Method for producing nucleic acid oligomer

Abstract

The present invention provides a method for efficiently producing a nucleic acid oligomer, particularly a method for efficiently oxidizing a nucleic acid precursor that has a phosphite triester bond. Specifically, the present invention provides a method which is for producing, via the phosphoramidite method, a nucleic acid compound that has, at the 5' terminal, a nucleotide represented by formula (I) and in which a nucleic acid that has at least one phosphorothioate bond is produced, said method comprising a step for reacting: a precursor that has, at the 5' terminal, a phosphite triester bond represented by formula (II); an aromatic hydrocarbon or an aromatic heterocyclic compound that has a conjugate acid pKa of less than 5; and an oxidizing solution that contains iodine, pyridine, and water. [The substituents in formulas (I) and (II) are as defined in the description.]

Description

Method for producing nucleic acid oligomers

[0001] This patent application claims priority under the Paris Convention to and the benefit of Japanese Patent Application No. 2024-084646 (filed May 24, 2024), the entire contents of which are incorporated herein by reference. The present invention relates to a method for producing a nucleic acid oligomer, and more specifically to an oxidizing solution used in oxidizing a phosphite ester produced by a coupling reaction using a phosphoramidite in the synthesis of a nucleic acid oligomer.

[0002] In recent years, there has been growing interest in the application of nucleic acid oligomers in the medical field, including antisense nucleic acids, aptamers, ribozymes, and nucleic acids that induce RNA interference (RNAi), such as siRNA, which are called nucleic acid drugs.

[0003] Nucleic acid oligomers can be produced, for example, using the phosphoramidite method (hereinafter also referred to as the "amidite method"), in which nucleoside phosphoramidites (hereinafter also referred to as "amidites") are used as raw materials. In the amidite method, nucleic acid oligomers synthesized by extending nucleic acids through coupling, oxidation, and deprotection steps are then subjected to removal of the protecting groups to produce the desired nucleic acid oligomers. The purity of the nucleic acid oligomers synthesized in this manner is not always satisfactory, and the synthesis is inefficient (Non-Patent Document 1). It is known that side reactions other than the desired oxidation reaction occur in the step of oxidizing the phosphite ester produced by the coupling reaction using phosphoramidites. For example, it is known that nucleic acids having phosphorothioate bonds (PS bonds) in their molecules can undergo conversion of the phosphorothioate bonds to PO bonds as a side reaction during the oxidation reaction. It is known that the occurrence of such side reactions in the oxidation reaction results in a decrease in the yield and purity of the desired nucleic acid oligomer. In particular, when synthesizing long-chain nucleic acid oligomers using the phosphoramidite method, repeated oxidation reactions are required during the synthesis process, resulting in a greater impact from side reactions. A method for reducing side reactions in oxidation reactions is known in which oxidation is performed in the presence of a base (specifically, N-methylimidazole, for example) whose conjugate acid has a pKa of greater than 5.25 (Patent Document 1). Patent Document 2 also discloses that side reactions can be reduced by using an oxidation solution containing potassium iodide and iodine (i.e., an (iodine) oxidation solution containing potassium iodide as an additive). However, these methods have not been effective enough.

[0004] International Publication No. 2009 / 007736 U.S. Patent No. 5,783,684

[0005] Tetrahedron 2013, 69, 3615-3637

[0006] An object of the present invention is to provide an efficient method for producing a nucleic acid oligomer, in particular, a method for efficiently oxidizing a nucleic acid precursor having a phosphite triester bond.

[0007] As a result of extensive research to achieve the above object, the present inventors have found that, in the synthesis of a nucleic acid oligomer, the oxidation reaction proceeds efficiently when a phosphite ester formed by a coupling reaction using a phosphoramidite is oxidized using an oxidizing solution containing an aromatic hydrocarbon or aromatic heterocyclic compound whose conjugate acid has a pKa of less than 5, iodine, water, and pyridine.As a result, the present inventors have found that ...

[0008] The present invention includes, but is not limited to, the following embodiments: [1] Formula (I): (In the formula, G 1 and G 2 are each independently the same or different and represent a protecting group for a hydroxyl group, B a represents a nucleic acid base which may be protected with a protecting group, R represents a protected hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group, Q' represents a methylene group bonded to the 4' carbon atom of ribose, an ethylene group bonded to the 4' carbon atom of ribose, or an ethylidene group bonded to the 4' carbon atom of ribose, and the bond marked with * represents a bond to the 3' end of the nucleic acid. (In the formula, G 1 , G 2 , B a , R and * are as defined above.) A method for producing a nucleic acid having at least one phosphorothioate bond, comprising a step of reacting a precursor having a phosphite triester bond represented by the formula (A), an aromatic hydrocarbon or aromatic heterocyclic compound having a conjugate acid pKa of less than 5, and an oxidizing solution containing iodine, pyridine and water. [2] A method for producing a nucleic acid having at least one phosphorothioate bond, comprising reacting a precursor having a phosphite triester bond represented by the formula (A), [In the formula, Y 1 , Y 2 , Y 3 , Y 4 , Y 5 , and Y6 are each independently the same or different and represent a hydrogen atom, a C1-C6 chain hydrocarbon group optionally having one or more substituents selected from Group A, a C3-C8 alicyclic hydrocarbon group, a tri(C1-C6 alkyl)silyl group, a halogen atom, a hydroxyl group, a C1-C6 alkoxy group (the C1-C6 alkoxy group optionally having one or more halogen atoms), C(O)R 11 , sulfanyl group, C1-C6 alkylsulfanyl group, phenylsulfanyl group, amino group, C1-C6 alkylamino group, C2-C6 dialkylamino group, cyano group, nitro group, phenyl group, 1,2-epoxyethyl group, (C1-C6 alkyl)carbonyloxy group, (C1-C6 alkyl)carbonylamino group, diphenylphosphinyl group, diphenylphosphinthioyl group, or pyridyl group. 1 and Y 2and optionally form a ring together with the carbon atoms to which they are bonded, and the ring represents a C3-C8 alicyclic hydrocarbon, a 3- to 8-membered heterocyclyl, succinimide, N-hydroxysuccinimide, or benzene, and the ring may be substituted with one or more halogen atoms.] 2) a 6-membered aromatic heterocyclic compound optionally having one or more substituents selected from Group B {the 6-membered aromatic heterocyclic compound contains only one or more nitrogen atoms as heteroatoms constituting the ring. Two adjacent carbon atoms constituting the 6-membered aromatic heterocyclic compound may form another ring containing those two carbon atoms as ring-constituting atoms, and the ring represents a C3-C8 alicyclic hydrocarbon or a 3- to 8-membered non-aromatic heterocycle, and the ring may be substituted with one or more halogen atoms.}, or 3) a 5-membered aromatic heterocyclic compound optionally having one or more substituents selected from group C {the 5-membered aromatic heterocyclic compound contains, as heteroatoms constituting the ring, one or more heteroatoms selected from the group consisting of a nitrogen atom, an oxygen atom, and a sulfur atom. Two adjacent atoms among the carbon atoms or nitrogen atoms constituting the 5-membered aromatic heterocyclic compound may form another ring containing them as ring-constituting atoms, and the ring represents a C3-C8 alicyclic hydrocarbon, benzene, or a 3- to 8-membered heterocyclyl, and the ring may be substituted with one or more halogen atoms. Group A: a group consisting of a halogen atom, a hydroxyl group, a cyano group, a nitro group, a C1-C6 alkoxy group optionally substituted with one or more halogen atoms, a carboxy group, a tri(C1-C6 alkyl)silyl group, a C3-C8 alicyclic hydrocarbon group, a phenyl group, and a 3- to 8-membered heterocyclyl group; Group B: a C1-C6 open chain hydrocarbon group optionally having one or more substituents selected from Group A, a C3-C8 alicyclic hydrocarbon group, a tri(C1-C6 alkyl)silyl group, a halogen atom, a hydroxyl group, an alkoxy group {the alkoxy group may have one or more halogen atoms}, C(O)R 11, a sulfanyl group, a C1-C6 alkylsulfanyl group, a phenylsulfanyl group, an amino group, a C1-C6 alkylamino group, a C2-C6 dialkylamino group, a cyano group, a nitro group, a phenyl group, a 1,2-epoxyethyl group, a (C1-C6 alkyl)carbonyloxy group, a (C1-C6 alkyl)carbonylamino group, and a pyridyl group; Group C: a C1-C6 chain hydrocarbon group optionally having one or more substituents selected from Group A, a C3-C8 alicyclic hydrocarbon group, a tri(C1-C6 alkyl)silyl group, a halogen atom, a hydroxyl group, an alkoxy group {the alkoxy group optionally has one or more halogen atoms}, C(O)R 11 the group consisting of a sulfanyl group, a C1-C6 alkylsulfanyl group, a phenylsulfanyl group, an amino group, a C1-C6 alkylamino group, a C2-C6 dialkylamino group, a cyano group, a nitro group, a phenyl group, a 1,2-epoxyethyl group, a (C1-C6 alkyl)carbonyloxy group, a (C1-C6 alkyl)carbonylamino group, and a pyridyl group; R 11 represents a C1-C6 alkyl group, a C1-C6 alkoxy group, a hydroxyl group, or NR 12 R 13 represents R 12 and R 13 are the same or different and each independently represent a C1-C6 alkyl group optionally substituted with one or more halogen atoms or a hydrogen atom. [3] The method according to [2], wherein the aromatic hydrocarbon or aromatic heterocyclic compound having a conjugate acid pKa of less than 5 is a compound represented by formula (A). [4] The method according to [2], wherein the aromatic hydrocarbon or aromatic heterocyclic compound having a conjugate acid pKa of less than 5 is a compound represented by formula (A), and Y 1 , Y 2 , Y 3 , Y 4 , Y 5 , and Y 6are each independently the same or different and are a hydrogen atom, a methyl group, an ethyl group, a propyl group, an isopropyl group, a butyl group, a sec-butyl group, a tert-butyl group, a cyclopentyl group, a cyclohexyl group, a vinyl group, a propenyl group, an isopropenyl group, a hydroxymethyl group, a hydroxyethyl group, a hydroxypropenyl group, a cyanomethyl group, a methoxymethyl group, a hydroxyl group, a methoxy group, an ethoxy group, a sulfanyl group, a methylsulfanyl group, a carboxy group, an amido group, an amino group, a methylamino group, an ethylamino group, a dimethylamino group, a diethylamino group, a cyano group, a phenylsulfanyl group, a nitro group, a phenyl group, a benzyl group, an acetyl group, an acetoxy group, a trifluoromethyl group, a trifluoromethoxy group, a diphenylphosphinyl group, a diphenylphosphinthioyl group, or a halogen atom; and Y 1 and Y 2 and Y may form a ring together with the carbon atoms to which they are bonded, the ring being optionally substituted with one or more halogen atoms, and the ring being cyclopentane, cyclohexane, cyclopentene, cyclohexene, succinimide, N-hydroxysuccinimide, dihydropyran, pyridine, pyridazine, pyrimidine, pyrazine, triazine, pyrrole, furan, thiophene, pyrazole, oxazole, isoxazole, thiazole, isothiazole, or benzene. [5] The aromatic hydrocarbon or aromatic heterocyclic compound having a pKa of less than 5 is a compound represented by formula (A), 1 , Y 2 , Y 3 , Y 4 , Y 5 , and Y 6 are each independently the same or different and are a hydrogen atom, a methyl group, an ethyl group, a propyl group, an isopropyl group, a butyl group, a sec-butyl group, a tert-butyl group, a vinyl group, a propenyl group, an isopropenyl group, a hydroxypropenyl group, a hydroxyl group, a methoxy group, a phenylsulfanyl group, a carboxy group, or a chlorine atom; and Y 1 and Y 2and optionally form a ring together with the carbon atoms to which they are bonded, and the ring is cyclopentene, N-hydroxysuccinimide, or benzene. [6] The production method according to [2], wherein the aromatic hydrocarbon or aromatic heterocyclic compound having a conjugate acid pKa of less than 5 is a 6-membered aromatic heterocyclic compound optionally having one or more substituents selected from Group B {the 6-membered aromatic heterocyclic compound contains only one or more nitrogen atoms as heteroatoms constituting the ring, and two adjacent carbon atoms constituting the 6-membered aromatic heterocyclic compound may form another ring containing those two carbon atoms as ring-constituting atoms, and the ring represents a C3-C8 alicyclic hydrocarbon or a 3- to 8-membered non-aromatic heterocycle, and the ring may be substituted with one or more halogen atoms.} [7] The aromatic hydrocarbon or aromatic heterocyclic compound having a conjugate acid pKa of less than 5 is pyridine, pyridazine, pyrimidine, pyrazine, or triazine {the pyridine, the pyridazine, the pyrimidine, the pyrazine, and the triazine are selected from the group B 1 The method according to [6], wherein two adjacent carbon atoms constituting the pyridine, the pyridazine, the pyrimidine, the pyrazine, and the triazine may form another ring containing those two carbon atoms as ring-constituting atoms, and the ring represents cyclopentane, cyclohexane, cyclopentene, cyclohexene, or dihydropyran, and the ring may be substituted with one or more halogen atoms. 1[8] The group consisting of a methyl group, an ethyl group, a propyl group, an isopropyl group, a butyl group, a sec-butyl group, a tert-butyl group, a cyclopentyl group, a cyclohexyl group, a vinyl group, a propenyl group, an isopropenyl group, a hydroxymethyl group, a hydroxyethyl group, a hydroxypropenyl group, a cyanomethyl group, a methoxymethyl group, a hydroxyl group, a methoxy group, an ethoxy group, a sulfanyl group, a methylsulfanyl group, a carboxy group, an amido group, an amino group, a dimethylamino group, a diethylamino group, a cyano group, a phenylsulfanyl group, a nitro group, a phenyl group, a benzyl group, an acetyl group, an acetoxy group, a trifluoromethyl group, a trifluoromethoxy group, and a halogen atom. [9] The group consisting of a methyl group, an ethyl ... 2 Two adjacent carbon atoms constituting the pyridine, the pyridazine, the pyrimidine, the pyrazine, and the triazine may form another ring containing them as ring-constituting atoms, and the ring represents cyclopentene, and the ring may be substituted with one or more halogen atoms. 2the group consisting of a methyl group, an ethyl group, a propyl group, an isopropyl group, a butyl group, a sec-butyl group, a tert-butyl group, a vinyl group, a propenyl group, an isopropenyl group, a hydroxypropenyl group, a hydroxyl group, a methoxy group, a phenylsulfanyl group, a carboxy group, and a chlorine atom. [9] The production method according to [2], wherein the aromatic hydrocarbon or aromatic heterocyclic compound having a pKa of less than 5 is a 5-membered aromatic heterocyclic compound optionally having one or more substituents selected from Group C {the 5-membered aromatic heterocyclic compound contains, as heteroatoms constituting the ring, one or more heteroatoms selected from the group consisting of a nitrogen atom, an oxygen atom, and a sulfur atom. Two adjacent carbon atoms or nitrogen atoms constituting the 5-membered aromatic heterocyclic compound may form another ring containing them as ring-constituting atoms, and the ring represents a C3-C8 alicyclic hydrocarbon or a 3- to 8-membered heterocyclyl, and the ring may be substituted with one or more halogen atoms.}

