Mature forebrain assembloid, preparation method therefor, and schizophrenia biomarker

A method for manufacturing a forebrain assembler with mature laminar organization and functional connectivity addresses the limitations of current brain organoids, providing a reproducible model for studying neurodevelopmental disorders.

WO2025239654A1PCT designated stage Publication Date: 2025-11-20SEOUL NATIONAL UNIVERSITY R&DB FOUNDATION
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/006489
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-05-13
Filing Date
2025-05-13
Publication Date
2025-11-20

AI Technical Summary

Technical Problem

Current brain organoids fail to accurately recapitulate the mature human brain, lacking mature cortical laminar structures and cellular diversity, and suffer from size and morphology inconsistencies, limiting their ability to study subtle disease-related phenotypes.

Method used

A step-by-step method involving culturing pluripotent stem cells to form forebrain organoids, activating Hedgehog and Wnt signaling pathways, separating into single rosette structures, encapsulating with reelin-expressing neurons, and injecting glial cells to create a forebrain assembler with six cortical layers and glial cells.

Benefits of technology

The method produces a forebrain assembler with mature laminar organization and functional connectivity, exhibiting high reproducibility and similarity to the human brain, enabling the study of neurodevelopmental disorders like schizophrenia.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025006489_20112025_PF_FP_ABST
    Figure KR2025006489_20112025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a forebrain assembloid that exhibits a maturity similar to that of the human brain, and a schizophrenia biomarker identified using the forebrain assembloid. More specifically, the present invention relates to: a method for preparing a forebrain assembloid; a forebrain assembloid having a single rosette structure that includes six cortical layers and cavities, the cortical layers including glial cells; a composition for diagnosing schizophrenia, comprising an agent for measuring the expression level of UCN, an agent for measuring the expression level of PTPRF, an agent for measuring the expression level of WNT11, and an agent for measuring the expression level of THBS4; and a kit comprising the composition for diagnosing schizophrenia.
Need to check novelty before this filing date? Find Prior Art

Description

Mature forebrain assembler, its manufacturing method, and schizophrenia biomarker

[0001] The present invention relates to a whole brain assembler showing a maturity level similar to that of the human brain and a schizophrenia biomarker identified by the whole brain assembler, and more particularly, to a method for manufacturing a whole brain assembler; a whole brain assembler comprising a single rosette structure including six cortical layers and a cavity, wherein the whole brain assembler is characterized in that the cortical layer includes glial cells; a composition for diagnosing schizophrenia, characterized in that it includes an agent for measuring a UCN expression level, an agent for measuring a PTPRF expression level, an agent for measuring a WNT11 expression level, and an agent for measuring a THBS4 expression level; and a schizophrenia diagnostic kit comprising the composition.

[0002] Brain organoids, three-dimensional (3D) self-organizing tissues derived from pluripotent stem cells, have been developed for many years. Beginning with early forebrain organoids, they have evolved into region-specific organoids such as cortical, midbrain, and subcortical organoids, and more recently, connected hybrid organoids. While conventional neural cell culture methods and genetically engineered mouse models fail to adequately recapitulate the complex dynamics of cell-to-cell interactions occurring in the human brain, brain organoids mimic the tissue architecture and cellular composition of the human brain in vivo, serving as an innovative platform for studying human brain pathophysiology.

[0003] Although brain organoids provide a useful system for studying the human brain, current brain organoids still have several significant limitations. First, current model systems do not accurately recapitulate the mature human brain. Currently available brain organoids only recapitulate the embryonic to early fetal stages of the human brain, lacking the mature organization of cortical laminar structures and the cellular diversity of the human brain. Furthermore, limited oxygen and nutrient diffusion ultimately leads to the formation of necrotic cores within brain organoids, limiting the size and cellular diversity of brain organoids. Second, heterogeneity in size and morphology between individual organoids and batches, as well as batch effects, remain challenges. The reproducibility issues of current brain organoid technology are primarily due to difficulties in controlling the number and size of rosettes, neural tube-like neuroepithelial structures, in conventional multi-rosette organoids. These structures differ from the in vivo developmental structure of the human brain, which includes a single ventricular zone.

[0004] Various approaches have been attempted to enhance the maturity of brain organoids, including long-term culture methods to prevent cell death during long-term culture and co-culture with glial cells to increase cellular complexity. However, these organoids lack mature cortical laminar organization and mature synaptic interactions between neurons and glia, failing to recapitulate the functional connectivity of the human brain and limiting their ability to study subtle disease-related phenotypes. Furthermore, the inconsistency and heterogeneity of these organoids in size and shape still pose significant reproducibility challenges.

[0005] [Prior Art Literature]

[0006] [Non-patent literature]

[0007] (Non-patent Document 0001) Lancaster, MA et al. “Cerebral organoids model human brain development and microcephaly”, Nature501, 373-379 (2013).

[0008] Against this backdrop, the present inventors developed a step-by-step, module-based cellular reconstruction technique for sequentially constructing whole-brain assemblers. The single rosette-based whole-brain assemblers, developed through sequential reconstruction with non-neuronal glial cells, exhibited high consistency and uniformity with minimal heterogeneity and placement effects. Furthermore, we confirmed that these whole-brain assemblers recapitulated the six-layer cortical structure with mature laminar organization and functional connectivity between neurons and glial cells. Furthermore, we constructed whole-brain assemblers derived from schizophrenia patients, demonstrating the importance of dynamic cellular interactions between neurons and glial cells in specific stages of human brain development and the pathogenesis of human SCZ. In other words, we completed the present invention by confirming that the whole-brain assemblers can be applied to understanding the pathophysiology of various human neurodevelopmental disorders, such as SCZ, during human brain development.

[0009] Accordingly, an object of the present invention is to provide a method for manufacturing a whole brain assembly comprising the following steps:

[0010] (a) A step of culturing pluripotent stem cells (PSCs) to form forebrain organoids;

[0011] (b) a step of treating a substance that activates the Hedgehog and Wnt signaling pathways of the forebrain organoid;

[0012] (c) a step of separating the forebrain organoid into a single rosette structure to form a single rosette forebrain organoid;

[0013] (d) a step of culturing the single rosette forebrain organoid by encapsulating it with reelin (RELN) expressing neurons; and

[0014] (e) A step of producing a forebrain assembler by injecting glial cells into the single rosette forebrain organoid.

[0015] Another object of the present invention is to provide a whole brain assembly manufactured by the above manufacturing method.

[0016] Another object of the present invention is to provide a forebrain assembler comprising a single rosette structure including six cortical layers and a cavity, characterized in that the cortical layer includes glial cells.

[0017] In addition, another object of the present invention is to provide a composition for diagnosing schizophrenia, characterized by including a preparation for measuring UCN expression level, a preparation for measuring PTPRF expression level, a preparation for measuring WNT11 expression level, and a preparation for measuring THBS4 expression level.

[0018] Furthermore, another object of the present invention is to provide a kit for diagnosing schizophrenia comprising the composition.

[0019] To solve the above-described problem, a method for manufacturing a whole brain assembler is provided, comprising the following steps:

[0020] (a) A step of culturing pluripotent stem cells (PSCs) to form forebrain organoids;

[0021] (b) a step of treating a substance that activates the Hedgehog and Wnt signaling pathways of the forebrain organoid;

[0022] (c) a step of separating the forebrain organoid into a single rosette structure to form a single rosette forebrain organoid;

[0023] (d) a step of culturing the single rosette forebrain organoid by encapsulating it with reelin (RELN) expressing neurons; and

[0024] (e) A step of producing a forebrain assembler by injecting glial cells into the single rosette forebrain organoid.

[0025] At this time, the above-mentioned forebrain assembler may be a human forebrain assembler.

[0026] At this time, the substances that activate the Hedgehog and Wnt signal pathways in the above step (b) may be CHIR99021 and SAG.

[0027] At this time, the CHIR99021 may be at a concentration of 0.1 to 5 μM, and the SAG may be at a concentration of 100 to 1000 nM.

[0028] At this time, the manufacturing method may additionally include a step of manufacturing a relin-expressing neuron before the step (d).

[0029] At this time, the above-mentioned reelin-expressing neurons may be produced by transducing reelin into neural progenitor cells.

[0030] At this time, the above-mentioned relin-expressing neurons were 1×10 3 1×10 5 It could be personal.

[0031] At this time, in the step (e), the glial cells may be at least one selected from the group consisting of astrocytes and microglia.

[0032] At this time, the stellate cells are 1×10 3 1×10 5 It is a dog, and the microglia are 1×10 2 1×10 4 It could be personal.

[0033] At this time, the single rosette forebrain organoid has a virtual first line penetrating the outer cortical layer of the single rosette forebrain organoid,

[0034] A virtual second line penetrating the outer cortical layer of the single rosette forebrain organoid but orthogonal to the first line, and

[0035] A virtual third line penetrating the outer cortical layer of the single rosette forebrain organoid, but orthogonal to the first line and the second line,

[0036] The first line, the second line and the third line penetrate the center of the single rosette forebrain organoid,

[0037] The above-mentioned glial cells may be injected into the outer cortical layer of the single rosette forebrain organoid at a location where the first line, the second line, and the third line contact the outer cortical layer of the single rosette forebrain organoid.

[0038] At this time, the substance that activates the Hedgehog and Wnt signal pathways in the step (b) may be treated for 5 to 10 days.

[0039] At this time, in the above step (d), the culture may be performed for 10 to 20 days.

[0040] At this time, the manufacturing method may additionally include a step of culturing and maturing the whole brain assembler for an additional 10 to 40 days after the step (e).

[0041] In addition, the present invention provides a whole brain assembly manufactured by the above manufacturing method.

[0042] In addition, the present invention provides a forebrain assembler comprising a single rosette structure including six cortical layers and a cavity, characterized in that the cortical layer includes glial cells.

[0043] At this time, the above-mentioned forebrain assembler may be a human forebrain assembler.

[0044] At this time, the six cortical layers may be the first layer expressing RELN, the second layer expressing CUX2, the third layer expressing BRN2, the fourth layer expressing SATB2, the fifth layer expressing CTIP2, and the sixth layer expressing TBR1.

[0045] At this time, the glial cells may be at least one selected from the group consisting of astrocytes and microglia.

[0046] At this time, the microglia may be in a state of moving within the assembler.

[0047] At this time, the assembler may exhibit spontaneous neural activity and include a functionally connected neural network.

[0048] At this time, the assembler may additionally include one or more cell types selected from the group consisting of radial glial cells, intermediate progenitor cells, excitatory neurons, and inhibitory neurons.

[0049] In addition, the present invention provides a composition for diagnosing schizophrenia, characterized in that it comprises a preparation for measuring UCN expression level, a preparation for measuring PTPRF expression level, a preparation for measuring WNT11 expression level, and a preparation for measuring THBS4 expression level.

[0050] At this time, the composition may additionally include an agent for measuring the TP53 expression level and an agent for measuring the NFATC4 expression level.

[0051] At this time, the composition for diagnosing schizophrenia is applied to a whole brain assembler manufactured by culturing cells isolated from an individual whose onset of schizophrenia is to be confirmed.

[0052] The above brain assembler is,

[0053] (a) a step of forming a forebrain organoid by culturing pluripotent stem cells derived from the above entity;

[0054] (b) a step of treating a substance that activates the Hedgehog and Wnt signaling pathways of the forebrain organoid;

[0055] (c) a step of separating the forebrain organoid into a single rosette structure to form a single rosette forebrain organoid;

[0056] (d) culturing the single rosette forebrain organoid by encapsulating it with reelin-expressing neurons; and

[0057] (e) It may be manufactured through a step of manufacturing a forebrain assembler by injecting the individual-derived glial cells into the single rosette forebrain organoid.

[0058] Furthermore, the present invention provides a kit for diagnosing schizophrenia comprising the composition.

[0059] The whole brain assembler of the present invention exhibits a maturity that mimics the structure and function of the human brain, and has been confirmed to exhibit high reproducibility with no significant variation between batches, and thus can be usefully utilized for disease models and new drug development related to brain diseases. In addition, it is expected that the development of new drugs in a novel way that has never been seen before will be possible by utilizing the miracle of schizophrenia development according to the epigenetic gene expression variation of neural precursors in the early stage of brain development in schizophrenia patients and the signal feedback variation between neurons and surrounding microglia and astrocytes in the late stage of development, which were identified through the whole brain assembler, and thus the whole brain assembler and schizophrenia biomarker of the present invention have high utility value.

[0060] Figure 1 shows the process of experimentally producing a whole brain assembler.

[0061] Figure 2 shows forebrain organoids immunostained for neural progenitor cells (SOX2) and neurons (TUJ1) with or without CHIR99021 and SAG treatment.

[0062] Figure 3 quantifies the NPC population by counting the number of SOX2-positive cells within each rosette, with the counts being from all organoids (numbers on the x-axis) in each group.

