A method for predicting the response of a patient with dlbcl to Anti-il-1ß therapy
The method predicts patient response to anti-IL-1β therapy by detecting IRF2BP2 mutations in DLBCL, offering personalized treatment for 15% of patients with IRF2BP2 gene mutations, enhancing treatment efficacy by using IL-1β antagonists like canakinumab.
Patent Information
- Application Number
- PCT/EP2025/064145
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-23
- Filing Date
- 2025-05-22
- Publication Date
- 2025-11-27
AI Technical Summary
Current treatments for diffuse large B-cell lymphoma (DLBCL) are not curative, and there is a need for personalized treatment options based on genetic vulnerabilities, particularly for patients with mutations in the IRF2BP2 gene, as existing therapies do not specifically address this genetic alteration.
A method for predicting patient response to anti-IL-1β therapy by detecting mutations in the IRF2BP2 gene and/or lack of IRF2BP2 protein expression in DLBCL cells, using sequencing and immunohistochemical analysis, and recommending anti-IL-1β therapy for patients with positive detection results.
Identifies 15% of DLBCL patients likely to respond positively to anti-IL-1β therapy, increasing treatment success by targeting IL-1β-dependent tumor growth through IL-1β antagonists like canakinumab, reducing tumor volume and proliferation.
Smart Images

Figure 00000015_0000 
Figure 00000015_0001 
Figure 00000016_0000
Abstract
Description
[0001] A METHOD FOR PREDICTING THE RESPONSE OF A PATIENT WITH DLBCL TO ANTI-IL-1 p THERAPY
[0002] The present invention relates to a method for predicting a response of a patient with diffuse large B-cell lymphoma (DLBCL) to anti-IL-1 p therapy.
[0003] This includes the detection of a mutation in the IRF2BP2 gene and / or a lack of IRF2BP2 protein expression in the patient's DLBCL cells in a sample obtained from the patient. The invention also relates to the use of such detection for predicting a patient's response to IL-1 p therapy.
[0004] Diffuse large B-cell lymphoma is a tumour disease of the lymph nodes, which are present at various locations in the body. It is the most common non-Hodgkin's lymphoma in adults and is classified by the WHO as an aggressive, blastic mature B-cell neoplasm.
[0005] The first choice in the treatment of diffuse large B-cell lymphoma is a combination of an anti-CD20 antibody with a chemotherapy cocktail. This therapy achieves a cure in around 60-70% of patients. For patients with primary refractory or recurrent lymphoma, different second- or third-line therapies are proposed depending on the patient's general condition and age. None of these forms of treatment are currently curative, so there is a need for new treatment methods. A frequently pursued approach here is the identification of tumour-specific vulnerabilities that are associated with certain genetic changes (personalised medicine, target therapy). The present invention is intended to provide a treatment option for patients with mutations in the IRF2BP2 gene. The functionality of IRF2BP2 in the context of DLBCL is largely undescribed.
[0006] Pastor, T.P., et al. (2021) reveal the connection between IRF2BP2 and the development of haematopoietic and solid tumours. It is assumed, even if the exact mechanisms are not yet understood, that IRF2BP2 can act both as a tumour suppressor gene and as an oncogene, depending on the cellular context. A connection with IL-1 p is not revealed.
[0007] Ellegast, J.M. et al. (2022) disclose a connection between IRF2BP2 and IL-1 in AML (acute myeloid leukaemia). However, in contrast to the field of application described in this application, a loss of function of IRF2BP2 does not lead to increased growth, but to the death of the tumour cells. The administration of an IL-1 p inhibitor would therefore be contraindicated here. Arranz, et al. (2017) reveal that increased IL-1 p secretion is common in patients with haematological cancers and treatment with IL-1 antagonists could be therapeutically promising. DLBCL is not specifically mentioned and a link to IRF2BP2 is not disclosed.
[0008] Canakinumab, a common IL-1 antagonist, is an IL-1 p antibody already authorised by Novartis for the treatment of gouty arthritis, periodic fever syndrome and Still's syndrome.
[0009] AU 2018 / 287519 A1 and US 2022 / 0025036 A1 disclose dedicated claims of the compound canakinumab of Novartis. The patents relate to the IL-1 p binding antibody (or a fragment thereof) and its use in the treatment and / or prevention of cancer based at least in part on inflammatory processes. According to AU 2018 / 287519 A1 , this includes cancers such as breast or lung cancer as well as two haematological cancer types: multiple myeloma and AML. In US 2022 / 0025036 A1 , the disclosed subject matter relates to the haematological cancer CML. Neither DLBCL nor a superorder into which DLBCL may fall are explicitly listed in AU 2018 / 287519 A1 or US 2022 / 0025036 A1.
[0010] The present invention utilises the finding that IRF2BP2 is mutated in about 15 % of cases of diffuse large B-cell lymphoma (DLBCL). The inventors were able to show that the loss of functional IRF2BP2 is surprisingly accompanied by increased secretion of interleukin-1 p (IL-1 p). This mechanism results in a dependence of the tumour cell on IL- 1 p. Neutralising antibodies against IL-1 p reduce the growth of IRF2BP2-deficient DLBCL cell lines. The detection of certain concentrations of IL-1 p itself, as a cytokine frequently occurring in the body in the immune response to inflammatory reactions, is difficult or difficult to assign.