[10] The aromatic hydrocarbon or aromatic heterocyclic compound having a conjugate acid pKa of less than 5 is selected from the group consisting of pyrrole, furan, thiophene, pyrazole, 1,2,3-triazole, 1,2,4-triazole, tetrazole, oxazole, isoxazole, thiazole, isothiazole, 1,2,5-oxadiazole, 1,2,3-oxadiazole, and 1,3,4-thiadiazole {the pyrrole, the furan, the thiophene, the pyrazole, the 1,2,3-triazole, the 1,2,4-triazole, the tetrazole, the oxazole, the isoxazole, the thiazole, the isothiazole, the 1,2,5-oxadiazole, the 1,2,3-oxadiazole, and the 1,3,4-thiadiazole are selected from the group consisting of group C 1Two adjacent carbon atoms or nitrogen atoms constituting the pyrrole, the furan, the thiophene, the pyrazole, the 1,2,3-triazole, the 1,2,4-triazole, the tetrazole, the oxazole, the isoxazole, the thiazole, the isothiazole, the 1,2,5-oxadiazole, the 1,2,3-oxadiazole, and the 1,3,4-thiadiazole may form another ring containing them as ring-constituting atoms, and the ring represents cyclopentane, cyclohexane, cyclopentene, cyclohexene, dihydropyran, or benzene, and the ring may be substituted with one or more halogen atoms. 1

[11] The group consisting of a methyl group, an ethyl group, a propyl group, an isopropyl group, a butyl group, a sec-butyl group, a tert-butyl group, a vinyl group, a propenyl group, an isopropenyl group, a hydroxypropenyl group, a hydroxy group, a methoxy group, a phenylsulfanyl group, a carboxy group, and a chlorine atom.

[12] The group consisting of a methyl group, an ethyl group, a propyl group, an isopropyl group, a butyl group, a sec-butyl group, a tert-butyl group, a vinyl group, a propenyl group, an isopropenyl group, a hydroxypropenyl group, a hydroxy group, a methoxy group, a phenylsulfanyl group, a carboxy group, and a chlorine atom.

[13] The group consisting of a methyl group, an ethyl group, a propyl group, an isopropyl group, a butyl group, a sec-butyl group, a tert-butyl group, a vinyl group, a propenyl group, an isopropenyl group, a hydroxypropenyl group, a hydroxy group, a methoxy group, a phenylsulfanyl group, a carboxy group, and a chlorine atom.

[14] The group consisting of a methyl group, an ethyl group, a propyl group, a butyl group, a tert-butyl group, a vinyl group, a propenyl group, an isopropenyl group, a hydroxypropenyl group, a hydroxy group, a methoxy group, a phenylsulfanyl group, a carboxy group, and a chlorine atom.

[15] The group consisting of a methyl group, an ethyl group, a propyl group, a butyl group, a tert-butyl group, a vinyl group, a propenyl group, a hydroxypropenyl group, a hydroxy group, a methoxy group, a phenylsulfanyl group, a carboxy group, and a chlorine atom. 2 The pyrrole, the furan, the thiophene, the pyrazole, the oxazole, the isoxazole, the thiazole, and the isothiazole may have one or more substituents selected from the following. Two adjacent carbon atoms or nitrogen atoms constituting the pyrrole, the furan, the thiophene, the pyrazole, the oxazole, the isoxazole, the thiazole, and the isothiazole may form another ring containing them as ring-constituting atoms, and the ring represents cyclopentene or benzene. 2The group consisting of a methyl group, an ethyl group, a propyl group, an isopropyl group, a butyl group, a sec-butyl group, a tert-butyl group, a cyclopentyl group, a cyclohexyl group, a vinyl group, a propenyl group, an isopropenyl group, a hydroxymethyl group, a hydroxyethyl group, a hydroxypropenyl group, a cyanomethyl group, a methoxymethyl group, a hydroxy group, a methoxy group, an ethoxy group, a thiol group, a methylthio group, a carboxy group, an amido group, an amino group, a dimethylamino group, a diethylamino group, a cyano group, a phenylsulfanyl group, a nitro group, a phenyl group, a benzyl group, an acetyl group, an acetoxy group, a trifluoromethyl group, a trifluoromethoxy group, and a halogen atom.

[12] The method according to [1], wherein the aromatic hydrocarbon or aromatic heterocyclic compound having a conjugate acid with a pKa of less than 5 is toluene, cinnamyl alcohol, phenol, 2,4-dimethylphenol, 3-methoxyphenol, ethyl salicylate, 4,6-di-tert-butyl-m-cresol, 4-sec-butyl-2,6-di-tert-butylphenol, 2-tert-butyl-4,6-dimethylphenol, anisole, benzoic acid, phenyl sulfide, chlorobenzene, indene, naphthalene, benzo[b]thiophene, N-hydroxyphthalimide, quinoline, 2,3-benzofuran, indole, pyrrole, thiophene, thiazole, triphenylphosphine oxide, triphenylphosphine sulfide, 2-methylfuran, 5-methylisoxazole, ethyl 4-oxazolecarboxylate, or 2-methoxy-3-methylpyrazine.

[13] The method according to [1], wherein the aromatic hydrocarbon or aromatic heterocyclic compound having a conjugate acid with a pKa of less than 5 is selected from the group P 5 The method according to [1], wherein the compound is a phenol optionally substituted with one or more substituents selected from the group consisting of: 5: a group consisting of a methyl group, a butyl group, and a methoxy group.

[14] The production method according to any one of [1] to

[13] , wherein the content of the aromatic hydrocarbon or aromatic heterocyclic compound, the conjugate acid of which has a pKa of less than 5, in the oxidation solution is 0.02 wt % to 30 wt %.

