Pharmaceutical combination comprising TDG inhibitor and immune checkpoint inhibitor, and use thereof
By designing a combination of small molecule compounds covalently bound to TDG and immune checkpoint inhibitors, the treatment challenge of p53-deficient tumors has been solved, achieving effective inhibition of TDG and tumor growth.
Patent Information
- Application Number
- PCT/CN2025/096900
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-24
- Filing Date
- 2025-05-23
- Publication Date
- 2025-11-27
AI Technical Summary
Current technologies lack safe and effective small molecule inhibitors targeting TDG, making it impossible to effectively treat p53-deficient tumors.
A small molecule compound was designed to covalently bind to the cysteine residue at position 276 of TDG and to be combined with an immune checkpoint inhibitor for the treatment of p53-deficient tumors.
It enhances the anti-tumor immune response, inhibits tumor growth, reduces DHX9 levels, and increases dsRNA accumulation, providing a safe and effective treatment strategy.
Smart Images

Figure PCTCN2025096900-FTAPPB-I100001 
Figure PCTCN2025096900-FTAPPB-I100002 
Figure PCTCN2025096900-FTAPPB-I100003
Abstract
Description
A pharmaceutical combination comprising a TDG inhibitor and an immune checkpoint inhibitor and uses thereof TECHNICAL FIELD
[0001] The present application relates to the field of medicine, in particular to a pharmaceutical combination comprising a TDG inhibitor and an immune checkpoint inhibitor. BACKGROUND
[0002] Human thymine DNA glycosylase (TDG) is a multifunctional protein belonging to the uracil DNA glycosylase (UDG) superfamily, which is involved in DNA mismatch repair, DNA demethylation, and transcriptional regulation, etc. However, the mechanism of TDG in tumor progression is largely unknown, making it still lack effective targeted TDG tumor treatment strategies in clinic.
[0003] Previous studies have found that targeting TDG shows certain potential in various p53-deficient (TP53 gene mutation) tumors due to the important role of TDG in gene transcriptional regulation. Mechanistically, TDG and p53 complement each other to promote the transcription of RNA helicase DHX9, thereby regulating the level of double-stranded RNA (dsRNA) in cells. Specifically, inhibiting TDG in p53-deficient tumor cells will lead to the down-regulation of DHX9, and further trigger the abnormal accumulation of double-stranded RNA (dsRNA) produced by short interspersed nuclear elements (SINEs). This process will trigger an antiviral response through the RIG-I / MDA5-MAVS pathway, thereby inhibiting tumor growth and enhancing anti-tumor immune response. However, there is still a lack of a safe and effective small molecule inhibitor targeting TDG.
[0004] Therefore, there is an urgent need in the art to develop a safe and effective small molecule inhibitor compound targeting TDG to provide a new strategy for the treatment of p53-deficient tumors. SUMMARY
[0005] To solve the above problems, the applicant designed a small molecule compound 1 that can form a covalent bond with the 276th cysteine residue of TDG, providing a new strategy for the treatment of p53-deficient tumors.
[0006] In a first aspect of the present application, a pharmaceutical combination is provided, comprising:
[0007] A. a safe and effective amount of a TDG inhibitor; and
[0008] B. a safe and effective amount of an immune checkpoint inhibitor;
[0009] The immune checkpoint inhibitor is selected from the group consisting of PD-1 inhibitors, PD-L1 inhibitors, CTLA-4 inhibitors, or combinations thereof.
[0010] In another preferred embodiment, the drug combination is a single dosage form; preferably, the single dosage form is an oral dosage form or an injectable dosage form.
[0011] In another preferred embodiment, the oral dosage form is selected from the group consisting of tablets, capsules, granules, and oral liquid preparations.
[0012] In another preferred embodiment, the TDG inhibitor and the immune checkpoint inhibitor in the drug combination are administered via the same route, such as oral or intravenous administration.
[0013] In another preferred embodiment, the drug combination comprises individual dosage forms; preferably, the TDG inhibitor is an oral dosage form and the immune checkpoint inhibitor is an injectable dosage form.
[0014] In another preferred embodiment, in the drug combination, the TDG inhibitor and the immune checkpoint inhibitor are administered via different routes, for example, the TDG inhibitor is administered orally and the immune checkpoint inhibitor is administered intravenously.
[0015] In a preferred embodiment, the TDG inhibitor is a compound represented by Formula I, or a deuterated product, stereoisomer, tautomer thereof, or a pharmaceutically acceptable salt thereof:
[0016] R1 is selected from the following group: OH, H, halogen, cyano, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C2-C6 alkenyl, substituted or unsubstituted C2-C6 alkynyl, substituted or unsubstituted C1-C6 alkoxy, substituted or unsubstituted C6-C 10 Aryl, substituted or unsubstituted 3-12 membered heterocycles, substituted or unsubstituted 5-12 membered heteroaromatic rings, substituted or unsubstituted -O-3-12 membered heterocycles, substituted or unsubstituted -C1-C6 alkyl-phenyl, substituted or unsubstituted -O-phenyl, substituted or unsubstituted C1-C4 alkyl-C(O)-, substituted or unsubstituted C1-C4 alkyl-S(O)2-, substituted or unsubstituted C1-C6 alkyl-NH-, (substituted or unsubstituted C1-C6 alkyl)2-N-, -O(CH2) s R 10 , or -S(CH2) s R 10 ;s is 0, 1, 2, or 3;R 10 Selected from the following group: H, substituted or unsubstituted C 3-8substituted or unsubstituted 3- to 8-membered heterocycloalkyl, substituted or unsubstituted C6-C 10 substituted or unsubstituted 5- to 12-membered heteroaryl; R
[0017] R2is each independently selected from the group consisting of H, halogen, substituted or unsubstituted C1-C6alkyl;
[0018] R3is selected from the group consisting of H, halogen, cyano, substituted or unsubstituted C1-C6alkyl, substituted or unsubstituted C1-C6alkoxy, substituted or unsubstituted C3-C 12 cycloalkyl, or (C1-C6alkyl)C(O)R8, (C1-C6alkyl)C(O)NHR8, (C1-C6alkyl)C(O)N(substituted or unsubstituted C1-C6alkyl)R8, (C1-C6alkyl)C(O)OR8; said R8is selected from the group consisting of H, substituted or unsubstituted C1-C6alkyl, substituted or unsubstituted C6-C 10 substituted or unsubstituted C1-C6alkyl, or substituted or unsubstituted C3-C m substituted or unsubstituted C1-C6alkyl, or substituted or unsubstituted C3-C m NHC(O)(CH2) n R 13 , -(CH2)CHR9NHC(O)(CH2) n R 13 , CHR9(CH2)NHC(O)(CH2) n R 13 ; said R9is selected from the group consisting of H, -COOH, -CONHR 12 , -CONHCH2R 12 , -CONH(CH2CH2O) m (CH2) n COOH, substituted or unsubstituted C1-C6alkoxy, substituted or unsubstituted C6-C 10 substituted or unsubstituted C3-C 10 substituted or unsubstituted 3- to 12-membered heterocycloalkyl, substituted or unsubstituted 5- to 12-membered heteroaryl; R 12 substituted or unsubstituted C1-C6alkyl, substituted or unsubstituted C3-C8cycloalkyl, substituted or unsubstituted C6-C 10 substituted or unsubstituted 5- to 12-membered heteroaryl; said R 13 substituted or unsubstituted C3-C 10 substituted or unsubstituted C6-C
[0019] m and n are each independently 0, 1, 2, or 3;
[0020] R4 is selected from the following group: H, halogen, cyano, substituted or unsubstituted C1-C6 alkoxy, substituted or unsubstituted C1-C6 amino, substituted or unsubstituted C6-C 10 Aryl, substituted or unsubstituted C3-C8 cycloalkyl, substituted or unsubstituted 3-12-membered heterocyclic, substituted or unsubstituted 5-12-membered heteroaromatic ring, substituted or unsubstituted -O-5-12-membered heteroaromatic ring;
[0021] Alternatively, R3 and R4, together with the carbon atom attached to them, form a structure selected from the group consisting of: substituted or unsubstituted C6-C10 aromatic rings, substituted or unsubstituted 5-10 membered aromatic heterocycles, substituted or unsubstituted C3-C8 carbon rings, or substituted or unsubstituted 3-10 membered heterocycles.
[0022] R5 and R6 are each independently selected from the group consisting of: H, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C6-C10 aromatic ring, substituted or unsubstituted 5-10 membered aromatic heterocycle, substituted or unsubstituted C3-C8 carbon ring, or substituted or unsubstituted 3-10 membered heterocycle; or R5 and R6 together with the carbon atom attached thereto form a substituted or unsubstituted 3-12 membered carbon ring.
[0023] R6' is selected from the following group: H, substituted or unsubstituted C1-C6 alkyl; or R6 and R6' together constitute =CH2;
[0024] X is selected from O or S;
[0025] Z is selected from O, S, or NR. 14 Among them, R 14 It is H or C1-C4 alkyl;
[0026] R7 is selected from the following group: H, substituted or unsubstituted C1-C. 12 Alkyl, or C(O)R 11 C(O)OR 11 -CH2OC(O)OR 11 -S(O)2NHR 11 ;
[0027] The R mentioned 11 Selected from the following group: H, substituted or unsubstituted C1-C 16 Alkyl, substituted or unsubstituted C6-C 10 Aryl, -(OCH2CH2) m -Substituted or unsubstituted C1-C6 alkyl groups, substituted or unsubstituted 5-8 membered heterocyclic groups;
[0028] Unless otherwise indicated, in the above formulae, the heteroaromatic ring, heteroaryl group, heterocyclic ring or heterocyclyl group contains 1, 2 or 3 heteroatoms selected from N, S or O; the aromatic ring, aryl group, heteroaromatic ring or heteroaryl group can be monocyclic or fused; the carbocyclic ring, cycloalkyl group, heterocyclic ring or heterocyclyl group can be monocyclic, annelated, bridged or spirocyclic; the carbocyclic ring, heterocyclic ring or heterocyclyl group can be saturated or partially unsaturated but not aromatic.
[0029] The substituents are one or more substituents selected from the group consisting of deuterium, halogen, hydroxy, carboxy, thiol, benzyl, C2-C6alkenyl, C1-C6alkoxy, C3-C6cycloalkyl, C1-C6alkyl-amine, C1-C6alkyl-aminocarbonyl, C1-C6alkylcarbonyl, C1-C6alkoxycarbonyl, C1-C6aldehyde, (C1-C6alkyl)3Si, amino, C1-C6amido, nitro, cyano, unsubstituted or halogenated C1-C6alkyl, C2-C6alkenyl, C1-C6alkoxy, C3-C6cycloalkyl, C1-C6alkyl-amine, C1-C6alkyl-aminocarbonyl, C1-C6alkylcarbonyl, C1-C6alkoxycarbonyl, C1-C6aldehyde, (C1-C6alkyl)3Si, amino, C1-C6amido, nitro, cyano, unsubstituted or halogenated C1-C4alkyl-S(O)2-, unsubstituted or C1-C4alkyl-substituted C1-C4alkyl-OC(O)NH-, unsubstituted or halogenated C1-C4alkyl-SO-, unsubstituted or C1-C4alkyl-substituted 5-7 membered heterocyclic ring, or phenyl (which can have 1-5 substituents selected from halogen, C1-C4alkyl, C1-C4alkoxy). 12 alkyl-S(O)2-, unsubstituted or C1-C4alkyl-substituted C1-C4alkyl-OC(O)NH-, unsubstituted or halogenated C1-C4alkyl-SO-, unsubstituted or C1-C4alkyl-substituted 5-7 membered heterocyclic ring, or phenyl (which can have 1-5 substituents selected from halogen, C1-C4alkyl, C1-C4alkoxy). 10 alkyl-S(O)2-, unsubstituted or C1-C4alkyl-substituted C1-C4alkyl-OC(O)NH-, unsubstituted or halogenated C1-C4alkyl-SO-, unsubstituted or C1-C4alkyl-substituted 5-7 membered heterocyclic ring, or phenyl (which can have 1-5 substituents selected from halogen, C1-C4alkyl, C1-C4alkoxy). 12 alkyl-S(O)2-, unsubstituted or C1-C4alkyl-substituted C1-C4alkyl-OC(O)NH-, unsubstituted or halogenated C1-C4alkyl-SO-, unsubstituted or C1-C4alkyl-substituted 5-7 membered heterocyclic ring, or phenyl (which can have 1-5 substituents selected from halogen, C1-C4alkyl, C1-C4alkoxy). 10 alkyl-S(O)2-, unsubstituted or C1-C4alkyl-substituted C1-C4alkyl-OC(O)NH-, unsubstituted or halogenated C1-C4alkyl-SO-, unsubstituted or C1-C4alkyl-substituted 5-7 membered heterocyclic ring, or phenyl (which can have 1-5 substituents selected from halogen, C1-C4alkyl, C1-C4alkoxy).
