Fusion protein and use thereof
By fusing the active fragment of Neuritin with Fc or His protein to form a fusion protein, combined with CB2 agonists and specific drug carriers, the treatment challenges of inflammation-related diseases have been solved, achieving long-lasting therapeutic effects with low toxicity and side effects and low cost, while promoting tissue repair and immune balance.
Patent Information
- Application Number
- PCT/CN2024/094774
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-05-22
- Publication Date
- 2025-11-27
AI Technical Summary
In the current technology, there are no effective treatments for inflammation-related diseases such as autoimmune diseases, age-related degenerative diseases, and diabetic refractory wounds. Moreover, existing drugs have significant side effects and are costly, and traditional drugs are difficult to cure completely.
Design a fusion protein by fusing a Neuritin active fragment with an Fc or His protein via disulfide bonds in the Fc hinge region, binding a CB2 agonist, and using hydrogels or nanoparticles as drug carriers to improve drug stability and targeting. Polyethylene glycol modification is used to enhance in vivo stability and half-life.
It provides a treatment option with a clear target, low toxicity and side effects, and low cost, which significantly relieves inflammatory symptoms, prolongs the duration of action of Neuritin in the body, enhances the therapeutic effect, and promotes tissue repair and immune balance.
Smart Images

Figure CN2024094774_27112025_PF_FP_ABST
Abstract
Description
Fusion protein and application thereof TECHNICAL FIELD
[0001] The present application belongs to the technical field of biological medicine, and particularly relates to a fusion protein and application of the fusion protein in preparation of anti-inflammatory disease products. BACKGROUND
[0002] The inflammatory diseases include autoimmune diseases, senile degenerative diseases and diabetic refractory wounds.
[0003] Autoimmune diseases are chronic diseases. Currently, the clinical immunotherapy for autoimmune diseases mainly uses tumor necrosis factor alpha antagonists and interleukin 1 antagonists. Patients are prone to infection and allergic symptoms. The existing drugs for treating autoimmune diseases include non-steroidal drugs and steroid drugs. Long-term use of the drugs is accompanied by adverse gastrointestinal symptoms, and even destroys the intestinal wall to cause intestinal leakage, thereby aggravating the pain of patients.
[0004] Most of the senile degenerative diseases have no effective treatment, and there is no complete cure. The means for relieving symptoms are also limited. For senile degenerative diseases such as Alzheimer's disease, commonly used drugs include acetylcholinesterase inhibitors and N-methyl-D-aspartate (NMDA) receptor antagonists. These drugs can improve nerve conduction function and relieve symptoms, but cannot cure the disease.
[0005] In the treatment of diabetic refractory wounds, in addition to the conventional methods such as blood sugar control and debridement, some new treatment methods such as autologous skin transplantation and stem cell therapy have appeared in the clinic. However, the treatment cost of these methods is high, and the safety of the clinical use is still controversial.
[0006] Neuritin is a neurotrophic factor, which plays an important role in regulating synaptic plasticity, neuronal growth, migration and survival. The open reading frame of Neuritin is 429 bp, which encodes 142 amino acids. Although most of the studies on Neuritin mainly focus on its effect on the nervous system, few people report the regulatory effect of Neuritin in the immune system.
[0007] The present application provides a novel Neuritin fusion protein for treating autoimmune diseases, senile degenerative diseases and diabetic refractory wounds and other inflammatory diseases. The Neuritin fusion protein is an original therapeutic fusion protein drug with clear target, obvious effect, low toxicity and low cost.
[0008] SUMMARY
[0009] The present application aims to provide a fusion protein to solve the problem of lack of effective drugs for treating inflammation-related diseases and large side effects of drugs in the prior art.
[0010] The present application also provides a DNA molecule encoding the fusion protein and a recombinant vector.
[0011] The present application also provides the use of the fusion protein in the preparation of anti-inflammatory disease products.
[0012] To achieve the above-mentioned purposes, the present application adopts the following technical solutions:
[0013] A fusion protein, which is fused by an active fragment of Neuritin and Fc protein or His protein, wherein the amino acid sequence of the active fragment of Neuritin is shown as SEQ ID NO: 1.
[0014] Further, the amino acid sequence of the Fc protein is shown as SEQ ID NO: 2.
[0015] Further, the amino acid sequence of the His protein is shown as SEQ ID NO: 3.
[0016] Further, the fusion protein is connected by the disulfide bond of the Fc hinge region between the active fragment of Neuritin and the Fc protein fragment.