[0063] Figure 4 quantifies the rosette size by measuring the diameter of SOX2-positive rosettes, counting the number of all organoids in each group (numbers on the x-axis).

[0064] Figure 5 quantifies the VZ thickness by measuring the VZ thickness within each rosette, and is the result of counting all organoids (numbers on the x-axis) in each group.

[0065] Figure 6 quantifies the number of rosettes in three sections within one organoid, counted from all organoids in each group (numbers on the x-axis).

[0066] Figure 7 shows the before and after separation into a single rosette, and shows the results of quantifying the rosette size after separation according to the length of the diameter. The normal distribution is represented by a curve, and the median diameter is represented by a vertical line.

[0067] Figure 8 shows the results of immunostaining with SOX2 and ZO-1 after separation into single rosettes on day 32, and quantifying the proportion of rosettes with distinct cavities or partially protruding NPCs.

[0068] Figure 9 shows an image of a single rosette surrounded by a RELN expression layer, immunostained with SOX2 and RELN.

[0069] Figure 10 shows the results of immunocytochemical analysis of hPSC-derived relin-expressing neurons.

[0070] Figure 11A shows the microinjection process of glial cells (astrocytes and microglia), and Figure 11B shows the results of labeling astrocytes and microglia in intermediate assembles with RFP and GFP, respectively, immediately after glial cell microinjection (day 50).

[0071] Figure 12 shows the results of immunocytochemical analysis of hPSC-derived astrocytes and microglia.

[0072] Figure 13 shows the image of the whole brain assembler (day 80) and the results of measuring the diameter value.

[0073] Figure 14 is an image showing the morphological structure and neurites of neurons in a forebrain assembler (day 80), with white arrowheads indicating dendritic spines.

[0074] Figure 15 shows a forebrain assembler (day 80) immunostained with MAP2 to visualize neurites along the cortical layers.

[0075] Figure 16 shows a merged image of a section within a whole brain assembler immunostained with TBR1 / CTIP2, SATB2 / RELN, and BRN2 / CUX2, and individual images of TBR1, CTIP2, SATB2, BRN2, CUX2, and RELN positive layers.

[0076] Figure 17 shows the results of quantifying cortical layer thickness by dividing the cortical plate image of the whole brain assembler into 15 equal sections from apical to basal, calculating the ratio of the number of layer-specific marker-positive cells in each section to the total number of neurons, and assigning each section to one of the six cortical layers according to the ratio. Cortical thickness is represented by an independent bar in the graph.

[0077] Figure 18 shows the results of immunostaining analysis of the morphology and function of astrocytes in the forebrain assembler (day 80), with yellow arrowheads indicating tripartite synapses.

[0078] Figure 19 shows the results of immunostaining analysis of the morphology and function of microglia in the forebrain assembler (day 80).

[0079] Figure 20 shows the number of spikes per minute analyzed through calcium imaging of selected cells from the whole brain assembler.

[0080] Figure 21 shows an array-wide spike histogram (AWSH) and recording plot analyzed by MEA in a whole-brain assembler, with network bursts highlighted in magenta.

[0081] Figure 22 shows the weighted average firing rate (Figure 22A), burst frequency (Figure 22B), and inter-burst interval (Figure 22C) of the whole brain assembler measured using MEA.

[0082] Figure 23 shows the results of calcium imaging analysis at the bulk region level of the whole brain assembler.

[0083] Figure 24 shows the results of calcium imaging analysis of selected cells from the whole brain assembler.

[0084] Figure 25 shows the number of network bursts of the whole brain assembler measured using MEA.

[0085] Figure 26 shows a tSNE plot for scRNA-seq data of the whole brain assembler and the results of analyzing the proportion of individual cell types.

[0086] Figure 27 is a dot plot showing the expression of genes in each cluster within the whole brain assembler (circle size: cell ratio, shade: expression level).

[0087] Figure 28 shows a heatmap of pseudobulk gene expression correlation coefficients between the whole brain assembler and human fetal brain tissue from the BrainSpan dataset (pcw: weeks post-conception, mos: months, yrs: years).

[0088] Figure 29 shows a UMAP plot of scRNA-seq data for the cluster labeled as excitatory neurons in Figure 26.

[0089] Figure 30 shows the results of analyzing the individual cell ratios according to six cortical layers in the whole brain assembler.

[0090] Figure 31 is a violin plot showing marker genes expressed in each of the six cortical layers of the forebrain assembler presented in Figure 29.

[0091] Figure 32 shows the results of trajectory analysis of excitatory neurons in the forebrain assembler, color-coded into six cortical layers.

[0092] Figure 33 shows the results of SOX2 and TUJ1 immunostaining of normal and SCZ early forebrain organoids (day 32), the results of quantifying NPCs by counting the number of SOX2-positive cells in each rosette, the results of quantifying the VZ thickness of each rosette, the results of quantifying the size of SOX2+ rosettes, and the results of quantifying the number of rosettes.

[0093] Figure 34 shows the images of normal and SCZ early forebrain organoids (day 32) immunostained with Ki67 and the results of quantifying NPC proliferation by calculating the ratio of Ki67-positive cells to total SOX2-positive cells. The dotted line indicates the border between the VZ and the ventricle.

[0094] Figure 35 shows SOX2 and TUJ1 immunostaining images of normal and SCZ early forebrain organoids (day 32).

[0095] Figure 36 shows Ki67 immunostaining images of normal and SCZ early forebrain organoids (day 32).

[0096] Figure 37 shows the normal group and SCZ early forebrain organoids (day 32) immunostained with phospho-vimentin (p-Vim) and the NPC ratio according to the direction of cell division (0-30°: horizontal, 30-60°: oblique, 60-90°: vertical) in each section. The dotted line indicates the border between the VZ and the ventricle, and the white arrows indicate NPCs that divided horizontally, and the red arrows indicate NPCs that divided obliquely or vertically.

[0097] Figure 38 shows p-Vim immunostaining images of normal and SCZ early forebrain organoids (day 32), where white arrows indicate horizontally divided NPCs and red arrows indicate obliquely or vertically divided NPCs.

[0098] Figure 39 shows the results of quantifying the cortical thickness of six cortical layers of normal and SCZ forebrain assembler (day 80) and dividing the six cortical layers based on the expression of markers specifically expressed in each layer.

[0099] Figure 40A shows the results of quantifying synapse density by calculating the number of synapses per unit area of ​​normal and SCZ forebrain assembles (day 80) immunostained for neurons (MAP2) and synapses (PSD95), and Figure 40B shows the results of quantifying the weighted average firing rate measured via MEA and the MEA single electrode recording plot, and Figure 40C shows the results of calcium imaging analysis of cells selected from each assembled cell and the results of quantifying the number of spikes per minute.

[0100] Figure 41A shows immunostaining images of neurons (MAP2) and synapses (PSD95) in normal and SCZ forebrain assembles (day 80), Figure 41B shows MEA recording plots of a single electrode, and Figure 41C shows the results of calcium imaging analysis of selected cells.

[0101] Figure 42 illustrates the co-expression network analysis process for bulk RNA-seq data of postmortem brain tissue.

[0102] Figure 43 shows the results of identifying three initial modules (ME13, ME26, and ME58) through time-dependent gene expression analysis of each module, and the results of analyzing the cell type specificity of the initial modules.

[0103] Figure 44 shows the Log2FC values ​​of SCZ differentially expressed genes included in the NPC module (ME13), GO analysis for the NPC module, and the results of transcription factor abundance analysis for genes included in the NPC module.

[0104] Figure 45 shows the results of measuring the relative expression levels of TP53 and NFATC4 in normal and SCZ early forebrain organoids.

[0105] Figure 46 shows the results of immunostaining control, TP53 KO, NFATC4 KO, TP53, NFATC4-KO organoids derived from SCZ patients with SOX2 and TUJ1, quantifying the VZ thickness, and quantifying the number of NPCs by counting the number of SOX2+ positive cells.

[0106] Figure 47 shows the results of immunostaining control, TP53 KO, NFATC4 KO, TP53, and NFATC4-KO organoids derived from SCZ patients with Ki67 and quantifying NPC proliferation by calculating the ratio of Ki67-positive cells to SOX2-positive cells. The dotted line indicates the border between the VZ and the ventricle.

[0107] Figure 48 shows the results of immunostaining with p-Vim in control, TP53 KO, NFATC4 KO, TP53, and NFATC4-KO organoids derived from SCZ patients, and quantification of the percentage of NPCs that divided horizontally, obliquely, or vertically (0-30°: horizontal, 30-60°: obliquely, 60-90°: vertical). The dotted line indicates the border between the VZ and the ventricle, white arrows indicate horizontally divided NPCs, and red arrows indicate obliquely or vertically divided NPCs.

[0108] Figure 49 shows the results of RNA-seq analysis of control, TP53 KO, NFATC4 KO, TP53, and NFATC4-KO organoids derived from SCZ patients, including an RNA-seq analysis heatmap, Pearson correlation coefficients calculated based on DEGs, and an RNA-seq PCA plot.

[0109] Figure 50 shows the results of GO analysis on TP53, NFATC4-KO organoids using selected DEGs.

[0110] Figure 51 shows eight mix-and-match forebrain assembles produced by combining normal or SCZ forebrain organoids with normal or SCZ-derived glial cells.

[0111] Figure 52A shows the results of quantifying the synapse density by calculating the number of synapses per unit area in the above-mentioned combinatorial whole-brain assembler, Figure 52B shows the results of quantifying the weighted average firing rate, and Figure 52C shows the results of quantifying the number of spikes per minute by analyzing five cells selected from the above-mentioned combinatorial whole-brain assembler by calcium imaging.

[0112] Figure 53 shows the experimental process of functional analysis of the forebrain assembler according to the presence or absence of glial cells.

[0113] Figure 54 shows the results of immunostaining analysis and quantification of synapse density in normal and SCZ forebrain assembles (with or without glial cells).

[0114] Figure 55 shows the MEA recording plots of single electrodes from normal and SCZ forebrain assembles (with or without glial cells) and the results of quantifying the weighted average firing rate through MEA measurements.

[0115] Figure 56 shows the results of calcium imaging analysis of selected cells from normal and SCZ forebrain assembles (with or without glial cells) and the results of quantifying the number of spikes per minute through calcium imaging.

[0116] Figure 57 illustrates common neuronal and glial factors identified in the cell-cell interaction prediction analysis of the forebrain assembler and postmortem brain tissue.

[0117] Figure 58 shows the results of measuring the relative expression levels of UCN, PTPRF, WNT11, and THBS4 in neurons, astrocytes, and microglia isolated from normal and SCZ forebrain assembler, respectively.

[0118] Figure 59 illustrates the dynamic interaction between neurons and glial cells.

[0119] Figure 60A shows the results of immunostaining analysis, MEA recording plot, and calcium imaging analysis for synapse density in SCZ forebrain assembles and UCN / PTPRF KO SCZ forebrain assembles, and Figure 60B shows the results of quantifying synapse density, weighted average firing rate, and spikes per minute.

[0120] Figure 61A shows the results of measuring the relative expression levels of UCN and PTPRF in neurons isolated from genetically engineered forebrain assembler, and Figure 61B shows the results of measuring the relative expression levels of WNT11 and THBS4 in astrocytes and microglia, respectively, isolated from genetically engineered forebrain assembler.

[0121] Figure 62A shows the results of immunostaining analysis, MEA recording plot, and calcium imaging analysis of synapse density in SCZ forebrain assembles and SCZ neurons, WNT11-depleted astrocytes, and THBS4-depleted microglia reconstituted, and Figure 62B shows the results of quantifying synapse density, weighted average firing rate, and spikes per minute.

[0122] Hereinafter, the present invention will be described in more detail.

[0123] Meanwhile, each description and embodiment disclosed herein can also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed herein fall within the scope of the present invention. Furthermore, the scope of the present invention is not limited by the specific descriptions described below.

[0124] Furthermore, those skilled in the art will recognize or be able to ascertain, using no more than routine experimentation, numerous equivalents to the specific embodiments of the invention described in this application. Furthermore, such equivalents are intended to be encompassed by the present invention.

[0125] As described above, the inventors of the present invention have completed the present invention by producing a forebrain assembler exhibiting a maturity similar to that of the human brain, and confirming that the forebrain assembler exhibits mature layered organization and functional connectivity between neurons and glial cells.

[0126] In a specific embodiment of the present invention, a mature forebrain assembler was produced as shown in Fig. 1. Specifically, Hedgehog and Wnt signaling pathways were pharmacologically activated to promote NPC proliferation and expansion (Figs. 2 to 6), and then manually separated into single rosette structures to form single-rosette forebrain organoids (Figs. 7 and 8) with little variation between different cell lines. The single-rosette forebrain organoids were cultured (Fig. 9) and reconstituted with RELN-expressing neurons (Fig. 10), and glial cells were injected (Figs. 11 and 12) to successfully form mature human forebrain assemblers (Fig. 13).