[15] The production method according to any one of [1] to

[13] , wherein the content of the aromatic hydrocarbon or aromatic heterocyclic compound, the conjugate acid of which has a pKa of less than 5, in the oxidation solution is 0.1 wt % to 20 wt %.

[16] The production method according to any one of [1] to

[13] , wherein the content of the aromatic hydrocarbon or aromatic heterocyclic compound, the conjugate acid of which has a pKa of less than 5, in the oxidation solution is 0.1 wt % to 5 wt %.

[17] The production method according to any one of [1] to

[13] , wherein the concentration of iodine in the oxidation solution is 1 mM to 500 mM.

[18] The production method according to any one of [1] to

[13] , wherein the concentration of iodine in the oxidation solution is 20 mM to 200 mM.

[19] An oxidation solution for nucleic acid synthesis, comprising an aromatic hydrocarbon or aromatic heterocyclic compound having a conjugate acid pKa of less than 5, iodine, pyridine, and water.

[20] The aromatic hydrocarbon or aromatic heterocyclic compound having a conjugate acid pKa of less than 5 is represented by: 1) a compound represented by formula (A): [In the formula, Y 1 , Y 2 , Y 3 , Y 4 , Y 5 , and Y 6 are each independently the same or different and represent a hydrogen atom, a C1-C6 chain hydrocarbon group optionally having one or more substituents selected from Group A, a C3-C8 alicyclic hydrocarbon group, a tri(C1-C6 alkyl)silyl group, a halogen atom, a hydroxyl group, a C1-C6 alkoxy group (the C1-C6 alkoxy group optionally having one or more halogen atoms), C(O)R 11 , sulfanyl group, C1-C6 alkylsulfanyl group, amino group, C1-C6 alkylamino group, C2-C6 dialkylamino group, cyano group, nitro group, phenyl group, 1,2-epoxyethyl group, (C1-C6 alkyl)carbonyloxy group, (C1-C6 alkyl)carbonylamino group, diphenylphosphinyl group, diphenylphosphinthioyl group, or pyridyl group. 1 and Y 2and optionally form a ring together with the carbon atoms to which they are bonded, and the ring represents a C3-C8 alicyclic hydrocarbon, a 3- to 8-membered heterocyclyl, succinimide, N-hydroxysuccinimide, or benzene, and the ring may be substituted with one or more halogen atoms.] 2) a 6-membered aromatic heterocyclic compound optionally having one or more substituents selected from Group B {the 6-membered aromatic heterocyclic compound contains only one or more nitrogen atoms as heteroatoms constituting the ring. Two adjacent carbon atoms constituting the 6-membered aromatic heterocyclic compound may form another ring containing those two carbon atoms as ring-constituting atoms, and the ring represents a C3-C8 alicyclic hydrocarbon or a 3- to 8-membered non-aromatic heterocycle, and the ring may be substituted with one or more halogen atoms.}, or 3) a 5-membered aromatic heterocyclic compound optionally having one or more substituents selected from group C {the 5-membered aromatic heterocyclic compound contains, as heteroatoms constituting the ring, one or more heteroatoms selected from the group consisting of a nitrogen atom, an oxygen atom, and a sulfur atom. Two adjacent carbon atoms or nitrogen atoms constituting the 5-membered aromatic heterocyclic compound may form another ring containing them as ring-constituting atoms, and the ring represents a C3-C8 alicyclic hydrocarbon or a 3- to 8-membered heterocyclyl, and the ring may be substituted with one or more halogen atoms. Group A: a group consisting of a halogen atom, a hydroxyl group, a cyano group, a nitro group, a C1-C6 alkoxy group optionally substituted with one or more halogen atoms, a carboxy group, a tri(C1-C6 alkyl)silyl group, a C3-C8 alicyclic hydrocarbon group, a phenyl group, and a 3- to 8-membered heterocyclyl group; Group B: a C1-C6 open chain hydrocarbon group optionally having one or more substituents selected from Group A, a C3-C8 alicyclic hydrocarbon group, a tri(C1-C6 alkyl)silyl group, a halogen atom, a hydroxyl group, an alkoxy group {the alkoxy group optionally has one or more halogen atoms}, C(O)R 11, a sulfanyl group, a C1-C6 alkylsulfanyl group, an amino group, a C1-C6 alkylamino group, a C2-C6 dialkylamino group, a cyano group, a nitro group, a phenyl group, a 1,2-epoxyethyl group, a (C1-C6 alkyl)carbonyloxy group, a (C1-C6 alkyl)carbonylamino group, and a pyridyl group; Group C: a C1-C6 chain hydrocarbon group optionally having one or more substituents selected from Group A, a C3-C8 alicyclic hydrocarbon group, a tri(C1-C6 alkyl)silyl group, a halogen atom, a hydroxyl group, an alkoxy group {the alkoxy group optionally has one or more halogen atoms}, C(O)R 11 the group consisting of a sulfanyl group, a C1-C6 alkylsulfanyl group, an amino group, a C1-C6 alkylamino group, a C2-C6 dialkylamino group, a cyano group, a nitro group, a phenyl group, a 1,2-epoxyethyl group, a (C1-C6 alkyl)carbonyloxy group, a (C1-C6 alkyl)carbonylamino group, and a pyridyl group; R 11 represents a C1-C6 alkyl group, a C1-C6 alkoxy group, a hydroxyl group, or NR 12 R 13 represents R 12 and R 13 are the same or different and each independently represent a C1-C6 alkyl group optionally substituted with one or more halogen atoms or a hydrogen atom.

[21] A compound according to the present invention, wherein a precursor having a phosphite triester bond represented by formula (II) at the 5'-end is prepared by reacting a compound represented by formula (4): (In the formula, G 1 represents a protecting group for a hydroxyl group, 2 are each independently the same or different and represent a hydroxyl-protecting group; aare each independently the same or different and represent a nucleobase which may be protected with a protecting group; R are each independently the same or different and represent a protected hydroxyl group, hydrogen atom, fluorine atom, methoxy group, 2-methoxyethyl group, or OQ' group; Q' are each independently the same or different and represent a methylene group bonded to the 4' carbon atom of ribose, an ethylene group bonded to the 4' carbon atom of ribose, or an ethylidene group bonded to the 4' carbon atom of ribose; Y are each independently the same or different and represent an oxygen atom or a sulfur atom; n represents an integer of 1 to 300; X represents OZ, W represents an OV group, and V represents a protecting group for a hydroxyl group, or X represents an R group, and W represents a group represented by OZ; and Z is a group having a structure consisting of a solid phase support and a linking group. When n is an integer of 2 or more, the nucleic acid compound represented by formula (4) may have a non-nucleotide linker incorporated in place of at least one nucleotide between the 5'-terminal and 3'-terminal nucleotides. (In the formula, G 1 , G 2 , B a , R, n, W, X, and Y are as defined above, and a non-nucleotide linker may be incorporated in place of a nucleotide as defined in formula (4).

[22] The method according to [1], wherein the nucleic acid is a nucleic acid represented by formula (5'): (In the formula, G 2 , B a , R, X and W are as defined for formula (5), 5 represents a protecting group for a hydroxyl group or a hydrogen atom, m is an integer satisfying m≧n, and Y's are each independently the same or different and represent an oxygen atom or a sulfur atom, provided that at least one Y is an oxygen atom; (In the formula, G 5 , R and m are as defined above; B c are each independently the same or different and represent a nucleic acid base; 4 represents a hydrogen atom, an alkali metal ion, an ammonium ion, an alkylammonium ion, or a hydroxyalkylammonium ion; each Y is independently the same or different and represents an oxygen atom or a sulfur atom, and at least one Y is an oxygen atom; X represents a hydroxyl group and W represents an OV group, where V represents a protecting group for a hydroxyl group, or X represents an R group and W represents a hydroxyl group. (In the formula, m, Y, G 4 and B c are as defined above, each R' is independently the same or different and represents a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group, each Q' is independently the same or different and represents a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position of ribose, or an ethylidene group bonded to the carbon atom at the 4' position of ribose, and X 10 and W 10 each independently represents a hydroxyl group, or X 10 represents an R' group, and W 10 represents a hydroxyl group.)

[23] The method of any one of [1] to

[18] or

[21] to

[22] , wherein the nucleic acid is a ribonucleoside (RNA).

[24] The method of any one of [1] to

[18] or

[21] to

[22] , wherein the nucleic acid is a ribonucleoside (RNA), and the 2'-protecting group is represented by formula (12): (wherein q represents an integer of 0 to 5; R a and R b are each independently the same or different and represent a methyl group, an ethyl group, or a hydrogen atom, the bond marked with an * is attached to the oxygen atom of the hydroxyl group at the 2' position of ribose, and EW represents an electron-withdrawing group.)

[25] The method for producing a compound according to any one of [1] to

[18] or

[21] to

[22] , wherein q is a protecting group represented by the formula: a and R b are independently the same or different and are a methyl group or a hydrogen atom; E w is a cyano group.

[26] The method according to any one of [1] to

[18] or

[21] to

[22] , wherein, when the nucleic acid is a ribonucleoside (RNA) and R is a protected hydroxyl group, the protecting group is a protecting group selected from the group consisting of a 2'-tert-butyldimethylsilyl (TBDMS) group, a 2'-bis(2-acetoxyethoxy)methyl (ACE) group, a 2'-(triisopropylsilyloxy)methyl (TOM) group, a 2'-(2-cyanoethoxy)ethyl (CEE) group, a 2'-(2-cyanoethoxy)methyl (CEM) group, and a 2'-para-tolylsulfonylethoxymethyl (TEM) group.

[27] The method according to any one of [1] to

[18] or

[21] to

[26] , wherein the nucleic acid is a ribonucleoside (RNA) having a chain length of 40 or more.

[0009] The present invention provides an efficient method for producing nucleic acid oligomers, and in particular, a method for efficiently oxidizing nucleic acid precursors having a phosphite triester bond.

[0010] 1 is a diagram showing a scheme of steps (1) to (6) of the production method of the present invention.

[0011] As a mode for carrying out the present invention, an embodiment will be shown and described, but the present invention is not limited to the following embodiment.