[0017] In the present application, the amino acid sequence of the fusion protein is shown as SEQ ID NO: 4 or SEQ ID NO: 5.
[0018] A DNA molecule encoding the fusion protein.
[0019] Further, the DNA molecule contains a nucleic acid sequence encoding the active fragment of Neuritin protein.
[0020] Further, the nucleic acid sequence encoding the active fragment of Neuritin protein is shown as SEQ ID NO: 6.
[0021] Further, the nucleic acid sequence of the DNA molecule is shown as SEQ ID NO: 9 or SEQ ID NO: 10.
[0022] A recombinant vector comprising the DNA molecule and a plasmid vector.
[0023] Further, the plasmid vector is a eukaryotic expression vector pcDNA3.1(+).
[0024] A recombinant cell strain comprising the DNA molecule or the recombinant vector.
[0025] Further, the recombinant cell strain is obtained by transfecting cells with the recombinant vector.
[0026] A composition comprising the fusion protein.
[0027] Further, the composition further comprises a pharmaceutical carrier, which is a hydrogel or a nanoparticle or a liposome. The liposome can be used to encapsulate the drug in the liposome to improve its stability and targeting. The ideal drug delivery system for treating wounds with hydrogel is to deliver drugs in the deep layer of the skin. The use of nanoscale local drug delivery system, combined with the characteristics of hydrogel / nanoparticle, can stabilize the long-term release of drugs in the wound.
[0028] Further, the fusion protein is modified by polyethylene glycol and its derivatives. Protein drugs are easily hydrolyzed by hydrolytic enzymes in the body, and it is difficult to deliver them to the corresponding site. Therefore, it is necessary to improve the stability of protein drugs to hydrolytic enzymes and to improve the retention of protein drugs in the body to ensure their maximum therapeutic effect. Polyethylene glycol modification can be used. The derivatives of polyethylene glycol can form a covalent bond with the side chain groups of amino acids, which can improve the water solubility of the drug, reduce the toxic side effects and immunogenicity, and increase the half-life of the drug.
[0029] In the present application, the composition further comprises a CB2 agonist.
[0030] Further, the CB2 agonist is HU308.
[0031] Further, the composition further comprises an excipient.
[0032] The fusion protein is used for treating inflammation-related diseases.
[0033] The fusion protein is used for preparing anti-inflammatory related disease products.
[0034] Further, the inflammation-related disease comprises one of autoimmune diseases, senile degenerative diseases, and diabetic refractory wounds.
[0035] The present application has the following advantages:
[0036] (1) The fusion protein of the present application is fused by connecting the Neuritin active fragment with the Fc protein or the His protein, and the fusion protein is used for treating inflammation-related diseases, which is a target-specific, effective, low-toxicity, low-cost treatment fusion protein drug.
[0037] (2) The fusion protein of the present application can prolong the half-life of Neuritin in the plasma by fusing Neuritin with the Fc protein, prolong the action time of Neuritin in the body, and enhance the treatment capacity. At the same time, the fusion Fc fragment can increase the molecular volume and reduce the kidney clearance rate, further improving the treatment effect.
[0038] (3) The fusion protein of the present application interacts with CB2, can inhibit MIP2 and IL6, significantly relieves the symptoms of inflammation, and has better effect when combined with CB2 agonist. BRIEF DESCRIPTION OF DRAWINGS
[0039] The technical solutions of the present application will be further described below in combination with the drawings and specific embodiments of the present application.
[0040] Fig. 1 is an immunofluorescence staining diagram and electrophoretic co-precipitation diagram of different cells transfected with CB2 and Neuritin plasmid;
[0041] Fig. 2 is the influence of Neuritin fusion protein and CB2 agonist on macrophages;
[0042] Fig. 3 is the healing situation of cell scratch after Neuritin fusion protein intervention;
[0043] Fig. 4 is the influence of Neuritin fusion protein on the symptoms of psoriasis in mice;
[0044] Fig. 5 is the influence of Neuritin on the symptoms of psoriasis;
[0045] Fig. 6 is the influence of Neuritin fusion protein on the symptoms of intestinal inflammation in DSS-induced intestinal inflammation model;
[0046] Fig. 7 is the treatment effect of Neuritin fusion protein after knocking out CB2 receptor; DETAILED DESCRIPTION
[0047] The purpose of the present application is to design a new type of fusion protein for treating autoimmune diseases, senile degenerative diseases and promoting tissue repair and other inflammation-related diseases. Neuritin, as a potential immunosuppressive molecule, can maintain and regulate the homeostasis of the immune system in the body, correct the broken immune balance in autoimmune diseases, have significant effect with less drug administration, and the present application can improve the deficiencies of existing treatment methods for autoimmune diseases, senile degenerative diseases and wound healing and enrich the treatment approaches.