[0011] The present invention is intended to provide a treatment option for patients with mutations in the IRF2BP2 gene, which is carried by approximately 15% of all DLBCL patients.
[0012] It has been shown that loss of IRF2BP2 in DLBCL cell lines leads to increased secretion of the cytokine IL-1 p. In these cell lines, IL-1 p surprisingly leads to the activation of NFKB via autocrine / paracrine stimulation of the corresponding receptor and thus to increased growth.
[0013] NFKB is a specific transcription factor, particularly in the signalling pathways, and is involved in the regulation of the immune response, cell proliferation and apoptosis and stands for nuclear factor ‘kappa-light-chain-enhancer’ of activated B cells.
[0014] IRF2BP2 is an interferon regulatory factor 2 binding protein 2 and interacts with the C- terminal transcriptional repression domain of IRF2.
[0015] Neutralisation of extracellular I L-1 p by antagonistic antibodies leads to a reduction in NFKB and cell proliferation. This inhibitory effect occurs in the IRF2BP2-mutated context, whereas IRF2BP2 wild-type cells were not affected by an anti-IL-1 antibody.
[0016] According to the invention, a method for predicting a response of a patient with diffuse large B-cell lymphoma (DLBCL) to anti-IL-1 p therapy is proposed. This involves the detection of a mutation in the IRF2BP2 gene and / or a lack of IRF2BP2 protein expression in the patient's DLBCL cells in a sample obtained from the patient.
[0017] Method steps associated with the method according to the invention are thus, for example: (i) diagnosing a diffuse large B-cell lymphoma (DLCBL) in a patient; (ii) obtaining at least one sample from the patient; (iii) detecting a mutation in the IRF2BP2 gene of the DLBCL cells of the patient in the sample obtained from the patient; and / or (iv) detecting a lack of IRF2BP2 protein expression of the DLBCL cells of the patient in the sample obtained from the patient; and (v) evaluating with respect to a prognosis of the patient's response to anti-IL-1 p therapy.
[0018] Although the term ‘patient’ in the context of the method according to the invention is to be understood broadly, i.e. it can refer to both animal and human patients at various stages, it preferably refers to humans, in particular with an already established diagnosis of DLCBL and at the beginning of a therapy in this regard.
[0019] Anti-IL-1 p therapy, for which a prognosis is made in the method according to the invention, is to be understood as a therapy, which is carried out with antagonists of IL-1 p.
[0020] ‘Response’ of the patient with DLBCL to anti-IL-1 p therapy in the present context means that a positive effect on the course of the disease can be assumed. ‘Response’ can include both a cure and an alleviation. In particular, it includes influencing the tumour growth or tumour volume of the DLBCL, which is inhibited or reduced.