[0127] Accordingly, a first aspect of the present invention relates to a method for manufacturing a whole brain assembly comprising the following steps:

[0128] (a) A step of forming a forebrain organoid by culturing pluripotent stem cells (PSCs);

[0129] (b) a step of treating a substance that activates the Hedgehog and Wnt signaling pathways of the forebrain organoid;

[0130] (c) a step of separating the forebrain organoid into a single rosette structure to form a single rosette forebrain organoid;

[0131] (d) a step of culturing the single rosette forebrain organoid by encapsulating it with reelin (RELN) expressing neurons; and

[0132] (e) A step of producing a forebrain assembler by injecting glial cells into the single rosette forebrain organoid.

[0133] The term "organoid" as used herein refers to a small cultured organism that mimics the shape and function of a tissue or organ. More specifically, an organoid must contain at least one cell type among the various cell types that constitute an organ or tissue, and the cells must be spatially organized into a form similar to an organ by clumping together.

[0134] The term "assembled" used in the present invention refers to a tissue and organ mimic manufactured by recombining various types of cells existing in the organoid and actual tissue, and refers to a three-dimensional biological tissue model manufactured by physically / functionally combining two or more different cell types in a modular or stepwise manner, and in particular, according to one embodiment of the present invention, refers to a biological structure capable of reproducing functional cell-to-cell interactions by including at least neuron and glial cell types. Such an assembled cell is different from the organoid in that it is not a simple aggregate of cells but is functionally connected, and can be used as a patient-specific model for new drug development, artificial organs, disease treatments, and disease treatment.

[0135] In the present invention, the step (a) is a step of forming a forebrain organoid by culturing pluripotent stem cells, and the term "pluripotent stem cell" used in the present invention may mean a cell that has the ability to differentiate into all cells constituting the body, and may generally include induced pluripotent stem cells (iPSCs) and embryonic stem cells (ES cells) that have the common characteristic of differentiating into multiple potencies. More specifically, embryonic stem cells are induced from the inner cell mass of a blastocyst in the preimplantation stage. The induced cells are maintained in a specific environment, and are capable of unlimited culture and pluripotent differentiation. Furthermore, induced pluripotent stem cells may mean pluripotent differentiated cells created by dedifferentiation from somatic cells, and are formed by making somatic cells into a state very similar to embryonic stem cells through a process called reprogramming, such as cell fusion, nuclear transfer, and overexpression of pluripotency regulatory factors. Furthermore, pluripotent stem cells are not limited to embryonic stem cells and induced pluripotent stem cells, and may include any cell possessing both differentiation pluripotency and self-renewal capacity. However, pluripotent stem cells are preferably mammalian cells, and more preferably human-derived induced pluripotent stem cells.

[0136] Specifically, the step (a) may be a step of inducing an embryoid body from a PSC, differentiating the embryoid body into a neuroectoderm lineage, and forming a forebrain organoid composed of multiple rosettes.

[0137] In the present invention, the step (b) is a step of treating a substance that activates the Hedgehog and Wnt signal pathways to induce an increase in rosette size through proliferation of neural progenitor cells, and the substance that activates the Hedgehog and Wnt signal pathways in the step (b) may be CHIR99021 and SAG.

[0138] At this time, the CHIR99021 may be at a concentration of 0.1 to 5 μM, and the SAG may be at a concentration of 100 to 1000 nM. Preferably, the CHIR99021 may be at a concentration of 0.1 to 3 μM, and the SAG may be at a concentration of 200 to 800 nM, more preferably, the CHIR99021 may be at a concentration of 0.1 to 2 μM, and the SAG may be at a concentration of 300 to 500 nM, and most preferably, the CHIR99021 may be at a concentration of 1 μM, and the SAG may be at a concentration of 400 nM.

[0139] In the present invention, the step (c) is a step of forming a single rosette forebrain organoid by separating a forebrain organoid composed of multiple rosettes into a single rosette structure in order to achieve the goal of producing a forebrain assembler with a single rosette structure. The separation may be performed manually. The manual operation may be performed using any tool that can separate into a single rosette while maintaining the rosette structure, but is preferably performed using fine forceps.

[0140] In the present invention, step (d) refers to a step of encapsulating and culturing a separated single rosette forebrain organoid with reelin-expressing neurons to form a six-layered structure. The encapsulation may refer to a process of coating the surface of the single rosette forebrain organoid with reelin-expressing neurons. In a specific embodiment of the present invention, the encapsulation is performed with matrigel containing reelin-expressing neurons, but is not limited thereto.

[0141] In the present invention, the manufacturing method may further include a step of manufacturing a reelin-expressing neuron before the step (d), and the reelin-expressing neuron may be manufactured by transducing reelin into neural progenitor cells.

[0142] The term "transduction" used in the present invention refers to a series of processes for delivering and expressing a gene after infecting a cell of interest.

[0143] In the present invention, the relin-expressing neurons are 1×10 3 1×10 5 It can be personal. Preferably 5×10 3 5×10 4 Dog, preferably 1×10 4 It could be a dog.

[0144] In the present invention, the step (e) is a step for securing cell diversity similar to that of an actual brain by injecting glial cells corresponding to non-neuronal cells into a single rosette forebrain organoid encapsulated with relin-expressing neurons, and the glial cells may be at least one selected from the group consisting of astrocytes and microglia.

[0145] The term "glial cell" as used in the present invention refers to a cell that supports and protects nerve cells within the central or peripheral nervous system, and contributes to maintaining metabolic and immunological balance. Glial cells may generally include astrocytes, oligodendrocytes, microglia, and Schwann cells present in the peripheral nervous system. Here, "astrocytes" refer to cells that support the metabolism of nerve cells, regulate ion homeostasis, absorb and release neurotransmitters, and maintain the blood-brain barrier (BBB). In addition, "microglia" refers to cells that are members of the innate immune system of the central nervous system and are involved in the removal of pathogens, phagocytosis of damaged cells, and regulation of inflammatory responses. In the present invention, glial cells may include not only natural cells, but also glial cells differentiated from human or animal-derived stem cells, genetically engineered glial cells, or glial-like cells manufactured using a tissue engineering method.

[0146] In the present invention, the astrocytes and microglia may be produced by differentiating from PSCs.

[0147] In the present invention, the stellate cells are 1×10 3 1×10 5 It is a dog, and the microglia are 1×10 2 1×10 4 It may be individual. Preferably, the astrocytes are 5×10 3 5×10 4 It is a dog, and the microglia are 5×10 2 5×10 3 Dog, most preferably, said stellate cells are 1×10 4 It is a dog, and the microglia are 1×10 3 It could be personal.

[0148] In the present invention, a virtual first line (11) penetrating the outer cortical layer of the single rosette forebrain organoid,

[0149] A virtual second line (12) penetrating the outer cortical layer of the single rosette forebrain organoid but orthogonal to the first line, and

[0150] A virtual third line (13) penetrating the outer cortical layer of the single rosette forebrain organoid but orthogonal to the first line and the second line,

[0151] The first line, the second line and the third line penetrate the center (22) of the single rosette forebrain organoid,

[0152] The above-mentioned glial cells may be injected into the outer cortex layer of the single rosette forebrain organoid at a location where the first line, the second line, and the third line contact the outer cortex (21) layer of the single rosette forebrain organoid.

[0153] In the present invention, the substance activating the Hedgehog and Wnt signal pathways in step (b) may be treated for 5 to 10 days. Preferably, it may be treated for 6 to 8 days, and most preferably, for 7 days.

[0154] In the present invention, in step (d), the culturing may be performed for 10 to 20 days. Preferably, it may be performed for 12 to 18 days, more preferably, for 14 to 16 days, and most preferably, for 15 days.

[0155] In the present invention, the manufacturing method may further include a step of further culturing and maturing the forebrain assembler for 10 to 40 days after step (e). Preferably, the culturing may be further performed for 20 to 40 days, and most preferably, for 30 days.

[0156] In addition, the second aspect of the present invention relates to a brain assembler manufactured by the above manufacturing method.

[0157] In a specific embodiment of the present invention, it was confirmed that the forebrain assembler of the present invention systematically forms a cortical structure composed of six layers (Figs. 14 to 17) and includes mature astrocytes (Fig. 18) and microglia (Fig. 19). In addition, it was confirmed that the forebrain assembler of the present invention possesses strong and spontaneous neural activity (Figs. 20 to 22) and has a functionally connected neural network (Figs. 23 to 25). Furthermore, the forebrain assembler of the present invention contained seven transcriptionally distinct cell types (Figs. 26 and 27), showed a high correlation with the later stages of the human fetal brain (Fig. 28), and showed a correlation with specific cortical layers of the human brain (Figs. 29 to 32), indicating a very high similarity to the actual human brain. In addition, the MI score confirmed a high level of consistency in all assemblers (Fig. 26), suggesting that the forebrain assembler of the present invention is a uniform, mature forebrain assembler similar to the human brain.

[0158] Accordingly, the third aspect of the present invention relates to a forebrain assembler comprising a single rosette structure including six cortical layers and a cavity, characterized in that the cortical layers include glial cells.

[0159] In the present invention, the forebrain assembler may be a human forebrain assembler.

[0160] In the present invention, the six cortical layers may be a first layer expressing RELN, a second layer expressing CUX2, a third layer expressing BRN2, a fourth layer expressing SATB2, a fifth layer expressing CTIP2, and a sixth layer expressing TBR1. The first to sixth layers may be identical to the cortical layer structure consisting of six layers of an actual human brain.

[0161] In the present invention, the glial cells may be at least one selected from the group consisting of astrocytes and microglia.

[0162] In the present invention, the microglia may be in a state of moving within the assembler.

[0163] In the present invention, the assembler may exhibit spontaneous neural activity and include a functionally connected neural network.

[0164] In the present invention, the assemble may additionally include one or more cell types selected from the group consisting of radial glial cells, intermediate progenitor cells, excitatory neurons, and inhibitory neurons.

[0165] The term "radial glial cell" used in the present invention refers to a type of neural progenitor cell that appears during the neurogenesis process, and "intermediate progenitor cell" refers to a secondary neural progenitor cell derived from a firing glial cell during the neurogenesis process.

[0166] In a specific embodiment of the present invention, early forebrain organoids derived from SCZ patients were produced and their phenotypes were confirmed (Figs. 33 to 36), and it was confirmed that the phenotypic defects were due to decreased proliferation and premature differentiation of NPCs (Figs. 37 and 38). Furthermore, forebrain assembler derived from SCZ patients was produced and examined, and six cortical layers were confirmed (Fig. 39), but functional connectivity was significantly reduced (Figs. 40 and 41). To elucidate the mechanism of defects in NPC proliferation, we performed analyses and found that the expression of TP53 and NFATC4 was significantly increased in SCZ forebrain organoids (Figs. 42 to 45), confirming the association of SCZ with TP53 and NFATC4 genes (Figs. 46 to 50). Analysis of SCZ forebrain assembler confirmed the association between the UCN-WNT11 signaling axis and the PTPRF-THBS4 signaling axis and SCZ (Figs. 57 to 62). In addition, the production of combinatorial forebrain assembler confirmed that glial cells exhibit high plasticity and play an important role through this high plasticity (Figs. 51 to 56).

[0167] Accordingly, the third aspect of the present invention relates to a composition for diagnosing schizophrenia, characterized in that it comprises a preparation for measuring UCN expression level, a preparation for measuring PTPRF expression level, a preparation for measuring WNT11 expression level, and a preparation for measuring THBS4 expression level.

[0168] In the present invention, the agent for measuring the expression level may be a substance that detects mRNA of a target gene or its protein.

[0169] In the present invention, the agent for measuring the expression level is not limited as long as it can detect the mRNA or protein of the target gene, but may be, for example, one selected from the group consisting of antibodies, aptamers, DNA, RNA, proteins, and polypeptides.

[0170] The term "antibody" as used herein refers to a protein molecule specific for an antigenic site. The antibody refers to an antibody that specifically binds to the protein of the target gene, and may include monoclonal antibodies, polyclonal antibodies, and recombinant antibodies.

[0171] The above monoclonal antibody may be produced using a hybridoma method or phage antibody library technology widely known in the art, but may not be limited thereto.

[0172] The polyclonal antibodies described above can be produced by methods well known in the art, including injecting the protein antigen described above into an animal and collecting blood from the animal to obtain serum containing the antibodies. Such polyclonal antibodies can be produced from any animal species host, including, but not limited to, goats, rabbits, sheep, monkeys, horses, pigs, cows, and dogs.

[0173] Additionally, the antibodies of the present invention may also include special antibodies such as chimeric antibodies, humanized antibodies, and human antibodies.