[0030] In a preferred embodiment, the compound has the structure shown in formula III:
[0031] wherein R1, R2, R3 and XR7 are as defined in claim 2.
[0032] In a preferred embodiment, R1 is selected from the group consisting of halogen, substituted or unsubstituted C1-C6alkoxy, substituted or unsubstituted C6-C10aryl, substituted or unsubstituted 3-12 membered heterocyclic ring, substituted or unsubstituted 5-12 membered heteroaromatic ring, substituted or unsubstituted -O-3-12 membered heterocyclic ring, substituted or unsubstituted C1-C4alkyl-S(O)2-, substituted or unsubstituted C1-C6alkyl-NH-, (substituted or unsubstituted C1-C6alkyl)2-N-, -O(CH2)1-4- substituted or unsubstituted C1-C6alkyl, substituted or unsubstituted C3-C8cycloalkyl, substituted or unsubstituted phenyl, and -C(O)NR8R9. 10 alkyl-S(O)2-, unsubstituted or C1-C4alkyl-substituted C1-C4alkyl-OC(O)NH-, unsubstituted or halogenated C1-C4alkyl-SO-, unsubstituted or C1-C4alkyl-substituted 5-7 membered heterocyclic ring, or phenyl (which can have 1-5 substituents selected from halogen, C1-C4alkyl, C1-C4alkoxy). s R 10 .
[0033] In a preferred embodiment, R3 is selected from the group consisting of H, halogen, substituted or unsubstituted C1-C6alkyl, substituted or unsubstituted C3-C8cycloalkyl, substituted or unsubstituted phenyl.
[0034] In a preferred embodiment, the PD-1 inhibitor is selected from the group consisting of Retifanlimab (Retifanlimab), Pucotenlimab (Pucotenlimab), Cadonilimab (Cadonilimab), Serplulimab (Serplulimab), Nivolumab / Relatlimab (Nivolumab / Relatlimab), Zimberelimab (Zimberelimab), Penpulimab (Penpulimab), Dostarlimab-gxly (Dostarlimab), Prolgolimab, Tislelizumab (Tislelizumab), Camrelizumab (Camrelizumab), Sintilimab (Sintilimab), Toripalimab (Toripalimab), Cemiplimab-RWLC (Cemiplimab), Pembrolizumab (Pembrolizumab), Nivolumab (Nivolumab), Balstilimab (Balstilimab), Finotonlimab, Iparomlimab (Iparomlimab), Ivonescimab (Ivonescimab), Enlazelimab, or a combination thereof.
[0035] The PD-L1 inhibitor is selected from the group consisting of Benmelstobart (Benmelstobart), Socazolimab (Socazolimab), Adebrelimab (Adebrelimab), Sugemalimab (Sugemalimab), Envafolimab (Envafolimab), Durvalumab (Durvalumab), Avelumab (Avelumab), Atezolizumab (Atezolizumab), Tagitanlimab (Tagitanlimab), or a combination thereof.
[0036] The CTLA-4 inhibitor is selected from the group consisting of Tremelimumab (Tremelimumab), Ipilimumab (Ipilimumab), Cadonilimab (Cadonilimab), Erfonrilimab, Gotistobart, Pembrolizumab / Quavonlimab, Prolgolimab / nurulimab, Quavonlimab, Tuvonralimab / Iparomlimab (Iparomlimab Tuvonralimab), Volrustomig, or a combination thereof.
[0037] In a preferred embodiment, the pharmaceutical combination further comprises a pharmaceutically acceptable carrier.
[0038] In a preferred embodiment, the mass ratio of the TDG inhibitor to the immune checkpoint inhibitor is 1-1000: 1000-1.
[0039] Preferably, the mass ratio of the TDG inhibitor to the immune checkpoint inhibitor is 1-10: 10-1.
[0040] In another preferred embodiment, the mass ratio of the TDG inhibitor to the immune checkpoint inhibitor in the pharmaceutical combination is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 20:1, 30:1, 40:1, 50:1, 60:1, 70:1, 80:1, 90:1, 100:1, 150:1, 200:1, 250:1, 300:1, 350:1, 400:1, 450:1, 500:1, 550:1, 600:1, 650:1, 700:1, 750:1, 800:1, 850:1, 900:1, 950:1, or 1000:1.
[0041] In another preferred embodiment, the mass ratio of the TDG inhibitor to the immune checkpoint inhibitor in the pharmaceutical combination is 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:20, 1:30, 1:40, 1:50, 1:60, 1:70, 1:80, 1:90, 1:100, 1:150, 1:200, 1:250, 1:300, 1:350, 1:400, 1:450, 1:500, 1:550, 1:600, 1:650, 1:700, 1:750, 1:800, 1:850, 1:900, 1:950, or 1:1000.
[0042] In a second aspect of the present application, a kit is provided, the kit comprising:
[0043] (A) a safe and effective amount of a TDG inhibitor;
[0044] (B) a safe and effective amount of an immune checkpoint inhibitor; and
[0045] (C) instructions for use.
[0046] In a third aspect of the present application, use of the pharmaceutical combination according to the first aspect of the present application, or the kit according to the second aspect of the present application, for the manufacture of a medicament for treating a TP53 gene mutation-containing related disease is provided.
[0047] Preferably, the TP53 gene mutation-containing related disease is a TP53 gene mutation-containing tumor.
[0048] More preferably, the TP53 gene mutation-containing tumor is selected from the group consisting of lung cancer, liver cancer, skin cancer, bladder cancer, breast cancer, colon cancer, esophageal cancer, acute myeloid leukemia, or a combination thereof.
[0049] In another preferred embodiment, the TP53 gene mutation is selected from the group consisting of TP53 missense mutation, TP53 gene deletion, TP53 frameshift mutation, TP53 splice site mutation, TP53 truncating mutation, or a combination thereof.
[0050] In another preferred embodiment, the pharmaceutical combination or kit is used for inhibiting the binding of TDG to genomic DNA.
[0051] In a preferred embodiment, the pharmaceutical combination or kit is used for inhibiting the activity of TDG.
[0052] In another preferred embodiment, the pharmaceutical combination or kit is used for inhibiting the binding of TDG to dsDNA
[0053] In another preferred embodiment, the pharmaceutical combination or kit is used for binding to TDG.
[0054] In a preferred embodiment, the pharmaceutical combination or kit is used for reducing the level of DHX9 in p53-mutant tumor cells, or the pharmaceutical combination or kit is used for increasing the level of dsRNA in p53-mutant tumor cells.
[0055] In another preferred embodiment, the pharmaceutical composition is used for inhibiting the growth of p53-mutant tumor cells.
[0056] In a fourth aspect of the present application, there is provided a use of a TDG inhibitor for the manufacture of:
[0057] (a) a covalent ligand that selectively binds to the cysteine residue at position 276 (Cys276) in the target protein; and / or
[0058] (b) a pharmaceutical composition for preventing, alleviating and / or treating a TP53 gene mutation-containing related disease.
[0059] In another preferred embodiment, the TDG inhibitor is used for inhibiting the binding of TDG to genomic DNA.
[0060] In another preferred embodiment, the TDG inhibitor is used for inhibiting the activity of TDG.
[0061] In another preferred embodiment, the TDG inhibitor is used for inhibiting the binding of TDG to dsDNA.
[0062] In another preferred embodiment, the TDG inhibitor is used for increasing the thermal stability of TDG protein.
[0063] In another preferred embodiment, the TDG inhibitor is used to bind to TDG.
[0064] In another preferred embodiment, the TDG inhibitor is used to inhibit the expression of DHX9 protein in KP cells.
[0065] In another preferred embodiment, the TDG inhibitor is used to promote the accumulation of dsRNA in cytoplasm.
[0066] In another preferred embodiment, the TDG inhibitor is used to reduce the level of DHX9 in TP53 mutant tumor cells, or the TDG inhibitor is used to increase the level of dsRNA in TP53 mutant tumor cells.
[0067] In another preferred embodiment, the TDG inhibitor is a compound of Formula I.
[0068] In a fifth aspect of the present application, a method for designing a TDG inhibitor is provided, comprising the steps of:
[0069] (a) providing a candidate molecule, which is capable of binding to Cys276 in TDG protein;
[0070] (b) determining the TDG binding ability of the candidate molecule.
[0071] It should be understood that, within the scope of the present application, each of the technical features described above and each of the technical features described in detail below (e.g., in the Examples) can be combined with each other to form new or preferred technical solutions. Due to the limited space, they will not be listed one by one here. BRIEF DESCRIPTION OF DRAWINGS
[0072] Figure 1 shows the inhibition curve of compound 1 on TDG activity.
[0073] Figure 2 shows the inhibition curve of compound 1 on the binding of TDG to double-stranded DNA.
[0074] Figure 3 shows the binding constant Kd of compound 1 binding to TDG.
[0075] Figure 4 shows the binding constant Kd of compound 1 binding to three other glycosylases in the same family.
[0076] Figure 5 shows the inhibitory effect of compound 1 on the activity of 23 epigenetic target enzymes.
[0077] Figure 6 shows that compound 1 is covalently bound to TDG.
[0078] Figure 7 shows the co-crystal of compound 1 and TDG.
[0079] Figure 8 shows the effect of compound 1 on the thermal stability of TDG protein at the protein and cellular levels.
[0080] Figure 9 shows the effect of compound 1 on TDG binding to genomic DNA.
[0081] Figure 10 shows the effect of compound 1 on DHX9 protein expression in KP cells (Trp53 knockout mouse lung cancer cells).
[0082] Figure 11 shows the effect of compound 1 on dsRNA levels in KP cells (Trp53 knockout mouse lung cancer cells).
[0083] Figure 12 shows the effect of compound 1 on dsRNA levels in p53 mutant and wild type tumor cells.
[0084] Figure 13 shows the IC of inhibition of compound 1 on the proliferation of p53 mutant and wild type tumor cell lines in vitro. 50 .
[0085] Figure 14 shows the inhibition experiment of compound 1 on p53 mutant and wild type tumor cell lines.
[0086] Figure 15 shows the inhibition experiment of compound 1 on p53 mutant and wild type tumor cell lines in immunodeficient mice subcutaneously loaded with tumors.
[0087] Figure 16 shows the experiment of compound 1 combined with anti-CTLA-4 antibody on p53-deficient homologous mouse models KP, 4T1, MC38.
[0088] Figure 17 shows the mechanism of action of compound 1 on p53 mutant tumors. DETAILED DESCRIPTION
[0089] After long-term and in-depth research, through a large number of screening, the applicant first developed a small molecule inhibitor that inhibits the function of TDG by covalently modifying the 276th cysteine residue of TDG, and further explored the effect of the above inhibitor on tumors related to TP53 gene mutations. Based on this, the applicant completed the present application.
