrathecal, intraventricular, intraurethral, intrasternal, intracranial, intramuscular and subcutaneous. Suitable devices for parenteral administration include needle (including microneedle) injectors, needle-free injectors, and infusion techniques.
[0266] In another embodiment, the compounds of the disclosure may also be administered topically to the skin or mucosa, that is, dermally or transdermally. In another embodiment, the compounds of the disclosure may also be administered intranasally or by inhalation. In another embodiment, the compounds of the disclosure may be administered rectally or vaginally. In another embodiment, the compounds of the disclosure may also be administered directly to the eye or ear.
[0267] The dosage regimen for the compounds of the disclosure or compositions containing said compounds is based on a variety of factors, including the type, age, weight, sex and medical condition of the patient; the severity of the condition; the route of administration; and the activity of the particular compound employed. Thus, the dosage regimen may vary widely. In one embodiment, the total daily dose of a compound of the disclosure is typically from about 0.01 to about 100 mg / kg (i.e., mg compound of the disclosure per kg body weight) for the treatment of the indicated conditions discussed herein. In another embodiment, total daily dose of the compound of the disclosure is from about 0.1 to about 50 mg / kg, and in another embodiment, from about 0.5 to about 30 mg / kg. It is not uncommon that the administration of the compounds of the disclosure will be repeated a plurality of times in a day (typically no greater than 4 times). Multiple doses per day typically may be used to increase the total daily dose, if desired.
[0268] Therapeutic Methods and Uses
[0269] The compounds of the disclosure are useful as vaccine adjuvants.
[0270] Adjuvant formulations comprising the compounds of the disclosure may be used with an immunogen (j.e. a therapeutic agent or antigen of interest) to obtain an immunogenic composition, for example, a vaccine. The immunogenic composition comprising an adjuvant disclosed herein may further comprise naturally-occurring or artificially-created proteins, recombinant proteins, glycoproteins, peptides, carbohydrates, nucleic acids, haptens, whole viruses, bacteria, protozoa, or virus-like particles, or conjugates thereof as the immunogen. The immunogenic composition comprising an adjuvant and an immunogen may be suitably used as a vaccine targeted for a virus, a gram negative bacteria, a gram positive bacteria, or cancer. The immunogenic composition comprising an adjuvant disclosed herein may be suitably used in methods for treating or preventing a disease or infection in a subject caused by a pathogen associated with an infectious disease, wherein the pathogen is selected from the group consisting of a virus, a gram negative bacteria, and a gram positive bacteria.
[0271] Co-administration
[0272] The compounds of the disclosure may be used alone, or in combination with one or more therapeutic agents.
[0273] The administration of two or more compounds “in combination” means that all of the compounds are administered closely enough in time to affect treatment of the subject. The two or more compounds may be administered simultaneously or sequentially, via the same or different routes of administration, on same or different administration schedules and with or without specific time limits depending on the treatment regimen. Additionally, simultaneous administration may be carried out by mixing the compounds prior to administration or by administering the compounds at the same point in time but as separate dosage forms at the same or different site of administration. Examples of “in combination” include, but are not limited to, “concurrent administration,” “co-administration,” “simultaneous administration,” “sequential administration” and “administered simultaneously”.
[0274] A compound of the disclosure and the one or more therapeutic agents may be administered as a fixed or non-fixed combination of the active ingredients. The term "fixed combination" means a compound of the disclosure, or a pharmaceutically acceptable salt thereof, and the one or more therapeutic agents, are both administered to a subject simultaneously in a single composition or dosage. The term "non-fixed combination" means that a compound of the disclosure, or a pharmaceutically acceptable salt thereof, and the one or more therapeutic agents are formulated as separate compositions or dosages such that they may be administered to a subject in need thereof simultaneously or at different times with variable intervening time limits, wherein such administration provides effective levels of the two or more compounds in the body of the subject.
[0275] These agents and compounds of the disclosure may be combined with pharmaceutically acceptable vehicles such as saline, Ringer’s solution, dextrose solution, and the like. The particular dosage regimen, i.e. , dose, timing and repetition, will depend on the particular individual and that individual’s medical history.
[0276] Kits
[0277] Another aspect of the disclosure provides kits comprising the compound of the disclosure or pharmaceutical compositions comprising the compound of the disclosure. A kit may include, in addition to the compound of the disclosure or pharmaceutical composition thereof, diagnostic or therapeutic agents. A kit may also include instructions for use in a diagnostic or therapeutic method. In some embodiments, the kit includes the compound or a pharmaceutical composition thereof and a diagnostic agent. In other embodiments, the kit includes the compound or a pharmaceutical composition thereof and one or more therapeutic agents.
[0278] In yet another embodiment, the disclosure comprises kits that are suitable for use in performing the methods described herein. In one embodiment, the kit contains a first dosage form comprising one or more of the compounds of the disclosure in quantities sufficient to carry out the methods of the disclosure. In another embodiment, the kit comprises one or more compounds of the disclosure in quantities sufficient to carry out the methods of the disclosure and a container for the dosage.
[0279] EXAMPLES
[0280] In order that this disclosure may be better understood, the following examples are set forth. These examples are for purposes of illustration only and are not to be construed as limiting the scope of the disclosure in any manner. The following Examples illustrate some embodiments of the disclosure.
[0281] EXAMPLE 1 : PREPARATION OF NANOPARTICLES INCLUDING ALUMINUM AND POLYACRYLIC ACID (PAA)
[0282] In this first example, nanoparticles containing aluminum hydroxide and PAA were prepared using a Microfluidizer® (Microfluidics™).