[0174] The above "peptide" possesses the advantage of high binding affinity to target substances and is resistant to denaturation even during heat and chemical treatments. Furthermore, its small molecular size allows it to be attached to other proteins to form fusion proteins. Specifically, it can be attached to polymer protein chains, making it suitable for use as a diagnostic kit and drug delivery material.

[0175] The term "aptamer" used in the present invention refers to a type of polynucleotide composed of a special type of single-stranded nucleic acid (DNA, RNA, or modified nucleic acid) that has a stable tertiary structure in itself and has the characteristic of being able to bind to a target molecule with high affinity and specificity. As described above, an aptamer can specifically bind to an antigenic substance in the same way as an antibody, but is composed of a polynucleotide that is more stable than a protein, has a simple structure, and is easy to synthesize, and therefore can be used as a substitute for an antibody.

[0176] The substance that specifically binds to the mRNA may be, but is not limited to, sense and antisense primers or probes.

[0177] The term "primer" used in the present invention refers to a short genetic sequence that serves as the starting point for DNA synthesis, and is an oligonucleotide synthesized for the purpose of diagnosis, DNA sequencing, etc. The primers are typically synthesized and used with a length of 15 to 30 base pairs, but this may vary depending on the intended use, and may be modified by methylation, capping, etc. using known methods.

[0178] The term "probe" used in the present invention refers to a nucleic acid capable of specifically binding to mRNA, ranging from a few bases to several hundred bases in length, produced through enzymatic, chemical, or synthetic separation and purification processes. The presence or absence of mRNA can be confirmed by labeling with a radioactive isotope or enzyme, and the probe can be designed and modified using known methods.

[0179] Since the nucleotide sequence of the gene encoding the target gene is known, a probe or primer that specifically binds to the nucleotide sequence of the target gene, a sequence complementary to the nucleotide sequence, or a fragment of the nucleotide can be designed by a person skilled in the art based on the sequence using a conventional method in the art.

[0180] The term "diagnosis" as used in the present invention includes determining the susceptibility of a subject to a specific disease or condition, determining whether the subject currently has a specific disease or condition, determining the prognosis of a subject suffering from a specific disease or condition, determining whether the disease will recur after treatment, or therametrics (e.g., monitoring the condition of an object to provide information on the efficacy of a treatment).

[0181] The term "diagnostic composition" used in the present invention refers to an integrated mixture or device that includes a means for measuring biomarker expression levels to determine whether a subject has developed schizophrenia or to predict the likelihood of developing schizophrenia, and may be expressed as a "diagnostic kit." Since the diagnostic composition of the present invention includes a means for measuring the biomarker discovered in the present invention, the term "diagnostic composition" may also be expressed as a "quantitation device" for the biomarker.

[0182] The term "schizophrenia" used in the present invention, also referred to as status fever or schizophrenia, is a disease that can cause social function impairment in addition to symptoms such as auditory hallucinations, disorganized speech, and emotional dullness. It is a disease with a poor prognosis and chronic course, causing considerable distress to patients and their families. Although schizophrenia is referred to as a single disease, patients with schizophrenia actually show diverse clinical manifestations, treatment responses, and disease course. Currently, the exact cause has not been identified, but it is thought to be caused by a complex interaction of various factors such as genetic causes and abnormalities in the neurotransmitter system.

[0183] In the present invention, the composition may further include an agent for measuring the TP53 expression level and an agent for measuring the NFATC4 expression level.

[0184] In the present invention, the composition for diagnosing schizophrenia is applied to a whole brain assembly manufactured by culturing cells isolated from an individual whose onset of schizophrenia is to be confirmed,

[0185] The above brain assembler is,

[0186] (a) a step of forming a forebrain organoid by culturing pluripotent stem cells derived from the above entity;

[0187] (b) a step of treating a substance that activates the Hedgehog and Wnt signaling pathways of the forebrain organoid;

[0188] (c) a step of separating the forebrain organoid into a single rosette structure to form a single rosette forebrain organoid;

[0189] (d) culturing the single rosette forebrain organoid by encapsulating it with reelin-expressing neurons; and

[0190] (e) It may be manufactured through a step of manufacturing a schizophrenia forebrain assembler by injecting the subject-derived glial cells into the single rosette forebrain organoid.

[0191] In the present invention, the subject may be a human.

[0192] In addition, the fourth aspect of the present invention relates to a kit for diagnosing schizophrenia comprising the composition.

[0193] In the present invention, the kit may not only include a substance that specifically binds to the mRNA of the target gene or its protein, but may also include one or more other component compositions, solutions or devices suitable for an analysis method for measuring the expression level of the mRNA of the target gene or its protein used by the kit.

[0194] If the above kit is a kit for measuring the expression level of mRNA or protein of a target gene, it may be a kit containing the essential elements required for performing RT-PCR. In addition to each primer pair specific for the mRNA of the marker gene, the RT-PCR kit may include a test tube or other appropriate container, reaction buffer, deoxyribonucleotides (dNTPs), enzymes such as Taq polymerase and reverse transcriptase, DNase, RNase inhibitor, DEPC water, sterile water, etc. In addition, it may include a primer pair specific for a gene used as a quantitative control.

[0195] The above kit may include a substrate, a suitable buffer solution, a secondary antibody labeled with a chromogenic enzyme or fluorescent substance, and a chromogenic substrate for immunological detection of a substance that specifically binds to a nucleotide sequence of a target gene, a sequence complementary to the nucleotide sequence, a fragment of the nucleotide, or a protein encoded by the nucleotide sequence. The substrate may be a nitrocellulose membrane, a 96-well plate synthesized with a polyvinyl resin, a 96-well plate synthesized with a polystyrene resin, a glass slide glass, etc., and the chromogenic enzyme may be peroxidase or alkaline phosphatase, the fluorescent substance may be FITC, RITC, etc., and the chromogenic substrate may be 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) or o-phenylenediamine (OPD), tetramethyl benzidine (TMB), etc.

[0196] In addition, the kit of the present invention may include an antibody that specifically binds to a marker component, a secondary antibody conjugate to which a label that develops color by reaction with a substrate is conjugated, a chromogenic substrate solution that reacts with the label, a washing solution, an enzyme reaction stop solution, etc., and may be manufactured with a plurality of separate packagings or compartments containing the reagent components used, but may not be limited thereto.

[0197] The kit of the present invention may be a kit characterized by including essential elements necessary for performing ELISA in order to implement various ELISA methods such as ELISA kits and sandwich ELISA. Such ELISA kits include antibodies specific for the proteins. The antibodies have high specificity and affinity for the protein of the target gene and little cross-reactivity to other proteins, and may be monoclonal antibodies, polyclonal antibodies, or recombinant antibodies. In addition, the ELISA kit may include antibodies specific for a control protein. In addition, the ELISA kit may include, but is not limited to, reagents capable of detecting bound antibodies, such as labeled secondary antibodies, chromophores, enzymes and their substrates, or other substances capable of binding to antibodies.

[0198] In addition, the kit may be a kit for implementing Western blot, immunoprecipitation assay, complement fixation assay, flow cytometry, or protein chip analysis, and may further include additional components suitable for each analysis method. Through these analysis methods, schizophrenia can be diagnosed by comparing the amount of antigen-antibody complex formation.

[0199] Furthermore, a fifth aspect of the present invention relates to a method for providing information for diagnosing schizophrenia, comprising the following steps:

[0200] (a) a step of producing a whole brain assembler by culturing cells isolated from an individual for whom the onset of schizophrenia is to be confirmed; and

[0201] (b) A step of determining whether schizophrenia has occurred by measuring the expression levels of UCN, PTPRF, WNT11, and THBS4 in the above forebrain assembler.

[0202] In the present invention, the step (a) may be a method for manufacturing a whole brain assembly, specifically including the following steps:

[0203] (i) A step of forming a schizophrenia forebrain organoid by culturing pluripotent stem cells derived from the above entity;

[0204] (ⅱ) a step of treating a substance that activates the Hedgehog and Wnt signaling pathways of the forebrain organoid;

[0205] (ⅲ) a step of separating the forebrain organoid into a single rosette structure to form a single rosette forebrain organoid;

[0206] (ⅳ) a step of culturing the single rosette forebrain organoid by encapsulating it with reelin-expressing neurons; and

[0207] (ⅴ) A step of manufacturing a schizophrenia forebrain assembler by injecting glial cells derived from the individual into the single rosette forebrain organoid.

[0208] In the present invention, if the expression levels of UCN, PTPRF, WNT11 and THBS4 in the step (b) are increased compared to the whole brain assembler derived from a healthy individual, the individual may be determined to be a schizophrenia patient.

[0209] In the present invention, the expression levels of TP53 and NFATC4 may be additionally measured in step (b). At this time, if the expression levels of UCN, PTPRF, WNT11, THBS4, TP53, and NFATC4 in step (b) are increased compared to the whole brain assembler derived from a healthy individual, the individual may be determined to be a schizophrenic patient.

[0210] Furthermore, the sixth aspect of the present invention relates to a method for diagnosing schizophrenia using the whole brain assembler.

[0211] Furthermore, the seventh aspect of the present invention relates to a method for diagnosing and treating schizophrenia, comprising the following steps:

[0212] (a) a step of producing a whole brain assembler by culturing cells isolated from an individual for whom the onset of schizophrenia is to be confirmed; and

[0213] (b) A step of measuring the expression levels of UCN, PTPRF, WNT11 and THBS4 in the above forebrain assembler to determine whether schizophrenia has developed and treating schizophrenia by administering genetic manipulation, shRNA or drugs.

[0214] In the present invention, the drug of step (b) may be a typical drug that blocks dopamine receptors to alleviate positive symptoms such as delusions and auditory hallucinations, or an atypical drug that not only blocks dopamine receptors but also acts on serotonin receptors to alleviate positive / negative symptoms and partially improve cognitive function. The typical drug may be Haldol, Thorazine, Perphenazine, or Sulpiride, and the atypical drug may be Risperdal, Seroquel, Abilify, Zyprexa, or Clozaril, but is not limited thereto.

[0215] In the present invention, in the step (a), the whole brain assembler may be manufactured using the manufacturing method.

[0216] Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the following examples are intended only to illustrate the present invention and are not intended to limit the scope of the present invention.

[0217]

[0218] <Example 1>

[0219] 1. Experimental methods and materials

[0220] 1-1. hPSC culture

[0221] All human pluripotent stem cell (hPSC) cell lines (H9 hESC, WiCell; healthy hPSC and SCZ hPSC) were cultured on mitomycin C-treated mouse embryonic fibroblast (MEF) cells in DMEM / F12 (Gibco) medium supplemented with 20% KnockOut Serum Replacement (Gibco), 1× Glutamax (Gibco), 1× Non-essential amino acid (Gibco), 1% penicillin-streptomycin, 100 μM 2-Mercaptoethanol (Sigma), and 10 ng / ml human bFGF (Peprotech). All hPSC cell lines were seeded in 0.5 ml of culture medium (5 × 10 per well) in each well of a 24-well plate. 4 (including feeder cells) were added and cultured. The cells were supplied with nutrients daily, and when the cell density reached 70%, 10 small colonies were passively dissociated and subcultured into each well of a 24-well plate. The cells used in the present invention were confirmed to be free of mycoplasma contamination (e-Myco mycoplasma PCR detection kit).

[0222] 1-2. hiPSC generation

[0223] Human induced pluripotent stem cells (hiPSCs) from a healthy individual (IMR90, female) were obtained from WiCell. Healthy hiPSCs (GM25256, male; GM23338, male), SCZ patient hiPSCs (GM23762, male), fibroblasts (GM01835, female; GM02038, male; GM02503, female; GM01792, male), and B lymphocytes (GM23836, male; GM01487, female; GM01489, male) were obtained from the National Institute of General Medical Sciences Cell Repository through the Coriell Institute for Medical Research. Schizophrenia (SCZ) fibroblasts and B lymphocytes were reprogrammed into iPSCs by retroviral transduction with Yamanaka factors (Oct4, Klf4, Sox2, and c-Myc). Specifically, 1 × 10 5 Human fibroblasts or B lymphocytes were transduced with retroviruses containing OCT3 / 4, SOX2, KLF4, and c-MYC together with protamine sulfate (5 μg / ml) and cultured overnight. Five days after transduction, fibroblasts or B lymphocytes were split into MEFs and cultured in hPSC medium for 30 days. hiPSC colonies were manually transferred to new culture plates and expanded.