[0012] Substituents will now be described. A halogen atom refers to a fluorine atom, chlorine atom, bromine atom, or iodine atom. When a substituent is substituted with two or more halogen atoms or substituents, those halogen atoms or substituents may be the same or different. In this specification, the notation "CX-CY" means that the number of carbon atoms is X to Y. For example, the notation "C1-C6" means that the number of carbon atoms is 1 to 6. A chain hydrocarbon group refers to an alkyl group, an alkenyl group, or an alkynyl group. Examples of alkyl groups include a methyl group, an ethyl group, a propyl group, an isopropyl group, a 1,1-dimethylpropyl group, a 1,2-dimethylpropyl group, a 1-ethylpropyl group, a butyl group, a sec-butyl group, an isobutyl group, a tert-butyl group, a pentyl group, and a hexyl group. Examples of alkenyl groups include vinyl, 1-propenyl, 2-propenyl, 1-methyl-1-propenyl, 1-methyl-2-propenyl, 1,2-dimethyl-1-propenyl, 1-ethyl-2-propenyl, 3-butenyl, 4-pentenyl, and 5-hexenyl. Examples of alkynyl groups include ethynyl, 1-propynyl, 2-propynyl, 1-methyl-2-propynyl, 1,1-dimethyl-2-propynyl, 1-ethyl-2-propynyl, 2-butynyl, 4-pentynyl, and 5-hexynyl. Alicyclic hydrocarbon groups include cycloalkyl groups, cycloalkenyl groups, and the like. Examples of cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and cycloheptyl. Examples of cycloalkenyl groups include cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclohexenyl, and cycloheptenyl groups. Examples of alkoxy groups include methoxy, ethoxy, propoxy, isopropoxy, butoxy, tert-butoxy, pentyloxy, hexyloxy, and octyloxy groups.Examples of alkylsulfanyl groups include methylsulfinyl, ethylsulfinyl, propylsulfinyl, isopropylsulfinyl, butylsulfinyl, tert-butylsulfinyl, pentylsulfinyl, hexylsulfinyl, and octylsulfinyl groups. Examples of alkylamino groups include methylamino, ethylamino, propylamino, isopropylamino, butylamino, sec-butylamino, isobutylamino, tert-butylamino, pentylamino, and hexylamino groups. Examples of dialkylamino groups include dimethylamino, diethylamino, dipropylamino, and diisopropylamino groups. Examples of trialkylsilyl groups include trimethylsilyl, triethylsilyl, tripropylsilyl, and triisopropylsilyl groups. Examples of alkylcarbonyloxy groups include acetoxy, ethylcarbonyloxy, propylcarbonyloxy, and isopropylcarbonyloxy groups. Examples of alkylcarbonylamino groups include methylcarbonylamino groups, ethylcarbonylamino groups, propylcarbonylamino groups, and isopropylcarbonylamino groups. Alicyclic hydrocarbons refer to non-aromatic carbon rings, and include cycloalkanes and cycloalkenes. Examples of cycloalkanes include cyclopropane, cyclobutane, cyclopentane, cyclohexane, cycloheptane, and cyclooctane. Examples of cycloalkenes include cyclopropene, cyclobutene, cyclopentene, cyclohexene, cycloheptene, and cyclooctene. Heterocyclyl refers to a ring having one or more heteroatoms as ring-constituting atoms, and includes aromatic and non-aromatic heterocycles.Examples of heterocyclyls include pyrrole, furan, thiophene, pyrazole, imidazole, triazole, tetrazole, oxazole, isoxazole, thiazole, isothiazole, oxadiazole, thiadiazole, pyridine, pyridazine, pyrimidinine, pyrazine, triazine, tetrazine, pyrrolidine, imidazole, imidazolidine, piperidine, tetrahydropyrimidine, hexahydropyrimidine, piperazine, oxazolidine, isoxazolidine, 1,3-oxazine, morpholine, thiazolidine, isothiazolidine, 1,3-thiazine, and thiomorpholine. Examples of non-aromatic heterocycles include pyrrolidine, imidazolidine, piperidine, tetrahydropyrimidine, hexahydropyrimidine, piperazine, oxazolidine, isoxazolidine, 1,3-oxazine, morpholine, thiazolidine, isothiazolidine, 1,3-thiazine, and thiomorpholine.

[0013] The aromatic hydrocarbon or aromatic heterocyclic compound used in the present invention, whose conjugate acid has a pKa of less than 5, may exist as one or more isomers. Examples of isomers include enantiomers, diastereomers, geometric isomers, and tautomers. The aromatic hydrocarbon or aromatic heterocyclic compound used in the present invention, whose conjugate acid has a pKa of less than 5, is intended to encompass all such isomers that may exist, as well as their racemates and optically pure forms. In other words, the aromatic hydrocarbon or aromatic heterocyclic compound used in the present invention, whose conjugate acid has a pKa of less than 5, includes each isomer and a mixture of isomers in any ratio.

[0014] Tautomers can be characterized by the migration of a hydrogen atom or a proton accompanied by the inversion of a single bond and an adjacent double bond, and include, for example, keto-enol tautomers. When tautomers exist, the aromatic hydrocarbon or aromatic heterocyclic compound having a conjugate acid pKa of less than 5 used in the present invention includes pure forms and mixtures thereof.

[0015] In this specification, unless otherwise specified, the pKa value used is the pKa value in water at 25°C (i.e., the pKa value of an aqueous solution at 25°C). The pKa value of an aqueous solution at 25°C is known from many publications. For example, the "Organic Chemistry Data" website (URL: https: / / organicchemistrydata.org / hansreich / resources / pka / ) by the Division of Organic Chemistry of the American Chemical Society can be referenced. More specifically, the values ​​disclosed in the "pKa Values ​​in Water Compilation (by R. Williams)" and "pKa Values ​​Compilation (by Dave Evans and D.H. Ripin)" published on the website can be used. The pKa value can be determined by conventional methods, for example, by the method described in Journal of the Chemical Society 1964, 3591-3596 or Journal of the American Chemical Society 2002, 124, 8575-8583.

[0016] Examples of pKa values ​​of the conjugate acids of the aromatic hydrocarbons or aromatic heterocyclic compounds used in the present invention are shown below. The numbers in parentheses indicate the pKa values ​​of the conjugate acids of the compounds: benzene (-24.3), pyridazine (2.10), pyrimidine (1.10), pyrazine (0.37), naphthalene (-20.4), pyrrole (-0.27), indole (-2.40), 5-methylisoxazole (-2.03), ethyl 4-oxazolecarboxylate (0.98), quinoline (4.85), and 2-methoxy-3-methylpyrazine (1.22).

[0017] The pKa of the conjugate acid of the aromatic hydrocarbon or aromatic heterocyclic compound used in the present invention is less than 5, less than 5, 4.9 or less, 4.8 or less, 4.7 or less, 4.6 or less, 4.5 or less, 4.4 or less, 4.3 or less, 4.2 or less, 4.1 or less, 4.0 or less, 4 or less, 3.9 or less, 3.8 or less, 3.7 or less, 3.6 or less, 3.5 or less, 3.4 or less, 3.3 or less, 3.2 or less, 3.1 or less, 3.0 or less, 3 or less, 2.9 or less, 2.8 or less, 2.7 or less, 2.6 or less, 2.5 or less, 2.4 or less, 2.3 or less, 2.2 or less, 2.1 or less, 2.0 or less, 2 or less, 1.5 or less, 1 or less, 0.5 or less, 0 or less; -30 or more, -25 or more, -24 or more, -23 or more, -22 or more, -2 Examples include 1 or more, -20 or more, -19 or more, -18 or more, -17 or more, -16 or more, -15 or more, -14 or more, -13 or more, -12 or more, -11 or more, -10 or more, -9 or more, -8 or more, -7 or more, -6 or more, -5 or more, -4 or more, -3 or more, -2 or more, -1 or more, 0 or more, 1 or more, 2 or more, 3 or more, and 4 or more. Examples include above 5 but less than 5, -25 to 4.5, -25 to 4, -25 to 3, -25 to 2, -25 to 1, -25 to 0, -20 or more but less than 5, -20 to 4, -20 to 3, -20 to 2, -20 to 1, -20 to 0, -15 to 4, -15 to 3, -15 to 2, -15 to 1, -15 to 0, -10 to 4, -10 to 3, -10 to 2, -10 to 1, and -10 to 0.

[0018] Examples of aromatic hydrocarbons or aromatic heterocyclic compounds having a conjugate acid with a pKa of less than 5 include: 1) a compound represented by formula (A) (hereinafter also referred to as Compound A), 2) a 6-membered aromatic heterocyclic compound selected from Group B which may have one or more substituents {the 6-membered aromatic heterocyclic compound contains only one or more nitrogen atoms as heteroatoms constituting the ring. Two adjacent carbon atoms constituting the 6-membered aromatic heterocyclic compound may form another ring containing those two carbon atoms as ring-constituting atoms, and the ring represents a C3-C8 alicyclic hydrocarbon or a 3- to 8-membered non-aromatic heterocycle, and the ring may be substituted with one or more halogen atoms} (hereinafter also referred to as Compound B), and 3) a 5-membered aromatic heterocyclic compound selected from Group C which may have one or more substituents {the 5-membered aromatic heterocyclic compound contains one or more heteroatoms selected from the group consisting of nitrogen atoms, oxygen atoms, and sulfur atoms as heteroatoms constituting the ring. Two adjacent carbon atoms or nitrogen atoms constituting the 5-membered aromatic heterocyclic compound may form another ring containing them as ring-constituting atoms, and the ring represents a C3-C8 alicyclic hydrocarbon or a 3- to 8-membered heterocyclyl, and the ring may be substituted with one or more halogen atoms.} (hereinafter also referred to as compound C), and one having a conjugate acid with a pKa of less than 5 is used.

[0019] Examples of Compound A include the following compounds.