[0283] Preparation of Nanoparticles Including Aluminum (9 mg / mL) and PAA (6 mg / mL) using LV1 Microfluidizer®:
[0284] 9 mL of Alhydrogel®(Croda™), an aluminum hydroxide gel suspension at a concentration of 10mg / mL, and 95.23 mg of PAA (63 wt % solution in water; actual weight of 91 .33 mg) were mixed. The pH was measured to be 3.06, and then adjusted to a pH of 7.4 (actual pH of 7.47). The volume was increased to 10 mL using WFI. The size of the diluted sample (30 pL of sample in 60 pL WFI) was measured to be 1251 nm with a polydispersity index (PDI) of 0.18. Six passes of microfluidization were performed using a low-volume LV1 Microfluidizer® (Microfluidics™). After microfluidization, the aluminum hydroxide preparation was determined to have an average size of 82 nm and a PDI of 0.17. The intermediate pH was measured to be 7.52.
[0285] Scale up using LM10 Microfluidizer® for the Preparation of Nanoparticles Including Aluminum (9 mg / mL) and PAA (6 mg / mL):
[0286] 45 mL of Alhydrogel® (Croda™), an aluminum hydroxide gel suspension at a concentration of 10mg / mL, and 476 mg of polyacrylic acid (63 wt% solution in water; actual weight of 480.32 mg) were mixed. The pH was measured to be 2.86 and then adjusted to 7.4 (actual pH of 7.42). The volume was increased to 50 mL using WFI. The size of the diluted sample (30 pL of sample in 60 pL WFI) was measured to be 1472 nm with a polydispersity index (PDI) of 0.13. Twenty passes of microfluidization were performed using a high-volume LM10 Microfluidizer® (Microfluidics™). After microfluidization, the aluminum hydroxide preparation was determined to have an average size of 89 nm and a PDI of 0.19. The intermediate pH was measured to be 7.49.
[0287] The 5 mL nanoparticle preparation was mixed with 7.5 mL of 40mM Histidine buffer at pH 6.0 and 17.5mL of WFI to give the final formulation.
[0288] EXAMPLE 2: PREPARATION OF NANOPARTICLES INCLUDING ALUMINUM AND CpG OLIGONUCLEOTIDES
[0289] In this second example, nanoparticles containing aluminum hydroxide and CpG 24555 were prepared using a Microfluidizer® (Microfluidics™). Preparation of Nanoparticles Including Aluminum (9 mg / mL) and CpG Oligonucleotides (7.2 mg / mL) using LV1 Microfluidizer®:
[0290] 3 mL of Alhydrogel® (Croda™), an aluminum hydroxide gel suspension at a concentration of 10mg / mL, 72 mg of CpG 24555 (actual weight of 72.89 mg), and 6 mL of WFI were mixed. The pH was measured to be 7.03. The volume was increased to 10 mL using WFI. The size of the diluted sample (30 pL of sample in 60 pL WFI) was measured to be 1318 nm with a PDI of 0.18. Eight passes of microfluidization were performed using a low-volume LV1 Microfluidizer® (Microfluidics™). After microfluidization, the aluminum hydroxide preparation was determined to have an average size of 80 nm and a PDI of 0.15. The pH of the intermediate was measured to be 7.26.
[0291] Scale up using LM10 Microfluidizer® for the Preparation of Nanoparticles Including Aluminum (9 mg / mL) and CpG Oligonucleotides (7.2mg / mL):
[0292] 15 mL of Alhydrogel® (Croda™), an aluminum hydroxide gel suspension at a concentration of 10mg / mL, 360 mg of CpG 24555 (an actual weight of 359.01 mg), and 30 mL of WFI were mixed. The pH was measured to be 7.20. The volume was increased to 50 mL using WFI. The size of the diluted sample (30 pL of sample in 60 pL WFI) was measured to be 1454 nm with a polydispersity index (PDI) of 0.13. Sixteen passes of microfluidization were performed using a high-volume LM10 Microfluidizer® (Microfluidics™). After microfluidization, the aluminum hydroxide preparation was determined to have an average size of 88 nm and a PDI of 0.17. The intermediate pH was measured to be 7.20.
[0293] The 15 mL nanoparticle preparation was mixed with 7.5 mL of 40mM Histidine buffer at pH 6.3 and 7.5mL of WFI to give the final formulation.
[0294] EXAMPLE 3: PREPARATION OF NANOPARTICLES INCLUDING ALUMINUM, CpG OLIGONUCLEOTIDES, AND PAA
[0295] In this third example, nanoparticles containing aluminum hydroxide, CpG 24555, and PAA were prepared using a Microfluidizer® (Microfluidics™).
[0296] Preparation of Nanoparticles Including Aluminum (2 mg / mL), CpG Oligonucleotides (1.33 mg / mL), and PAA (1 mg / mL) using LM10 Microfluidizer®:
[0297] 15 mL of Alhydrogel® (Croda™), an aluminum hydroxide gel suspension at a concentration of 10 mg / mL, 100 mg of CpG 24555 (an actual weight of 103.67 mg), and 30 mL of WFI were mixed. The pH was measured to be 6.91. The volume was increased to 50 mL using WFI. The size of the diluted sample (30 pL of sample in 60 pL WFI) was measured to be 1171 nm with a polydispersity index (PDI) of 0.15. Fifteen passes of microfluidization were performed using a LM10 Microfluidizer® (Microfluidics™). After microfluidization, the aluminum hydroxide preparation was determined to have an average size of 86 nm and a PDI of 0.18. 50 mL of 3 mg / mL polyacrylic acid solution, pH 7.4, was added. The size of the diluted sample (30 L of sample in 60 L WFI) was measured to be 85 nm with a polydispersity index (PDI) of 0.15. Ten passes of microfluidization were performed using a high-volume LM10 Microfluidizer® (Microfluidics™). After microfluidization, the aluminum hydroxide preparation was determined to have an average size of 83 nm and a PDI of 0.17. The intermediate pH was measured to be 7.76.