[0021] In an advantageous embodiment of the method according to the invention, detection is carried out by means of sequencing and mutation analysis and / or immunohistochemical analysis. The sequencing and mutation analysis is used to detect a mutation in the IRF2BP2 gene, while the immunohistochemical analysis is used to detect a lack of IRF2BP2 protein expression. Both methods can be performed using standard protocols known in the field and provide a positive (mutation or lack of expression is present) or a negative (mutation or lack of expression is not present) result.
[0022] The mutation to be analysed affects the IRF2BP2 gene (Ensembl ID ENSG00000168264, chromosome 1 : 234,604,269-234,610,178 reverse strand, GRCh38), which comprises 5910 base pairs and the following sequence (SEQ ID No: 1):
[0023] GTAGAAGTGGAGCGGTCGCGGCGGCAGCAGCAGCAGCGACGGTGGCGGCGGCGGAGCTGAGGCGGGCTGGCCGCTGACGCTGGCGCTGGAGAGC GGCGACGCCAGGAGCTGTGAGAGAGCGGCGGAGCGACCCGGGGCCCGCGCCGCGCCCGAGCTCCACGCCGCCCGGCCGCCGCCACCCCGGCGCG GCATGCCCCGCCGCTCGGGCTGAGCCTGCCCCGGCGGCCGCCCCCCGCCCCCTGCCCCCCCGGCCTCCCCGCCCCCCGCCCCGCACTCCGTGCC GGCCGCCGCCGCGACCTGCTGCGCTCCCCCGCGCCCGCGCGGCCCGTCTTCGCCCCGGTCTGGAGGCCCGCCGCGGCTCCGGCCGAGCCCCCAC CGCCGCGCCCGCCGCCCCGCCGCGCCGCGCCGCCCGCCCGTGCCCGGGCCGGCCGGGGGGAACTGCTGCCGCGGCTGCAGCCCCTCACCTCGCG CCCGCCGCCCCTCGTGCACCGGGGGCGCTGCGCGGGCGCCGAGCCTTCGCGGGCTTTGCCGCCGCCGCCGCCGCCTTTGCGGCCGCCGCCGCCG CTGGTGGGGGAGACGCGGGGTTGGGGGGGGAGGAGGGCGCGCGTGGTGCCGGTGGGGGGCGGCGGCGGCGCCCCCTCCTCCTCCTCCGCCTCCT CCTCCGGCGTCGCGGGCTCCTCGGACATGGCCGCGGCGGTGGCGGTGGCGGCCGCGTCCCGGCGGCAGTCGTGCTACCTGTGTGACCTGCCCCG CATGCCCTGGGCCATGATCTGGGACTTCACCGAACCCGTCTGCCGCGGCTGCGTCAACTACGAGGGCGCCGACCGCGTCGAGTTCGTCATCGAG ACGGCGCGGCAGCTCAAGCGGGCGCACGGCTGCTTCCCGGAGGGTCGCTCCCCACCCGGCGCCGCGGCCTCGGCCGCCGCCAAGCCGCCGCCGC TCTCCGCCAAGGACATCCTTTTGCAGCAGCAGCAGCAGCTTGGCCACGGCGGCCCCGAGGCGGCCCCGCGCGCGCCGCAGGCCTTGGAGCGCTA CCCGTTGGCGGCCGCGGCCGAGAGGCCCCCGCGCCTCGGCTCTGACTTCGGCAGCAGCCGCCCGGCAGCGAGCCTGGCCCAGCCGCCGACGCCG CAGCCGCCGCCCGTGAACGGCATCCTGGTGCCCAACGGCTTCTCCAAGCTAGAGGAGCCGCCCGAGCTGAATCGCCAGAGCCCGAACCCGCGGC GCGGCCACGCGGTGCCGCCCACCCTGGTGCCGCTCATGAACGGCTCGGCCACGCCGCTGCCCACCGCGCTCGGCCTCGGCGGCCGCGCTGCCGC CTCCTTAGCCGCGGTGTCCGGAACCGCGGCCGCCAGCCTGGGCTCCGCGCAGCCCACCGATCTGGGCGCCCACAAGCGGCCGGCATCCGTGTCG AGCAGCGCTGCCGTGGAGCACGAGCAGCGTGAGGCGGCAGCCAAGGAGAAACAACCGCCGCCGCCTGCGCACCGGGGCCCGGCCGACAGCCTGT CCACCGCGGCCGGGGCCGCCGAGCTGAGCGCGGAAGGTGCGGGCAAGAGCCGCGGGTCTGGAGAGCAGGACTGGGTCAACAGGCCCAAGACCGT GCGCGACACGCTGCTGGCGCTGCACCAGCACGGCCACTCGGGGCCCTTCGAGAGCAAGTTTAAGAAGGAGCCGGCCCTGACTGCAGGCAGGTTG TTGGGTTTCGAGGCCAACGGGGCCAACGGGTCTAAAGCAGGTAGGGGCGGCTGTGAAGTGAGGGGGTCTAGGGGAGAAAAGGGGACGGAGAGCA GAGGAAGGGTGGTTCTTTGGATTCACCATTTTACCCCAGCCCAGAAACAACAAACACCCCACTTCCTGATCTGCCTGAGGCGGAACCAGTGCT GGTGGCAACGTGTTCATGTGCTGAAGCAGCATAACAGAGATGAGTCAGACTGGGCTGATACGCTCTGACACGGGGTTTTCCTTTCCCAGCACAT TCTTGGATGGGAGCATGAGGGCACCAGTCACCTTTTAACCTATTGGGGGACATTAGCAGTCACATGTTGAGTGCAAACGAGGGTACTTTTGTGC
[0024] ATGTGTACAAACAGGCAGTTACAAGCGTGTCATTTTCAGTGGCTCCATTTTAAATCAGTCTGCTGCCTCAGAATCCCGTACGCCTGAAGGTTTT
[0025] AAGTTGCATGTGCACCTGAAACTCGTATATGAGTATTTTCTGTCTGTGCTTTTAGAGAGGAGGAATTCTGTAACGACTTTTGTTTCGGGTTAGG
[0026] AAGAGAATGATCTCTTTCAGTGCACCGCCACTTATGTTACCTTTTTCCTTTTATTTCTTTGTGTTTCCAGTTGCAAGAACAGCAAGGAAAAGGA
[0027] AGCCCTCTCCAGAACCAGAAGGTGAAGTCGGGCCCCCTAAGATCAACGGAGAGGCCCAGCCGTGGCTGTCCACATCCACAGAGGGGCTCAAGAT
[0028] CCCCATGACTCCTACATCCTCTTTTGTGTCTCCGCCACCACCCACTGCCTCACCTCATTCCAACCGGACCACACCGCCTGAAGCGGCCCAGAAT
[0029] GGCCAGTCCCCCATGGCAGCCCTGATCTTAGTAGCAGACAATGCAGGGGGCAGTCATGCCTCAAAAGATGCCAACCAGGTTCACTCCACTACCA