[0020] [Aspect A1] In compound A, Y 1 ~Y 6are each independently the same or different and are a hydrogen atom, a methyl group, an ethyl group, a propyl group, an isopropyl group, a butyl group, a sec-butyl group, a tert-butyl group, a cyclopentyl group, a cyclohexyl group, a vinyl group, a propenyl group, an isopropenyl group, a hydroxymethyl group, a hydroxyethyl group, a hydroxypropenyl group, a cyanomethyl group, a methoxymethyl group, a hydroxyl group, a methoxy group, an ethoxy group, a sulfanyl group, a methylsulfanyl group, a carboxy group, an amido group, an amino group, a methylamino group, an ethylamino group, a dimethylamino group, a diethylamino group, a cyano group, a phenylsulfanyl group, a nitro group, a phenyl group, a benzyl group, an acetyl group, an acetoxy group, a trifluoromethyl group, a trifluoromethoxy group, a diphenylphosphinyl group, a diphenylphosphinthioyl group, or a halogen atom; and Y 1 and Y 2 and Y may be taken together with the carbon atoms to which they are attached to form a ring, which may be substituted with one or more halogen atoms, and the ring is cyclopentane, cyclohexane, cyclopentene, cyclohexene, succinimide, N-hydroxysuccinimide, dihydropyran, pyridine, pyridazine, pyrimidine, pyrazine, triazine, pyrrole, furan, thiophene, pyrazole, oxazole, isoxazole, thiazole, isothiazole, or benzene. [Aspect A2] Compound A, wherein Y 1 ~Y 6 are each independently the same or different and are a hydrogen atom, a methyl group, an ethyl group, a propyl group, an isopropyl group, a butyl group, a sec-butyl group, a tert-butyl group, a vinyl group, a propenyl group, an isopropenyl group, a hydroxypropenyl group, a hydroxyl group, a methoxy group, a phenylsulfanyl group, a carboxy group, or a chlorine atom; and Y 1 and Y 2 and may form a ring together with the carbon atom to which they are attached, and the ring is cyclopentene, N-hydroxysuccinimide or benzene. [Aspect A3] Compounds of Group P 1 Phenol optionally substituted with one or more substituents selected from Group P 1C1-C6 chain hydrocarbon group optionally substituted with one or more halogen atoms, C1-C6 alkoxy group optionally substituted with one or more halogen atoms, and C(O)OR 21 The group consisting of: R 21 represents a C1-C6 alkoxy group. [Aspect A4] Group P 2 Phenol optionally substituted with one or more substituents selected from Group P 2 : C1-C6 chain hydrocarbon group, C1-C6 alkoxy group, and C(O)OR 21 A group consisting of: [Aspect A5] Group P 3 Phenol optionally substituted with one or more substituents selected from Group P 3 : the group consisting of C1-C6 alkyl groups and C1-C6 alkoxy groups. [Aspect A6] Group P 4 Phenol optionally substituted with one or more substituents selected from Group P 4 Group P: A group consisting of C1-C4 alkyl groups and C1-C4 alkoxy groups. 5 Phenol optionally substituted with one or more substituents selected from Group P 5 : the group consisting of a methyl group, a butyl group, and a methoxy group. [Aspect A8] Group P 6 Phenol optionally substituted with one or more substituents selected from Group P 6 The group consisting of methyl and methoxy groups. [Aspect A9] Phenol optionally substituted with one or more methoxy groups. [Aspect A10] 3-methoxyphenol.

[0021] Examples of compound B include the following compounds.

[0022] [Aspect B1] Pyridine, pyridazine, pyrimidine, pyrazine, or triazine {the pyridine, the pyridazine, the pyrimidine, the pyrazine, and the triazine are selected from the group B １Two adjacent carbon atoms constituting the pyridine, pyridazine, pyrimidine, pyrazine, and triazine may form another ring containing those two carbon atoms as ring-constituting atoms, and the ring represents cyclopentane, cyclohexane, cyclopentene, cyclohexene, or dihydropyran, and the ring may be substituted with one or more halogen atoms.

[0023] [Aspect B2] Pyridine, pyridazine, pyrimidine, pyrazine, or triazine {the pyridine, the pyridazine, the pyrimidine, the pyrazine, and the triazine are selected from the group B 2 Two adjacent carbon atoms constituting the pyridine, pyridazine, pyrimidine, pyrazine, and triazine may form another ring containing them as ring-constituting atoms, and the ring represents cyclopentene, and the ring may be substituted with one or more halogen atoms.

[0024] Examples of compound C include the following compounds.

[0025] [Aspect C1] Pyrrole, furan, thiophene, pyrazole, 1,2,3-triazole, 1,2,4-triazole, tetrazole, oxazole, isoxazole, thiazole, isothiazole, 1,2,5-oxadiazole, 1,2,3-oxadiazole, or 1,3,4-thiadiazole {the pyrrole, the furan, the thiophene, the pyrazole, the 1,2,3-triazole, the 1,2,4-triazole, the tetrazole, the oxazole, the isoxazole, the thiazole, the isothiazole, the 1,2,5-oxadiazole, the 1,2,3-oxadiazole, and the 1,3,4-thiadiazole may have one or more substituents selected from Group C1. Two adjacent carbon atoms or nitrogen atoms constituting the pyrrole, the furan, the thiophene, the pyrazole, the 1,2,3-triazole, the 1,2,4-triazole, the tetrazole, the oxazole, the isoxazole, the thiazole, the isothiazole, the 1,2,5-oxadiazole, the 1,2,3-oxadiazole, and the 1,3,4-thiadiazole may form another ring containing them as ring-constituting atoms, and the ring represents cyclopentane, cyclohexane, cyclopentene, cyclohexene, dihydropyran, or benzene, and the ring may be substituted with one or more halogen atoms.}. [Aspect C2] Pyrrole, furan, thiophene, pyrazole, oxazole, isoxazole, thiazole, or isothiazole {The pyrrole, the furan, the thiophene, the pyrazole, the oxazole, the isoxazole, the thiazole, and the isothiazole are selected from the group C 2 Two adjacent carbon atoms or nitrogen atoms constituting the pyrrole, the furan, the thiophene, the pyrazole, the oxazole, the isoxazole, the thiazole, and the isothiazole may form another ring containing them as ring-constituting atoms, and the ring represents cyclopentene or benzene.}. [Aspect C3] Group P 11 Pyrrole optionally substituted with one or more substituents selected from the group P 11 Furan optionally substituted with one or more substituents selected from the following:11 Group P: a group consisting of C1-C6 chain hydrocarbon groups optionally substituted with one or more halogen atoms, and C1-C6 alkoxy groups optionally substituted with one or more halogen atoms. 12 Pyrrole optionally substituted with one or more substituents selected from the group P 12 Furan optionally substituted with one or more substituents selected from the following: 12 Group P: a group consisting of C1-C6 chain hydrocarbon groups and C1-C6 alkoxy groups. 13 Pyrrole optionally substituted with one or more substituents selected from the group P 13 Furan optionally substituted with one or more substituents selected from the following: 13 The group consisting of C1-C4 alkyl groups and C1-C4 alkoxy groups. [Aspect C6] Pyrrole which may be substituted with one or more C1-C4 alkyl groups, or furan which may be substituted with one or more C1-C4 alkyl groups. [Aspect C7] Group P 14 Pyrrole optionally substituted with one or more substituents selected from the group P 14 The group consisting of C1-C4 alkyl groups and C1-C4 alkoxy groups. [Aspect C8] Pyrrole optionally substituted with one or more C1-C4 alkyl groups. [Aspect C9] Pyrrole optionally substituted with one or more methyl groups. [Aspect C10] Pyrrole.

[0026] Furthermore, examples of aromatic hydrocarbons or aromatic heterocyclic compounds having a conjugate acid pKa of less than 5 include the following compounds: [Embodiment 1] Group P 1 phenols optionally substituted with one or more substituents selected from the group P 11 Pyrrole optionally substituted with one or more substituents selected from the group P 11 [Embodiment 2] Group P 2 phenols optionally substituted with one or more substituents selected from the group P 12 Pyrrole optionally substituted with one or more substituents selected from the group P 12Furan optionally substituted with one or more substituents selected from the group P 3 phenols optionally substituted with one or more substituents selected from the group P 13 Pyrrole optionally substituted with one or more substituents selected from the group P 13 [Embodiment 4] A furan optionally substituted with one or more substituents selected from the group P 4 Phenol optionally substituted with one or more substituents selected from the group consisting of pyrrole optionally substituted with one or more C1-C4 alkyl groups, and furan optionally substituted with one or more C1-C4 alkyl groups. 5 Phenol optionally substituted with one or more substituents selected from the group P 14 Pyrrole optionally substituted with one or more substituents selected from the group P 5 Phenol optionally substituted with one or more substituents selected from the group consisting of phenyl, ... 6 Phenol optionally substituted with one or more substituents selected from the above, or pyrrole optionally substituted with one or more C1-C4 alkyl groups. [Aspect 8] Phenol optionally substituted with one or more methoxy groups, or pyrrole optionally substituted with one or more methyl groups. [Aspect 9] Phenol optionally substituted with one or more methoxy groups, or pyrrole. [Aspect 10] 3-methoxyphenol or pyrrole.

[0027] More specific examples of aromatic hydrocarbons or aromatic heterocyclic compounds having a conjugate acid with a pKa of less than 5 include toluene, cinnamyl alcohol, phenol, 2,4-dimethylphenol, 3-methoxyphenol, ethyl salicylate, 4,6-di-tert-butyl-m-cresol, 4-sec-butyl-2,6-di-tert-butylphenol, 2-tert-butyl-4,6-dimethylphenol, anisole, benzoic acid, phenyl sulfide, chlorobenzene, indene, naphthalene, benzo[b]thiophene, N-hydroxyphthalimide, quinoline, 2,3-benzofuran, indole, pyrrole, thiophene, thiazole, 2-methylfuran, 5-methylisoxazole, ethyl 4-oxazolecarboxylate, 2-methoxy-3-methylpyrazine, triphenylphosphine oxide, and triphenylphosphine sulfide.

[0028] Examples of embodiments of the aromatic hydrocarbon or aromatic heterocyclic compound used in the present invention, in which the pKa of the conjugate acid is less than 5, include the following compounds: [Aspect S1] Toluene, cinnamyl alcohol, phenol, 2,4-dimethylphenol, 3-methoxyphenol, ethyl salicylate, 4,6-di-tert-butyl-m-cresol, 4-sec-butyl-2,6-di-tert-butylphenol, 2-tert-butyl-4,6-dimethylphenol, anisole, benzoic acid, phenyl sulfide, chlorobenzene, indene, naphthalene, benzo[b]thiophene, N-hydroxyphthalimide, quinoline, 2,3-benzofuran, indole, pyrrole, thiophene, thiazole, triphenylphosphine oxide, triphenylphosphine sulfide, 2-methylfuran, 5-methylisoxazole, ethyl 4-oxazolecarboxylate, or 2-methoxy-3-methylpyrazine. [Aspect S2] Toluene, cinnamyl alcohol, phenol, 2,4-dimethylphenol, 3-methoxyphenol, ethyl salicylate, 4,6-di-tert-butyl-m-cresol, 4-sec-butyl-2,6-di-tert-butylphenol, anisole, benzoic acid, phenyl sulfide, chlorobenzene, indene, naphthalene, N-hydroxyphthalimide, quinoline, 2,3-benzofuran, indole, pyrrole, thiophene, 2-methylfuran, 5-methylisoxazole, ethyl 4-oxazolecarboxylate, and 2-methoxy-3-methylpyrazine, triphenylphosphine oxide, or triphenylphosphine sulfide. [Aspect S3] 2-tert-butyl-4,6-dimethylphenol, phenol, indene, cinnamyl alcohol, 2,3-benzofuran, pyrrole, 3-methoxyphenol, 2-methylfuran, ethyl 4-oxazolecarboxylate, or ethyl salicylate. [Aspect S4] Pyrrole, phenol, cinnamyl alcohol, or 3-methoxyphenol. [Aspect S5] Pyrrole or 3-methoxyphenol.