[0298] The 22.5 mL nanoparticle preparation was mixed with 7.5 mL of 40mM Histidine buffer at pH 6.0 to give the final formulation. EXAMPLE 4: BUFFER SELECTION FOR FINAL ALUMINUM NANOPARTICLE PREPARATIONS
[0299] In this fourth example, the long-term stability of the aluminum nanoparticle preparations within both 10 mM Tris buffer at pH 7.4 and 10 mM Histidine buffer at pH 6.5 was tested. The nanoparticle preparations tested included aluminum + PAA, aluminum + CpG 24555, and aluminum + CpG 24555 + PAA, as shown in Table 1 , below:
[0300] Table 1 : Stability of Nanoparticle Preparations Over Time
[0301] These results demonstrate that all nanoparticle preparations were stable within both buffers tested (10 mM Tris buffer at pH 7.4 and 10 mM Histidine buffer at pH 6.5) for three months based on the metrics of pH, size (nm), and PDI.
[0302] EXAMPLE 5: VMAX DETERMINATION FOR THE ALUMINUM NANOPARTICLE FORMULATIONS
[0303] In this fifth example, a Vmax study was done using Sample 4 in Table 1 above (Alhydrogel (1.5 mg / mL) + CpG 24555 (3.6 mg / mL) in 10 mM Histidine buffer at pH 6.5). As shown in Table 2 below, the four filters tested were a polyethersulfone (PES) bilayer membrane filter with a pore size of 0.5 pm / 0.2 pm, a PES monolayer membrane filter with a pore size of 0.2 pm, a polyvinylidene difluoride (PVDF) bilayer membrane filter with a pore size of 0.45 pm / 0.2 pm, and PVDF monolayer membrane filter with a pore size of 0.22 pm.
[0304] Table 2: VMAX OF ALUMINUM NANOPARTICLE FORMULATIONS TESTED WITH VARIOUS FILTERS
[0305] These results demonstrate that the PVDF monolayer membrane filter had the highest Vmax of 71.8 L / m2, followed by the PVDF bilayer membrane with a Vmax of 65.5 L / m2. Accordingly, it was concluded that both PVDF membranes were suitable for use with the tested Alhydrogel and CpG nanoparticle preparation. All references cited herein, including patents, patent applications, papers, textbooks, and the like, and the references cited therein, to the extent that they are not already, are hereby incorporated by reference in their entireties. In the event that one or more of the incorporated literature and similar materials differs from or contradicts this application, including but not limited to defined terms, term usage, described techniques, or the like, this application controls.
[0306] The following clauses describe additional embodiments of the disclosure:
[0307] C1. A composition comprising aluminum nanoparticles, wherein the nanoparticles have an average size less than about 1000 nanometers (nm).
[0308] C2. The composition of C1 , wherein the nanoparticles have an average size less than about 950 nm, about 900 nm, about 850 nm, about 800 nm, about 750 nm, about 700 nm, about 650 nm, about 600 nm, about 550 nm, about 500 nm, about 450 nm, about 400 nm, about 350 nm, about 300 nm, about 250 nm, about 200 nm, about 150 nm, about 100 nm, or about 50 nm.
[0309] C3. The composition of C1 or C2, wherein the nanoparticles have an average size less than about 100 nm.
[0310] C4. The composition of any one of C1-C3, wherein the nanoparticles have an average size between about 80 nm and about 90 nm.
[0311] C5. The composition of any one of C1-C4, wherein the nanoparticles have an average size of about 80 nm, about 81 nm, about 82 nm, about 83 nm, about 84 nm, about 85 nm, about 86 nm, about 87 nm, about 88 nm, about 89 nm, or about 90 nm.
[0312] C6. The composition of any one of C1-C5, wherein the average size is the z-average diameter of the nanoparticles.
[0313] C7. The composition of any one of C1-C6, wherein nanoparticles have a polydispersity index (PDI) less than about 0.5, about 0.4, about 0.3, about 0.2, or about 0.1.
[0314] C8. The composition of any one of C1-C7, wherein the nanoparticles have a polydispersity index (PDI) of less than about 0.2. C9. The composition of any one of C1-C8, wherein the nanoparticles have a polydispersity index (PDI) of about 0.1, about 0.11, about 0.12, about 0.13, about 0.14, about 0.15, about 0.16, about 0.17, about 0.18, or about 0.19.
[0315] C10. The composition of any one of C1-C9, wherein the nanoparticles further comprise an anionic compound.
[0316] C11. The composition of any one of C1-C10, wherein the nanoparticles further comprise polyacrylic acid (PAA), phytic acid (PA), or polyglutamic acid (PGA).
[0317] C12. The composition of any one of C1-C11 , wherein the nanoparticles further comprise polyacrylic acid (PAA).
[0318] C13. The composition of C12, wherein the aluminum and PAA form a nanoparticle complex.
[0319] C14. A composition comprising nucleotide nanoparticles, wherein the nanoparticles have an average size less than about 1000 nanometers (nm).
[0320] C15. The composition of C14, wherein the nanoparticles have an average size less than about 950 nm, about 900 nm, about 850 nm, about 800 nm, about 750 nm, about 700 nm, about 650 nm, about 600 nm, about 550 nm, about 500 nm, about 450 nm, about 400 nm, about 350 nm, about 300 nm, about 250 nm, about 200 nm, about 150 nm, about 100 nm, or about 50 nm.
[0321] C16. The composition of C14 or C15, wherein the nanoparticles have an average size less than about 100 nm.
[0322] C17. The composition of any one of C14-C16, wherein the nanoparticles have an average size between about 80 nm and about 90 nm.
[0323] C18. The composition of any one of C14-C17, wherein the nanoparticles have an average size of about 80 nm, about 81 nm, about 82 nm, about 83 nm, about 84 nm, about 85 nm, about 86 nm, about 87 nm, about 88 nm, about 89 nm, or about 90 nm.
[0324] C19. The composition of any one of C14-C18, wherein the average size is the z-average diameter of the nanoparticles. C20. The composition of any one of C14-C19, wherein the nanoparticles have a polydispersity index (PDI) less than about 0.5, about 0.4, about 0.3, about 0.2, or about 0.1.
[0325] C21. The composition of any one of C14-C20, wherein the nanoparticles have a PDI of less than about 0.2.