[0090] TERMS
[0091] In the present application, the halogen is F, Cl, Br or I.
[0092] In the present application, the terms used have the general meaning known to those skilled in the art, unless otherwise specified. In the present application, all chemical formulas are intended to encompass any possible optical or geometric isomers (e.g. R form, S form or racemate, or cis-trans isomers of olefins, etc.) if not specifically indicated.
[0093] In the present application, the term "C1-C6alkyl" refers to straight or branched chain alkyl groups having from 1 to 6 carbon atoms, including without limitation methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, t-butyl, pentyl, and hexyl groups, and the like; preferably ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, and t-butyl groups.
[0094] In the present application, the term "C1-C6alkoxy" refers to straight or branched chain alkoxy groups having from 1 to 6 carbon atoms, including without limitation methoxy, ethoxy, propoxy, isopropoxy, and butoxy groups, and the like.
[0095] In the present application, the term C1-C6amine refers to "C1-C6alkyl-NH-" and "(C1-C6alkyl)2N-", or the like.
[0096] In the present application, the term "C2-C6alkenyl" refers to straight or branched chain alkenyl groups having from 2 to 6 carbon atoms containing one double bond, including without limitation ethenyl, propenyl, butenyl, isobutenyl, pentenyl, and hexenyl groups, and the like.
[0097] In the present application, the term "C2-C6alkynyl" refers to straight or branched chain alkynyl groups having from 2 to 6 carbon atoms containing one triple bond, including without limitation ethynyl, propynyl, butynyl, isobutynyl, pentynyl, and hexynyl groups, and the like.
[0098] In the present application, the term "C3-C 10 In the present application, the term "C3-C8cycloalkyl" refers to cyclic alkyl groups having from 3 to 10 carbon atoms in the ring, including without limitation cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, and cyclodecyl groups, and the like. The terms "C3-C8cycloalkyl", "C3-C7cycloalkyl", and "C3-C6cycloalkyl" have similar meanings.
[0099] In the present application, the term "C1-C 12 In the present application, the term "C1-C12alkoxycarbonyl" refers to alkoxycarbonyl groups having from 1 to 12 carbon atoms in the alkyl chain, including without limitation methoxycarbonyl, ethoxycarbonyl, propoxycarbonyl, isopropoxycarbonyl, t-butoxycarbonyl, benzyloxycarbonyl, and the like.
[0100] In the present application, the term "C1-C 12 In the present application, the term "C1-C12alkylaminocarbonyl" refers to alkylaminocarbonyl groups having from 1 to 12 carbon atoms in the alkyl chain, including without limitation methylaminocarbonyl, ethylaminocarbonyl, propylaminocarbonyl, isopropylaminocarbonyl, t-butylaminocarbonyl, benzylaminocarbonyl, dimethylaminocarbonyl, and the like.
[0101] In the present application, the terms "aromatic ring" or "aryl" have the same meaning, and preferably "aryl" is "C6-C10aryl" or "C6-C10aryl". 12 In the present application, the terms "aromatic ring" or "aryl" have the same meaning, and preferably "aryl" is "C6-C10aryl" or "C6-C10aryl". 10"aryl." The term "C6-C12 aryl" means an aromatic ring radical having from 6 to 12 carbon atoms, such as phenyl, naphthyl, and the like. The term "C6-C10 aryl" has a similar meaning. 12 "aryl." The term "C6-C12 aryl" means an aromatic ring radical having from 6 to 12 carbon atoms, such as phenyl, naphthyl, and the like. The term "C6-C10 aryl" has a similar meaning. 10 "aryl." The term "C6-C12 aryl" means an aromatic ring radical having from 6 to 12 carbon atoms, such as phenyl, naphthyl, and the like. The term "C6-C10 aryl" has a similar meaning.
[0102] In the present application, the terms "aromatic heterocycle," "heteroaromatic ring," or "heteroaryl" have the same meaning and refer to a heteroaromatic radical containing one to several heteroatoms. The heteroatoms referred to herein include oxygen, sulfur, and nitrogen. Examples include furyl, thienyl, pyridyl, pyrazolyl, pyrrolyl, N-alkylpyrrolyl, pyrimidinyl, pyrazinyl, imidazolyl, tetrazolyl, and the like. The heteroaryl ring can be fused to an aryl, heterocyclyl, or cycloalkyl ring, wherein the ring that is attached to the parent structure is the heteroaryl ring. The heteroaryl group can be optionally substituted or unsubstituted.
[0103] In the present application, the term "3- to 12-membered heterocyclyl" means a saturated or unsaturated 3- to 12-membered ring radical containing one to three heteroatoms selected from oxygen, sulfur, and nitrogen in the ring, such as dioxolanyl, and the like. The term "3- to 7-membered heterocyclyl" has a similar meaning.
[0104] In the present application, the term "substituted" means that one or more hydrogen atoms on a particular group are replaced with a particular substituent. The particular substituent is a substituent described in the foregoing or a substituent appearing in the various embodiments. Unless otherwise specified, a substituted group can have one substituent selected from a particular group at any available substitutable position on the group, and the substituents can be the same or different at each position. A cyclic substituent, such as a heterocycloalkyl group, can be attached to another ring, such as a cycloalkyl group, to form a spiro bicyclic ring system, for example, two rings having a common carbon atom. Those skilled in the art will appreciate that combinations of substituents contemplated by the present application are those combinations that result in stable or chemically feasible compounds. The substituents include, but are not limited to, the following: C 1-8 alkyl, C 2-8 alkenyl, C 2-8 alkynyl, C 3-8 cycloalkyl, 3- to 12-membered heterocyclyl, aryl, heteroaryl, halogen, hydroxy, carboxyl (-COOH), C 1-8 aldehyde, C 2-10 acyl, C 2-10 ester, C1-C 12 alkoxycarbonyl, amino, alkoxy, C 1-10 sulfonyl, and the like.
[0105] As used herein, a "pharmaceutical combination" can be a combination of two or more active ingredients; it can also be a combination of pharmaceutical compositions, each of which contains a separate active ingredient, e.g. a combination of a tablet and an injection, a combination of a capsule and an injection, a combination of tablets and tablets, a combination of tablets and capsules; it can also be a single pharmaceutical composition in which the active ingredients are combined.
[0106] The term "active ingredient" or "active drug" of the pharmaceutical combination according to the present application means a TDG inhibitor and / or an immune checkpoint inhibitor according to the present application.
[0107] "Pharmaceutical combination", "combination therapy", "combined treatment", "co- medication" or "co-treatment" means the use of two or more active ingredients together or in sequence, by combination or association, in which the combined effect of the active ingredients is greater than the effect of the single active ingredients. For example, the combination of a TDG inhibitor and an immune checkpoint inhibitor as used herein, and their respective symptoms and manifestations are a combination therapy. "Combined administration" means administration of two agents, e.g. a TDG inhibitor and an immune checkpoint inhibitor as used herein, in which the pharmacological effects of the two agents are manifested simultaneously in the patient. Thus, combined administration does not require that the single pharmaceutical compositions, the same dosage form or even the same route of administration be used in the administration of the two agents or that the two agents be administered at exactly the same time. The two agents can be administered simultaneously or sequentially or in an alternating manner. The two agents can also be formulated into a single pharmaceutically acceptable composition. Non-limiting examples of such single compositions are oral compositions or oral dosage forms.
[0108] "Pharmaceutically acceptable" means safe and non-toxic, preferably for in vivo administration, more preferably for administration to humans.
[0109] Active ingredient - TDG inhibitor
[0110] As used herein, "TDG inhibitor" refers to the compound of formula (I) and also includes its stereoisomers, its optical isomers, its pharmaceutically acceptable salts, its crystalline forms, its isotopic derivatives, its prodrugs, its metabolites, its solvates or its hydrates.
[0111] Unless specifically indicated, the structural formulae described in the present application are intended to include all stereoisomers (such as syn and anti isomers, enantiomeric, diastereomeric and conformational isomers) in all possible configurations: R, S configurations for asymmetric centers, (Z), (E) isomers for double bonds, syn and anti isomers for cycloalkanes, etc. Thus, individual stereochemical isomers of the compounds of the present application or mixtures thereof, including racemates, are within the scope of the present application.
[0112] The compounds of the present application can contain geometric isomers, one or more chiral carbon atoms, and therefore can exist in stereoisomeric forms. Geometric isomers refer to the non-enantiomeric isomers of a compound that differ only in the arrangement of atoms in space. This restriction is usually due to the presence of a functional group in the organic compound structure that cannot rotate freely, such as C=C double bond, C=N double bond, C=S double bond, N=N double bond, heterocycle or cycloalkane, etc. Organic molecules containing such isomers, such as alkenes, azo compounds, cycloalkanes, etc. are considered geometric isomers, with cis referring to the same ligand being in adjacent positions, usually denoted by "cis" or "cis-"; trans referring to the same ligand being in opposite positions, usually denoted by "trans" or "trans-". Each chiral carbon atom can be defined as (R)- or (S)- based on stereochemistry. The present application is intended to include all possible isomers, as well as their racemates and optically pure forms. The preparation of the compounds of the present application can select racemates, geometric isomers, chiral isomers, diastereomers or enantiomers as starting materials or intermediates. Optically active isomers can be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques, such as crystallization and chiral chromatography, etc.
[0113] Conventional techniques for preparing / isolating individual optical isomers (i.e., geometric isomers and chiral isomers) include chiral synthesis from appropriate geometric precursors or optically pure precursors, or resolution of racemates (or racemates of salts or derivatives) using, for example, chiral high performance liquid chromatography.
[0114] If a synthesis of a specific stereoisomer of a compound of the present application is desired, it can be prepared by asymmetric synthesis, or derivatized with a chiral auxiliary, separating the resulting stereomixture, and removing the chiral auxiliary to obtain the pure geometric monomer, chiral monomer or mixed stereomonomer. If the molecule contains a geometric isomerism center, it can be purified by column chromatography (normal phase silica gel column or reverse phase high performance liquid preparation) to obtain pure cis product or trans product; in addition, if the molecule contains a basic functional group, such as an amino acid, or an acidic functional group, such as a carboxyl group, it can be separated by forming a diastereomeric salt with an appropriate optically active acid or base, and then separated by conventional means such as crystallization or chromatography, etc. to obtain pure enantiomers.
[0115] The present application also includes isotopically-labeled compounds (i.e., isotopic derivatives), the disclosure of which are equivalent to the originally disclosed compounds. However, actual isotopic substitutions often occur in one or more atoms of a molecule. Examples of isotopes that are within the present application include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorous, sulphur, fluorine, and chlorine, such as 2 H、 3 H、13 C 11 C 14 C 15 N、 18 O、 17 O、 31 P, 32 P, 35 S, 18 F and 36 Cl. Isotope derivatives of the compounds of this invention are all within the scope of protection of this invention. In this document, 3 H-labeled compounds and 14 C-labeled compounds are useful in tissue distribution experiments of drugs and substrates. Tritium (i.e., 3 H) and carbon-14 (i.e. 14 C) Labeled compounds are relatively easy to prepare and detect, making them the preferred choice among isotopes. Furthermore, heavier isotope substitutions, such as deuterium, are also possible. 2 H, due to its excellent metabolic stability, offers advantages in certain therapies, such as increasing half-life or reducing dosage in vivo, and therefore may be preferred in some cases. Isotopically labeled compounds can be prepared using general methods, by replacing the non-isotopic reagent with an readily available isotopically labeled reagent, according to the scheme disclosed in the examples.
[0116] As used herein, the term "pharmaceutically acceptable salt" includes pharmaceutically acceptable acid addition salts and pharmaceutically acceptable base addition salts.