[0029] The content of the aromatic hydrocarbon or aromatic heterocyclic compound, the conjugate acid of which has a pKa of less than 5, in the oxidizing solution containing iodine, pyridine, and water is usually 0.001 to 40 mass%, preferably 0.02 to 30 mass%, more preferably 0.1 to 20 mass%, and even more preferably 0.1 to 5 mass%.

[0030] The concentration of iodine in the oxidizing solution containing an aromatic hydrocarbon or aromatic heterocyclic compound whose conjugate acid has a pKa of less than 5, iodine, pyridine, and water is adjusted to usually 0.5 to 1000 mM, preferably 1 to 500 mM, and more preferably 20 to 200 mM.

[0031] The oxidizing solution of the present invention containing an aromatic hydrocarbon or aromatic heterocyclic compound having a conjugate acid pKa of less than 5, iodine, pyridine, and water is typically prepared from an aromatic hydrocarbon or aromatic heterocyclic compound having a conjugate acid pKa of less than 5, iodine, water, and pyridine. Such an oxidizing solution may be mixed with at least one solvent selected from the group consisting of acetonitrile and tetrahydrofuran (THF).

[0032] The solvent for the oxidation solution (including pyridine and water in the oxidation solution of the present invention) is obtained by mixing, for example, 1 to 90 parts pyridine, 1 to 50 parts water, 0 to 90 parts acetonitrile, and 0 to 90 parts tetrahydrofuran, per total volume of the solution, and preferably a mixed solvent obtained by mixing 5 to 90 parts pyridine, 2 to 30 parts water, 0 to 80 parts acetonitrile, and 0 to 80 parts tetrahydrofuran. Stirring is not essential when preparing the oxidation solution, but stirring power Pv of 0.0 to 0.5 kW / m is usually required. 3 Stirring is carried out within the range of Pv of 0.1 to 0.3 kW / m 3 It is preferable to stir the mixture.

[0033] The oxidizing solution prepared as described above can also be stored by preparing it so that the concentrations of the aromatic hydrocarbon or aromatic heterocyclic compound having a conjugate acid pKa of less than 5 and iodine are higher than those used in the oxidation reaction. When used, such a high-concentration oxidizing solution may be diluted with the solvent to adjust it to a final desired concentration.

[0034] There is no limitation on the period from preparation of the oxidizing solution to synthesis of the nucleic acid oligomer, but for example, an oxidizing solution may be used that has been aged at 25 to 60° C. for one day or more, preferably one week or more, more preferably two weeks or more, and even more preferably one month or more. The storage temperature of the oxidizing solution after preparation is not limited to the temperature range for aging, and it can be stored at 0 to 80° C.

[0035] The oxidizing solution can be stored in a glass, plastic, or metal container. Examples of plastic containers include polyethylene or polypropylene containers, and examples of metal containers include stainless steel or Hastelloy containers. The oxidizing solution can be stored in an air atmosphere or an inert gas atmosphere, and examples of inert gases that can be used include argon, nitrogen, carbon dioxide, and helium.

[0036] An example of a compound containing a phosphite triester bond is the compound of formula (4). An example of a nucleic acid compound produced by the action of an oxidizing solution is the nucleic acid compound of formula (5). In formulas (4) and (5), Q', which may be the same or different, independently represents a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position of ribose, or an ethylidene group bonded to the carbon atom at the 4' position of ribose, specifically has the structure of formula (8) below.

[0037] [In the formula, B a represents an optionally protected nucleobase.

[0038] More specifically, the group represented by Z, which is composed of a solid phase carrier and a linking group connecting the solid phase carrier and the oxygen atom of the hydroxyl group at the 2'-position or 3'-position of ribose at the 3'-end of the nucleic acid oligomer, includes a structure represented by the following formula (9): In formula (9), Sp represents a spacer. Examples of the spacer (Sp) include those having the structural formula shown in formula (10) below.

[0039]

[0040] The linker may have, for example, a structure shown in the following formula (11), or a structure in which the structure of formula (11) does not have a hexamethyleneamino group portion and an aminopropyl group is bonded to Si. Alternatively, the linker may have a structure shown in the following formula (15). [In the formula, A may be any of a hydroxyl group, an alkoxy group, or an alkyl group. Examples of alkoxy groups include a methoxy group and an ethoxy group. Examples of alkyl groups include a methyl group, an ethyl group, an isopropyl group, and an n-propyl group. Si indicates that it is bonded to the oxygen of a hydroxyl group on the surface of the support.] Examples of solid supports include inorganic porous supports and organic resin supports. Examples of inorganic porous supports include controlled pore glass (CPG) and zeolite. Examples of organic resin supports include supports made of polystyrene.

[0041] Nucleosides (ribose and deoxyribose) contained in the nucleic acid oligomer used in the present invention include, but are not limited to, DNA, RNA, 2'-O-MOE (2'-O-methoxyethyl), 2'-O-Me, 2'-F, and the above-mentioned LNA.

[0042] A method for synthesizing a nucleic acid oligomer by solid-phase synthesis, which includes the oxidation step using an oxidizing solution, typically includes the following steps: (1) a step of deprotecting the 5'-hydroxyl group of a hydroxyl-protected nucleoside bound to a solid-phase support via a linker, (2) a step of coupling the 5'-hydroxyl group generated in the above step with a phosphoramidite to obtain a phosphite triester compound, (3) a step of reacting the phosphite triester generated in the above step with an oxidizing solution to convert it into a phosphate triester to produce an extended nucleic acid molecule, or an optional step of reacting it with a thiolating agent to convert it into a thiophosphate triester, (4) a step of synthesizing a nucleic acid molecule on a solid-phase support by repeating a series of reaction cycles consisting of the steps (1) to (3), i.e., the step of deprotecting the 5'-hydroxyl group of the generated nucleic acid molecule, the step of coupling the 5'-hydroxyl group with a phosphoramidite, and the step of oxidizing the generated phosphite triester, any number of times; (5) a step of subjecting the nucleic acid molecule on the solid support produced in step (4) to a step of excising and deprotecting it to release it from the solid support, thereby producing a nucleic acid oligomer from which the protecting groups have been removed, and (6) a step of deprotecting the protecting group of the hydroxyl group at the 2'-position or the 3'-position of the 3'-end of the ribose constituting the nucleic acid oligomer. However, the method for synthesizing a nucleic acid oligomer may include, following step (2) or (3), a step of capping the hydroxyl group at the 5'-position that has not undergone the coupling reaction with the phosphoramidite compound, and a capping step may be added between any of the steps in the series of reaction cycles constituting step (4).

[0043] More specifically, step (5) is carried out by subjecting the nucleic acid molecule on the solid support produced in step (4) to the following reactions in steps (5-1) and (5-2), in this order. The reaction in step (5-1) may be carried out arbitrarily, and the reaction in step (5-2) may be carried out using the method described in Japanese Patent No. 4705716. As a result, a nucleic acid oligomer in which a protecting group has been removed from the nucleic acid molecule released from the solid support, or a nucleic acid oligomer in which the hydroxyl group at the 5'-end is protected, can be produced. (5-1) A reaction to deprotect the protecting group of the hydroxyl group at the 5'-end of the nucleic acid molecule, and (5-2) A reaction to cleave and release the nucleic acid molecule from the solid support.

[0044] More specifically, the step (6) is carried out by subjecting the nucleic acid oligomer obtained in step (5), which has been released from the solid phase support and from which the protecting groups have been removed, to the deprotection reaction in the following step (6): (6) A reaction for deprotecting the protecting group of the hydroxyl group at the 2'-position or the 3'-position of the 3'-end of the ribose constituting the nucleic acid molecule.

[0045] The scheme of steps (1) to (6) is shown in Figure 1. The synthesis of nucleic acid compounds by the amidite method in steps (1) to (5) can be carried out by repeating the deprotection step, coupling step, and other steps according to a generally known method (e.g., the method described in Japanese Patent No. 5,157,168 or Japanese Patent No. 5,554,881), except for the oxidation step related to the present invention in step (3) or (4) in the scheme of Figure 1, to perform a nucleic acid extension reaction. Each step will be explained below. The oxidation reaction in step (3) or (4) shown in Figure 1 is carried out using the oxidizing solution described above. The definitions of the substituents in the chemical formula in Scheme A are as defined above.

[0046] The nucleic acid compound of formula (5) can be further extended to any desired chain length using a nucleotide or non-nucleotide linker by the amidite method and used to produce the nucleic acid compound of formula (5'). The nucleic acid compound alone can be excised from the nucleic acid compound of formula (5') bound to a solid support to obtain the nucleic acid oligomer of formula (6), which can then be further deprotected to obtain the nucleic acid oligomer of formula (7). The substituents in each formula are described in more detail below.

[0047] As used herein, the term "nucleobase" refers to a group having a natural or non-natural nucleobase backbone, and also encompasses modified forms of the natural or non-natural nucleobase backbone.

[0048] B a and a nucleobase optionally protected by a protecting group represented by c The nucleic acid base represented by the formula (I) is not particularly limited. Examples of the nucleic acid base include adenine, cytosine, guanine, uracil, thymine, 5-methylcytosine, pseudouracil, and 1-methylpseudouracil. The nucleic acid base may also be substituted with a substituent. Examples of such substituents include halogen atoms such as fluoro, chloro, bromo, and iodo groups, acyl groups such as acetyl groups, alkyl groups such as methyl and ethyl groups, arylalkyl groups such as benzyl groups, alkoxy groups such as methoxy groups, alkoxyalkyl groups such as methoxyethyl groups, cyanoalkyl groups such as cyanoethyl groups, hydroxy groups, hydroxyalkyl groups, acyloxymethyl groups, amino groups, monoalkylamino groups, dialkylamino groups, carboxy groups, cyano groups, and nitro groups, as well as combinations of two or more of these substituents.