[0326] C22. The composition of any one of C14-C21, wherein the nanoparticles have a PDI of about 0.1, about 0.11, about 0.12, about 0.13, about 0.14, about 0.15, about 0.16, about 0.17, about 0.18, about 0.19, or about 0.2.
[0327] C23. The composition of any one of C1-C13, further comprising nucleotide nanoparticles.
[0328] C24. The composition of C23, wherein the aluminum and the nucleotide form a complex, and wherein the complex comprises nanoparticles with an average size less than about 950 nm, about 900 nm, about 850 nm, about 800 nm, about 750 nm, about 700 nm, about 650 nm, about 600 nm, about 550 nm, about 500 nm, about 450 nm, about 400 nm, about 350 nm, about 300 nm, about 250 nm, about 200 nm, about 150 nm, about 100 nm, or about 50 nm.
[0329] C25. The composition of C24, wherein the complex nanoparticles have an average size less than about 100 nm.
[0330] C26. The composition of C24 or C25, wherein the complex nanoparticles have an average size between about 80 nm and about 90 nm.
[0331] C27. The composition of any one of C24-C26, wherein the complex nanoparticles have an average size of about 80 nm, about 81 nm, about 82 nm, about 83 nm, about 84 nm, about 85 nm, about 86 nm, about 87 nm, about 88 nm, about 89 nm, or about 90 nm.
[0332] C28. The composition of any one of C24-C27, wherein the complex nanoparticles have a polydispersity index (PDI) less than about 0.5, about 0.4, about 0.3, about 0.2, or about 0.1.
[0333] C29. The composition of any one of C24-C28, wherein the complex nanoparticles have a PDI of less than about 0.2.
[0334] C30. The composition of any one of C24-C29, wherein the complex nanoparticles have a PDI of about 0.1 , about 0.11, about 0.12, about 0.13, about 0.14, about 0.15, about 0.16, about 0.17, about 0.18, about 0.19, or about 0.2. C31. The composition of any one of C24-C30, wherein the nanoparticle complex is formed by a charge-charge interaction between aluminum and the nucletoide.
[0335] C32. The composition of any one of C24-C31 , wherein the complex nanoparticles further comprise an anionic compound.
[0336] C33. The composition of any one of C24-C31 or C32, wherein the complex nanoparticles further comprise polyacrylic acid (PAA), phytic acid (PA), or polyglutamic acid (PGA).
[0337] C34. The composition of any one of C14-C33, wherein the nucleotide comprises CpG oligodeoxynucleotides (CpG ODN).
[0338] C35. The composition of C34, wherein at least one of the CG dinucleotides within the CpG ODN contains an unmethylated cytosine.
[0339] C36. The composition of C34 or C35, wherein each of the CG dinucleotides within the CpG ODN contains an unmethylated cytosine.
[0340] C37. The composition of any one of C14-C36, wherein the nucleotide comprises at least one phosphorothioate internucleotide linkage.
[0341] C38. The composition of any one of C14-C37, wherein the nucleotide comprises phosphorothioate internucleotide linkages for each internucleotide linkage.
[0342] C39. The composition of any one of C14-C38, wherein the nucleotide comprises a CpG motif consisting of 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides.
[0343] C40. The composition of any one of C14-C39, wherein the nucleotide consists of between 15 and 30 nucleotides.
[0344] C41. The composition of any one of C14-C40, wherein the nucleotide consists of 20, 21 , 22, 23, or 24 nucleotides.
[0345] C42. The composition of any one of C14-C41 , wherein the nucleotide comprises the sequence of any one of SEQ ID Nos: 1-23. C43. The composition of any one of C14-C42, wherein the nucleotide consists of the sequence of any one of SEQ ID Nos: 1-23.
[0346] C44. The composition of any one of C14-C43, wherein the nucleotide comprises the sequence of SEQ ID NO: 2.
[0347] C45. The composition of any one of C14-C44, wherein the nucleotide consists of the sequence of SEQ ID NO: 2.
[0348] C46. The composition of any one of C14-C43, wherein the nucleotide comprises the sequence of SEQ ID NO: 9.
[0349] C47. The composition of any one of C14-C43 or C46, wherein the nucleotide consists of the sequence of SEQ ID NO: 9.
[0350] C48. The composition of any one of C1-C47, wherein the nanoparticles are for use as an adjuvant.
[0351] C49. The composition of any one of C1-C48, wherein the composition further comprises 1 , 2, 3, or more additional adjuvants.
[0352] C50. The composition of C49, wherein at least one additional adjuvant has an average size of less than about 1000 nm.
[0353] C51. The composition of C49 or C50, wherein at least one additional adjuvant has an average size of less than about 100 nm.
[0354] C52. The composition of any one of C1-C51 , wherein the composition is for use as an adjuvant.
[0355] C53. The composition of any one of C1-C52, wherein the composition further comprises a buffer.
[0356] C54. The composition of any one of C1-C53, wherein the composition further comprises a histidine buffer. C55. The composition of C54, wherein the concentration of histidine is between about 1 mM and about 50 mM.
[0357] C56. The composition of C54 or C55, wherein the concentration of histidine is about 10 mM.
[0358] C57. The composition of any one of C54-C56, wherein the pH of the histidine buffer is between about 6 and about 7.
[0359] C58. The composition of any one of C54-C57, wherein the pH of the histidine buffer is about 6.5.
[0360] C59. The composition of any one of C1-C53, wherein the composition further comprises a T ris buffer.
[0361] C60. The composition of C59, wherein the concentration of Tris is between about 1 mM and about 50 mM.
[0362] C61. The composition of C59 or C60, wherein the concentration of Tris is about 10 mM.
[0363] C62. The composition of any one of C59-C61 , wherein the pH of the T ris buffer is between about 7 and about 8.
[0364] C63. The composition of any one of C59-C62, wherein the pH of the Tris buffer is about 7.4.
[0365] C64. The composition of any one of C1-C63, wherein the nanoparticles maintain an average size (nm) that deviates by no more than about 5%, about 10%, about 15%, about 20%, about 25%, or about 30% of the value of their average size at time zero (TO) for at least about 3 months after TO, and wherein TO is the time when the formulation of the composition comprising the nanoparticles is completed.