[0117] "Pharmaceutically acceptable acid addition salts" refer to salts formed with inorganic or organic acids that retain the bioavailability of the free base without other side effects. Inorganic acid salts include, but are not limited to, hydrochlorides, hydrobroms, sulfates, nitrates, and phosphates; organic acid salts include, but are not limited to, formates, acetates, 2,2-dichloroacetate, trifluoroacetate, propionates, hexanoates, octanoates, decanoates, undecenoates, glycolates, gluconates, lactates, sebates, adipates, glutarate, malonates, oxalates, maleates, succinates, fumarates, tartrates, citrates, palmitates, stearates, oleates, cinnamates, laurates, malates, glutamates, pyroglutamates, aspartate, benzoates, methanesulfonates, benzenesulfonates, p-toluenesulfonates, alginates, ascorbic acid salts, salicylates, 4-aminosalicylic acid salts, and naphthalene disulfonates. These salts can be prepared using methods known in this field.
[0118] "Pharmaceutically acceptable base addition salt" refers to salts of the free acids that retain the biological effectiveness and non-toxicity of the free acids and that are formed with inorganic or organic bases. Salts derived from inorganic bases include, but are not limited to, sodium salts, potassium salts, lithium salts, ammonium salts, calcium salts, magnesium salts, iron salts, zinc salts, copper salts, manganese salts, aluminum salts, and the like. Preferred inorganic salts are ammonium, sodium, potassium, calcium, and magnesium salts. Salts derived from organic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, substituted amines, including naturally occurring substituted amines, cyclic amines, and basic ion exchange resins, such as ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, diethanolamine, triethanolamine, dimethyl ethanolamine, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, choline, betaine, ethylenediamine, glucosamine, methylglucosamine, theobromine, purines, piperazine, piperidine, N-ethylpiperidine, polyamine resins, and the like. Preferred organic bases include isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline, and caffeine. These salts can be prepared by methods known in the art.
[0119] Metabolites of the compounds of Formula (I), and pharmaceutically acceptable salts thereof, as well as all prodrugs of the compounds of Formula (I), and pharmaceutically acceptable salts thereof, are also within the scope of the application. Prodrugs are any covalently bonded compounds, which release the parent drug in vivo upon metabolism or hydrolysis. Typically, the release occurs through a simple chemical or enzymatic reaction, but a prodrug can also be a bioprecursor, which provides the drug moiety in vivo upon some biochemical reaction. Prodrugs are often active drugs in their own right, and can be designed to improve the delivery, distribution, absorption, metabolism, and / or excretion of the parent drug. A thorough discussion is provided in the literature: e.g., H. Bundgaard, Design of Prodrugs (Elsevier, 1985); idem, Advanced Drug Delivery Reviews 8: 1-38 (1992); idem, Chemical Approaches to the Delivery of Drugs (Plenum, 1987); and idem, Trends in Synthetic Medicinal Chemistry 2: 335-343 (1988); all of which are incorporated herein by reference.
[0120] As used herein, the term "solvate" means a complex of a compound of Formula (I) with solvent molecules in specific ratios.
[0121] As used herein, the term "hydrate" means a complex of a compound of Formula (I) with water molecules in specific ratios.
[0122] As described herein, the compounds of the application can be substituted with any number of substituents or functional groups to expand the scope of the application. Generally, the term "substituted" means substituted with the indicated substituent group in place of a hydrogen radical. When a particular structure is substituted with multiple instances of a particular substituent, each occurrence of the substituent group can be the same or different. As used herein, the term "substituted" includes all permissible substituents. In a broad aspect, the permissible substituents include acyclic and cyclic, branched and unbranched, carbocyclic and heterocyclic, aromatic and nonaromatic organic radicals. As used herein, heteroatoms such as nitrogen can have hydrogen substituents and / or any permissible substituents of the
[0123] Active ingredient - immune checkpoint inhibitor
[0124] Immune checkpoint inhibitors refer to a class of anti-tumor drugs that work by inhibiting immune system immune checkpoints, allowing immune cells to be reactivated and kill tumor cells by blocking the function of immune checkpoints. The immune checkpoint inhibitors described herein include, but are not limited to, PD-1 inhibitors, PD-L1 inhibitors, CTLA-4 inhibitors, or combinations thereof.
[0125] In a preferred embodiment, the PD-1 inhibitor includes, but is not limited to, Retifanlimab (Retifanlimab), Pucotenlimab (Pucotenlimab), Cadonilimab (Cadonilimab), Serplulimab (Serplulimab), Nivolumab / Relatlimab (Nivolumab / Relatlimab), Zimberelimab (Zimberelimab), Penpulimab (Penpulimab), Dostarlimab-gxly (Dostarlimab), Prolgolimab, Tislelizumab (Tislelizumab), Camrelizumab (Camrelizumab), Sintilimab (Sintilimab), Toripalimab (Toripalimab), Cemiplimab-RWLC (Cemiplimab), Pembrolizumab (Pembrolizumab), Nivolumab (Nivolumab), Balstilimab (Balstilimab), Finotonlimab, Iparomlimab (Iparomlimab), Ivonescimab (Ivonescimab), Enlonsurabimab, or combinations thereof;
[0126] In a preferred embodiment, the PD-L1 inhibitor includes, but is not limited to, Benmelstobart (Benmelstobart), Socazolimab (Socazolimab), Adebrelimab (Adebrelimab), Sugemalimab (Sugemalimab), Envafolimab (Envafolimab), Durvalumab (Durvalumab), Avelumab (Avelumab), Atezolizumab (Atezolizumab), Tagitanlimab (Tagitanlimab), or combinations thereof;
[0127] In a preferred embodiment, the CTLA-4 inhibitor includes, but is not limited to, Tremelimumab, Ipilimumab, Cadonilimab, Erfonrilimab, Gotistobart, Pembrolizumab / Quavonlimab, Prolgolimab / nurulimab, Quavonlimab, Tuvonralimab / Iparomlimab, Volrustomig, or a combination thereof.
[0128] Applications
[0129] Since the TDG inhibitor of the present application can selectively bind to the cysteine residue at position 276 (Cys276) in the target protein, the pharmaceutical combination of the TDG inhibitor and the immune checkpoint inhibitor of the present application can be used for preventing and / or treating (stabilizing, alleviating or curing) diseases containing TP53 gene mutations.
[0130] In the present application, the term "pharmaceutical composition" refers to a preparation including the pharmaceutical combination of the present application (i.e., the pharmaceutical combination including the TDG inhibitor and the immune checkpoint inhibitor) and a medium generally accepted in the art for the delivery of biological active compounds to mammals (e.g., humans). The medium includes a pharmaceutically acceptable carrier. The objective of the pharmaceutical composition is to facilitate administration of the biological agent and to facilitate absorption of the active ingredient to thereby exert a biological activity.
[0131] The pharmaceutical composition of the present application includes the TDG inhibitor and the immune checkpoint inhibitor in a safe and effective amount range, and a pharmaceutically acceptable excipient or carrier. Among them, the "safe and effective amount" refers to the amount of the compound sufficient to significantly improve the condition without causing serious side effects.
[0132] The "pharmaceutically acceptable carrier" refers to one or more compatible solid or liquid filler or gel materials that are suitable for human use and must have sufficient purity and sufficiently low toxicity. "Compatibility" here refers to the fact that the components in the composition can be mixed with the TDG inhibitor and the immune checkpoint inhibitor of the present application and between them without significantly reducing the efficacy of the compounds. Examples of the pharmaceutically acceptable carrier include cellulose and its derivatives (such as sodium carboxymethyl cellulose, sodium ethyl cellulose, cellulose acetate, etc.), gelatin, talc, solid lubricants (such as stearic acid, magnesium stearate), calcium sulfate, vegetable oils (such as soybean oil, sesame oil, peanut oil, olive oil, etc.), polyhydric alcohols (such as propylene glycol, glycerol, mannitol, sorbitol, etc.), emulsifiers (such as lecithin, acetylated lanolin, etc.), isotonizing agents (such as sodium chloride, etc.), buffers (such as citrate, phosphate, etc.), preservatives (such as methyl paraben, propyl paraben, chlorobutanol, benzalkonium chloride, etc.), flavoring agents (such as peppermint, methyl salicylate, etc.), coloring agents (such as FD&C red No. 3, FD&C yellow No. 5, etc.), and the like. ) wetting agents (such as, for example, sodium lauryl sulfate), coloring agents, flavoring agents, stabilizers, antioxidants, preservatives, pyrogen-free water, and the like.
[0133] The mode of administration of the TDG inhibitor, immune checkpoint inhibitor or pharmaceutical composition of the present application is not particularly limited, and representative modes of administration include, but are not limited to, oral, parenteral (intravenous, intramuscular or subcutaneous).
[0134] Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In these solid dosage forms, the active compound is mixed with at least one conventional inert excipient (or carrier) such as sodium citrate or dicalcium phosphate, or with such ingredients as (a) fillers or extenders, such as starches, lactose, sucrose, glucose, mannitol, and silicic acid; (b) binders, such as hydroxymethylcellulose, alginic acid, gelatin, polyvinylpyrrolidone, sucrose, and acacia; (c) humectants, such as glycerol; (d) disintegrating agents, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain complex silicates, and sodium carbonate; (e) solution retarders, such as paraffin; (f) absorption accelerators, such as quaternary ammonium compounds; (g) wetting agents, such as cetyl alcohol and glycerol monostearate; (h) absorbents, such as kaolin and bentonite clay; and (i) lubricants, such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, or mixtures thereof. In the case of capsules, tablets, and pills, the dosage forms can also comprise buffering agents.
[0135] Solid dosage forms, such as tablets, dragees, capsules, pills, and granules, can be prepared with coatings and shells, such as enteric coatings and other coatings and shells well known in the art. They can contain opacifying agents, and can also be of such composition that they release the active compound or compounds in a certain part of the intestinal tract in a delayed manner. Examples of embedding compositions that can be used are polymeric substances and waxes. The active compounds can also be in micro-encapsulated form, if desired, with one or more of the above-described excipients.
[0136] Liquid dosage forms for oral administration include pharmaceutically-acceptable emulsions, solutions, suspensions, syrups, and elixirs. In addition to the active compounds, the liquid dosage forms can include inert diluents commonly used in the art, such as water or other solvents, solubilizing agents and emulsifiers, as, for example, ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3- butylene glycol, dimethylformamide, and the like, as well as mixtures thereof.
[0137] Besides such inert diluents, the composition can also include adjuvants, such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents.
[0138] In addition to the active ingredients, the suspension can contain suspending agents such as ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide gel, and agar-agar, or mixtures of these substances, and the like.
[0139] Compositions for parenteral injection can contain physiologically acceptable sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Suitable aqueous and nonaqueous carriers, diluents, solvents or excipients include water, ethanol, polyols and suitable mixtures thereof.
[0140] Dosage forms for topical administration of a compound of this application include ointments, powders, sprays, and inhalers. The active component is admixed with a carrier, which can be a sterile powder, a sterile non-fluid ointment, or a sterile non-fluid spray. Carriers, if desired, can include a solvent, a diluent, an excipient, or a combination thereof.
[0141] The pharmaceutical combination of the present application can also be administered in combination with other pharmaceutically acceptable compounds.
[0142] When administered in combination, the pharmaceutical composition further comprises one or more (2, 3, 4, or more) other pharmaceutically acceptable compounds. One or more (2, 3, 4, or more) of the other pharmaceutically acceptable compounds can be used simultaneously, separately, or sequentially with the pharmaceutical combination of the present application for preventing and / or treating diseases containing TP53 gene mutations.
[0143] The pharmaceutical combination of the present application is administered to a mammal (e.g., a human) in need of treatment in a safe and effective amount. The dose administered, when used in the pharmaceutical combination of the present application, is generally in the range of 1-2000 mg, preferably 20-500 mg, per day for a 60 kg body weight adult, in a single or divided doses. The specific dose level and frequency of dosage will vary depending on the nature of the disease, the age, body weight, sex and medical history of the patient, and the route of administration. Such determinations are well within the level of skill in the art.