[0049] When a nucleic acid base has an amino group at the exocyclic position, the protecting group for the amino group is not particularly limited, and any protecting group known in nucleic acid chemistry can be used. Examples of such protecting groups include benzoyl, 4-methoxybenzoyl, acetyl, propionyl, butyryl, isobutyryl, phenylacetyl, phenoxyacetyl, 4-tert-butylphenoxyacetyl, 4-isopropylphenoxyacetyl, and (dimethylamino)methylene, as well as combinations of two or more of these protecting groups.

[0050] B a More specifically,

[0051] [wherein R 4 represents a hydrogen atom, a methyl group, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group, or a benzoyl group; R 5 represents a hydrogen atom, an acetyl group, an isobutyryl group, or a benzoyl group; R 6 represents a hydrogen atom, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group, or an isobutyryl group; R 7 represents a 2-cyanoethyl group, R 8 represents a hydrogen atom, a methyl group, a benzoyl group, a 4-methoxybenzoyl group, or a 4-methylbenzoyl group, and R 9 represents a dimethylaminomethylene group.]

[0052] B c More specifically, examples of the group include groups obtained by removing the protecting group from the above formula.

[0053] G 1 There are no particular limitations on the protecting group, so long as it can function as a protecting group, and a wide range of known protecting groups used in amidite compounds can be used.

[0054] G 1 is preferably the following group: [In the formula, R 1 , R 2 and R 3 are each independently the same or different and represent a hydrogen atom or an alkoxy group.

[0055] R 1 , R 2 and R 3 Preferably, one of the groups is a hydrogen atom and the remaining two are the same or different (preferably the same) alkoxy groups, and a methoxy group is particularly preferred as the alkoxy group.

[0056] G 2 There are no particular limitations on the protecting group G as long as it can function as a protecting group, and a wide range of known protecting groups used in amidite compounds can be used. 2 Examples of the alkyl group include an alkyl group, an alkenyl group, an alkynyl group, a cycloalkyl group, a haloalkyl group, an aryl group, a heteroaryl group, an arylalkyl group, a cycloalkenyl group, a cycloalkylalkyl group, a cyclylalkyl group, a hydroxyalkyl group, an aminoalkyl group, an alkoxyalkyl group, a heterocyclylalkenyl group, a heterocyclylalkyl group, a heteroarylalkyl group, a silyl group, a silyloxyalkyl group, a mono-, di-, or trialkylsilyl group, and a mono-, di-, or trialkylsilyloxyalkyl group, which may be substituted with one or more electron-withdrawing groups.

[0057] G 2 is preferably an alkyl group substituted with an electron-withdrawing group. Examples of the electron-withdrawing group include a cyano group, a nitro group, an alkylsulfonyl group, a halogen atom, an arylsulfonyl group, a trihalomethyl group, and a trialkylamino group, and is preferably a cyano group.

[0058] G 2 Particularly preferred as the alkyl group is a 2-cyanoethyl group (a group represented by the following formula).

[0059] G 3 is two G 3 may be bonded to each other to form a cyclic structure. 3Preferably, both of the groups are isopropyl groups.

[0060] The R 1 , R 2 , R 3 and G 2 The alkyl group in the definition may be either linear or branched, and is preferably an alkyl group having 1 to 12 carbon atoms, more preferably an alkyl group having 1 to 6 carbon atoms. Specific examples of the alkyl group include a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, a tert-butyl group, an n-pentyl group, an isopentyl group, and a hexyl group. The alkyl group moiety constituting the alkoxy group in the definition of the substituent has the same definition as the alkyl group herein.

[0061] In the method of the present invention, the phosphoramidite can be used in a free state or in a salt state. Phosphoramidite salts include, but are not limited to, base addition salts and acid addition salts. Specific examples of base addition salts include salts with inorganic bases such as sodium salts, magnesium salts, potassium salts, calcium salts, and aluminum salts; salts with organic bases such as methylamine, ethylamine, and ethanolamine; salts with basic amino acids such as lysine, ornithine, and arginine; and ammonium salts. Specific examples of acid addition salts include salts with mineral acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, nitric acid, and phosphoric acid; organic acids such as formic acid, acetic acid, propionic acid, oxalic acid, malonic acid, malic acid, tartaric acid, fumaric acid, succinic acid, lactic acid, maleic acid, citric acid, methanesulfonic acid, trifluoromethanesulfonic acid, and ethanesulfonic acid; and acidic amino acids such as aspartic acid and glutamic acid. The phosphoramidites also include salts, hydrates, solvates, crystalline polymorphs, and other forms.

[0062] When R represents a protected hydroxyl group, the protecting group of the hydroxyl group represented by V may be any that can be used in the amidite method, for example, 2'-tert-butyldimethylsilyl (TBDMS) group, 2'-bis(2-acetoxyethoxy)methyl (ACE) group, 2'-(triisopropylsilyloxy)methyl (TOM) group, 2'-(2-cyanoethoxy)ethyl (CEE) group, 2'-(2-cyanoethoxy)methyl (CEM) group, 2'-para-tolylsulfonylethoxymethyl (TEM) group, 2'-EMM group (WO 2013 / 027843), as well as 2'-PMM group (WO 2019 / 208571). Of these ribonucleoside (RNA) 2'-protecting groups, the protecting group represented by the formula (12) is exemplified as a preferred protecting group. More preferably, E W An example of such a protecting group is a protecting group represented by formula (13) having a cyano group as the electron-withdrawing group.

[0063] Formula (13): [In the formula, q, R a and R b is the same as defined in the formula (12). a and R b and do not simultaneously represent a hydrogen atom. ]

[0064] The protecting group represented by formula (13) can be synthesized, for example, according to the description in WO 2013 / 027843 and WO 2019 / 208571, and an amidite compound having such a protecting group can be used for producing a nucleic acid oligomer. For the nucleic acid elongation reaction, an amidite compound represented by formula (3) shown in the scheme of Figure 1 is used.

[0065] Examples of non-nucleotide linkers include linkers consisting of an amino acid backbone (for example, linkers consisting of an amino acid backbone described in Japanese Patent No. 5157168 or Japanese Patent No. 5554881). Specific, non-limiting examples include linkers represented by formula (A14-1), (A14-2), or (A14-3) (for example, as described in WO 2019 / 074110). In addition to these linkers, examples include the linkers described in WO 2012 / 005368, WO 2018 / 182008, or WO 2019 / 074110. (In the formula, Y is as defined above.)

[0066] Nucleotides and amidites in which the R group in formula (3) and the R′ group in formula (7) are substituents other than a hydroxyl group can be produced from nucleosides synthesized by known methods described in Japanese Patent No. 3745226, WO 2001 / 053528, JP 2014-221817 A, and known methods cited therein, or can be produced using commercially available products in accordance with the methods described in the Examples below or by methods with appropriate modifications to these methods.

[0067] G 4represents a hydrogen atom, an alkali metal ion, an ammonium ion, an alkylammonium ion, or a hydroxyalkylammonium ion. Examples of alkali metal ions include sodium ions and lithium ions. Specific examples of alkyl groups for alkylammonium ions include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl, and hexyl, with more specific examples including diethylammonium ion, triethylammonium ion, tetrabutylammonium ion, hexylammonium ion, and dibutylammonium ion. Specific examples of hydroxyalkyl moieties for hydroxyalkylammonium ions include hydroxymethyl, hydroxyethyl, hydroxy-n-propyl, hydroxyisopropyl, hydroxy-n-butyl, and trishydroxymethyl, with more specific examples of hydroxyalkylammonium ions including trishydroxymethylammonium ions.

[0068] G 5 represents a hydrogen atom or a protecting group for a hydroxyl group, and when representing a protecting group for a hydroxyl group, it is G 1 represents the same protecting group as 5 is a hydrogen atom when deprotected, and the nucleotide compound in this state is also subjected to a series of steps in a nucleic acid extension reaction.

[0069] (Nucleic acid extension reaction) In this specification, the term "nucleic acid extension reaction" refers to a reaction in which nucleotides are sequentially linked via phosphodiester bonds to extend an oligonucleotide. The nucleic acid extension reaction can be carried out according to the general procedure of the phosphoramidite method. The nucleic acid extension reaction may be carried out using an automatic nucleic acid synthesizer or the like that employs the phosphoramidite method.

[0070] The chain length of the nucleic acid oligomer may be, for example, 20 mer or more (i.e., n≧19), 40 mer or more (i.e., n≧39), 50 mer or more (i.e., n≧49), 60 mer or more (i.e., n≧59), 80 mer or more (i.e., n≧79), 100 mer or more (i.e., n≧99), 200 mer or more (i.e., n≧199), 300 mer or less (i.e., n≦299), 250 mer or less (i.e., n≦249), or 200 mer or less. (i.e., n≦199), 150mer or less (i.e., n≦149), 130mer or less (i.e., n≦129), 2-300mer (i.e., 1≦n≦299), 2-250mer (i.e., 1≦n≦249), 2-200mer (i.e., 1≦n≦199), 10-300mer (i.e., 9≦n≦299), 10-250mer (i.e., 9≦n≦249), 10-200mer (i.e., 9≦n≦199), 10-150 mer (i.e., 9≦n≦149), 15-300mer (i.e., 14≦n≦299), 15-250mer (i.e., 14≦n≦249), 15-200mer (i.e., 14≦n≦199), 15-150mer (i.e., 14≦n≦149), 15-110mer (i.e., 14≦n≦109), 80-300mer (i.e., 79≦n≦299), 80-250mer (i.e., 79≦n≦249), 80-200mer (i.e., 79≦n≦199), 80-150mer (i.e., 79≦n≦149), 80-130mer (i.e., 79≦n≦129), 100-300mer (i.e., 99≦n≦299), 100-250mer (i.e., 99≦n≦249), 100-200mer (i.e., 99≦n≦199), 100-150mer (i.e., 99≦n≦149), or 100-130mer (i.e., 99≦n≦129).

[0071] The 5'-deprotection step of step (1) is a step of deprotecting the protecting group of the 5'-hydroxyl group at the end of the RNA strand supported on the solid phase support. Common protecting groups include the 4,4'-dimethoxytrityl group (DMTr group), the 4-monomethoxytrityl group, and the 4,4',4"-trimethoxytrityl group. Deprotection can be carried out using an acid. Examples of acids used for deprotection include trifluoroacetic acid, dichloroacetic acid, trifluoromethanesulfonic acid, trichloroacetic acid, methanesulfonic acid, hydrochloric acid, acetic acid, and p-toluenesulfonic acid.