[0048] The inventors found that Neuritin is a potential immunosuppressive molecule, the tumor growth rate of Neuritin systemically deficient mice is slowed down, the expression of IFN-gamma is increased, the expression of PD1 is reduced, and a stronger anti-tumor response is exhibited. As a newly discovered immunosuppressive molecule, Neuritin has low side effects in the immune system. It has a small molecular weight, can penetrate various tissue barriers, can maintain and regulate the homeostasis of the immune system, and can restore the broken immune balance in autoimmune disease patients rather than simply inhibit the occurrence of inflammation, thereby fundamentally controlling the development of autoimmune diseases and having a more stable and long-lasting effect.
[0049] The present application proves that Neuritin can bind to cannabinoid receptor 2 (CB2) to exert its anti-inflammatory effect, CB2 is a G protein-coupled receptor and a member of the cannabinoid receptor family, and CB2 receptors are mainly expressed on the surfaces of immune cells such as B cells, macrophages, dendritic cells and T cells in the immune system. Neuritin can act on the CB2 receptors on the surfaces of immune cells such as macrophages, inhibit the expression of inflammatory proteins MIP2 and cytokines IL6 in macrophages, and thus achieve the purpose of anti-inflammation. In a DSS-induced mouse intestinal inflammation model, administration of Neuritin can significantly slow down the progression of intestinal inflammation in mice; and in CB2 systemically knockout mice intervened by DSS, the function of Neuritin in treating intestinal inflammation is significantly weakened. This result suggests that Neuritin may be an endogenous ligand of CB2 receptor, and Neuritin can inhibit the occurrence of inflammation by activating CB2 receptor.
[0050] The present application provides an optimized point mutation Fc sequence, a design for fusion with Neuritin, and a modified Fc protein that can prolong the half-life of Neuritin in plasma, prolong the action time of Neuritin in vivo, and enhance its therapeutic ability. At the same time, the fusion Fc fragment can increase the molecular volume and reduce the renal clearance rate. For patients who are ineffective for traditional drugs, the combination of the two provides a new means for treating autoimmune diseases, senile degenerative diseases and promoting tissue repair and healing pathways related to inflammatory diseases, and is expected to achieve long-term therapeutic effect by regulating immune balance. Specifically as follows:
[0051] The present application provides a fusion protein, which is fused by an active fragment of Neuritin and an Fc protein or a His protein, the amino acid sequence of the active fragment of Neuritin is shown as SEQ ID NO: 1.
[0052] Further, the amino acid sequence of the Fc protein is shown as SEQ ID NO: 2. The amino acid sequence of the His protein is shown as SEQ ID NO: 3.
[0053] Further, the fusion protein is connected by disulfide bond of Fc hinge region between Neuritin active fragment and Fc protein fragment.
[0054] In the present application, the amino acid sequence of the fusion protein is shown in SEQ ID NO: 4 or SEQ ID NO: 5.
[0055] The present application provides a DNA molecule encoding the fusion protein.
[0056] Further, the DNA molecule contains nucleic acid sequence encoding Neuritin protein active fragment.
[0057] Further, the nucleic acid sequence encoding Neuritin protein active fragment is shown in SEQ ID NO: 6.
[0058] Further, the nucleic acid sequence of the DNA molecule is shown in SEQ ID NO: 9 or SEQ ID NO: 10.
[0059] The present application provides a recombinant vector comprising the DNA molecule and plasmid vector.
[0060] Further, the plasmid vector is eukaryotic expression vector pcDNA3.1(+).
[0061] The present application provides a recombinant cell strain comprising the DNA molecule or the recombinant vector.
[0062] Further, the recombinant cell strain is obtained by transfecting cells with the recombinant vector.
[0063] The present application provides a composition comprising the fusion protein.
[0064] Further, the composition further comprises a pharmaceutical carrier, which is hydrogel or nanoparticle or liposome. The use of liposome can encapsulate the drug in the liposome to improve its stability and targeting. The ideal drug delivery system for hydrogel treatment of wound is to deliver the drug in the deep layer of the skin. The use of nanoscale local drug delivery system, combined with the characteristics of hydrogel / nanoparticle, can stabilize the long-term release of the drug in the wound.