[0144] The main advantages of the present application are:
[0145] 1. Compound 1 of the present application exhibits a strong therapeutic effect in p53-deficient tumors, especially showing excellent synergistic effects when used in combination with immune checkpoint inhibitors.
[0146] 2. Compound 1 of the present application can specifically modify the cysteine residue at position 276 of TDG.
[0147] 3. Compound 1 of the present application can effectively inhibit the DNA binding ability of TDG.
[0148] The application will be further described in conjunction with specific examples. It should be understood that these examples are only used to illustrate the application and not intended to limit the scope of the application. The experimental methods in the following examples, if not otherwise specified, are usually carried out according to the conventional conditions or according to the conditions suggested by the manufacturers. Unless otherwise specified, the percentages and parts are weight percentages and weight parts.
[0149] As used herein, the terms "p53-deficient", "p53-mutant", "TP53 gene mutation", and "Trp53 knockout" are synonymous.
[0150] Example 1 Preparation of compound 1
[0151] First step: synthesis of 4-hydroxy-2-methoxy-5-methylbenzaldehyde (b)
[0152] Synthesis of 4-hydroxy-2-methoxy-5-methylbenzaldehyde (b)
[0153] Nuclear magnetic resonance hydrogen spectrum (400 MHz, deuterium DMSO) δ: 10.64 (broad single peak, 1H), 10.11 (single peak, 1H), 7.44 (single peak, 1H), 6.53 (single peak, 1H), 3.82 (single peak, 3H), 2.07 (single peak, 3H).
[0154] Second step: synthesis of 4-(allyloxy)-2-methoxy-5-methylbenzaldehyde (c)
[0155] Compound b (5.0 g, 30.09 mmol, 1 eq) was dissolved in dimethylformamide (75 mL), potassium carbonate (12.5 g, 90.27 mmol, 3 eq) and 3-bromopropene (4.73 g, 39.12 mmol, 1.3 eq) were added and stirred at 25 °C for 3 h. Thin layer chromatography (petroleum ether: ethyl acetate = 4:1) showed that the reaction was completed. The reaction solution was filtered through celite, and the filtrate was concentrated to give a residue. The residue was purified by silica gel flash chromatography (eluent: 0-10% ethyl acetate / petroleum ether gradient, flow rate 65 mL / min, petroleum ether: ethyl acetate = 3:1, Rf= 0.4, product). Compound c (5.3 g, 25.70 mmol, yield 85.41%) was obtained as a white solid. 80g Silica gel flash chromatography column, eluent: 0-10% ethyl acetate / petroleum ether gradient, flow rate 65 mL / min, petroleum ether: ethyl acetate = 3:1, Rf= 0.4, product). Compound c (5.3 g, 25.70 mmol, yield 85.41%) was obtained as a white solid.
[0156] Nuclear magnetic resonance hydrogen spectrum (400 MHz, deuterated chloroform) δ: 10.30 (singlet, 1H), 7.64 (doublet, J = 0.61 Hz, 1H), 6.40 (singlet, 1H), 6.09 (multiplet, 1H), 5.48 (multiplet, 1H), 5.36 (multiplet, 1H), 4.65 (triplet of doublets, J = 1.53, 5.01 Hz, 2H), 3.91 (singlet, 3H), 2.19 (singlet, 3H).
[0157] Third step: synthesis of 4-(4-(allyloxy)-2-methoxy-5-methylphenyl)-3- oxabicyclo[3.1.0]hexan-2-one (d)
[0158] First, (Z)-ethyl 2-(phenylsulfinyl)cyclopropane-1-carboxylate (c-1) was prepared according to a reported method (Chawner, S. J., et al. Divergent Synthesis of Cyclopropane-Containing Lead-Like Compounds, Fragments and Building Blocks through a Cobalt Catalyzed Cyclopropanation of Phenyl Vinyl Sulfide. European J Org Chem 2017, 5015-5024).
[0159] Compound c-1 (8.09 g, 33.94 mmol, 1 eq) was dissolved in tetrahydrofuran (210 mL) and isopropyl magnesium chloride (2 M, 25.46 mL, 1.5 eq) was added at -78 °C, then stirred at -78 °C for 1 h. Compound c (7.0 g, 33.94 mmol, 1.0 eq) was dissolved in a mixture of toluene (20 mL) and tetrahydrofuran (10 mL), added to the reaction system, and stirred at 0 °C for 3 h. Thin layer chromatography analysis (petroleum ether: ethyl acetate = 3:1) showed that the reaction was completed. The reaction was quenched with 200 mL of water and aqueous ammonium chloride solution, and extracted with ethyl acetate (200 mL*3). The organic layers were combined, dried over sodium sulfate, filtered and concentrated to give a residue. The residue was purified by silica gel flash chromatography (eluent: 0-10, 15% ethyl acetate / petroleum ether gradient, flow rate 30 mL / min, petroleum ether: ethyl acetate = 3:1, Rf = 0.55, product, PMA). Compound d (4.8 g, 16.80 mmol, yield 49.49%) was obtained as a colorless oil. 220 g Silica gel flash chromatography column, eluent: 0-10, 15% ethyl acetate / petroleum ether gradient, flow rate 30 mL / min, petroleum ether: ethyl acetate = 3:1, Rf = 0.55, product, PMA). Compound d (4.8 g, 16.80 mmol, yield 49.49%) was obtained as a colorless oil.
[0160] Nuclear magnetic resonance hydrogen spectrum (400 MHz, deuterated chloroform) δ: 6.96-7.08 (multiplet, 1H), 6.47 (singlet, 1H), 6.00-6.18 (multiplet, 1H), 5.84 (doublet, J = 4.62 Hz, 0.24H), 5.51 (singlet, 0.7H), 5.46 (quartet, J = 1.65, 17.28 Hz, 1H), 5.27-5.36 (multiplet, 1H), 4.59 (triplet of doublets, J = 1.68, 5.01 Hz, 2H), 3.82-3.90 (multiplet, 3H), 2.61-2.72 (multiplet, 0.2H), 2.12-2.30 (multiplet, 4.8H), 1.20-1.40 (multiplet, 1H), 0.96-1.10 (multiplet, 1H), 0.80-0.90 (multiplet, 0.28H). Liquid chromatography-mass spectrometry: (ESI) m / z = 275.2 (M+1) + , retention time = 0.87 min.
[0161] Fourth step: synthesis of 4-(4-hydroxy-2-methoxy-5-methylphenyl)-3-oxabicyclo[3.1.0]hexan-2-one (compound 1)
[0162] Compound d (3.8 g, 13.85 mmol, 1 eq) was dissolved in tetrahydrofuran (100 mL), palladium acetate (933 mg, 4.16 mmol, 0.3 eq) and triphenylphosphine (4.36 g, 16.62 mmol, 1.2 eq) were added and stirred at 25 °C for 20 h. Thin layer chromatography (petroleum ether: ethyl acetate = 1 : 1) showed that the reaction was completed. The mixture was combined with two other batches (230 mg and 500 mg scale respectively) and worked up. The solvent was removed to give a residue. The residue was purified by flash chromatography on silica gel (eluent: 0-30% ethyl acetate / petroleum ether gradient, flow rate 60 mL / min, petroleum ether: ethyl acetate = 1 : 1, Rf= 0.45, product, PMA). Fractions of the desired product were combined and concentrated. The residue was triturated with methyl tert-butyl ether: petroleum ether (1 : 1, 10 mL) to give compound 1 (990 mg, 4.23 mmol, 25.64% yield) as an off-white solid. 80+40g Flash chromatography on silica gel, eluent: 0-30% ethyl acetate / petroleum ether gradient, flow rate 60 mL / min, petroleum ether: ethyl acetate = 1 : 1, Rf= 0.45, product, PMA). Fractions of the desired product were combined and concentrated. The residue was triturated with methyl tert-butyl ether: petroleum ether (1 : 1, 10 mL) to give compound 1 (990 mg, 4.23 mmol, 25.64% yield) as an off-white solid.
[0163] Nuclear magnetic resonance hydrogen spectrum (400 MHz, deuterated DMSO) δ: 9.19-9.67 (multiplet, 1H), 6.82-6.98 (multiplet, 1H), 6.44-6.54 (multiplet, 1H), 5.73 (doublet, J = 4.65 Hz, 0.2H), 5.39 (singlet, 0.8H), 3.64-3.79 (multiplet, 3H), 2.12-2.28 (multiplet, 2H), 1.98-2.11 (multiplet, 3H), 1.29 (doublet of triplets, J = 4.46, 8.16 Hz, 0.8H), 1.00-1.10 (multiplet, 0.2H), 0.96 (quartet, J = 4.28 Hz, 0.8H), 0.71 (broad doublet, J = 3.30 Hz, 0.2H). Liquid chromatography-mass spectrometry: (ESI) m / z = 235.1 (M + 1) + , retention time = 0.749 min.
[0164] Inhibition of TDG activity by Example 2 compound 1
[0165] The experiment was performed in a specific buffer environment with 50 nM of TDG human recombinant protein, 30 nM of FAM and biotin (Biotin) co-labeled G / U mismatch containing double-stranded DNA substrate.
[0166] The specific buffer consisted of 20 mM HEPES, pH 7.5, 0.2 mM EDTA, 2.5 mM MgCl2, 0.1 M NaCl and 0.05% BSA, and the final reaction volume was controlled at 20 μL.
[0167] The double-stranded DNA substrate containing G / U mismatch was prepared by annealing two oligonucleotides 5'-FAM-TAAUGTGAATGGAGCTG AAAT-biotin-3' and 5'-TTTCAGCTCCATTCACGTTA-3'.
[0168] In the experiment, compound 1 was diluted into 384-well plates by gradient dilution using Bravo and Mosquito HTS automation equipment, and then the prepared TDG protein and G / U substrate solution were added by Multidrop Combi equipment.
[0169] After incubation at room temperature for 30 minutes, 10 μL of streptavidin magnetic beads were added to the assay plate to bind the biotin-labeled G / U substrate, and incubation was continued at room temperature for 1 hour. Then 30 μL of 400 mM NaOH was added to terminate the reaction, and the backbone of double-stranded DNA was cleaved by TDG protein to remove the G / U mismatch to generate an apurinic / apyrimidinic site (AP site), forming different oligonucleotides. The multi-well plate was placed on a magnetic stand, and the unreacted oligonucleotides with fluorophores and biotin labels were adsorbed and precipitated by the magnetic stand. Then 40 μL of supernatant was transferred to a black 384-well plate, and the fluorescence signals at 485 nm / 535 nm were detected using an Envision multifunctional enzyme labeler.
[0170] The percentage of enzyme activity of compound 1 at each concentration was calculated by fluorescence signal, and the DMSO control was set to 100%, and the control without TDG protein was set to 0%. The four-parameter logistic (4PL) curve was used to fit the IC 50 (FIG. 1).
[0171] The experimental results showed that the IC 50 = 0.17 μM, indicating that the compound 1 of the present application has an excellent effect of inhibiting TDG activity.
[0172] Example 3 Inhibition of Compound 1 on TDG and Double-Stranded DNA Substrate Binding
[0173] The inhibition of compound 1 on TDG and double-stranded DNA substrate binding was evaluated by homogeneous time-resolved fluorescence technology (HTRF).