[0030] GGAGGAATAGCAACAGTCCGCCCTCTCCGTCCTCTATGAACCAAAGAAGGCTGGGCCCCAGAGAGGTGGGGGGCCAGGGAGCAGGCAACACAGG
[0031] AGGACTGGAGCCAGTGCACCCTGCCAGCCTCCCGGACTCCTCTCTGGCAACCAGTGCCCCGCTGTGCTGCACCCTCTGCCACGAGCGGCTGGAG
[0032] GACACCCATTTTGTGCAGTGCCCGTCCGTCCCTTCGCACAAGTTCTGCTTCCCTTGCTCCAGACAAAGCATCAAACAGCAGGGAGCTAGTGGAG
[0033] AGGTCTATTGTCCCAGTGGGGAAAAATGCCCTCTTGTGGGCTCCAATGTCCCCTGGGCCTTTATGCAAGGGGAAATTGCAACCATCCTTGCTGG
[0034] AGATGTGAAAGTGAAAAAAGAGAGAGACTCGTGACTTTTCCGGTTTCAGAAAAACCCAATGATTACCCTTAATTAAAACTGCTTGAATTGTATA
[0035] TATATCTCCATATATATATATATCCAAGACAAGGGAAATGTAGACTTCATAAACATGGCTGTATAATTTTGATTTTTTTTGAATACATTGTGTT
[0036] TCTATATTTTTTTTGACGACAAAAGGTATGTACTTATAAAGACATTTTTTTCTTTTGTTAACGTTATTAGCATATCTTTGTGCTTTATTATCCT
[0037] GGTGACAGTTACCGTTCTATGTAGGCTGTGACTTGCGCTGCTTTTTTAGAGCACTTGGCAAATCAGAAATGCTTCTAGCTGTATTTGTATGCAC
[0038] TTATTTTAAAAAGAAAAAAAAAGCCAAATACATTTTCTGACATTGTAAGATTGCCTTACTGTCTGTCATTCCTTATTGCTGGCCCCTTTCTCAG
[0039] GCCGGAGGCCAAGTGGTGGAGAAGGAAAGGAAATGATCGAACGGGCATGTTGTCAAGTGGGCATGCCACTGGGAAATACCACCAGTTTACCCTG
[0040] AAACATTGTCCTCAGAGGAGTAGGAAAGTGGATTTTGAATCTCTATTTTGCTCAAAAGTTCAGTTCCTGAGATACTGATGACTGAGAGTGCTGC
[0041] TGGGAAATTTTCAGGATTGTGTGGTCTTTTGGGGTTTTTTGTTTTTTTTTTTTTAAGACAAAGTTGACCGCTGTTCACTGTCCACGTGATCAGT
[0042] TGTAAGATTACAATGCTGCATGCTAGTTGGTTACATAAGATACAATTCCAGTGATGGAAGGCGGTTATAATGGATGGTGGTGTGTACAAGATGG
[0043] CACTGCCATCTTTGAGCAGAGCCCAGCTCTGCAGCGCCACTTCATCTTTTTAAACACCCTAGAGGTCTGTTTGTTGTTGCTGTTGTCCTTTATT
[0044] TTGAAAGAGTTGCAAGAGAAGTTACAGTCCAGGTGAACTTGGAGATTGTGGGATTGGTTTTGTTTCTGTTTTGTTTTGTTTATCATTTACCTGT
[0045] AGTGCTATTGCTGTTGATACTATCACCTATACCCTGTTTCTAGTGAGTGCTGAATACAGTATGGTACAATGACAGTAACAGCCGCGTGGTGCTG
[0046] CCAGGACTGCCCTTGGGCATATCAGTGACAGCCCAAATGTGGGTGGAGGAAACCTGTAATTTCCTTCTTAACATGTGTTTGAAATACCAAGTGA
[0047] ATAATACTGTTCTGGAAAAAAATGATAAACTAGTGGAAATTAAAGAAATTAAGGGTTTTATATAATAGACAGGCCCCACCTCTCAAAATATTTT
[0048] TAGAAGTCTTTTTGTAAACTAATTTCTTTTGATCACTATTTTGCATCAGTAAAATGATTTTTTTAAAACCAATAAATCATCAATTATTAGAAAT
[0049] AGTTGTCTCACAGTGATACTGGTTTTTCTTTTGTGCTGTTATGATTTAACATTGACAGGAACACTATTTTAAATCCTTACGTTCAGGTGTTTGT
[0050] AACTTGGCCTTATAATTAGGCTGAATTATGGCTTCAAGGTCTACAATTTATGTGTATGGTTCACAGCCTAGCTTCTATTTACATTTGAAAATAC
[0051] AGATTTTTACCAACTTTGGATTCTTTTTTAGTTATATGTTTGTCTTTCCTTTTTAAATTGTTCAAAACTATTTTTTAATGGTCAAGTTACTAAC
[0052] ACTTGAAAATCAGATACTGCACCAAATACAGTGTTTTTCCGTAGTGTTTTTAATGAGTGCACCTATTACTACTGTGCGAGAATTCATGTTTTAC
[0053] CAGTCATTGTTATATTACAAACAGACTTGCATGATTAACCAGTTGTTACACTTACTTTTTCAAGTTGGAGTATATATGACTCAGTGCAGACTGG
[0054] TCTCTCTTATGTGAATGCACACATGCAGAAATGCAGAGTCAATTTTACATGCCCATAAAGACATTTGTAAAGAATTCAGCTCTTATGGTCTGTT
[0055] GTATAAATGTGTATCTAGGCACTTTGGAATTTGACCTCACAGATGTTACAACTTGATCAGTCGTTTGACCTAATTTGTGGTAGCTATCTGTATG TTTTGCAATCTTAATACAGACATGCTTTCCAAAAAGATTAATACAGAACCATCCTGCCGTTTTGGATAAGTCTATCCAGCTGTGGAAAGGGCAA CCTGTGGTTTCTCTGTACTGGTGTTTAATGGGGGAAGAATATGAACAGCTTTAAAGAGCTGTGTATTGTGGTTACTACTATTAAAAAATAAGAT CTGCACGAGTCTGACTGGCCTTTGGGTGGCCTTTGTGGACGGCTCGTAGCTGGAAAGTGTTGATCTGGGTTTTCTGGCATTCTTTTAAGTTAAA AAGTTAACATCGGGACATGGGTTTGATCTTTTGTTGTACCTGATGACAGTGCAGAGATTCTCCACAGCTGGATAAAAATGTCACAAAGCTACTT ACTGTACATGGGCAGTATCAGATTTCAAATCCTAATATTTCAGCTGTGCTTTTAATACTCAAAATATTAGGGGATGGGGTGTTGAAGCTTTCCC TTTTTTGCTTTTAACAATTTATAGAATTTAACAGATGTACTGTCTTTCATGTGGCCTCACATTTAAAGTTATGAGAACATACACATGGTTTACA ACTTTTACTATATACCTTTCCTTGGCCACCAAGTATTTTAAAAGTGTGCCACCTTTTAACCTTTACTTTTTTTAAGTTGAAGGTGATACTTTTT CTATATATGATGAAACTCATGTCAACTGAAGTGAGTGTAATCTCAGATACCAACATTATTATATTTTAAAATCACGCTATGGAAATATCACCTG AATTCTGTCATTTGTCAGATTTACAGTACCTTTTTTTCTTTAACTTTTAGCATTAAATAAAAATAAAATTGGGAGCACTGAA