[0366] C65. The composition of any one of C1-C64, wherein the nanoparticles maintain an average size (nm) that deviates by no more than about 10% of the value of their average size at time zero (TO) for at least about 3 months after TO, and wherein TO is the time when the formulation of the composition comprising the nanoparticles is completed.
[0367] C66. The composition of any one of C1-C65, wherein the nanoparticles maintain a PDI that deviates by no more than about 5%, about 10%, about 15%, about 20%, about 25%, or about 30% of the value of their PDI at time zero (TO) for at least about 3 months after TO, and wherein TO is the time when the formulation of the composition comprising the nanoparticles is completed.
[0368] C67. The composition of any one of C1-C66, wherein the nanoparticles maintain a PDI that deviates by no more than about 10% of the value of their PDI at time zero (TO) for at least about 3 months after TO, and wherein TO is the time when the formulation of the composition comprising the nanoparticles is completed.
[0369] C68. The composition of any one of C1-C66, wherein the nanoparticles maintain a PDI that deviates by no more than about 20% of the value of their PDI at time zero (TO) for at least about 3 months after TO, and wherein TO is the time when the formulation of the composition comprising the nanoparticles is completed.
[0370] C69. The composition of any one of C1-C68, wherein the nanoparticles are sized using a method selected from the group consisting of microfluidization, high pressure homogenization, sonication, chemical reduction, coprecipitation, and microemulsion.
[0371] C70. The composition of any one of C1-C69, wherein the nanoparticles are sized using a microfluidic device.
[0372] C71 . A method for producing the composition of any one of C1-C70, wherein the nanoparticles are sized using a method selected from the group consisting of microfluidization, high pressure homogenization, sonication, chemical reduction, coprecipitation, milling, extrusion, and microemulsion.
[0373] C72. A method for producing the composition of any one of C1-C71 , wherein the method comprises the use of a microfluidic device to produce the nanoparticles.
[0374] C73. A method for producing aluminum nanoparticles, wherein the method comprises the use of a microfluidic device, and wherein the nanoparticles have an average size less than about 1000 nanometers (nm).
[0375] C74. The method of C73, wherein the nanoparticles have an average size less than about 950 nm, about 900 nm, about 850 nm, about 800 nm, about 750 nm, about 700 nm, about 650 nm, about 600 nm, about 550 nm, about 500 nm, about 450 nm, about 400 nm, about 350 nm, about 300 nm, about 250 nm, about 200 nm, about 150 nm, about 100 nm, or about 50 nm. C75. The method of C73 or C74, wherein the nanoparticles have an average size less than about 100 nm.
[0376] C76. The method of any one of C73-C75, wherein the nanoparticles have an average size between about 80 nm and about 90 nm.
[0377] C77. The method of any one of C73-C76, wherein the nanoparticles have an average size of about 80 nm, about 81 nm, about 82 nm, about 83 nm, about 84 nm, about 85 nm, about 86 nm, about 87 nm, about 88 nm, about 89 nm, or about 90 nm.
[0378] C78. The method of any one of C73-C77, wherein the average size is the z-average diameter of the nanoparticles.
[0379] C79. The method of any one of C73-C78, wherein the nanoparticles have a polydispersity index (PDI) less than about 0.5, about 0.4, about 0.3, about 0.2, or about 0.1.
[0380] C80. The method of any one of C73-C79, wherein the nanoparticles have a polydispersity index (PDI) less than about 0.2.
[0381] C81. The method of any one of C73-C80, wherein the nanoparticles have a polydispersity index (PDI) of about 0.1, about 0.11, about 0.12, about 0.13, about 0.14, about 0.15, about 0.16, about 0.17, about 0.18, about 0.19, or about 0.2.
[0382] C82. The method of any one of C73-C81, wherein the aluminum is obtained by microfluidizing aluminum hydroxide or aluminum phosphate.
[0383] C83. The method of any one of C73-C82, wherein the nanoparticles further comprise an anionic compound, and wherein the aluminum and the anionic compound form a complex.
[0384] C84. The method of any one of C73-C83, wherein the nanoparticles further comprise polyacrylic acid (PAA) or phytic acid (PA), and wherein the aluminum and PAA or PA form a complex.
[0385] C85. The method of any one of C73-C84, wherein the composition comprising the nanoparticles is obtained by combining aluminum hydroxide and PAA, wherein the ratio of aluminum hydroxide to PAA by mass (pg) is between about 1:1 and about 2:1. C86. The method of any one of C73-C85, the composition comprising the nanoparticles is obtained by combining aluminum hydroxide and PAA, wherein the ratio of aluminum hydroxide to PAA by mass (pg) is about 1.5:1.
[0386] C87. A method for producing nucleotide nanoparticles, wherein the method comprises the use of a microfluidic device, and wherein the nanoparticles have an average size less than about 1000 nanometers (nm).
[0387] C88. The method of C87, wherein the nanoparticles have an average size less than about 950 nm, about 900 nm, about 850 nm, about 800 nm, about 750 nm, about 700 nm, about 650 nm, about 600 nm, about 550 nm, about 500 nm, about 450 nm, about 400 nm, about 350 nm, about 300 nm, about 250 nm, about 200 nm, about 150 nm, about 100 nm, or about 50 nm.
[0388] C89. The method of C87 or C88, wherein the nanoparticles have an average size of less than about 100 nm.
[0389] C90. The method of any one of C87-C89, wherein the nanoparticles have an average size between about 80 nm and about 90 nm.
[0390] C91. The method of any one of C87-C90, wherein the nanoparticles have an average size of about 80 nm, about 81 nm, about 82 nm, about 83 nm, about 84 nm, about 85 nm, about 86 nm, about 87 nm, about 88 nm, about 89 nm, or about 90 nm.
[0391] C92. The method of any one of C87-C91 , wherein the average size is the z-average diameter of the nanoparticles.