[0174] Compound 1 starting concentration 250 mM, 3-fold dilution, 10 concentrations, duplicate wells. 10 different concentrations of solutions were gradient diluted in 384-well plates to 40 times final concentration. Then 500 nL was transferred to 384 reaction plates by Echo550 for standby. Subsequently, 1.5 pL / well of Epigeneous Binding Domain diluent buffer (Cat# 62DLBDDF, Cisbio), 4 pL of 5 times final concentration of His-tagged TDG protein, final concentration 40 nM, diluted with Epigeneous Binding Domain diluent buffer, 4 pL of 5 times final concentration of Biotin-labeled double-stranded DNA substrate, sequence Forward: TCGGATGTTGTGGGTCAGUGCATGATAGTGTA-Biotin, Reverse: TACACTATCATGCTGACCCACAACATCCGA, final concentration 40 nM, diluted with Epigeneous Binding Domain diluent buffer, 5 pL of 4 times final concentration of Streptavidin-XL665 (Cat# 610SAXLA, Cisbio), final concentration 5 nM, diluted with Epigeneous Binding Domain Detection buffer (Cat# 62DB1FDG, Cisbio), and 5 pL of 4 times final concentration of MAb Anti-6HIS-Eu cryptate Gold (Cat# 61HI2KLA, Cisbio), final concentration 0.1 pg / mL, diluted with Epigeneous Binding Domain Detection buffer were added in sequence. Incubated at 4 °C overnight, then HTRF signal was detected by Envision Multilabel Reader with HTRF function module.
[0175] The inhibition rate of Compound 1 at each concentration was calculated by HTRF signal, and IC 50 (Figure 2).
[0176] The experimental results showed that the inhibition IC 50 = 0.36 mM of Compound 1 on the binding of TDG and double-stranded DNA substrate, indicating that Compound 1 can effectively inhibit the binding of TDG and double-stranded DNA substrate.
[0177] Example 4 Binding constant Kd of Compound 1 to TDG
[0178] The binding constant Kd of compound 1 to TDG and three other glycosylases in the same family was tested by using MicroScale Thermophoresis (MST) technology, wherein the three other glycosylases in the same family were uracil DNA glycosylase 2 (UNG2), apurinic-apyrimidinic endonuclease 1 (APE1) and endonuclease VIII-like protein 1 (NEIL1), respectively.
[0179] After the His-tagged TDG, UNG2, APE1 and NEIL1 were labeled with RED-tris-NTA dye, the labeled proteins were mixed with different concentrations of compound 1 in PBS buffer containing 0.05% Tween 20, then loaded into capillaries, and the change of thermophoresis signal was detected using Monolith NT.115. The detection results were used for Kd fitting calculation by using MO.Affinity analysis V2.3 software.
[0180] The fitting calculation showed that the binding constant Kd of compound 1 to TDG was 0.69 μM (Figure 3), indicating that compound 1 could bind to TDG; but the binding constant Kd of compound 1 to UNG2, APE1 and NEIL1 were all greater than 100 μM, indicating that compound 1 did not bind to UNG2, APE1 and NEIL1 (Figure 4).
[0181] In summary, compound 1 has excellent selectivity and can specifically bind to TDG.
[0182] Example 5 Inhibition of the enzymatic activity of 23 epigenetic target enzymes by compound 1
[0183] In this example, the experimental concentration of compound 1 was 1 μM.
[0184] EZH2, SET7, NSD2, DOT1L, G9a, MLL1 and SETDB1 are histone lysine methyltransferases; GCN5, PCAF and P300 are histone acetyltransferases; BRD2 (D1, D2), BRD4 (D1, D2) and BRD9 are bromodomain-containing proteins; HDAC1 and HDAC6 are histone deacetylases; DNMT1 is a DNA cytosine methyltransferase; EP300 is a bromodomain-containing protein of P300; SMYD2 is a protein lysine methyltransferase; LSD1 is a histone lysine demethylase; METTL3 is an RNA adenosine methyltransferase; PARP1 and PARP7 are poly (ADP-ribose) polymerases.
[0185] The TDG enzyme activity inhibition experiment was performed according to Example 2.
[0186] EZH2 and SET7 enzyme activity inhibition experiments are isotopic detection experiments, using [3H]-SAH and polypeptide as substrates, detecting the change of isotopic 3H. 3 H]-SAH and polypeptide as substrates, detecting the change of isotopic 3H. 3 H.
[0187] GCN5, PCAF and P300 enzyme activity inhibition experiments are isotopic detection experiments, using [3H]-Ac-CoA and polypeptide as substrates, detecting the change of isotopic 3H. 3 H]-Ac-CoA and polypeptide as substrates, detecting the change of isotopic 3H. 3 H.
[0188] BRD2 (D1, D2), BRD4 (D1, D2) and BRD9 enzyme activity inhibition experiments are HTRF detection experiments, using polypeptide as substrates, detecting the change of HTRF signal.
[0189] HDAC1 and HDAC6 enzyme activity inhibition experiments are fluorescence detection experiments, using acetylated polypeptide as substrates, the product can be hydrolyzed by trypsin, detecting the change of fluorescence signal.
[0190] NSD2, DOT1L and DNMT1 enzyme activity inhibition experiments are isotopic detection experiments, using [3H]-SAH and polypeptide / recombinant nucleosome as substrates, detecting the change of isotopic 3H. 3 H]-SAH and polypeptide / recombinant nucleosome as substrates, detecting the change of isotopic 3H. 3 H.
[0191] G9a, EP300, SMYD2, MLL1, SETDB1, LSD1, PARP1 and PARP7 enzyme activity inhibition experiments are AlphaLISA detection experiments, using AlphaLISA kit to detect the generation of product.
[0192] METTL3 enzyme activity inhibition experiment is an isotopic detection experiment, using [3H]-SAH and RNA as substrates, detecting the change of isotopic 3H. 3 H]-SAH and RNA as substrates, detecting the change of isotopic 3H. 3 H.
[0193] The detection results of all experiments are converted into enzyme activity inhibition rate.
[0194] The experimental results show that compound 1 can significantly inhibit the activity of TDG, but cannot inhibit the activity of the other 22 epigenetic target enzymes (Figure 5), indicating that compound 1 has excellent selectivity.
[0195] Example 6 Binding mode of compound 1 with TDG
[0196] Intact MS technology was used to speculate the binding mode of compound 1 and TDG. The catalytic domain of TDG (comprising amino acid sequence aa111-308) at a concentration of 5 μM was mixed with 25 μM of compound 1 at a molar ratio of 1:5 in an Intact MS buffer with a total volume of 40 μL. The buffer contained 20 mM HEPES, pH 7.5, 300 mM NaCl, 1 mM DTT.
[0197] The mixed solution was incubated at room temperature for 1 hour. After incubation, in order to quench the covalent binding reaction that may occur, 0.8 μL of 10% formic acid was quickly added to the solution. At the same time, a sample of TDG catalytic region without the addition of compound 1 was prepared as a negative control. The processed sample was subjected to mass spectrometry analysis using Waters Q-TOF LC-MS technology to accurately detect the MS changes of TDG protein before and after the addition of compound 1.
[0198] The experimental results showed that the molecular weight of the TDG catalytic domain increased by 234 after treatment with compound 1, which is exactly the molecular weight of compound 1, indicating that compound 1 is covalently bound to TDG (Figure 6).
[0199] Example 7 Co-crystals of compound 1 and TDG
[0200] SUMO (Small ubiquitin-like modifier, ubiquitin-like protein modification molecule) modification is an important natural modification of TDG. Studies have shown that 20-50% of TDG in cells are SUMO-modified, and SUMO modification plays an important role in the cellular localization and functional regulation of TDG.
[0201] SUMO-1-TDG catalytic region protein expression and purification: The vectors containing SUMO-1 and TDG target genes (comprising amino acid sequence aa112-339) were co-transformed into BL21(DE3) competent cells for expression. After purification by Ni-NTA affinity column, TEV protease was added to remove the MBP tag, and unmodified TDG protein was removed by Mono S anion exchange column. The SUMO-1-TDG-MBP protein that was not cut by TEV enzyme was separated by heparin affinity column, and finally the protein purity was further improved by molecular sieve Superdex 75 to obtain the target protein SUMO-1-TDG suitable for crystal screening.
[0202] Co-crystallization of Compound 1 with SUMO-1-TDG: SUMO-1-TDG catalytic region at a concentration of 30 mg / mL was mixed with an equal volume of a stock solution containing 0.1 M Tris, pH 8.5, 25% PEG3350, 0.2 M MgCl2, and equilibrated with 100 μL of the stock solution at a temperature of 293 K. After three days of incubation, plate-shaped crystals were observed.
[0203] Subsequently, a DMSO solution of Compound 1 at a final concentration of 10 mM was added to the crystallization droplet and soaked for 12 hours. Next, the crystals were soaked in the mother liquor containing 30% (v / v) glycerol as a protective agent, and then rapidly frozen in liquid nitrogen for X-ray diffraction analysis.
[0204] The results of the co-crystallization experiment showed that Compound 1 binds near the cysteine residue at position 276 (Cys276) of the TDG protein and covalently modifies the cysteine residue at position 276 of the TDG protein (Figure 7).
[0205] Example 8 Effect of Compound 1 on the thermal stability of TDG protein at the protein and cellular levels
[0206] The effect of Compound 1 on the thermal stability of TDG protein at the protein and cellular levels was tested using the TSA technique (Thermal Shift Assay) and the CETSA technique (Cellular Thermal Shift Assay).
[0207] The TSA experiment was performed on a PikoReal 96 Real-Time PCR system using a melting curve program with a temperature ramp of 0.2 °C in the temperature range of 25-70 °C. According to the obtained positive derivative d(RFU) / dT curve, the change in the melting point (Tm) of TDG protein after treatment with Compound 1 was estimated using the PikoReal 96 Real-Time PCR system software.
[0208] The experimental results showed that the melting point (Tm) of TDG protein increased by 9.25 °C after treatment with Compound 1, indicating that the thermal stability of TDG protein was significantly improved (Figure 8a).
[0209] Cellular target binding experiment of Compound 1 was performed by CETSA experiment, following steps: NCI-H1299 cells were transfected with pCDNA4-Flag-TDG, after overnight culture, treated with 10 mM Compound 1 for 2 hours at 37℃. Then the cells were lysed, and the cell supernatant was treated at ten different temperatures from 35 to 55℃ for 3 minutes each, and centrifuged. Then, Western Blot was performed on the cell supernatant using Flag antibody to evaluate the change of thermal stability of TDG in cells before and after Compound 1 treatment.
[0210] And, after Compound 1 treatment, the melting point (Tm) of TDG protein at the cellular level increased by about 10℃, indicating that the thermal stability of TDG protein at the cellular level was significantly improved (Figure 8b).
[0211] In summary, Compound 1 can bind to TDG target in cells and improve its thermal stability.
[0212] Example 9 Effect of Compound 1 on the binding of TDG to genomic DNA
[0213] Chromatin Immunoprecipitation-Sequencing (ChIP-seq) was used to test the effect of Compound 1 on the binding of TDG to genomic DNA.
[0214] After NCI-H1299 cells overexpressing Flag-TDG were treated with 5 mM Compound 1 for 48 hours, cross-linking treatment with 1% formaldehyde was performed at room temperature for 10 minutes, followed by quenching with 0.125 M glycine. Then, COVARIS S220 was used for ultrasonic treatment to break the genomic DNA into fragments with a length of about 300 bp. In the immunoprecipitation (IP) step, one-tenth of the supernatant was incubated with Flag antibody at 4℃ overnight, and then immunoprecipitated using Protein G magnetic beads. The chromatin (ChIP DNA) obtained by immunoprecipitation was eluted in TE buffer. Then, steps such as end repair, A-tailing, adapter ligation, library amplification, sequencing and data analysis were performed.
[0215] The experimental results showed that TDG was mainly bound to the promoter region of genomic DNA, accounting for 60% (Figure 9a). And after Compound 1 treatment, the peak signal intensity of TDG binding was significantly reduced, indicating that Compound 1 can hinder the binding of TDG to genomic DNA (Figure 9b).
[0216] Example 10 Effect of Compound 1 on the expression of DHX9 protein in KP cells (Trp53 knockout mouse lung cancer cells)
[0217] DHX9 is an RNA helicase, and its decrease can lead to the accumulation of double-stranded RNA (dsRNA) in the cytoplasm, triggering an antiviral response, and thus inhibiting tumor growth and enhancing antitumor immune response.