[0056] In a further advantageous embodiment of the method according to the invention, it finally comprises a recommendation regarding an anti-IL-1 p therapy of the patient. This results from the determined detections, in particular their positive or negative result, but can also include further patient data.
[0057] In a further advantageous embodiment of the method according to the invention, the sample obtained from the patient is a biopsy and / or a sample of bodily fluid (liquid biopsy), preferably blood, blood serum, blood plasma or cerebrospinal fluid (CSF). The at least one sample obtained is subjected to procedures to enable either an analysis of the DNA with respect to a mutation in the IRF2BP2 gene and / or an immunohistochemical analysis with respect to a lack of IRF2BP2 protein expression. The DNA analysed may be either cellular or cell-free tumour DNA, which is isolated and purified according to standard protocols.
[0058] In a further advantageous embodiment of the method according to the invention, if a mutation in the IRF2BP2 gene and / or a lack of IRF2BP2 protein expression is positively detected, an anti-IL-1 p therapy of the patient is initiated. Positive detection indicates that the patient is one of the 15% of patients with DLBCL carrying a mutation in the IRF2BP2 gene and thus, is highly probable to respond positively to anti-IL-1 therapy, which significantly increases the success of the overall therapy with regard to DLBCL. The initiation of therapy can be listed as a further possible step (step (vi)) of the method according to the invention. In a particularly advantageous embodiment of the method according to the invention, the anti-IL-1 p therapy of the patient is carried out using at least one IL-1 antagonist. Such an IL-1 p antagonist inhibits the effect of the cytokine IL-1 p, which leads to a reduction in growth in DLBCL cells and thus, also to a reduction in tumour tissue.
[0059] The I L-1 p antagonist is particularly preferably an enzyme, a receptor, a protein and / or an antibody, in particular canakinumab. The IL-1 p antagonists can be of natural or synthetic origin, as well as of human origin or another species. Particularly preferred as I L-1 p antagonists are antibodies, especially canakinumab, which is commercially available and authorised as an active ingredient.
[0060] The method according to the invention can also be used in combination with conventional anti-IL-1 p therapies, for example, the method according to the invention is conceivable together with the administration of other active substances.
[0061] The invention also relates to the use of a detection of a mutation in the IRF2BP2 gene and / or a lack of IRF2BP2 protein expression in a patient’s DLBCL cells with diffuse large B-cell lymphoma (DLBCL) for predicting a response of the patient to anti-IL-1 p therapy.