[0065] The hydrogel is a kind of polymer material composed of cross-linked macromolecules and water, and has the characteristics of high water content, softness, good biocompatibility, etc. Polyvinyl alcohol is dissolved in hot water, stirred until polyvinyl alcohol is completely dissolved, and then cooled to room temperature to obtain a polyvinyl alcohol solution with a mass percentage concentration of 5% to 15%. Then, the purified hNeuritin-Fc protein or hNeurritin-His protein is dissolved in the polyvinyl alcohol solution, stirred uniformly, and left at room temperature for 3 hours to obtain a hNeuritin-fc hydrogel dressing.
[0066] Further, the fusion protein is modified by polyethylene glycol and its derivatives. Protein drugs are easily hydrolyzed by hydrolytic enzymes in the body, and it is difficult to deliver them to the corresponding site. Therefore, it is necessary to improve the stability of protein drugs to hydrolytic enzymes and improve the retention of protein drugs in the body to ensure their maximum therapeutic effect. Polyethylene glycol modification can be used. The derivatives of polyethylene glycol can form a covalent bond with the side chain group of amino acid, which can improve the water solubility of the drug, reduce the toxic side effects and immunogenicity, and increase the half-life of the drug.
[0067] Further, the composition further comprises an excipient. For patients with allergic asthma and other diseases, the purified hNeuritin-Fc protein or hNeurritin-His protein is added to an appropriate amount of excipient NaCl to prepare a fine dry powder by spray drying technology, and filled into an inhalation system. The dry hNeurtin-Fc powder can increase the stability of the preparation. The inhalation powder spray is a local administration method, which can directly act on the lesion, has small side effects on the whole body, and has the characteristics of rapid effect.
[0068] In the present application, the composition further comprises a CB2 agonist.
[0069] Further, the CB2 agonist is HU308.
[0070] Example 1
[0071] Construction of fusion plasmid
[0072] (1) The fragment of hNeuritin for exerting anti-inflammatory activity is a 60-amino-acid sequence.
[0073] The amino acid sequence of the Fc protein is as follows:
[0074] The amino acid sequence of the His protein is as follows:
[0075] The amino acid sequence of the Fc fusion protein is as follows:
[0076] The amino acid sequence of His fusion protein is as follows:
[0077] The construction of Fc fusion protein can form stable dimers through disulfide bond connection of Fc hinge region, and further through genetic engineering modification and modification of disulfide bond, Fc fusion protein can also be aggregated into hexamer complex. Fc region can be independently folded to ensure the stability of Neuritin in vitro and in vivo.
[0078] (2) The sequence of the active fragment of Neuritin is connected with the sequence of Fc protein and His protein respectively to synthesize DNA fragments, and the primers are designed to introduce homologous arms to insert the DNA fragments of hNeuritin-Fc or hNeuritin-His synthesized by the company into the MCS region of the vector.
[0079] The sequence of the primer is as follows:
[0080] hNeuritin-Fc-F: TTGGTACCGAGCTCGGCGGGCAAGTGCGATGCG
[0081] hNeuritin-Fc-R: CGTTACTAGTGGATCTTTACCCGGAGACAGGGA
[0082] hNeuritin-His-F: TTGGTACCGAGCTCGGCGGGCAAGTGCGATGCG
[0083] hNeuritin-His-R: CGTTACTAGTGGATCGTGATGGTGATGGTGATGC
[0084] The nucleic acid sequence of Neuritin DNA molecule is as follows:
[0085] The nucleic acid sequence of Fc protein is as follows:
[0086] The nucleic acid sequence of His protein is as follows:
[0087] The nucleic acid sequence of synthesized DNA is as follows:
[0088] hNeurritin-Fc:
[0089] hNeurritin-His:
[0090] The reaction system and reaction conditions of homologous arm introduction are as follows: Table 1:
[0091] Table 1. Reaction system with the introduction of homologous arms
[0092] Reaction conditions: 98℃, 10s; 60℃, 30s; 72℃, 5min; 35 cycles.
[0093] (3) pCDNA3.1(+) was selected as the expression vector, and EcoRI was selected as the restriction site in the vector. The incubation time was 37℃ for 2 h and 65℃ for 20 min.
[0094] The enzyme digestion system is as follows:
[0095] (4) The linearized vector was ligated to the hNeurin-Fc or hNeurritin-His fragment using the Vanzyme Seamless Cloning Kit.