[0392] C93. The method of any one of C87-C92, wherein the nanoparticles have a polydispersity index (PDI) less than about 0.5, about 0.4, about 0.3, about 0.2, or about 0.1.
[0393] C94. The method of any one of C87-C93, wherein the nanoparticles have a PDI of less than about 0.2.
[0394] C95. The method of any one of C87-C94, wherein the nanoparticles have a PDI of about 0.1, about 0.11, about 0.12, about 0.13, about 0.14, about 0.15, about 0.16, about 0.17, about 0.18, about 0.19, or about 0.2. C96. A method for producing nanoparticles, wherein the method comprises the use of a microfluidic device, wherein the nanoparticles comprise aluminum and a nucleotide within a complex, and wherein the nanoparticles have an average size less than about 1000 nanometers (nm).
[0395] C97. The method of C96, wherein the nanoparticles have an average size less than about 950 nm, about 900 nm, about 850 nm, about 800 nm, about 750 nm, about 700 nm, about 650 nm, about 600 nm, about 550 nm, about 500 nm, about 450 nm, about 400 nm, about 350 nm, about 300 nm, about 250 nm, about 200 nm, about 150 nm, about 100 nm, or about 50 nm.
[0396] C98. The method of any one of C96-C97, wherein the nanoparticles have an average size of less than about 100 nm.
[0397] C99. The method of any one of C96-C98, wherein the nanoparticles have an average size between about 80 nm and about 90 nm.
[0398] C100. The method of any one of C96-C99, wherein the nanoparticles have an average size of about 80 nm, about 81 nm, about 82 nm, about 83 nm, about 84 nm, about 85 nm, about 86 nm, about 87 nm, about 88 nm, about 89 nm, or about 90 nm.
[0399] C101. The method of any one of C96-C100, wherein the average size is the z-average diameter of the nanoparticles.
[0400] C102. The method of any one of C96-C101 , wherein the nanoparticles have a polydispersity index (PDI) of less than about 0.5, about 0.4, about 0.3, about 0.2, or about 0.1.
[0401] C103. The method of any one of C96-C102, wherein the nanoparticles have a PDI of less than about 0.2.
[0402] C104. The method of any one of C96-C103, wherein the nanoparticles have a PDI of about 0.1, about 0.11, about 0.12, about 0.13, about 0.14, about 0.15, about 0.16, about 0.17, about 0.18, about 0.19, or about 0.2.
[0403] C105. The method of any one of C96-C104, wherein the aluminum is obtained by microfluidizing aluminum hydroxide or aluminum phosphate. C106. The method of any one of C87-C105, wherein the nucleotide comprises CpG oligonucleotides.
[0404] C107. The method of any one of C87-C106, wherein the nucleotide comprises CpG oligodeoxynucleotides (CpG ODN).
[0405] C108. The method of any one of C87-C107, wherein the nucleotide comprises at least one phosphorothioate internucleotide linkage.
[0406] C109. The method of any one of C87-C108, wherein the nucleotide comprises phosphorothioate internucleotide linkages for each internucleotide linkage.
[0407] C110. The composition of any one of C87-C109, wherein the nucleotide comprises a CpG motif consisting of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, or 24 nucleotides.
[0408] C111. The composition of any one of C87-C110, wherein the nucleotide consists of between 15 and 30 nucleotides.
[0409] C112. The composition of any one of C87-C111 , wherein the nucleotide consists of 20, 21, 22, 23, or 24 nucleotides.
[0410] C113. The method of any one of C87-C112, wherein the nucleotide comprises the sequence of any one of SEQ ID Nos: 1-23.
[0411] C114. The method of any one of C87-C113, wherein the nucleotide consists of the sequence of any one of SEQ ID Nos: 1-23.
[0412] C115. The method of any one of C87-C114, wherein the nucleotide comprises the sequence of SEQ ID NO: 2.
[0413] C116. The method of any one of C87-C115, wherein the nucleotide consists of the sequence of SEQ ID NO: 2.
[0414] C117. The method of any one of C87-C114, wherein the nucleotide comprises the sequence of SEQ ID NO: 9. C118. The method of any one of C87-C114 or C117, wherein the nucleotide consists of the sequence of SEQ ID NO: 9.
[0415] C119. The method of any one of C96-C118, wherein the composition comprising the nanoparticles is obtained by combining nucleotides and aluminum hydroxide at a ratio of nucleotides to aluminum hydroxide by mass (pg) between about 0.5:1 and about 2.5:1.
[0416] C120. The method of any one of C95-C119, wherein the composition comprising the nanoparticles is obtained by combining nucleotides and aluminum hydroxide at a ratio of nucleotides to aluminum hydroxide by mass (pg) between about 2:1 and about 3:1.
[0417] C121. The method of any one of C95-C120, wherein the composition comprising the nanoparticles is obtained by combining nucleotides and aluminum hydroxide at a ratio of nucleotides to aluminum hydroxide by mass (pg) of about 2.1 :1 , about 2.2:1 , about 2.3:1 , about 2.4:1 , about 2.5:1 , about 2.6:1 , about 2.7:1 , about 2.8:1 , about 2.9:1 , or about 3:1.
[0418] C122. The method of any one of C95-C121 , wherein the composition comprising the nanoparticles is obtained by combining nucleotides and aluminum hydroxide at a ratio of nucleotides to aluminum hydroxide by mass (pg) of about 2.4:1.
[0419] C123. The method of any one of C95-C118, wherein the composition comprising the nanoparticles is obtained by combining nucleotides, aluminum hydroxide, and PAA, wherein the ratio of nucleotides to aluminum hydroxide by mass (pg) is between about 1 :0.5 and about 1 :2.
[0420] C124. The method of any one of C95-C118 or C123, wherein the composition comprising the nanoparticles is obtained by combining nucleotides, aluminum hydroxide, and PAA, wherein the ratio of nucleotides to aluminum hydroxide by mass (pg) is between about 1 :1 and about 1 :2.