[0224] 1-3. In vitro differentiation of neurons, astrocytes, and microglia

[0225] 1-3-1. Nerve cells

[0226] Glutamatergic neurons were differentiated from hPSCs. Specifically, hPSC colonies were detached from feeder layers using collagenase IV (Thermo) at 37°C for 1 h. Ten to sixteen PSC colonies (5–8 hPSC colonies from each of two wells of a 24-well plate) were collected and plated in 0.5 ml of N2 / B27 medium consisting of DMEM / F12, 1× N2 supplement (Gibco), 1× B27-RA supplement (Gibco), and 1× penicillin-streptomycin in a 35-mm petri dish. On day 1, the medium was replaced with N2 / B27 medium supplemented with 10 μM SB431542 (Sigma) and 0.1 μM LDN193189 (Stemgent). On day 7, embryoid bodies (EBs) were transferred to Matrigel-coated plates (10% Matrigel in DMEM / F12, Growth Factor Reduced; Corning) and cultured in N2 / B27 medium supplemented with 10 nM SB431542. On day 16, cells with a rosette structure were harvested and mechanically dissociated using pipetting. The dissociated cells were plated on Matrigel-coated plates in neural progenitor cell (NPC) medium consisting of DMEM / F12, 1× N2 supplement, 1× B27-RA supplement, 20 ng / ml basic FGF, and 1 μg / ml laminin (Thermo). At 80% cell density, NPC medium was replaced with neuronal medium consisting of DMEM / F12, 1× N2 supplement, 1× B27-RA supplement, 1× penicillin-streptomycin, 20 ng / ml BDNF (Peprotech), 10 ng / ml GDNF (Peprotech), 250 μg / ml dibutyryl cyclic-AMP (Biogems), and 200 nM L-ascorbic acid (Sigma).Cells were cultured in neuronal medium for 2 weeks on plates coated with 10 μg / ml poly-L-ornithine (Sigma) and 5 μg / ml laminin. Neuronal identity was verified by qRT-PCR and immunocytochemical staining.

[0227] 1-3-2. Astrocytes

[0228] hPSC-derived astrocytes were generated as follows. hPSC-derived NPCs were isolated single cells and seeded at a density of 15,000 cells / cm on matrigel-coated plates in astrocyte medium (ScienCell: 2% FBS, astrocyte growth supplement, 1% penicillin-streptomycin in astrocyte basal medium). 2 After 30–40 days of differentiation, hPSC-derived astrocytes were characterized using qRT-PCR and immunocytochemical staining.

[0229] 1-3-3. Microglia

[0230] hPSC-derived microglia were generated as follows. hPSC colonies were detached from the feeder layer using collagenase IV for 1 h. hPSC colonies were collected from sterile 100-mm Petri dishes in microglial medium containing 10 ng / ml IL-34 (Peprotech) and 10 ng / ml GM-CSF (Peprotech). After differentiation for 7–14 days, EBs with a cystic morphology were selected and transferred to plates coated with 10 μg / ml poly-L-ornithine and 5 μg / ml laminin. Additional treatments were performed every 5 days for a total of six cycles. Additional maintenance was performed in microglial medium containing 100 ng / ml IL-34 and 5 ng / ml GM-CSF. Microglial identity was confirmed by qRT-PCR and immunocytochemistry.

[0231] 1-4. Generation of RELN-expressing neurons

[0232] A lentiviral construct for reelin (RELN) expression was generated by subcloning domains 3–6 (the central domain) of RELN from the pCrl construct (Addgene #122443, gift from Song Mei-ryeong, Gwangju Institute of Science and Technology) into the pLenti 6.3-DEST (Thermo) lentiviral expression vector. NPCs were transduced with lentivirus containing RELN using protamine sulfate (5 μg / ml). Three days after transduction, NPCs were expanded in NPC medium containing blasticidin (6 μg / ml) for antibiotic selection. NPCs were then differentiated into glutamatergic neurons. qRT-PCR was performed to confirm RELN expression.

[0233] 1-5. Step-by-step development of the forebrain assembler

[0234] hPSCs were cultured on feeder layers in 24-well plates (5–8 hPSC colonies per well). When the hPSC colonies reached a diameter of 1.0–1.5 mm, the hPSC medium was replaced with 0.25 ml of 1 mg / ml collagenase IV and incubated at 37°C for 1–2 h to detach the colonies from the feeder layer without damaging the colony structure. The detached colonies were transferred to 15 ml tubes and washed with 1 ml of hPSC medium. Two ml of EB medium consisting of hPSC medium (without bFGF) supplemented with 2 μM Dorsomorphin (Sigma) and 2 μM A83-01 (Tocris) was added to a 35-mm petri dish, and 5–8 hPSC colonies (from each well of a 24-well plate) were transferred to the EB medium and cultured at 37°C to form EBs. On day 5, half of the medium was replaced with neural induction medium consisting of DMEM / F12 supplemented with 1× N2 supplement, 10 μg / ml heparin (Sigma), 1× penicillin streptomycin, 1× non-essential amino acids, 1× Glutamax, 1 μM CHIR99021 (Tocris), and 1 μM SB-431542 (Cellagentech). On day 7, 5–8 EBs were transferred to a 1.5 ml microcentrifuge tube and mixed with 50 μl of Matrigel and 33 μl of neural induction medium. A total of 88 μl of the mixture containing EBs was spread on the center of a 35 mm petri dish and incubated at 37°C for 30 min. Afterwards, 2 ml of neural induction medium was added, and the EBs were cultured for up to 14 days to induce neuroepithelial-like structures. On day 14, the neuroepithelial structures embedded in the Matrigel were mechanically dissociated by gentle pipetting, and the structures were placed in a 1.5 ml microcentrifuge tube containing 1× N2 supplement, 1× B27 supplement, 1× penicillin-streptomycin, 1× 2-mercaptoethanol, 1× non-essential amino acids, 1× GlutaMAX, and 2.The neuroepithelial structures were transferred to new 35 mm petri dishes containing 2 ml differentiation medium consisting of DMEM / F12 supplemented with 5 μg / ml insulin (Sigma). The neuroepithelial structures were cultured in differentiation medium in a shaking incubator (Eppendorf; New Brunswick S41i, 90 rpm) for up to 25 days to form forebrain organoids with multiple rosettes.

[0235] From day 25 to day 32, organoids were cultured in differentiation medium supplemented with 1 μM CHIR99021 and 400 nM SAG (Millipore). On day 32, forebrain organoids were manually dissociated using fine forceps (Fine Science Tools) to generate single-rosette organoids. Approximately 5–7 single-rosette organoids (approximately 25–40 single-rosette organoids from SCZ patients) were generated from one forebrain organoid. Each batch of hPSCs typically yields approximately 5–8 forebrain organoids, resulting in approximately 25–56 single-rosette organoids per batch (approximately 125–320 single-rosette organoids from SCZ patients). After dissociation, single-rosette organoids were cultured for an additional 3 days to stabilize the isolated structures.

[0236] At day 35, five single-rosette organoids with diameters closest to the median within the range of 25–40 single-rosette organoids were selected for further processing. For hESC-derived normal assembleoids, two batches were used for each set of experiments (a total of 10 single-rosette organoids were generated, and 10 final assembleoids were analyzed in each experiment). For hiPSC-derived normal assembleoids, one batch was used (a total of 5 single-rosette organoids were generated, and 3 final assembleoids were analyzed in each experiment). For SCZ-derived patient assembleoids, one batch was used (a total of 5 single-rosette organoids were generated, and 5 final assembleoids were analyzed in each experiment). The generated single-rosette organoids contained 1 × 10 RELN-expressing neurons. 4 Encapsulated with 1 to 2 μl of Matrigel containing cells / μl concentration, and cultured in 2 ml of differentiation medium for up to 50 days.

[0237] On day 50, hPSC-derived astrocytes (1 × 10 4 cells) and microglia (2 × 10 3 cells) were microinjected into the cortical layer of 50-day-old forebrain assemblies. Cells were microinjected at six different locations evenly distributed in the cortical layer, located 50 μm deep within the cortical layer surface. The generated assemblies were cultured for an additional 30 days in 2 ml of maturation medium consisting of Neurobasal medium (Gibco) supplemented with 1× B27 supplement, 1× penicillin-streptomycin, 1× 2-mercaptoethanol, 0.2 mM ascorbic acid, 20 ng / ml BDNF (Peprotech), 20 ng / ml GDNF (Peprotech), and 0.5 mM cAMP (Sigma) to generate the final morphology of forebrain assemblies. From day 14 to day 80, all cultures were cultured in a shaking incubator with medium replacement every other day.

[0238] 1-6. Create a Mix and Match Brain Assembled

[0239] Similar to the overall process of generating normal forebrain assembles in Examples 1-5 above, organoids derived from healthy individuals (H) or SCZ patients (S) were reconstituted with astrocytes and microglia derived from healthy individuals or SCZ patients to generate mix-and-match assembles. In this manner, eight mix-and-match assembles were generated in this example (organoid-astrocyte-microglia; HHH, HHS, HSH, HSS, SHH, SHS, SSH, SSS). For the mix-and-match assembles derived from multiple healthy and SCZ individuals, the organoids and glial cells from healthy individual #1 were matched with the organoids and glial cells from SCZ #1 to generate mix-and-match assemble #1. Combinational, mix-and-match assembles #2-#3 were also produced in the same manner.

[0240] 1-7. Generation of genetically engineered hPSCs

[0241] Guide RNAs were designed using CRISPR Design (https: / / chopchop.cbu.uib.no / ) and cloned into pL-CRISPR-EFS-GFP (Addgene #57818). hPSCs were maintained at 80% confluency on Matrigel-coated plates before electroporation. After electroporation, 30 GFP-positive colonies were picked and expanded. Gene knockout in each colony was confirmed using qRT-PCR and the Surveyor Mutation Detection Kit and sequencing (IDT Catalog No. 706020). The above process was repeated to generate genetically engineered hPSCs with multiple gene knockouts. Brain organoids, astrocytes, and microglia were differentiated from the genetically engineered hPSC lines and further utilized as indicated. The gRNA sequences used in this example are shown in Table 1 below.

[0242] Sequence name Sequence (5' → 3') SEQ ID NO: TP53CCATTGTTCAATATCGTCCG1NFATC4CTGATGGTCCAAGCCCCGG2UCNCAGACTCGGGTCCTGGACCC3PTPRFGGGTTCCCTTCCATCGACAT4WNT11CATACACGAAGGCCGACTCC5THBS4GATTGTGAACGGAATCCACC6

[0243] 1-8. Lentivirus and Retrovirus Production Lentivirus production was performed as follows. A transfection mixture was prepared by mixing 9 μg of packaging vector (pCMV.dR 8.74, gag / pol), 3 μg of envelope vector (pMD2.G, VSV-G), and 10 μg of the transfer vector of interest with three volumes of TransIT-LT1 transfection reagent (Mirus). Forty-eight hours after transfection, the supernatant containing lentivirus was collected, filtered through a 0.45 μm filter, and concentrated by centrifugation at 24,000 rpm for 2 hours at 4°C.

[0244] Retrovirus production was performed as follows. Transfection mixture was prepared by mixing 6.5 μg of packaging vector (Addgene #8454), 3.5 μg of envelope vector (Addgene #8449), 10 μg of the transfer vector of interest, and 3 volumes of TransIT-LT1 transfection reagent. The mixture was vortexed with Opti-MEM (Gibco), and the mixture was incubated at room temperature (RT) for 20 minutes. All other procedures were performed identically to lentivirus production.

[0245] 1-9. Lentiviral infection of forebrain assembler

[0246] Whole brain assembler was transfected with EGFP lentivirus (1.0 × 10 6The assemblies were cultured in sembloid medium (2 ml) containing 10 μg / ml of TU / ml and polybrene (10 μg / ml) at 37°C for 3 h. The virus-containing medium was removed, and the assemblies were washed twice with warm DPBS. The assemblies were cultured in sembloid medium for 3 more days and analyzed by fluorescence imaging.

[0247] 1-10. Electroporation

[0248] hPSCs were treated with ROCK inhibitor Y27632 (10 μM) 1 h before electroporation. Single cells dissociated with Accutase (Sigma) were resuspended in Opti-MEM. 10 μg of DNA plasmid was transfected into 1 × 10 cells using a NEPA21 electroporator. 6 were delivered to the cells (electroporation pulse: 125 V voltage, 2.5 ms pulse length, 50 ms pulse interval, 2 pulses, 10% pulse decay, + direction; delivery pulse: 20 V voltage, 50 ms pulse length, 50 ms pulse interval, 5 pulses, 40% pulse decay, ± direction). The cells were then cultured in mTeSR (StemCell Technologies) containing the ROCK inhibitor Y27632 for 48 h.

[0249] 1-11. qRT-PCR

[0250] Total RNA was extracted from various cells and organoids as follows. Cells and organoids were homogenized by pulverization and trypsinization. RNA was extracted using the RNeasy Plus Mini Kit (QIAGEN), and first-strand cDNA was synthesized using the High-Capacity cDNA Reverse Transcriptase Kit containing oligo dT (Applied Biosystems). qRT-PCR was performed using SYBR Green Supermix (Applied Biosystems) and a One-step Cycler (Applied Biosystems). Gene expression was normalized to the housekeeping gene GAPDH.