[0096] (5) Transformation of recombinant plasmid: Add 10 μL of recombinant product to 100 μL of competent cells for transformation. After heat shock in a 42℃ water bath for 60 seconds, immediately place on ice to cool for 2 min. Add 900 μL of LB medium (without antibiotics), shake at 37℃ for 1 h, plate the transformed cells, and incubate at 37℃ overnight. Pick single colonies for sequencing.
[0097] Example 2
[0098] Protein purification
[0099] (1) The plasmid that was correctly sequenced was placed in a 490cm solution. 3 Roller-type bottles with breathable caps, at 0.5 × 10 6 HEK 293F cells were cultured at a density of 1.0 × 10⁶ cells / ml until a final volume of 300 ml was reached. The cells were then cultured for 24 hours in a shaker at 37°C, 120 rpm, and 8% CO₂, achieving a final density of 1.0 × 10⁶ cells / ml. 6 Cells / ml. Add 300ug of plasmid to 30ml of PBS and vortex for 3 seconds. Then add 1.2ml of 0.5mg / ml PEI reagent, mix well, and incubate at room temperature for 20min. Then add to 293F cells for transfection for 48h. Centrifuge to collect the supernatant, 4℃, 19000g, 20min.
[0100] (2) Protein purification was performed using a protein A affinity chromatography column. The column was washed with ten volumes of binding buffer, and the supernatant containing hNeuritin-Fc or hNeuritin-His was slowly passed through the column. The column was then eluted with five volumes of elution buffer. The protein was collected after centrifugation in the dialysis column at 3000 rpm for 15 min. After the protein concentration was determined, the protein was stored at -20℃.
[0101] Example 3
[0102] Verification of the relationship between Neuritin and CB2
[0103] (1) After transfecting CB2 and Neuritin plasmids into Hela cells, 293T cells and B16-F10 cells for 24 hours, respectively, the co-localization of CB2 and Neuritin in different cells was detected by immunofluorescence staining;
[0104] (2) Overexpressing Flag-Neuritin and HA-CB2 in 293T cells, after incubating the proteins with Flag antibody and HA antibody, respectively, the proteins were combined with protein A / G beads, and then Western blot was used to verify the expression of Flag-Neurtin and HA-CB2.
[0105] The results are shown in Figure 1, and the results of co-immunoprecipitation and immunofluorescence show that Neuritin and CB2 interact with each other.
[0106] Example 4
[0107] Verification of the effect of Neuritin active fragment fusion protein and CB2 agonist on macrophages
[0108] After giving 2ug / ml LPS stimulation to macrophages RAW264.7 and adding 5ug / ml Neurtin fusion protein and 10uM CB2 agonist Hu308 for 24 hours, the mRNA levels of MIP2 and IL6 in RAW264.7 were detected by qPCR.
[0109] The results are shown in Figure 2, in LPS-stimulated Raw264.7 cells, Neurtin fusion protein alone can reduce the mRNA levels of MIP2 and IL6, and Neurtin fusion protein and CB2 agonist combination show a stronger trend of inhibiting MIP2 and IL6.
[0110] Example 5
[0111] Establishing a diabetic wound model and verifying protein activity
[0112] (1) Using 6-8 week old C57BL / 6 mice, intraperitoneally injecting STZ (60mg / kg) for five consecutive days, and monitoring the changes of blood pressure and blood glucose of the mice.
[0113] (2) The mice with successful modeling are divided into a PBS group and a hNeuritin-Fc administration group and a hNeuritin-His administration group. After the mice are anesthetized, a circular wound with a diameter of 8 mm is punched on the back of the mice by a puncher, and the full-thickness skin is excised. 100 μg of purified hNeuritin-Fc protein or hNeuritin-His protein is smeared on the wound, and an equal volume of normal saline is smeared on the wound. The wound healing on the back of the mice is observed on the 1st, 7th and 14th day after the operation, so as to evaluate the curative effect of the hNeuritin-Fc protein and the hNeuritin-His.
[0114] As shown in FIG. 3, after the intervention of the hNeuritin-Fc protein and the hNeuritin-His, the cell scratch healing is accelerated, indicating that the Neuritin active fragment fusion protein can promote tissue healing and repair.
[0115] Example 6
[0116] Verification of the activity of the active fragment fusion protein in a psoriasis mouse model
[0117] (1) 6-8-week-old C57BL / 6 mice are used, the back is depilated, and IMQ (62.5 mg per mouse) is smeared on the back for seven consecutive days.
[0118] (2) On the day of modeling, 100 μg of purified hNeuritin-Fc protein or hNeuritin-His protein is injected intraperitoneally, and the administration is performed every other day for 7 days. The psoriasis, erythema and skin thickening of the back of the mice are observed on the 1st, 3rd, 5th and 7th day after modeling, and the pathological score is evaluated, so as to evaluate the curative effect of the hNeuritin active fragment fusion protein.