[0421] C125. The method of any one of C95-C118 or C123-C124, wherein the composition comprising the nanoparticles is obtained by combining nucleotides, aluminum hydroxide, and PAA, wherein the ratio of nucleotides to aluminum hydroxide by mass (pg) is about 1 :1 , about 1.1 :1 , about 1.2:1 , about 1.3:1 , about 1.4:1 , about 1.5:1 , about 1.6:1 , about 1.7:1 , about 1.8:1 , about 1.9:1 , or about 1 :2.
[0422] C126. The method of any one of C95-C118 or C123-C125, wherein the composition comprising the nanoparticles is obtained by combining nucleotides, aluminum hydroxide, and PAA, wherein the ratio of nucleotides to aluminum hydroxide by mass (pg) is about 1 :1.5. C127. The method of any one of C95-C118 or C123-C126, wherein the composition comprising the nanoparticles is obtained by combining nucleotides, aluminum hydroxide, and PAA, wherein the ratio of nucleotide to PAA by mass (pg) is between about 1 :0.5 and about 1 :2.
[0423] C128. The method of any one of C95-C118 or C123-C127, wherein the composition comprising the nanoparticles is obtained by combining nucleotides, aluminum hydroxide, and PAA, wherein the ratio of nucleotide to PAA by mass (pg) is about 1:0.5, about 1:0.75, about 1:1, about 1 :1.25, about 1:1.5, about 1 :1.75, or about 1:2.
[0424] C129. The method of any one of C95-C118 or C123-C128, wherein the composition comprising the nanoparticles is obtained by combining nucleotides, aluminum hydroxide, and PAA, wherein the ratio of nucleotide to PAA by mass (pg) is between about 1 :0.5 and about 1 :1.
[0425] C130. The method of any one of C95-C118 or C123-C129, wherein the composition comprising the nanoparticles is obtained by combining nucleotides, aluminum hydroxide, and PAA, wherein the ratio of nucleotide to PAA by mass (pg) is about 1:0.75.
[0426] C131. The method of any one of C73-C130, wherein the composition is for use as an adjuvant.
[0427] C132. The method of any one of C73-C131 , wherein the microfluidic device is a high-volume microfluidic device having a minimum sample size of about 10 ml, about 20 ml, about 30 ml, about 40 ml, or about 50 ml.
[0428] C133. The method of any one of C73-C132, wherein the nanoparticles are produced by between about 5 and about 30 passes through the microfluidic device.
[0429] C134. The method of any one of C73-C133, wherein the nanoparticles are produced by about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, or about 20 passes through the microfluidic device.
[0430] C135. The method of any one of C73-C134, wherein the microfluidic device is used at a pressure between about 500 pound per square inch (PSI) and about 50,000 PSI.
[0431] C136. The method of any one of C73-C135, wherein the microfluidic device is used at a pressure of about 500 PSI, about 1,000 PSI, about 5,000 PSI, about 10,000 PSI, about 15,000 PSI, about 20,000 PSI, about 25,000 PSI, about 30,000 PSI, about 35,000 PSI, about 40,000 PSI, about 45,000 PSI, or about 50,000 PSI.
[0432] C137. The method of any one of C73-C136, wherein the microfluidic device is used at a pressure of about 30,000 PSI.
[0433] C138. The method of any one of C73-C137, wherein the aluminum is obtained by microfluidizing a gel comprising aluminum in the microfluidic device.
[0434] C139. The method of any one of C73-C138, wherein the aluminum is obtained by microfluidizing a gel comprising aluminum hydroxide in the microfluidic device.
[0435] C140. The method of any one of C73-C139, wherein the method further comprising filter sterilizing the composition comprising the nanoparticles.
[0436] C141. The method of any one of C73-C140, wherein the method further comprising filter sterilizing the composition comprising the nanoparticles using a filter comprising polyethersulfone (PES) or polyvinylidene difluoride (PVDF).
[0437] C142. The method of C140 or C141 , wherein the filter comprises a monolayer membrane.
[0438] C143. The method of any one of C140-C142, wherein the filter comprises a pore size between about 0.2 pm and about 0.3 pm.
[0439] C144. The method of any one of C140-C143, wherein the filter comprises a pore size of about 0.2 pm or about 0.22 pm.
[0440] C145. The method of C140 or C141 , wherein the filter comprises a bilayer membrane.
[0441] C146. The method of C145, wherein one of the membranes within the bilayer comprises a pore size between about 0.2 pm and about 0.3 pm.
[0442] C147. The method of C145 or C146, wherein one of the membranes within the bilayer comprises a pore size of about 0.2 pm or about 0.22 pm.
[0443] C148. The method of any one of C145-C147, wherein one of the membranes within the bilayer comprises a pore size between about 0.4 pm and about 0.5 pm. C149. The method of any one of C145-C148, wherein one of the membranes within the bilayer comprises a pore size of about 0.45 pm. C150. The method of any one of C140-C149, wherein the Vmax of the composition through the filter measured in liters per meter squared (L / m2) is between about 60 and about 75.
[0444] C151. The method of any one of C140-C150, wherein the Vmax of the composition through the filter is between about 65 L / m2and about 66 L / m2.
[0445] C152. The method of any one of C140-C150, wherein the Vmax of the composition through the filter is between about 71 L / m2and about 72 L / m2.
Claims
WHAT IS CLAIMED IS:
1. A composition comprising nanoparticles comprising aluminum and CpG oligodeoxynucleotides (CpG ODN) within a complex, wherein the nanoparticles have an average size less than about 100 nanometers (nm).
2. The composition of claim 1, wherein the nanoparticles have an average size between about 80 nm and about 90 nm.
3. The composition of claim 1 or 2, wherein the nanoparticles have an average size of about 80 nm, about 81 nm, about 82 nm, about 83 nm, about 84 nm, about 85 nm, about 86 nm, about 87 nm, about 88 nm, about 89 nm, or about 90 nm.