[0251] 1-12. Immunohistochemical staining

[0252] Immunohistochemical staining was performed as follows. Brain organoids and assembles were fixed in 4% paraformaldehyde (PFA) for 15 minutes and cryopreserved in 30% sucrose overnight. Samples were embedded in OCT compound (Sakura) and frozen at -20°C. Sections of 8–20 μm thickness were then prepared using a cryostat (Leica). Frozen sections were fixed in 4% PFA for 20 minutes at 4°C, washed three times with phosphate-buffered saline (PBS), and blocked in PBS containing 2% goat serum and 0.25% Triton X-100 (PBS-T) for 1 hour at room temperature. Sections were then incubated overnight at 4°C with primary antibodies diluted in blocking buffer. The following primary antibodies were used: Ki67 (1:500, Abcam), p-Vim (1:250, MBL), TUJ1 (1:300, BioLegend), SOX2 (1:300, Abcam), CTIP2 (1:300, Abcam), CUX2 (1:300, Abcam), SATB2 (1:300, Abcam), TBR1 (1:300, Abcam), MAP2 (1:300, Abcam), GFAP (1:300, Dako), IBAI (1:60, Santacruz), RELN (1:200, MBL), BRN2 (1:300, Santacruz), PSD95 (1:300, Invitrogen), VGLUT1 (1:100, Santacruz), P73 (1:200, Thermo). Sections were washed three times with 0.25% PBS-T and incubated with secondary antibody (1:1,000, Life Technologies) diluted in blocking buffer for 1 h at room temperature. Sections were washed with 0.25% PBS-T and mounted with Prolong Gold mounting reagent (Invitrogen).

[0253] For immunocytochemical staining, cells were plated on coverslips coated with 10 μg / ml poly-L-ornithine and 5 μg / ml laminin in 12-well plates. When 80% confluent was reached, cells were washed with PBS and fixed in 4% PFA for 5 minutes at room temperature. Cells were washed three times with PBS and blocked for 40 minutes at room temperature. Cells were then incubated with diluted primary antibodies for 1 hour at room temperature and washed three times with PBS-T. Cells were then incubated with secondary antibodies diluted in blocking buffer for 40 minutes at room temperature. Cells were washed twice with PBS-T and mounted on glass slides.

[0254] 1-13. Multi-electrode array (MEA) recording

[0255] 24-well MEA plates (Axion Biosystems, Atlanta, GA, USA) were coated with 10 μg / ml poly-L ornithine and 5 μg / ml laminin solution prior to culturing assemblages. Assemblages were placed on the MEA plates and cultured for 2 weeks, with the medium replaced every 3 days, to allow attachment to the electrodes. After 2 weeks of attachment and stabilization, recordings were collected to measure basic parameters such as weighted mean firing rate, burst frequency, interburst interval, and number of network bursts using the Maestro MEA system and AxIS Software Spontaneous Neural Configuration (Axion Biosystems). Spike detection was performed using AxIS software with an adaptive threshold set to 5.5 times the estimated noise standard deviation for each channel (electrode). The plates were allowed to stabilize for 10 minutes inside the Maestro device before recording.

[0256] Electrodes generating at least five spikes per minute were defined as active electrodes. Bursts occurring within each electrode's data were recognized based on an interspike interval (ISI) threshold requiring a minimum of five spikes and a maximum ISI of 100 ms. Network bursts within a well required at least 12 spikes under the same ISI criteria, with at least 50% active electrodes. Raster plots and array-wide spike histograms were obtained using the Neural Metrics Tool from Axion Biosystems.

[0257] 1-14. Calcium imaging

[0258] Forebrain assemblies were cultured in organoid medium containing 1 μM Fluo4-AM (Invitrogen) at 37°C for 3 h. The assemblies were washed once with DPBS and cultured in brain organoid medium. Time-lapse image sequences were acquired at 1-s intervals for 2 min using a Nikon confocal microscope. The ΔF / F traces of selected cells were calculated and plotted (ΔF / F = (F - F0) / F, where F is the fluorescence at a specific time point and F0 is the minimum fluorescence of each cell). The average amplitude (ΔF / F) and frequency of spikes detected in forebrain assemblies were 0.6–1.4 and 3–4 spikes / min, respectively. Spontaneous calcium activity was analyzed using ImageJ software.

[0259] 1-17. Single-cell RNA sequencing

[0260] 1-17-1. Cell harvesting

[0261] Whole brain assemblies were harvested and washed twice with DPBS. Cells were treated with Accutase for 2–3 minutes at room temperature, then dissociated into single cells by pipetting and centrifugation at 300 g for 5 minutes. Cells were resuspended in medium (DMEM containing 10% FBS) and filtered through a 40 μm cell strainer. Each sample was analyzed on 10X Chromium Single-Cell Chips (10X GENOMICS) according to the manufacturer's instructions.

[0262] 1-17-2. Preparation and Sequencing of Single-Cell RNA Libraries

[0263] The scRNA-seq library was prepared using the Chromium Single Cell 3 Prime platform (v3.1 Chemistry; 10x Genomics) according to the manufacturer's instructions. Specifically, 10,000 cells per sample were loaded onto the Chromium Controller to generate a single gel bead-in-emulsion (GEM) using the Chromium Next GEM Single Cell 3 Prime Reagent Kit v3.1 (PN-1000268; 10x Genomics). Cells were lysed, and the released RNA was reverse-transcribed into cDNA in individual GEMs. Polyadenylated mRNA was captured with a poly(dT) primer and barcoded to synthesize full-length cDNA. cDNA was synthesized by incubating at 53°C for 45 minutes and 85°C for 5 minutes. After GEM purification, cDNA was amplified through 12 PCR cycles to generate sufficient DNA for library construction. Single-cell 3' GEX and feature barcode libraries were sequenced on an Illumina NovaSeq 6000.

[0264] 1-17-3. Preprocessing of single-cell RNA sequencing data

[0265] Samples were demultiplexed, barcoded, and aligned to the GRCh38 reference genome provided by Cell Ranger (v6.1.2) using the Cell Ranger pipeline (v6.1.2 10X Genomics). Raw base call (BCL) data generated from the Illumina sequencer were demultiplexed and converted to FASTQ files using the 'mkfastq' module in Cellranger. Alignment, filtering, barcode counting, and UMI counting were performed using the 'count' module in Cellranger. A single-cell gene expression count matrix was constructed for each sample using Seurat (v4.3.0). Only cells with ≥500 detected features and features with ≥5 detected cells were included. Considering the diverse distributions of nCount_RNA, nFeature_RNA, and percent.mt in each sample, different maximum thresholds (nCount_RNA <50,000–300,000, nFeature_RNA <9,000–12,000, percent.mt <5–15) were implemented. Doublets were detected using scDblFinder (v1.14.0) with an expected doublet rate of 0.8% to remove cells considered as doublets.

[0266] The single-cell gene count matrices were merged and log-normalized using the 'NormalizeData' function. Based on the average expression and distribution of each gene, the top 2,000 highly variable genes were selected using the 'FindVariableFeatures' function using the vst selection method. All samples were feature-level scaled using 'ScaleData' to reduce the influence of outliers.

[0267] To remove batches derived from each sample, we integrated the Seurat object using batchelor (v1.13.3) with 'RunFastMNN'. After extracting and preprocessing excitatory neurons from the object, we identified anchors across the 13 datasets using 'FindIntegrationAnchors' and integrated all datasets using 'IntegrateData'.

[0268] 1-17-4. Clustering

[0269] The nearest neighbors in the single-cell data were found using the 'FindNeighbors' function, using the dimensionality of the NMF. Graph-based Louvain clustering was performed using the 'FindClusters' function. Afterwards, 50 NMFs were used for nonlinear dimensionality reduction using t-distributed stochastic neighbor embedding (t-SNE) using RunTSNE.

[0270] 1-17-5. Cell type annotation

[0271] Cell type annotation for the identified clusters in the forebrain assembler was performed by comparing the marker genes in each cluster with those of previously annotated cell types. The genes used to annotate each cluster are shown in Table 2. When marker gene-based annotation was unavailable, literature-based annotation was used.

[0272] Cell Type Gene Excitatory Neuron STMN2, NRXN1, NEUROD6, SLA Inhibitory Neuron GAD2 Intermediate Progenitor Cell (IPC) EOMES, HES6, NEUROD4 Radial Glia (RG) GLI3, VIMDividing RGHES1, SOX2, PTN, TOP2A, MKI67 Astrocyte GFAP, S100 B, APOE Microglia AIF1, CD44, CXCL8, LGALS3, IL6

[0273] 1-17-6. Annotation of six cortical layers. Excitatory neuron clusters were reclustered at 1.0 resolution and annotated to one of the six cortical layers of the human brain based on their correlation coefficients with the six cortical layers. Using spatialLIBD (version 1.10.1), we calculated the correlation between the t-statistics obtained from the gene enrichment analysis of the histological layers of the reference dataset and the t-statistics obtained from the gene enrichment analysis of the query dataset. Clusters in the query dataset were annotated based on the neuronal layer with the highest correlation coefficient. Layer 1 was annotated based on RELN expression, and the remaining clusters were assigned to the layer with the highest correlation coefficient score. Clusters that did not show a positive correlation with any of the six human brain layers were designated as "undefined."

[0274] 1-17-7. Developmental trajectory analysis

[0275] We generated a simplified graph representation of the partitions using the Partition-based Graphical Abstraction (PAGA) function in the Python environment (v3.8.18) provided by the Scanpy library (v1.9.5). We computed a neighborhood graph using principal component analysis (PCA) cell embeddings with parameters set to n_pcs = 50 and n_neighbors = 20. We then visualized the connectivity patterns between partitions, with connection strengths represented by edge weights.

[0276] 1-17-8. Comparison of Whole Brain Assembloid and Primary Human Fetal Brain Tissue

[0277] We compared single-cell transcriptomes of forebrain assemblers with primary human fetal tissue using BrainSpan RNA-sequencing data. The 'AggregateExpression' function in Seurat (v4.3.0) was used to generate pseudobulks from the brain assemblers and generate correlation plots. The correlation between assembler-derived pseudobulks and fetal brain tissue was calculated using the Pearson correlation coefficient using the corrplot package, with a significance p-value cutoff of 0.05 for the top 50 differentially expressed genes in each cluster identified by the 'FindAllMarkers' function.

[0278] 1-17-9. MI Score Calculation

[0279] Mutual information (MI) scores were calculated between clusters and individual assemblers using mpmi (v0.43.2.1). The statistical significance of the observed MI scores was calculated by generating a background distribution for each data set.

[0280] 1-18. Analysis of co-expression modules in postmortem human brain tissue.

[0281] To identify SCZ-associated co-expression modules, we utilized two data sources: 1) a 73-gene co-expression module that is spatiotemporally regulated in human brain development was previously identified using weighted correlation network analysis (WGCNA); 2) differentially expressed genes (DEGs) between healthy controls and SCZ patients in postmortem brain tissue were obtained from a previous study as part of the PsychENCODE project.

[0282] To identify potential associations between SCZ and co-expression modules, we ranked DEGs based on their log2FC values ​​and performed gene set enrichment analysis (GSEA) on 73 spatiotemporal modules using GSEApy version 0.9.4. Modules that showed significant enrichment (false discovery rate, FDR < 0.05) with DEGs in SCZ were defined as SCZ-related modules. SCZ-related modules that showed positive scale expression in the early time period were subsequently determined to be early developmental modules. To identify NPC-related modules, we performed cell type enrichment analysis on the early developmental modules. Gene ontology (GO) and biological processes enriched in the NPC-related modules were confirmed by hypergeometric testing using curated gene set signatures from MSigDB (v7.0). TF enrichment analysis for genes within NPC-related modules was performed using the hypergeometric test using the "TF target genes" of the PsychENCODE50 gene regulatory network (elastic network regression weight cutoff = 0.1). The enrichment p-values ​​from the hypergeometric test were adjusted using the Benjamini-Hochberg method. TF enrichment tests for differentially expressed genes between forebrain organoids derived from healthy individuals and forebrain organoids derived from SCZ patients were performed using the ChEA3 database web server application.

[0283] 1-19. Predictive analysis to identify signaling axes of cell-to-cell interactions.

[0284] We used the NicheNet platform to identify reciprocal ligand-receptor interactions between neurons and glial cells. To identify neuronal factors that can induce transcriptomic changes in glial cells, the sender and receiver were defined as assembler-derived SCZ neurons and assembler-derived SCZ astrocytes / microglia, respectively. Conversely, to identify glial factors that can induce transcriptomic changes in neurons, the sender and receiver were defined as assembler-derived SCZ astrocytes / microglia and assembler-derived SCZ neurons, respectively. DEGs were used as inputs for both the sender and receiver in the NicheNet platform.