[0119] As shown in FIGS. 4 and 5, in the mouse psoriasis model, the psoriasis symptoms of the mice are alleviated, and the pathological score is reduced after the treatment with the Neuritin fusion protein.
[0120] Example 7
[0121] Verification of the activity of the protein in a DSS-induced enteritis mouse model
[0122] (1) 6-8-week-old C57BL / 6 mice are used, and 2.5% DSS aqueous solution is given for 7 consecutive days.
[0123] (2) In the D1 abdominal cavity injection of 100 μg / purified hNeuritin-Fc protein or hNeuritin-His protein, injection of administration every other day for 7 days. After modeling each day to record the changes in body weight of mice, in the seventh day after modeling change to normal water for 2 days, the length of the mouse colon tissue collection and pathological section staining to evaluate the efficacy of hNeuritin active fragment fusion protein.
[0124] Results are shown in Figures 6-7, in the DSS-induced intestinal inflammation model, Neuritin transgenic mice weight loss slower, intestinal inflammation is reduced. In the DSS-induced intestinal inflammation model in mice, wild-type mice given Neuritin active fragment fusion protein treatment (WT group, WT+Neuritin) can significantly alleviate the symptoms of intestinal inflammation in mice, performance in the treatment group of mice colon length is longer; and in CB2 knockout mice (CB2 KO group, CB2 KO+Neuritin group), Neuritin fusion protein treatment of intestinal inflammation was significantly weakened, further proving the interaction between Neuritin and CB2.
[0125] The above disclosure is only the preferred embodiments of the present application, of course, can not be limited by the scope of the claims of the present invention, therefore, the equivalent changes made in accordance with the claims of the present invention, still within the scope of the present application.
Claims
1. A fusion protein, characterized in that, The fusion protein is formed by connecting an Fc protein or a His protein to a Neuritin active fragment, wherein the amino acid sequence of the Neuritin active fragment is shown as SEQ ID NO:
1.
2. The fusion protein of claim 1, wherein, The amino acid sequence of the Fc protein is shown as SEQ ID NO: 2, and the amino acid sequence of the His protein is shown as SEQ ID NO:
3.
3. The fusion protein according to claim 1 or 2, characterized in that, The fusion protein is formed by connecting the Neuritin active fragment and the Fc protein fragment through the disulfide bond of the Fc hinge region.
4. The fusion protein of claim 1, wherein, The amino acid sequence of the fusion protein is shown as SEQ ID NO: 4 or SEQ ID NO:
5.
5. A DNA molecule, characterized in that, The DNA molecule encodes the fusion protein of any one of claims 1-4.
6. The DNA molecule of claim 5, wherein The DNA molecule contains a nucleic acid sequence encoding a Neuritin active fragment, wherein the nucleic acid sequence encoding the Neuritin active fragment is shown as SEQ ID NO:
6.
7. The DNA molecule of claim 5 wherein, The nucleic acid sequence of the DNA molecule is shown as SEQ ID NO: 9 or SEQ ID NO:
10.
8. A recombinant vector, characterized in that, The DNA molecule of any one of claims 5-7 and a plasmid vector.
9. A recombinant cell strain, characterized in that, The DNA molecule of any one of claims 5-7 or the recombinant vector of claim 8.
10. A composition characterized in that, The fusion protein of any one of claims 1-4.
11. The composition of claim 10, wherein, The fusion protein is modified by polyethylene glycol and its derivatives.
12. The composition of claim 10, wherein The composition further comprises a CB2 agonist.
13. Use of the fusion protein of any one of claims 1-4 in the preparation of a product for treating an inflammation-related disease.
14. Use according to claim 13, characterized in that, The inflammation-related disease comprises one of an autoimmune disease, a senile degenerative disease, and a diabetic refractory wound.
Citation Information
Patent Citations
Medicament for promoting regeneration and repair after neurologic damage
CN101406690A
Neuritin protein active fragment, expression system thereof and special vector
CN101481413A
Methods and compositions for soluble CPG15
US20040176291A1
CPG15 and CPG15-2 compounds and inhibitors as insulin receptor and insulin-like growth factor receptor agonists and antagonists
US20070299010A1
Manipulation of Regulatory T Cell and Dc Function By Targeting Neuritin Gene Using Antibodies, Agonists and Antagonists
US20100040636A1