[0218] The effect of compound 1 on the expression of DHX9 protein in KP cells (Trp53 knockout mouse lung cancer cells, i.e., lung cancer cells simulating TP53 deletion) was tested by Western Blot (WB).
[0219] Construction of KP cells: Kras G12D mutant, Trp53 conditional knockout mice were bred. Detailed experimental procedures can be referred to DuPage M, et al. Conditional mouse lung cancer models using adenoviral or lentiviral delivery of Cre recombinase. Nat Protoc. 2009; 4(7): 1064-72. The sgRNA sequences used for knocking out Trp53 in mice were: mTrp53_sg-1: AGTGAAGCCCTCCGAGTGTC; mTrp53_sg-2: GACCCTGTCACCGAGACCCC. After 3-4 weeks of Ad-Cre induced tumorigenesis in mice by intranasal inhalation, tumor nodules in the lung tissue of Kras G12D mutant, Trp53 knockout mice were bred. Detailed experimental procedures can be referred to DuPage M, et al. Conditional mouse lung cancer models using adenoviral or lentiviral delivery of Cre recombinase. Nat Protoc. 2009; 4(7): 1064-72. The sgRNA sequences used for knocking out Trp53 in mice were: mTrp53_sg-1: AGTGAAGCCCTCCGAGTGTC; mTrp53_sg-2: GACCCTGTCACCGAGACCCC. After 3-4 weeks of Ad-Cre induced tumorigenesis in mice by intranasal inhalation, tumor nodules in the lung tissue of Kras
[0220] The constructed KP cells were treated with different concentrations of compound 1, and the treatment concentrations were 0.625, 1.25, and 2.5 μM, respectively. After 4 days of treatment of the cells with compound 1, the effect of compound 1 on the level of DHX9 protein was tested by Western Blot (WB).
[0221] The results of WB showed that the level of DHX9 protein in KP cells was significantly decreased after treatment with compound 1 (Figure 10), indicating that compound 1 can inhibit the expression of DHX9 protein in KP cells, suggesting that compound 1 can promote the accumulation of dsRNA in the cytoplasm.
[0222] Example 11 Effect of compound 1 on double-stranded RNA (dsRNA) in KP cells (Trp53 knockout mouse lung cancer cells)
[0223] The effect of compound 1 on double-stranded RNA (dsRNA) in KP cells (Trp53 knockout mouse lung cancer cells) was tested by Immunofluorescence (IF).
[0224] The KP cells used in this example are the same as in Example 10, which are Trp53 knockout mouse lung cancer cells. The adherent KP cells were treated with 1.25 mM Compound 1 for 4 days. After fixation, permeabilization and blocking, the cells were treated with J2 antibody (an antibody specifically recognizing dsRNA), fluorescent secondary antibody Cy TM 3 and DAPI, respectively, and then photographed under a fluorescence microscope.
[0225] The immunofluorescence experiment showed that the level of dsRNA in the cytoplasm of KP cells was increased after Compound 1 treatment compared with the control group (Figure 11), indicating that Compound 1 can increase the level of dsRNA in KP cells.
[0226] The results in this example are consistent with the conclusion that the level of DHX9 protein is significantly decreased in Example 10, indicating that the increase in the level of dsRNA is caused by the decrease in the level of DHX9 protein, in other words, Compound 1 can promote the accumulation of dsRNA in the cytoplasm by inhibiting DHX9 protein in KP cells.
[0227] Example 12 Effect of Compound 1 on dsRNA in p53 mutant and p53 wild-type tumor cells
[0228] The KP cells used in this example are the same as in Example 10, which are Trp53 knockout mouse lung cancer cells; 4T1 cells are Trp53 deletion mouse breast cancer cells; Hep3B is a TP53 deletion human liver cancer cell; HCI-H1299 is a TP53 deletion human lung cancer cell; A549 is a TP53 wild-type human lung cancer cell.
[0229] The effect of Compound 1 on dsRNA in p53 mutant and wild-type tumor cells was tested by immunofluorescence technology (IF). The experimental procedure was the same as in Example 10, and the PE Operatta high-content cell imaging system was used for photography and quantification.
[0230] The experimental results showed that the level of dsRNA in p53 knockout or deletion tumor cells (i.e. p53 mutant tumor cells) treated with Compound 1 was significantly increased, and the change in the level of dsRNA in the cells was correlated with the dose of Compound 1 (Figure 12a), but the effect of Compound 1 on the level of dsRNA in p53 wild-type tumor cells was not significant (Figure 12b), indicating that the effect of Compound 1 on the level of DHX9 protein and dsRNA is only specific to TP53 mutant tumor cells.
[0231] Example 13 Inhibition of Compound 1 on the proliferation of TP53 mutant and wild-type tumor cells
[0232] Inhibition IC of Compound 1 on the proliferation of TP53 mutant and wild type tumor cells 50 The TP53 mutant and wild type tumor cells used in this example are all human tumor cells.
[0233] Tumor cells were plated in 384-well plates and treated with DMSO or Compound 1 at indicated concentrations (0.04-30 mM). After 6 days of incubation, the chemiluminescent intensity was measured using CellTiter-Glo Luminescent Cell Viability Assay Kit (Promega). The curves were fitted using GraphPad Prism software and the IC50 values were calculated.
[0234] The results showed that Compound 1 significantly inhibited the proliferation of p53 mutant tumor cell lines in vitro, but weakly inhibited the proliferation of p53 wild type tumor cell lines in vitro (Figure 13), indicating that the effect of Compound 1 on tumor cell proliferation only specifically acts on TP53 mutant tumor cells, which is consistent with the conclusion in Example 12.
[0235] Example 14 Inhibition of Compound 1 on the growth of p53 mutant and wild type tumor cell lines in immunodeficient mice
[0236] The tumor cells used in this example are MDA-MB-436 (TP53 mutant human breast cancer cells), SKM-1 (TP53 mutant human AML cells), NCI-H1299 (TP53 deletion human lung cancer cells), CAL27 (TP53 mutant human tongue squamous carcinoma cells), NCI-H446 (TP53 mutant human lung cancer cells), RKO (TP53 wild type human colon cancer cells), A498 (TP53 wild type human renal cancer cells), A549 (TP53 wild type human lung cancer cells), NCI-H2228 (TP53 wild type human lung cancer cells), and HCT116 (TP53 wild type human colon cancer cells).
[0237] In this example, MDA-MB-436 and CAL27 models use NCG immunodeficient mice, SKM-1 and A498 models use CB17-SCID immunodeficient mice, NCI-H1299, NCI-H446, RKO, A549, NCI-H2228 and HCT116 models use BALB / c nude immunodeficient mice.
[0238] The above tumor cells were inoculated on the right thigh of immunodeficient mice, and when the tumor size was 50-150 mm 3The administration was started after the tumor cells were inoculated (the time point of starting administration was slightly different in different models). Compound 1 was administered at a dose of 50 mpk (i.e. 50 mg / kg) by oral gavage once a day. The tumor size and the body weight of the mice were recorded 2-3 times per week. The mice were sacrificed when the tumor volume of the control group was close to 2000 mm3, and the experiment was ended. 3
[0239] Tumor proliferation inhibition rate calculation: Tumor proliferation inhibition rate = (1- (T t -T0) / (C t -C0))*100, T t and T0 are the average tumor volume of the administration group at the end of administration and the starting administration point, respectively, and C t and C0 are the average tumor volume of the blank control group at the end of administration and the starting administration point, respectively.
[0240] The results showed that Compound 1 had a significant inhibitory effect on the growth of p53 mutant tumors and a weak inhibitory effect on the growth of p53 wild-type tumors (Figure 14), indicating that the effect of Compound 1 on tumor cell proliferation only specifically acts on TP53 mutant tumor cells, which is consistent with the conclusions in Examples 11 and 12.
[0241] In addition, in the mouse models inoculated with NCI-H1299, SKM-1 and MDA-MB-436 tumor cells, Compound 1 had a more significant inhibitory effect on tumor growth, and the changes in tumor volume and body weight of the mice are shown in Figure 15.
[0242] Example 15. Experiment of Compound 1 combined with anti-CTLA-4 antibody in p53-deficient syngeneic mouse models.
[0243] The tumor cells used in this example were KP (Trp53 knockout mouse lung cancer cells), 4T1 (Trp53 deletion mouse breast cancer cells) and MC38 (Trp53 mutant mouse colon cancer cells).
[0244] The C57BL / 6 immunocompetent mice were used in the KP and MC38 models, and the BALB / c immunocompetent mice were used in the 4T1 model.
[0245] The above tumor cells were inoculated into the right thigh of immunocompetent mice to construct p53-deficient syngeneic mouse models (KP, 4T1, MC38), and the mice were randomly grouped after inoculation. Compound 1 was administered on day 3, with a dose of 5 mpk, administered orally by gavage, once a day. Anti-CTLA-4 antibody was administered on day 6, with a dose of 10 mpk, administered by intraperitoneal injection, once every 3 days, for a total of 3-4 times. Tumor size and mouse body weight were recorded 3 times a week. The control group was sacrificed when the tumor size approached 2000 mm 3 and the experiment was ended.
[0246] The results showed that, compared with the use of compound 1 alone or anti-CTLA-4 antibody alone, the use of compound 1 in combination with anti-CTLA-4 antibody significantly reduced the tumor volume in the three p53-deficient syngeneic mouse models, indicating that the combination of compound 1 and anti-CTLA-4 antibody showed excellent synergistic effect in the three p53-deficient syngeneic mouse models (Figure 16).
[0247] In summary, compound 1 specifically inhibits the expression of DHX9 gene in p53-deficient tumor cells by inhibiting TDG, thereby regulating the level of dsRNA, and further activating the body's anti-tumor innate immunity. Moreover, the activated anti-tumor innate immunity can inhibit the growth of tumor cells in vitro and in vivo on the one hand, and can be used in combination with immunotherapy such as anti-CTLA-4 antibody to further inhibit the growth of tumor (Figure 17).
[0248] All the documents mentioned in the present application are cited as references in the present application, just as each document is cited as a reference individually. In addition, it should be understood that, after reading the above teaching of the present application, those skilled in the art can make various modifications or amendments to the present application, and these equivalent forms also fall within the scope defined by the claims attached to the present application.
Claims
1. A pharmaceutical combination, characterized in that, The pharmaceutical combination comprises: A. a safe and effective amount of a TDG inhibitor; and B. a safe and effective amount of an immune checkpoint inhibitor; wherein the immune checkpoint inhibitor is selected from the group consisting of a PD-1 inhibitor, a PD-L1 inhibitor, a CTLA-4 inhibitor, or a combination thereof.