[0285] To obtain differentially expressed genes (DEGs) in neurons, astrocytes, and microglia within SCZ assembleoids, we performed RNA-seq analysis on assembleoid-derived neurons, astrocytes, and microglia from healthy individuals (Healthy #1, 2, 3) and SCZ patients (SCZ #1, 2, 3). Genes with expression levels less than 1 [log2(average Transcripts Per Million (TPM) + 1) < 1] were filtered to obtain genes expressed in specific cell types. DEGs were defined as genes that met the criteria of |log2 Fold Change (FC)| > 1 and adjusted p-value < 0.05 for each cell type.

[0286] To identify differentially expressed genes (DEGs) in neurons, astrocytes, and microglia in postmortem SCZ brains, we analyzed scRNA-seq data from SCZ patients obtained from the National Institute of Mental Health Repository & Genomics Resource (Synapse ID: syn22362009), the central national biorepository for genetic research on psychiatric disorders. We calculated the average gene expression within each cluster annotated as neurons (both glutamatergic and GABAergic types), astrocytes, and microglia. Because no genes met the predefined fold change filter criterion (|log2FC| > 1) in the postmortem brain data, we determined DEGs based on an adjusted p-value < 0.05 for each cell type.

[0287] Four scores (Auroc (area under receiver operating characteristic), Aupr (area under precision-recall), Aupr_correct (area under precision-recall), and Pearson correlation coefficient score) indicating the degree to which a specific ligand can regulate the expression of a specific target gene were calculated for each DEG using the NicheNet platform. The regulatory potential score for individual genes was determined by multiplying these four scores, and genes were ranked based on the regulatory potential score. The top 50 genes in each cell type that were upregulated (log2FC > 0) and showed the highest regulatory potential in SCZ patients were identified and considered as candidate genes involved in the interaction between neurons and glial cells.

[0288] 1-20. RNA sequencing analysis

[0289] 1-20-1. RNA extraction and RNA-seq library construction

[0290] Total RNA was extracted using the RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. RNA-seq libraries were constructed from 1–5 μg of RNA using the TruSeq Stranded mRNA Kit (Illumina) according to the manufacturer's instructions. RNA-seq was performed using the Illumina NovaSeq 6000 or HiSeq X Ten platforms.

[0291] 1-20-2. RNA-seq data processing and DEG analysis

[0292] RNA-seq reads were aligned to the human reference genome GRCh37-hg19 using the STAR (v2.7.2b) aligner with the ENCODE option. Gene expression levels were quantified using the RSEM (v1.2.31) package. For differential expression analysis, we used DEGUST (degust.erc.monash.edu / .), a web-based tool that utilizes the 'limma' and 'edgeR' packages. Count data were filtered based on a minimum expression level and a counts per million (CPM) threshold of 0.5 in at least three samples. The filtered count data were normalized using the 'voom' function in the 'limma' package to prepare the data for linear modeling. A linear model was then fitted to the normalized data using the 'lmFit' function. The 'eBayes' function was applied to obtain differential expression statistics.

[0293] 1-20-3. GO and Pearson Correlation Coefficient Analysis

[0294] GO enrichment analysis for DEGs was performed using the Geneontology website application (http: / geneontology.org / ). Pearson correlation coefficients were calculated between the expression matrices of each data set.

[0295] 1-21. Data Analysis

[0296] Statistical analyses were performed using GraphPad Prism version 10. All data are expressed as the mean ± standard error of the mean (SEM). Comparisons between groups were performed using unpaired or nested t-tests. A p < 0.05 was considered statistically significant.

[0297] <Example 2>

[0298] 2. Experimental results

[0299] 2-1. Creating a mature brain assembler

[0300] In this invention, we developed a step-by-step strategy for producing mature forebrain assemblers. This strategy aims to provide essential developmental signals for producing mature forebrain assemblers and to reconstitute diverse cell types within the system (Figure 1).

[0301] 2-1-1. Production of single rosette organoids

[0302] In the initial stage of development, embryoid bodies (EBs) were derived from hPSCs through suspension culture. The EBs were cultured in Matrigel for 7 days to induce differentiation into the neuroectoderm lineage. On day 14, the Matrigel was removed, and the neuroectoderm structures were cultured for an additional 11 days under shaking conditions to form forebrain organoids composed of multiple individual neuroepithelium-like structures. These neuroepithelium-like structures are known as rosettes composed of NPCs. From day 25 to day 32, the Hedgehog (Hh) and Wnt signaling pathways were pharmacologically activated to promote the proliferation and expansion of NPCs. This process was characterized by an increase in SOX2-positive cells, hypertrophy of the ventricular zone (VZ), and expansion of individual rosettes (Figs. 2 to 6).

[0303] On day 32, forebrain organoids containing expanded rosettes were manually dissociated into single rosette structures, more accurately replicating the single subventricular zone of the developing brain. The resulting single-rosette organoids exhibited a uniform, cyst-like structure with minimal variation across cell lines (Fig. 7). All single-rosette organoids exhibited a single lumen, and although some NPCs slightly protruded toward the lumen, they maintained normal apical polarity, meeting the requirements for normal neurogenesis (Fig. 8).

[0304] 2-1-2. Reconstruction of single rosette organoids and RELN-expressing neurons

[0305] On day 35, after an additional 3-day culture period to stabilize the isolated structures, five single-rosette organoids with diameters closest to the median were selected and reconstituted with hPSC-derived neurons engineered to express RELN (hereinafter, "RELN-expressing neurons") (Fig. 9). Specifically, each single-rosette organoid was encapsulated in a thin layer of Matrigel seeded with RELN-expressing neurons to provide essential signals for precise neural induction suitable for the formation of structured cortical layers, and then cultured for an additional 15 days.

[0306] The RELN-expressing neurons above had the characteristics of glutamatergic neurons showing MAP2, VGLUT1, and P73 positivity, and showed high homogeneity with RELN expression (Fig. 10). That is, based on the marker expression pattern, the RELN-expressing neurons appeared to have a high possibility of functioning as Cajal-Retzius neurons that migrate to the marginal zone (later becoming layer 1) during early human brain development.

[0307] 2-1-3. Microinjection of astrocytes and microglia

[0308] On day 50, hPSC-derived astrocytes and microglia were microinjected into the outer cortical layer to integrate glial cells into the organoids formed in Example 2-1-2 (Figs. 11 and 12). This step was performed to incorporate essential glial cells that contribute to structural and functional maturation. The assembleoids were then cultured for an additional 30 days, during which time the elaboration of neuronal connections, glial cell maturation, and functional neural network formation were promoted. As a result, mature human forebrain assembleoids were successfully formed, closely mimicking the complexity and tissue architecture of the developing human brain, with high uniformity, enhanced cell diversity, and minimal batch effects (Fig. 13).

[0309] 2-2. Confirmation of the six-layer cortical structure and functional connectivity of the mature forebrain assembler.

[0310] 2-2-1. Confirming the 6-layer cortical structure

[0311] It was confirmed that the neurons in the mature forebrain assembler developed in the present invention are radially aligned, and their axons form a structure extending from the outer to the inner cortical region across the cortical layer (Figs. 14 and 15).

[0312] Since the human cortical layer is composed of upper layer neurons: SATB2 (layer 4), BRN2 (layer 3), CUX2 (layer 2), RELN (layer 1) expressing neurons and deep layer neurons: CTIP2 (layer 5), TBR1 (layer 6) expressing neurons, in order to additionally evaluate whether the neurons in the forebrain assembler of the present invention form a layered structure similar to the human cortex, immunostaining analysis using layer-specific cortical neuron markers was performed. As a result, it was confirmed that the layer-specific markers from layer 6 to layer 1 were distributed in the correct order in the forebrain assembler (Fig. 16). Furthermore, through quantitative analysis of the layer-by-layer expression pattern of layer-specific neuron markers, it was demonstrated that the newly developed forebrain assembler systematically formed a cortical structure composed of six layers (Fig. 17).

[0313] In particular, RELN-expressing neurons were consistently located on the outer surface of the forebrain assembler, suggesting that they function as layer 1 neurons that play a crucial role in the early developmental stages of the human brain (Figs. 16 and 17).

[0314] 2-2-2. Confirmation of maturation based on glial cells

[0315] Additionally, we analyzed the maturity based on glial cell development within the forebrain assembler.

[0316] GFAP-positive astrocytes exhibited a distinct star-like mature branching morphology and formed tripartite synapses with neurons (Fig. 18).

[0317] Microglia expressing IBA1 exhibited diverse morphologies, ranging from amoeboid to ramified, reflecting active and resting states, respectively (Fig. 19). Furthermore, these microglia were observed adjacent to neurons and actively migrated within the assembler, suggesting possible functional activities such as synaptic engulfment and remodeling (Fig. 19).

[0318] 2-2-3. Confirming neuron-based maturity and functional connectivity

[0319] To more precisely assess the spontaneous neural activity of forebrain assembles, we performed calcium imaging analysis without external stimulation to observe intracellular calcium dynamics in multiple neurons in real time. As a result, we observed an average of 3-4 spontaneous calcium surges per minute in individual neurons (Fig. 20). In addition, we analyzed various electrophysiological characteristics of forebrain assembles through extracellular recording using MEA. The analysis results confirmed that forebrain assembles exhibited robust electrical activity, including spontaneous spikes accompanied by distinct action potentials and depolarizations (Fig. 21). Furthermore, most firing events within forebrain assembles occurred in the form of repetitive, periodic bursts, with an average burst frequency of 0.33 Hz and an interburst interval (IBI) of 3.04 s (Fig. 22). These data suggest that the forebrain assembler possesses robust, spontaneous neural activity.

[0320] To determine whether activated neurons within the forebrain assembler were functionally connected, we analyzed area-wide calcium spike patterns to assess the synchronization of calcium spikes. High levels of synchronized calcium activity were observed throughout the forebrain assembler (Fig. 23), and even at the single-cell level, multiple individual neurons simultaneously exhibited calcium spikes within a short time window (1-3 s) (Fig. 24). This pattern suggests the presence of a functionally connected neural network. These interneuronal synchronization patterns were further verified through channel-level MEA analysis. The analysis revealed synchronized neural activity across multiple channels within the forebrain assembler, manifesting as network burst events (Fig. 25). Furthermore, these network bursts exhibited a periodic and regular oscillatory pattern, with an average network burst frequency of 0.3 Hz (Figs. 21, 22, and 25).

[0321] In summary, the above results, based on structural and functional analyses, demonstrate that the forebrain assembler is a model for forming a mature six-layer cortical structure with cellular diversity, mature synapse formation, and functionally connected neural networks.

[0322] 2-3. Identification of the cellular composition and transcriptome of mature forebrain assembler

[0323] The forebrain assembler produced in the present invention was confirmed to contain seven transcriptionally distinct cell types within the forebrain lineage, including radial glia (RGs), dividing RGs, intermediate progenitor cells (IPCs), excitatory neurons, inhibitory neurons, astrocytes, and microglia (Figs. 26 and 27). In particular, the cellular composition and transcriptome profile analysis of the forebrain assembler showed a high correlation with the late fetal stage (37 weeks) human fetal brain (Fig. 28). Further in-depth analysis confirmed that the neurons in the forebrain assembler were separated into six distinct cell populations expressing layer-specific markers, and each population was correlated with a specific cortical layer of the human brain (Figs. 29 to 31). Furthermore, developmental trajectory analysis showed that excitatory neurons in each cortical layer of the forebrain assembler sequentially generate layer-specific neurons from layer 6 to layer 2, following a normal developmental process (Fig. 32), which was very similar to the developmental pattern observed during human brain development.

[0324] Additionally, mutual information (MI) scores were calculated to evaluate the consistency of forebrain assemblers derived from different batches and stem cell lines, and a high level of consistency was confirmed in all assemblers (Fig. 26).

[0325] In summary, the forebrain assembler contains six distinct layers of cortical neurons and a diverse array of glial cells with a high degree of consistency, suggesting a high degree of maturity and cellular complexity similar to the cortex of the developing human brain.

[0326] 2-4. Phenotypic confirmation of forebrain assembler derived from SCZ patients

[0327] Early forebrain organoids are characterized by active proliferation of NPCs before the development of distinct cortical characteristics. Early-stage organoids derived from eight SCZ patients showed reduced numbers of SOX2-positive cells and impaired NPC proliferation, resulting in the formation of small rosettes with poorly defined ventricles and a thin subventricular zone (VZ) (Figs. 33–36). Furthermore, defective NPC proliferation was accompanied by impaired mature differentiation, characterized by a decreased rate of horizontal divisions and an increase in oblique and vertical divisions (Figs. 37 and 38). These results suggest that the early brain phenotypic defects in SCZ patients are due to impaired NPC proliferation and premature differentiation.