[0062] Such use is appropriate, for example, after the diagnosis of DLBCL and / or as part of the initial therapy of a patient with DLBCL. The detection obtained can provide further information about the tumour disease and thus, facilitate the selection of a therapy and increase its success.
[0063] In an advantageous embodiment of the use according to the invention, a positive detection of a mutation in the IRF2BP2 gene and / or a lack of IRF2BP2 protein expression indicates a positive response of the patient to an anti-IL-1 p therapy. Positive detection means that the patient is one of the 15% of patients with DLBCL carrying a mutation in the IRF2BP2 gene. A positive response to anti-IL-1 p therapy significantly increases the success of the overall therapy with regard to DLBCL.
[0064] Finally, the invention also relates to a PCR kit for detecting a mutation in the IRF2BP2 gene of the DLBCL cells from a patient with diffuse large B-cell lymphoma (DLBCL) to predict a patient response to an anti-IL-1 p therapy. In addition to the components of conventional PCR kits, this includes suitable primers, at least one corresponding primer pair, for amplification of the IRF2BP2 gene. Such a PCR kit offers the possibility of an initial targeted analysis of the DNA with regard to the IRF2BP2 gene and can thus quickly provide information about a possible mutation without having to carry out a complete sequencing. A further investigation, in particular a method as proposed according to the invention, could usefully follow the analysis using the PCR kit, depending on the result.
[0065] The method proposed according to the invention and the corresponding use as well as the PCR kit offer the great advantage of identifying the 15% of patients with DLBCL carrying a mutation in the IRF2BP2 gene and for whom an anti-IL-1 therapy is a sensible option. In this way, such a therapy can be used specifically for this group of patients, who have a high probability of responding to the therapy.
[0066] The method is less invasive, especially as numerous samples of bodily fluids and tissues are taken from patients with cancer anyway and are available for analysis. It can also be carried out quickly, so that a decision can be made on the further treatment of the patient. Another advantage is the clear result of the detection according to the invention, which is either positive or negative and therefore does not require any complicated interpretation but provides a clear recommendation for further action.
[0067] The following examples, Figures and claims further illustrate the invention.
[0068] EXAMPLES
[0069] Knock-out of IRF2BP2 in DLBCL cell lines leads to increased proliferation
[0070] HBL-1 and RI-1 are two established cell lines of diffuse large B-cell lymphoma (DLBCL). Both cell lines represent the ABC subtype of DLBCL, which is enriched with mutations in IRF2BP2 (Schmitz et al., 2018). Neither HBL-1 nor RI-1 show genetic alterations in IRF2BP2. CRISPR / Cas9-mediated knock-out (‘KO’) variants of both cell lines were generated using two independent sgRNA sequences. For this purpose, the RI-1 and HBL-1 cell lines were electroporated with ribonucleoprotein complexes containing Cas9, tracrRNA and either sgRNA sequences against IRF2BP2 (gRNA1 and gRNA2) or non- targeting sgRNA (NT gRNA). Efficient IRF2BP2 knockout by both sgRNAs was validated by immunoblotting (fig.1 A).
[0071] To determine possible growth differences between the IRF2BP2-KO variants and a nontargeted sgRNA control (‘NT gRNA’), cells were plated at a density of 100,000 / ml and cell viability was measured on the third day after seeding using the CellTiterGlo assay. For both RI-1 and HBL-1 consistently higher luminescence signals were observed in the IRF2BP2-KO lines compared to the NT control, corresponding to increased cell numbers (fig.1 B). The points shown in the diagram represent independent experiments. The values of the individual experiments were normalised to the NT control of the respective cell line and the statistics were calculated using Student's t-test: *, p < 0.05; **, p < 0.01 ; ***, p< 0.001.
[0072] In order to investigate whether these increased cell numbers are due to increased cell proliferation, an EdU test was carried out. EdU is a nucleotide analogue that is incorporated into DNA and can be measured by flow cytometry. Increased EdU incorporation during the exposure period indicates an increased percentage of cells synthesising DNA during this period. EdU incorporation was measured by flow cytometry after an EdU pulse of 1 hour and a consistently higher percentage of EdU-positive cells was observed in the IRF2BP2-KO variant compared to NT controls (fig.1 C). The points shown in the diagram represent independent experiments. The values of the individual experiments were normalised to the NT control of the respective cell line and the statistics were calculated using Student's t-test: *, p < 0.05; **, p < 0.01 ; ***, p< 0.001.
[0073] In summary, it was found that CRISPR / Cas9-mediated knockout of IRF2BP2 leads to increased proliferation in both DLBCL cell lines investigated.
[0074] Knock-out of IRF2BP2 leads to increased IL-10 secretion
[0075] It has already been reported that artificially induced loss of IRF2BP2 leads to increased expression of IL-1 p in an acute myeloid leukaemia (AML) cell line (Ellegast et al., 2022). In this context, IL-1 -mediated activation of NFKB led to cell death. To investigate whether the loss of IRF2BP2 also leads to increased IL-1 levels in DLBCL, IL-1 p levels were determined in the supernatant of IRF2BP2-KO and WT-HBL-1 and RI-1 cells. For this purpose, the IL-1 p level in the supernatant of the indicated cell lines was measured by ELISA 24 hours after plating. I L-1 p concentrations were consistently higher in the IRF2BP2-deficient setting (fig.2A). The points shown in all graphs in fig.2 represent independent experiments. The values of the individual experiments were normalised to the NT control of the respective cell line and the statistics were calculated using Student's t-test: *, p < 0.05; **, p < 0.01 ; ***, p< 0.001.