2. The pharmaceutical combination of claim 1, wherein, The TDG inhibitor is a compound of Formula I: R1 is selected from the following group: OH, H, halogen, cyano, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C2-C6 alkenyl, substituted or unsubstituted C2-C6 alkynyl, substituted or unsubstituted C1-C6 alkoxy, substituted or unsubstituted C6-C 10 Aryl, substituted or unsubstituted 3-12 membered heterocycles, substituted or unsubstituted 5-12 membered heteroaromatic rings, substituted or unsubstituted -O-3-12 membered heterocycles, substituted or unsubstituted -C1-C6 alkyl-phenyl, substituted or unsubstituted -O-phenyl, substituted or unsubstituted C1-C4 alkyl-C(O)-, substituted or unsubstituted C1-C4 alkyl-S(O)2-, substituted or unsubstituted C1-C6 alkyl-NH-, (substituted or unsubstituted C1-C6 alkyl)2-N-, -O(CH2) s R 10 , or -S(CH2) s R 10 ;s is 0, 1, 2, or 3;R 10 Selected from the following group: H, substituted or unsubstituted C 3-8 Carbon rings, substituted or unsubstituted 3-8 membered heterocycles, substituted or unsubstituted C6-C 10 Aryl, substituted or unsubstituted 5-12 membered heteroaryl rings; each R2is independently selected from the group consisting of H, halogen, substituted or unsubstituted C1-C6alkyl; R3 is selected from the following group: H, halogen, cyano, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C1-C6 alkoxy, substituted or unsubstituted C3-C 12 Cycloalkyl, or (C1-C6 alkyl)C(O)R8, (C1-C6 alkyl)C(O)NHR8, (C1-C6 alkyl)C(O)N (substituted or unsubstituted C1-C6 alkyl)R8, (C1-C6 alkyl)C(O)OR8; wherein R8 is selected from the group consisting of: H, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C6-C 10 Aryl, -(OCH2CH2) m -Substituted or unsubstituted C1-C6 alkyl groups, or substituted or unsubstituted groups selected from the group consisting of: -(CH2) m NHC(O)(CH2) n R 13 -(CH2)CHR9NHC(O)(CH2) n R 13 CHR9(CH2)NHC(O)(CH2) n R 13 The R9 mentioned is selected from the following group: H, -COOH, -CONHR 12 -CONHCH2R 12 -CONH(CH2CH2O) m (CH2) n COOH, substituted or unsubstituted C1-C6 alkoxy groups, substituted or unsubstituted C6-C 10 aryl, substituted or unsubstituted C3-C 10 Carbon rings, substituted or unsubstituted 3-12 membered heterocycles, substituted or unsubstituted 5-12 membered heteroaromatic rings; R 12 Selected from the following group: substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C3-C8 cycloalkyl, substituted or unsubstituted C6-C 10 aryl, substituted or unsubstituted 5-12 membered heteroaryl rings; the R 13 Selected from the following group: substituted or unsubstituted C3-C 10 Carbon rings; each of m and n is independently 0, 1, 2, or 3; R4is selected from the group consisting of H, halogen, cyano, substituted or unsubstituted C1-C6alkoxy, substituted or unsubstituted C1-C6amine, substituted or unsubstituted C6-C10aryl, substituted or unsubstituted C3-C8cycloalkyl, substituted or unsubstituted 3-12 membered heterocyclic ring, substituted or unsubstituted 5-12 membered heteroaryl ring, substituted or unsubstituted -O-5-12 membered heteroaryl ring; 10 R4is selected from the group consisting of H, halogen, cyano, substituted or unsubstituted C1-C6alkoxy, substituted or unsubstituted C1-C6amine, substituted or unsubstituted C6-C10aryl, substituted or unsubstituted C3-C8cycloalkyl, substituted or unsubstituted 3-12 membered heterocyclic ring, substituted or unsubstituted 5-12 membered heteroaryl ring, substituted or unsubstituted -O-5-12 membered heteroaryl ring; or R3and R4together with the carbon atom to which they are attached form a structure selected from the group consisting of a substituted or unsubstituted C6-C10aromatic ring, a substituted or unsubstituted 5-10 membered aromatic heterocyclic ring, a substituted or unsubstituted C3-C8carbocyclic ring, or a substituted or unsubstituted 3-10 membered heterocyclic ring; each of R5and R6is independently selected from the group consisting of H, substituted or unsubstituted C1-C6alkyl, substituted or unsubstituted C6-C10aromatic ring, substituted or unsubstituted 5-10 membered aromatic heterocyclic ring, substituted or unsubstituted C3-C8carbocyclic ring, or substituted or unsubstituted 3-10 membered heterocyclic ring; or R5and R6together with the carbon atom to which they are attached form a substituted or unsubstituted 3-12 membered carbocyclic ring; R6'is selected from the group consisting of H, substituted or unsubstituted C1-C6alkyl; or R6and R6'together form =CH2; X is selected from O or S; Z is selected from O, S or NR 14 ; wherein R is H or C1-C4 alkyl; and 14 H or C1-C4 alkyl; and R7is selected from the group consisting of H, substituted or unsubstituted CrC 12 alkyl, or C(O)R 11 , C(O)OR 11 , -CH2OC(O)OR 11 , -S(O)2NHR 11 ; The R mentioned 11 Selected from the following group: H, substituted or unsubstituted C1-C 16 Alkyl, substituted or unsubstituted C6-C 10 Aryl, -(OCH2CH2) m -Substituted or unsubstituted C1-C6 alkyl groups, substituted or unsubstituted 5-8 membered heterocyclic groups; Unless otherwise specified, in each of the above formulae, the heteroaromatic ring, heteroaryl, heterocyclic ring, or heterocyclyl contains 1, 2, or 3 heteroatoms selected from N, S, or O; the aromatic ring, aryl, heteroaromatic ring, or heteroaryl can be monocyclic or fused; the carbocyclic ring, cycloalkyl, heterocyclic ring, or heterocyclyl can be monocyclic, annelated, bridged, or spirocyclic; the carbocyclic ring, heterocyclic ring, or heterocyclyl can be saturated or partially unsaturated, but not aromatic; said substituents are selected from the group consisting of deuterium, halogen, hydroxy, carboxy, thiol, benzyl, C2-C6alkenyl, C2-C6alkynyl, C1-C6alkoxy, C3-C6cycloalkyl, C1-C6alkyl- amino, C1-C6alkylamino carbonyl, C1-C4alkyl-S(O)2-, C1-C4alkyl-OC(O)NH-, C1-C4alkyl-SO-, 5-7 membered heterocyclic ring, and phenyl (which can have 1-5 substituents selected from halogen, C1-C4alkyl, C1-C4alkoxy). 12 alkyl, C2-C6alkenyl, C2-C6alkynyl, C1-C6alkoxy, C3-C6cycloalkyl, C1-C6alkyl- amino, C1-C6alkylamino carbonyl, C1-C4alkyl-S(O)2-, C1-C4alkyl-OC(O)NH-, C1-C4alkyl-SO-, 5-7 membered heterocyclic ring, and phenyl (which can have 1-5 substituents selected from halogen, C1-C4alkyl, C1-C4alkoxy). 10 alkyl, C2-C6alkenyl, C2-C6alkynyl, C1-C6alkoxy, C3-C6cycloalkyl, C1-C6alkyl- amino, C1-C6alkylamino carbonyl, C1-C4alkyl-S(O)2-, C1-C4alkyl-OC(O)NH-, C1-C4alkyl-SO-, 5-7 membered heterocyclic ring, and phenyl (which can have 1-5 substituents selected from halogen, C1-C4alkyl, C1-C4alkoxy). 12 alkyl, C2-C6alkenyl, C2-C6alkynyl, C1-C6alkoxy, C3-C6cycloalkyl, C1-C6alkyl- amino, C1-C6alkylamino carbonyl, C1-C4alkyl-S(O)2-, C1-C4alkyl-OC(O)NH-, C1-C4alkyl-SO-, 5-7 membered heterocyclic ring, and phenyl (which can have 1-5 substituents selected from halogen, C1-C4alkyl, C1-C4alkoxy). 10 alkyl, C2-C6alkenyl, C2-C6alkynyl, C1-C6alkoxy, C3-C6cycloalkyl, C1-C6alkyl- amino, C1-C6alkylamino carbonyl, C1-C4alkyl-S(O)2-, C1-C4alkyl-OC(O)NH-, C1-C4alkyl-SO-, 5-7 membered heterocyclic ring, and phenyl ( 3. The pharmaceutical combination of claim 2, wherein, The compound has a structure as shown in formula III: wherein R1, R2, R3, and XR7are as defined in claim 2.
4. The pharmaceutical combination of claim 2, wherein, The R1 is selected from the group consisting of: halogens, substituted or unsubstituted C1-C6 alkoxy groups, substituted or unsubstituted C6-C6 alkoxy groups. 10 Aryl, substituted or unsubstituted 3-12 membered heterocycles, substituted or unsubstituted 5-12 membered heteroaromatic rings, substituted or unsubstituted -O-3-12 membered heterocycles, substituted or unsubstituted C1-C4 alkyl-S(O)2-, substituted or unsubstituted C1-C6 alkyl-NH-, (substituted or unsubstituted C1-C6 alkyl)2-N-, -O(CH2) s R 10 .
5. The pharmaceutical combination of claim 2, wherein R3is selected from the group consisting of H, halogen, substituted or unsubstituted C1-C6alkyl, substituted or unsubstituted C3-C8cycloalkyl, substituted or unsubstituted phenyl.
6. The pharmaceutical combination of claim 1, wherein, the PD-1 inhibitor is selected from the group consisting of Retifanlimab, Pucotenlimab, Cadonilimab, Serplulimab, Nivolumab / Relatlimab, Zimberelimab, Penpulimab, Dostarlimab-gxly, Prolgolimab, Tislelizumab, Camrelizumab, Sintilimab, Toripalimab, Cemiplimab-RWLC, Pembrolizumab, Nivolumab, Balstilimab, Finotonlimab, Iparomlimab, Ivonescimab, Enlonsurabumab, or a combination thereof; the PD-L1 inhibitor is selected from the group consisting of Benmelstobart, Socazolimab, Adebrelimab, Sugemalimab, Envafolimab, Durvalumab, Avelumab, Atezolizumab, Tagitanlimab, or a combination thereof; the CTLA-4 inhibitor is selected from the group consisting of Tremelimumab, Ipilimumab, Cadonilimab, Erfonrilimab, Gotistobart, Pembrolizumab / Quavonlimab, Prolgolimab / nurulimab, Quavonlimab, Tuvonralimab / Iparomlimab, Volrustomig, or a combination thereof.
7. The pharmaceutical combination of claim 1, wherein The pharmaceutical combination further comprises a pharmaceutically acceptable carrier.
8. The pharmaceutical combination of claim 1, wherein, The mass ratio of the TDG inhibitor to the immune checkpoint inhibitor is 1-1000: 1000-1. Preferably, the mass ratio of the TDG inhibitor to the immune checkpoint inhibitor is 1-10: 10-1.
9. A kit characterized in that, The kit comprises: (A) a safe and effective amount of a TDG inhibitor; (B) a safe and effective amount of an immune checkpoint inhibitor; and (C) instructions for use. (A) a safe and effective amount of a TDG inhibitor; (B) a safe and effective amount of an immune checkpoint inhibitor; and (C) instructions for use.
10. The pharmaceutical combination according to any one of claims 1 to 8, or the use of the kit of claim 9, wherein, The pharmaceutical combination or kit is used for preparing a medicament for treating a TP53 gene mutation-containing related disease; Preferably, the TP53 gene mutation-containing related disease is a TP53 gene mutation-containing tumor. More preferably, the TP53 gene mutation-containing tumor is selected from the group consisting of lung cancer, liver cancer, skin cancer, bladder cancer, breast cancer, colon cancer, esophageal cancer, acute myelocytic leukemia, or a combination thereof.
11. Use according to claim 10, characterized in that, The pharmaceutical combination or kit is used for inhibiting the activity of TDG.
12. The use according to claim 10, characterized in that, The pharmaceutical combination or kit is used for reducing the level of DHX9 in a p53 mutant tumor cell, or the pharmaceutical combination or kit is used for increasing the level of dsRNA in a p53 mutant tumor cell.
13. Use of a TDG inhibitor characterized in that, for preparing: (a) a covalent ligand that selectively binds to a cysteine residue at position 276 (Cys276) in a target protein; and / or (b) a pharmaceutical composition for preventing, alleviating and / or treating a TP53 gene mutation-containing related disease.
14. A method of designing a TDG inhibitor, characterized by, comprising the steps of: (a) providing a candidate molecule that is capable of binding to Cys276 in a TDG protein; (b) determining the TDG binding ability of the candidate molecule.
Citation Information
Patent Citations
Cancer vaccine
CN110662556A
Inhibition of Thymine DNA Glycosylase in the Treatment of Cancer
US20160199381A1