[0328] Furthermore, we reconstituted RELN-expressing neurons and patient-derived glial cells into patient-derived early organoids to generate eight SCZ patient-derived forebrain assembleoids, and examined the structural and functional changes in the later stages of SCZ brain development. Interestingly, all SCZ patient-derived forebrain assembleoids formed an appropriate laminar structure with six cortical layers, similar to the healthy forebrain assembleoids (Fig. 39). However, the overall thickness of each layer was significantly reduced, which is likely due to a proliferation defect in NPCs in the early stage. Furthermore, compared to the healthy control group, SCZ patient-derived forebrain assembleoids showed a significant decrease in synaptic density, neuronal excitability, and synaptic transmission, indicating a significant decrease in functional connectivity (Figs. 40 and 41). These results suggest that the brains of SCZ patients have a weakened laminar structure of the cortical layers and impaired synaptic function in the later stages of neurodevelopment.

[0329] 2-5. TP53 and NFATC4 in the early stages of SCZ development

[0330] To elucidate the mechanisms underlying the early defects in NPC proliferation in the SCZ brain, we performed gene expression module analysis using a large-scale transcriptome database (PsychENCODE; Figure 42) of brain tissue samples collected from hundreds of SCZ patients. Analysis of the temporal gene expression profiles of nine SCZ-associated modules revealed that three modules, ME13, ME26, and ME58, were associated with early developmental stages (Figure 43). Cell type-specific expression analysis confirmed that the ME13 module was specifically enriched in NPCs, which was further supported by GO analysis indicating that ME13 functions in NPC proliferation and differentiation (Figure 44). Given the recent report of a strong association between SCZ pathogenesis and altered expression of epigenetic regulators, we aimed to identify master regulators that epigenetically regulate the early transcriptome associated with ME13. Transcription factor abundance analysis identified 12 genes as key regulatory factor candidates (Fig. 44), and subsequent quantitative RT-PCR analysis confirmed that expression of TP53 and NFATC4 was significantly increased in all SCZ forebrain organoids compared to healthy organoids (Fig. 45).

[0331] Furthermore, in organoids in which TP53 and NFATC4 expression was suppressed, increased proliferation of NPCs was observed, and the proportion of oblique and vertical divisions was reduced, which resulted in an increase in the number of SOX2-positive NPCs per rosette (Figs. 46-48). Additionally, gene expression analysis revealed that the transcriptome of SCZ forebrain organoids in which TP53 and NFATC4 expression was knocked out showed high similarity to the transcriptome of healthy forebrain organoids (Fig. 49). GO analysis confirmed that cell proliferation-related pathways and cell differentiation-related pathways were altered in forebrain organoids in which TP53 and NFATC4 expression was knocked out (Fig. 50).

[0332] 2-6. UCN / PTPRF-WNT11 / THBS4 signaling axis in the late developmental stage of SCZ

[0333] Several studies have suggested that altered cell-to-cell interactions between various cell types are strongly associated with the pathogenesis of human SCZ. To elucidate the dynamic changes in interactions between the three major cell types—neurons, astrocytes, and microglia—in the SCZ brain, we combined patient-derived forebrain organoids with patient-derived glial cells to create a "mix-and-match forebrain assembler" (Fig. 51).

[0334] All four assembleoids (SHH, SHS, SSH, and SSS) containing neurons derived from SCZ patients exhibited functional abnormalities, regardless of whether the glial cells were derived from healthy individuals or SCZ patients (Fig. 52). This suggests that glial cells possess high plasticity. Notably, comparative analysis of the functions of normal and SCZ assembleoids depending on the presence or absence of glial cells confirmed that glial cells play a crucial role in both normal and SCZ brain development through plasticity (Figs. 53–56). Furthermore, the observation that functional abnormalities and other phenotypic changes were also observed in mix-and-match SCZ forebrain assembleoids reconstituted with glial cells derived from healthy individuals supports the possibility that glial plasticity is regulated by neurons.

[0335] Comparative analysis between brain assembleoids and postmortem tissues revealed that five neuronal factors and nine astroglial factors involved in neuron-astrocytic interactions, and two neuronal factors and seven microglial factors involved in neuron-microglia interactions, constitute common signaling circuits (Fig. 57). Furthermore, the expression of candidate genes in neurons and glial cells derived from SCZ forebrain assembleoids was confirmed by quantitative RT-PCR (qRT-PCR) analysis (Fig. 58). In addition, two reciprocal signaling axes were further identified: the UCN-WNT11 signaling axis between neurons and astrocytes and the PTPRF-THBS4 signaling axis between neurons and microglia (Fig. 59).

[0336] In forebrain assemblers generated by reconstituting SCZ neurons and SCZ glial cells in which UCN / PTPRF was ablated, the expression of WNT11 and THBS4 in astrocytes and microglia, respectively, was significantly reduced, and functional connectivity was significantly improved (Figs. 60 and 61). Furthermore, in forebrain assemblers generated by reconstituting SCZ neurons, astrocytes in which WNT11 was ablated, and microglia in which THBS4 was ablated, the synaptic function observed in the original SCZ assembler neurons was restored (Fig. 62).

[0337] Taken together, our results suggest that hyperactivation of reciprocal signaling feedback between SCZ neurons and glia mediated through the UCN / PTPRF-WNT11 / THBS4 signaling axis induces phenotypic changes through abnormal neuronal responses to various stimuli and defective biomolecule synthesis.

[0338] The present invention is an invention carried out through the following tasks.

[0339] [National Research and Development Project Supporting This Invention]

[0340] [Project ID] 1711196338

[0341] [Assignment Number] 00223277 (RS-2023-00223277)

[0342] [Ministry Name] Ministry of Science and ICT

[0343] [Name of Project Management (Specialist) Institution] National Research Foundation of Korea

[0344] [Research Project Name] Biomedical Technology Development

[0345] [Research Project Name] Discovery of a New Stem Cell Population and Development of a Novel Disease Model through the Construction of ATLAS, a Stem Cell System for the Whole Urinary Tract

[0346] [Name of the project performing organization] Seoul National University Industry-Academic Cooperation Foundation

[0347] Research Period: April 1, 2023 - December 31, 2027

[0348] [National Research and Development Project Supporting This Invention]

[0349] [Project ID] 1711187403

[0350] [Assignment Number] 2022R1A2C3002702

[0351] [Ministry Name] Ministry of Science and ICT

[0352] [Name of Project Management (Specialist) Institution] National Research Foundation of Korea

[0353] [Research Project Name] Individual Basic Research (Ministry of Science and ICT)

[0354] [Research Project Name] Research on Cell Differentiation Anticancer Treatment for Anticancer Drug-Resistant Tumors Based on Tumor Assembroid Technology

[0355] [Name of the project performing organization] Seoul National University Industry-Academic Cooperation Foundation

[0356] Research Period: March 1, 2022 - February 28, 2025

[0357] [National Research and Development Project Supporting This Invention]

[0358] [Task Base Year] 2024

[0359] [Project ID] 2460001995

[0360] [Subject Number] 00466703

[0361] [Ministry Name] Ministry of Health and Welfare

[0362] [Project Name] Global Research Cooperation Support Project

[0363] [Principal Investigator] Shin Geun-yu

[0364] [Name of the project performing organization] Seoul National University Industry-Academic Cooperation Foundation

[0365] [Project Management (Specialized) Agency] Name: Korea Health Industry Development Institute

[0366] [Project Period for the Current Year] 2024-10-01~2025-03-31

[0367] [Project Title] Developing Disease Treatment Control Technologies and Identifying Interactions Between Brain Cells, Brain Tissue, and Organs through the Construction of Human Multi-Organ Assemblies

Claims

1. A method for manufacturing a brain assembler comprising the following steps: (a) A step of culturing pluripotent stem cells (PSCs) to form forebrain organoids; (b) a step of treating a substance that activates the Hedgehog and Wnt signaling pathways of the forebrain organoid; (c) a step of separating the forebrain organoid into a single rosette structure to form a single rosette forebrain organoid; (d) a step of culturing the single rosette forebrain organoid by encapsulating it with reelin (RELN) expressing neurons; and (e) A step of producing a forebrain assembler by injecting glial cells into the single rosette forebrain organoid.

2. A method for manufacturing a whole brain assembler, characterized in that the whole brain assembler in the first paragraph is a human whole brain assembler.

3. A method for producing a whole brain assembler, characterized in that in the first paragraph, the substances that activate the Hedgehog and Wnt signal pathways in step (b) are CHIR99021 and SAG.

4. A method for producing a whole brain assembler, characterized in that in the third paragraph, the CHIR99021 is at a concentration of 0.1 to 5 μM, and the SAG is at a concentration of 100 to 1000 nM.

5. A method for producing a whole brain assembler, characterized in that it further comprises a step of producing a relin-expressing neuron before step (d) in the first paragraph.

6. A method for producing a forebrain assembler, characterized in that in the fourth paragraph, the reelin-expressing neuron is produced by transducing reelin into neural progenitor cells.

7. In the first paragraph, the relin-expressing neurons are 1×10 3 1×10 5 A method for manufacturing a brain assembler characterized by individual features.

8. A method for manufacturing a whole brain assembler, characterized in that in the step (e), the glial cells are at least one selected from the group consisting of astrocytes and microglia.

9. In the 8th paragraph, the stellate cells are 1×10 3 1×10 5 It is a dog, and the microglia are 1×10 2 1×10 4 A method for manufacturing a brain assembler characterized by individual features.

10. In paragraph 1, A virtual first line penetrating the outer cortical layer of the single rosette forebrain organoid, A virtual second line penetrating the outer cortical layer of the single rosette forebrain organoid but orthogonal to the first line, and A virtual third line penetrating the outer cortical layer of the single rosette forebrain organoid, but orthogonal to the first line and the second line, The first line, the second line and the third line penetrate the center of the single rosette forebrain organoid, A method for producing a forebrain assembler, wherein the glial cells are injected into the outer cortical layer of the single rosette forebrain organoid at a location where the first line, the second line, and the third line contact the outer cortical layer of the single rosette forebrain organoid.

11. A method for manufacturing a whole brain assembler, characterized in that in the first paragraph, the substance that activates the Hedgehog and Wnt signal pathways in the step (b) is treated for 5 to 10 days.

12. A method for producing a whole brain assembler, characterized in that in the first paragraph, the culturing in the step (d) is performed for 10 to 20 days.

13. A method for producing a whole brain assembler, further comprising, after step (e), a step of further culturing and maturing the whole brain assembler for 10 to 40 days.

14. A brain assembler manufactured by any one of the manufacturing methods of clauses 1 to 13. A forebrain assembler comprising a single rosette structure comprising 15.6 cortical layers and a cavity, characterized in that the cortical layer comprises glial cells.

16. A forebrain assembler characterized in that the forebrain assembler in the 15th paragraph is a human forebrain assembler.

17. A forebrain assembler according to claim 15, characterized in that the six cortical layers are a first layer expressing RELN, a second layer expressing CUX2, a third layer expressing BRN2, a fourth layer expressing SATB2, a fifth layer expressing CTIP2, and a sixth layer expressing TBR1.

18. A forebrain assembler according to claim 15, characterized in that the glial cells are at least one selected from the group consisting of astrocytes and microglia.

19. A forebrain assembler according to claim 18, characterized in that the microglia are in a state of moving within the assembler.

20. A whole brain assembler according to claim 15, characterized in that the assembler exhibits spontaneous neural activity and includes a functionally connected neural network.

21. A forebrain assembler according to claim 15, characterized in that it further comprises at least one cell type selected from the group consisting of radial glial cells, intermediate progenitor cells, excitatory neurons, and inhibitory neurons. A composition for diagnosing schizophrenia, characterized in that it comprises a preparation for measuring the expression level of 22.UCN, a preparation for measuring the expression level of PTPRF, a preparation for measuring the expression level of WNT11, and a preparation for measuring the expression level of THBS4.

23. A composition for diagnosing schizophrenia, characterized in that it further comprises a preparation for measuring the expression level of TP53 and a preparation for measuring the expression level of NFATC4 in accordance with claim 22.

24. In paragraph 22, the composition for diagnosing schizophrenia is applied to a schizophrenia whole brain assembly manufactured by culturing cells isolated from an individual to be confirmed to have schizophrenia, The above schizophrenia brain assembler is, (a) a step of forming a forebrain organoid by culturing pluripotent stem cells derived from the above entity; (b) a step of treating a substance that activates the Hedgehog and Wnt signaling pathways of the forebrain organoid; (c) a step of separating the forebrain organoid into a single rosette structure to form a single rosette forebrain organoid; (d) culturing the single rosette forebrain organoid by encapsulating it with reelin-expressing neurons; and (e) A composition for diagnosing schizophrenia, characterized in that it is manufactured through a step of manufacturing a schizophrenia forebrain assembler by injecting the subject-derived glial cells into the single rosette forebrain organoid.

25. A kit for diagnosing schizophrenia comprising a composition according to any one of claims 22 to 24.

Citation Information

Patent Citations

  • Stem cell derived single-rosette brain organoids and related uses thereof

    WO2021216846A2