[0076] Consistent with active I L-1 p / IL-1 R1 signalling, the increased IL-1 levels in the IRF2BP2- KO cell lines were accompanied by increased levels of NFKB, a downstream effector of the IL-1 p receptor, IL-1 R1. Increased NFKB activation was observed both by immunoblotting for the activating phosphorylation Ser536 at the NFKB subunit p65 (fig.2 B) and by using an NFKB reporter assay (fig.2C). For this purpose, the level of phosphorylated p65 was analysed by immunoblotting and the band intensities were quantified with Imaged. The NFKB reporter assay works by electroporation of a plasmid encoding an NFKB promoter-regulated luciferase gene (firefly luciferase). Increased NFKB transcriptional activity therefore leads to increased firefly luciferase expression. The firefly signal is measured relative to the signal of a second luciferase (Renilla, constitutively expressed), also encoded on the plasmid, as a surrogate for NFKB transcriptional activity. The luciferase produces a luminescence that can be measured. This luminescence, when analysed 48 h after electroporation, was significantly higher in IRF2BP2-KO cells of both cell lines compared to NT controls (fig.2C). Overall, IRF2BP2 knockout increased the amount of secreted IL-1 p that activates NFKB signalling in an autocrine / paracrine manner, which likely drives the increased proliferation observed in the IRF2BP2 knockout cell lines compared to controls.
[0077] An antagonising anti-IL-ip antibody reduces NFKB activation and proliferation in IRF2BP2-KO cell lines
[0078] To validate IL-1 p as a mediator of the increased proliferation observed in IRF2BP2 knockout cells, both IRF2BP2-KO and NT cell lines were treated with an anti-IL-1 p antibody (InvivoGen, mabg-hil1 b-3). For this purpose, the cell lines used were plated at a density of 100,000 / ml and treated with anti- IL-1 p antibody (alL-1 B, 10 pg / ml) or left untreated. Viability was measured after three days using CellTiterGlo (fig.3A). An NFKB reporter assay was used to measure NFKB transcriptional activity in the cell lines used after three days of treatment with al L-1 B (fig ,3B). Blockade of extracellular IL-1 p led to a reduction in proliferation and NFKB activation specifically in the IRF2BP2-KO setting, while NT controls were unaffected by the presence of the antibody (fig.3A, B). The data points shown in all graphs of fig.3 represent independent experiments. The values of each experiment were normalised to the corresponding NT control of each experiment and the statistics were calculated using Student's t-test: *, p < 0.05; **, p < 0.01 ; ***, p< 0.001.
[0079] Since no human DLBCL cell lines with endogenous IRF2BP2 mutations are available, several stable cell lines from primary DLBCL-like mouse tumours of DLBCL mouse models with the genotype Prdm1fl / fl; Myd88condpL252P / wt; R26LSLBCL2 / wt;Cd19Cre / wt(abbr. ‘PPMBC’) and Prdm1fl / fl; Myd88condpL252P / wt; Cd79bcondpY195H / wt;
[0080] R26LSLBCL2 / wt;Cd19Cre / wt(abbr. 79-PPMBC’) (Flumann, Hansen, Meinel, et al, 2023;
[0081] Flumann, Hansen, Pelzer, et al., 2023) were generated. This was followed by three days of treatment with an antibody against murine IL-1 p before cell viability was measured using Cel ITiterGlo. Three independent murine lymphoma cell lines with spontaneous IRF2BP2 mutations were sensitive to anti-IL-1 treatment (InvivoGen, mil1 b-mab9-02) (fig.SC), while one cell line with IRF2BP2 wild-type status was unaffected by the presence of the antibody (fig.3D). Importantly, sensitivity to IL-1 p blockade could be generated in this cell line by introducing a knockout of IRF2BP2 using CRISPR / Cas9 (fig.3D).
[0082] This demonstrates that the increased NFKB activity and proliferation observed as a result of IRF2BP2 knockout is mediated by IL-1 p and suggests anti-IL-1 p therapy as a potential treatment strategy in this genetic constellation.
[0083] Treatment with canakinumab reduces tumour growth in vivo
[0084] To investigate whether I L-1 p blockade by the commercial anti-IL-1 p antibody canakinumab is an effective treatment in vivo, immunodeficient NSG mice were subcutaneously injected with IRF2BP2-KO and IRF2BP2-WT variants of both HBL-1 and RI-1 (5x106cells in Matrigel). Animals were treated once weekly with intravenous canakinumab ("al L-1 B") at a dose of 10 mg / kg in PBS or vehicle control after the median tumour volume per group had reached -150 mm3A significant reduction in tumour growth was observed with canakinumab treatment only in the IRF2BP2-deficient xenografts, while no effect was observed in the NT control grafts (fig.4A, B). Tumour measurements were performed at the indicated time points and tumour volume was estimated using the formula 0.5*width*length2. Wilcoxon rank-sum test; *, p < 0.05; **, p< 0.01.