4. The composition of any one of claims 1-3, wherein the average size is the z-average diameter of the nanoparticles.
5. The composition of any one of claims 1-4, wherein the nanoparticles have a polydispersity index (PDI) of less than about 0.2, about 0.3, or about 0.4.
6. The composition of any one of claims 1-5, wherein the nanoparticles have a polydispersity index (PDI) of less than about 0.2.
7. The composition of any one of claims 1-6, wherein the nanoparticles further comprise an anionic compound.
8. The composition of claim 7, wherein the anionic compound is polyacrylic acid (PAA).
9. The composition of any one of claims 1-8, wherein the CpG ODN comprises a CpG motif consisting of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides.
10. The composition of any one of claims 1-9, wherein the CpG ODN consists of 20, 21, 22, 23, or 24 nucleotides.
11. The composition of any one of claims 1-10, wherein the CpG ODN comprises at least one phosphorothioate internucleotide linkage.
12. The composition of any one of claims 1-11, wherein the CpG ODN comprises the sequence of any one of SEQ ID Nos: 1-23.
13. The composition of any one of claims 1-12, wherein the CpG ODN consists of the sequence of any one of SEQ ID Nos: 1-23.
14. The composition of any one of claims 1-13, wherein the CpG ODN comprises the sequence of SEQ ID NO: 2 or SEQ ID NO: 9.
15. The composition of any one of claims 1-14, wherein the CpG ODN consists of the sequence of SEQ ID NO: 2 or SEQ ID NO: 9.
16. The composition of any one of claims 1-15, wherein the composition further comprises a histidine buffer, wherein the concentration of histidine is between about 1 mM and about 50 mM and the pH is between about 6 and about 7.
17. The composition of claim 16, wherein the histidine concentration is about 10 mM and the pH is about 6.5.
18. The composition of any one of claims 1-15, wherein the composition further comprises a Tris buffer, wherein the concentration of Tris is between about 1 mM and about 50 mM and the pH is between about 7 and about 8.
19. The composition of claim 18, wherein the Tris concentration is about 10 mM and the pH is about 7.4.
20. The composition of any one of claims 1-19, wherein the average size of the nanoparticles is measured at time zero (TO), wherein TO is the time when the formulation of the composition comprising the nanoparticles is completed.
21. The composition of any one of claims 5-19, wherein the PDI of the nanoparticles is measured at time zero (TO), wherein TO is the time when the formulation of the composition comprising the nanoparticles is completed.
22. The composition of any one of claims 1-21 , wherein the nanoparticles maintain an average size (nm) that deviates by no more than about 10% of the value of their average size at time zero (TO) for at least about 3 months after TO.
23. The composition of any one of claims 1-22, wherein the nanoparticles maintain a PDI that deviates by no more than about 20% of the value of their PDI at time zero (TO) for at least about 3 months after TO.
24. The composition of any one of claims 1-23, wherein the composition is for use as an adjuvant.
25. A method for producing the composition comprising the nanoparticles of any one of claims 1-24, wherein the method comprises the use of a microfluidic device to produce the nanoparticles.
26. The method of claim 25, wherein the aluminum is obtained by microfluidizing a gel comprising aluminum hydroxide in the microfluidic device.
27. The method of claim 25 or 26, wherein the composition comprising the nanoparticles is obtained by combining CpG ODN and aluminum hydroxide at a ratio of CpG ODN to aluminum hydroxide by mass (pg) between about 2:1 and about 3:1.
28. The method of any one of claims 25-27, wherein the composition comprising the nanoparticles is obtained by combining CpG ODN and aluminum hydroxide at a ratio of CpG ODN to aluminum hydroxide by mass (pg) of about 2.4:1.
29. The method of claim 25 or 26, wherein the composition comprising the nanoparticles is obtained by combining CpG ODN, aluminum hydroxide, and PAA, wherein the ratio of CpG ODN to PAA by mass (pg) is between about 1:0.5 and about 1 :1.
30. The method of claim 25, 26, or 29, wherein the composition comprising the nanoparticles is obtained by combining CpG ODN, aluminum hydroxide, and PAA, wherein the ratio of CpG ODN to PAA by mass (pg) is about 1:0.75.
31. The method of claim 25-26 or 29-30, wherein the composition comprising the nanoparticles is obtained by combining CpG ODN, aluminum hydroxide, and PAA, wherein the ratio of CpG ODN to aluminum hydroxide by mass (pg) is between about 1:1 and about 1 :2.
32. The method of any one of claims 25-26 or 29-31 , wherein the composition comprising the nanoparticles is obtained by combining CpG ODN, aluminum hydroxide, and PAA, wherein the ratio of CpG ODN to aluminum hydroxide by mass (pg) is about 1 :1.5.
33. The method of any one of claims 25-32, wherein the method further comprises filter sterilizing the composition comprising the nanoparticles using a PVDF filter.
34. The method of claim 33, wherein the filter has a pore size between about 0.2 pm and about 0.3 pm.
35. The method of any one of claims 25-34, wherein the microfluidic device is a high-volume microfluidic device having a minimum sample size of about 10 ml, about 20 ml, about 30 ml, about 40 ml, or about 50 ml.
36. The method of any one of claims 25-35, wherein the nanoparticles are produced by between about 5 and about 25 passes through the microfluidic device.
37. The method of any one of claims 25-36, wherein the nanoparticles are produced by about 10, about 11 , about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, or about 20 passes through the microfluidic device.
38. The method of any one of claims 25-37, wherein the microfluidic device is used at a pressure between about 500 pound per square inch (PSI) and about 30,000 PSI.
39. The method of any one of claims 25-38, wherein the microfluidic device is used at a pressure of about 30,000 PSI.
Citation Information
Patent Citations
Oligonucleotide therapeutic agent and methods of making same
EP0092574A1
Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US4469863A
Oligonucleotide therapeutic agent and method of making same
US5023243A
Bi-directional oligonucleotides that bind thrombin
US5658738A
Bi-directional oligonucleotides that bind thrombin
US5668265A