[0085] Cell lines with endogenous mutations in IRF2BP2 show sensitivity towards anti-IL- 1 p treatment
[0086] To investigate whether cell lines with endogenous mutations in IRF2BP2 show sensitivity towards IL-1 p blockade and no / RF2BP2-mutated human cell lines are available, we referred to stable cell lines isolated from murine DLBCL-like models, which frequently harbour spontaneous mutations in IRF2BP2 (Flumann, Hansen, Meinel, et al. 2024, Flumann, Hansen, Pelzer, et al., 2023). Three IRF2BP2mutcell lines showed a reduction in viability (readout 3 days post treatment by Cel ITiterGlo assay) upon treatment with an anti-IL-1 antibody (fig.5A). Of note, a fourth cell line with IRF2BP2 wi I dtype status did not respond to treatment (fig.5B), however sensitivity towards IL-1 blockade could be induced by CRISPR / Cas9-mediated knockout of IRF2BP2 (fig.5B). We verified the sensitivity of a cell line with a spontaneous IRF2BP2 mutation in a subcutaenous allograft transplantation system, while an IRF2BP2wttransplant did not respond (fig.5C). Summarized, it was found that the presence of IRF2BP2 deficiency confers a sensitivity towards I L-1 blockade also when the deficiency is the result of somatic mutations. Tumour measurements were performed at the indicated time points and tumour volume was estimated using the formula 0.5*width*length2. Fig.5A, B: Student’s t-test. Fig.5C: Wilcoxon rank-sum test; *, p < 0.05; **, p< 0.01.
[0087] References
[0088] Pastor, T.P., et al. (2021)
[0089] Ellegast, J.M. et al. (2022)
[0090] Arranz, et al. (2017)
[0091] Flumann, Hansen, Meinel, et al., 2024
[0092] Flumann, Hansen, Pelzer, et al., 2023
Claims
CLAIMS1 . A method for predicting a response of a patient with diffuse large B-cell lymphoma (DLBCL) to anti-IL-1 p therapy, comprising the detection of a mutation in the IRF2BP2 gene and / or a lack of IRF2BP2 protein expression in the patient's DLBCL cells in a sample obtained from the patient.
2. The method according to claim 1 , wherein the detection is carried out by means of sequencing and mutation analysis, and / or immunohistochemical analysis.
3. The method according to claim 1 or 2, wherein the method further comprises a treatment recommendation regarding administering anti-IL-1 therapy to the patient.
4. The method according to any of claims 1 to 3, wherein the sample from the patient is a biopsy and / or a sample of bodily fluid.
5. The method according to any of claims 1 to 4, wherein the sample from the patient is blood, blood serum, blood plasma or cerebrospinal fluid (CSF).
6. The method according to any of claims 1 to 5, wherein, if a mutation in the IRF2BP2 gene and / or a lack of IRF2BP2 protein expression is positively detected, the method further comprises treating the patient with an anti-IL-1 p therapy.
7. The method according to claim 6, wherein the anti-IL-1 p therapy is carried out by at least one I L-1 p antagonist.
8. The method according to claim 7, wherein the IL-1 p antagonist is an enzyme, a receptor, a protein, and / or an antibody.
9. The method according to claim 8, wherein the IL-1 p antagonist is an antibody, preferably the antibody canakinumab.
10. A use of a method of predicting a response of a patient with diffuse large B-cell lymphoma (DLBCL) to an anti-IL-1 therapy, the method comprising detecting a mutation in the IRF2BP2 gene and / or detecting a lack of IRF2BP2 protein expression in the patient's DLBCL cells.
11. The use according to claim 10, wherein the detection of a mutation in the IRF2BP2 gene and / or detection of a lack of IRF2BP2 protein expression indicates a positive response of the patient to anti-IL-1 p therapy.
12. A polymerase chain reaction (PCR) kit for detecting a mutation in the IRF2BP2 gene in diffuse large B-cell lymphoma (DLBCL) cells from a patient with DLBCL, wherein the kit comprises: at least one corresponding primer pair for the amplification of the IRF2BP2 gene, or at least a portion of the IRF2BP2 gene known to comprise one or more mutations; a suitable DNA polymerase for amplifying the IRF2BP2 gene, or at least a portion of the IRF2BP2 gene known to comprise one or more mutations; and suitable buffers for performing PCR analysis.
13. A use of the PCR kit according to claim 12 to predict the patient’s response to anti- IL-1 p therapy.
Citation Information
Patent Citations
Use of il-1beta binding antibodies
US20220025036A1
Panels and methods for treatment of diffuse large b-cell lymphoma
US20240117440A1
AU2018287519A1