[0072] The coupling step of step (2) is a reaction in which a nucleoside phosphoramidite represented by the following formula (3) shown in the scheme of FIG. 1 is bonded to the 5' hydroxyl group at the end of the oligonucleotide chain deprotected in the deprotection step. Examples of phosphoramidites used in nucleic acid elongation include phosphoramidites represented by formula (3) or formula (A12). Other usable phosphoramidites include 2'-OMe, 2'-F, 2'-O-tert-butyldimethylsilyl, 2'-O-methoxyethyl, 2'-H, 2'-fluoro-2'-deoxy-β-D-arabinofuranosyl, and the like. The nucleoside phosphoramidite used has its 5' hydroxyl group protected with a protecting group (e.g., a DMTr group). The coupling step can be carried out using an activator that activates the nucleoside phosphoramidite. Examples of the activator include 5-benzylthio-1H-tetrazole (BTT), 1H-tetrazole, 4,5-dicyanoimidazole (DCI), 5-ethylthio-1H-tetrazole (ETT), N-methylbenzimidazolium triflate (N-MeBIT), benzimidazolium triflate (BIT), N-phenylimidazolium triflate (N-PhIMT), imidazolium triflate (IMT), 5-nitrobenzimidazolium triflate (NBT), 1-hydroxybenzotriazole (HOBT), and 5-(bis-3,5-trifluoromethylphenyl)-1H-tetrazole.

[0073] The phosphoramidite (hereinafter also referred to as amidite) represented by formula (3) in the scheme of FIG. 1 is as follows: Formula (3): [In the formula, G 1 , G 2 , G 3 , B a and R is as defined above.

[0074] After the coupling step, any unreacted 5' hydroxyl groups may be capped as appropriate using a known capping solution such as an acetic anhydride-tetrahydrofuran solution or a phenoxyacetic anhydride / N-methylimidazole solution.

[0075] The oxidation step (3) is a step of converting the phosphite triester group formed in the coupling step into a phosphate triester group or a thiophosphate triester group. This step is a reaction of converting trivalent phosphorus to pentavalent phosphorus using an oxidizing agent, and can be carried out by allowing the oxidizing agent to act on an oligonucleic acid derivative supported on a solid phase carrier.

[0076] When converting a phosphite triester group into a phosphate triester group, the oxidation reaction can be carried out using the oxidation solution of the present invention. The reaction temperature is usually 5°C to 50°C, preferably 10°C to 30°C. The reaction time is usually 1 minute to 30 minutes, preferably 1 minute to 10 minutes. The amount of the oxidation solution used is preferably 1 to 100 mol, more preferably 1 to 10 mol, of iodine per mol of the compound supported on the solid phase support.

[0077] When converting a phosphite triester group into a thiophosphate triester group, a thionating agent is used as an oxidizing agent. Examples of thionating agents that can be used include sulfur, 3H-1,2-benzodithiol-3-one-1,1-dioxide (Beaucage reagent), 3-amino-1,2,4-dithiazole-5-thione (ADTT), 5-phenyl-3H-1,2,4-dithiazol-3-one (POS), [(N,N-dimethylaminomethylidene)amino]-3H-1,2,4-dithiazoline-3-thione (DDTT), and phenylacetyl disulfide (PADS). The oxidizing agent can be diluted with an appropriate solvent to a concentration of 0.001 to 2 M before use. The solvent used in the reaction is not particularly limited as long as it is inert to the reaction, and examples include dichloromethane, acetonitrile, pyridine, and any mixtures thereof. The oxidation step may be carried out after the capping step, or conversely, the capping step may be carried out after the oxidation step, and this order is not limited.

[0078] In step (5), after the synthesis of a nucleic acid having a desired sequence is completed, the phosphate protecting group is deprotected by the action of an amine compound to deprotect the protecting group of the phosphate moiety. Examples of the amine compound include diethylamine, which is described in Japanese Patent No. 4705716.

[0079] The protecting group of the 5' hydroxyl group of the nucleoside introduced at the end of elongation may be used for column purification using the 5' protecting group as a tag after cleavage from the solid phase support and deprotection of the protecting group as described below, or the protecting group of the 5' hydroxyl group may be deprotected after column purification.

[0080] In step (5), the nucleic acid oligomer elongated to a desired chain length on the solid phase support is cleaved from the solid phase support usually using concentrated aqueous ammonia as a cleavage agent.

[0081] Furthermore, the oligonucleotide chain is cleaved from the solid support and recovered using ammonia or an amine compound, etc. Examples of the amine compound include methylamine, ethylamine, isopropylamine, ethylenediamine, and diethylamine.

[0082] In step (6), the protecting group on the 2- or 3-hydroxyl group of the ribose of the nucleic acid oligomer represented by formula (6) cleaved from the solid phase support in step (5) can be removed according to the methods described in WO 2006 / 022323), WO 2013 / 027843, or WO 2019 / 208571, to obtain a deprotected nucleic acid oligomer represented by formula (7).

[0083] Nucleic acid oligomers that can be produced using the production method of the present invention include, but are not limited to, nucleic acid oligomers in which the nucleosides contained therein are RNA, DNA, RNA having 2'-O-MOE, 2'-O-Me, or 2'-F, and LNA. Examples of various nucleosides include those described in Xiulong, Shen et al., Nucleic Acids Research, 2018, Vol. 46, No. 46, 1584-1600, and Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558. Preferably, the nucleic acid molecule produced by the method of the present invention is RNA.

[0084] Typical examples of nucleic acid oligomers that can be used in the production method of the present invention include, but are not limited to, the following examples in addition to those described in the Examples. In the following explanations of sequences, U represents uridine (ST.25 format), C represents cytidine, A represents adenosine, and G represents guanosine.

[0085] Examples of nucleic acid oligomers include those having the following sequences (A) and (B) described in WO 2019 / 060442: Sequence (A): 5'-AUGGAAUmACUCUUGGUUmACdTdT-3' (based on the ST.25 format) (5'-ATGGAATmACTCTTGGTTmACdTdT-3' (based on the ST.26 format)) (Antisense) (SEQ ID NO: 1) 21 mer; Sequence (B): 5'-GUmAACmCmAAGAGUmAUmUmCmCmAUmdTdT-3' (based on the ST.25 format) (5'-GTmAACmCmAAGAGTmATmTmCmCmATmdTdT-3' (based on the ST.26 format)) (Sense) (SEQ ID NO: 2) 21 mer. In sequences (A) and (B), Um represents 2'-O-methyluridine (ST.25 format), Tm represents 2'-O-methyluridine (ST.26 format), Cm represents 2'-O-methylcytidine, and dT represents thymidine. Unless otherwise specified, the abbreviations in the sequences herein apply to both the ST.25 format and the ST.26 format.

[0086] An example is the nucleic acid oligomer described in Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558 (see page 553). A typical example is a nucleic acid molecule having the following sequence (C): Sequence (C): 5'-AGAGCCAGCCUUCUUAUUGUUUUAGAGCUAUGCUGU-3' (based on the ST.25 format) (5'-AGAGCCAGCCTTCTTATTGTTTTAGAGCTATGCTGT-3' (based on the ST.26 format)) (SEQ ID NO: 3) 36mer

[0087] An example is a nucleic acid molecule having the following sequence (D) described in Nucleic Acids Research, 2019, Vol. 47, No. 2: 547. Sequence (D): 5'-ACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU-3' (based on the ST.25 format) (5'-ACAGCATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT-3' (based on the ST.26 format)) (SEQ ID NO: 4) 67mer

[0088] An example is a nucleic acid molecule having the following sequence (E) described in JP-A No. 2015-523856, page 173: Sequence (E): 5'-GUUUUCCCUUUUCAAAGAAAUCUCCUGGGCACCUAUCUUCUUAGGUGCCCUCCCUUGUUUAAACCUGACCAGUUAACCGGCUGGUUAGGUUUUU-3' (based on the ST.25 format) (5'-GTTTTCCCTTTTCAAAGAAATCTCCTGGGCACCTATCTTCTTAGGTGCCCTCCCTTGTTTAAACCTGACCAGTTAACCGGCTGGTTAGGTTTT-3' (based on the ST.26 format)) (SEQ ID NO: 5) 94mer

[0089] Examples include the nucleic acid molecules described in JP-A-2017-537626. Typical examples include nucleic acid molecules having the following sequences (F), (G), (H), and (I).Sequence (F): 5'-AGUCCUCAUCUCCCUCAAGCGUUUUAGAGCUAGUAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3' (based on ST.25 format) (5'-AGTCCTCATCTCCCTCAAGCGTTTTAGAGCTAGTAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3' (based on ST.26 format)) (SEQ ID NO: 6) 100mer Sequence (G): 5'-GCAGAUGUAGUGUUUCCACAGUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU-3' (based on ST.25 format) (5'-GCAGATGTAGTGTTTCCACAGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3' (based on ST.26 format)) (SEQ ID NO: 7) 113mer Sequence (H): 5'-dAdGdTdCdCdTdCdAdTdCdTdCdCdCdTdCdAdGdCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU-3' (based on ST.25 format) (5'-dAdGdTdCdCdTdCdAdTdCdTdCdCdCdTdCdAdGdCGTTTAAGAGCTATGCTGGTAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3' (based on ST.26 format)) (SEQ ID NO: 8) 113mer In sequence (H), dT represents thymidine, dC represents 2'-deoxycytidine, dA represents 2'-deoxyadenosine, and dG represents 2'-deoxyguanosine.Sequence (I): 5'-AmsGmsUmsCCUCAUCUCCCUCAAGCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUmsUmsU-3' (based on ST.25 format) (5'-AmsGmsTmsCCTCATCTCCCTCAAGCGTTTAAGAGCTATGCTGGTAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTmsTmsTmsT-3' (based on ST.26 format)) (SEQ ID NO: 9) 113mer In sequence (I), Um represents 2'-O-methyluridine (ST.25 format), Tm represents 2'-O-methyluridine (ST.26 format), Am represents 2'-O-methyladenosine, Gm represents 2'-O-methylguanosine, and s represents a phosphorothioate modification.

[0090] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

[0091] <Measurement Methods> First, the various measurement methods used in the following tests are shown below.

[0092] (Measurement Method 1: Calculation of PS→PO Conversion Rate in Dimer) The PS→PO conversion rate in the dimer was measured using HPLC. The HPLC measurement conditions are shown in Table A1 below.

[0093]

[0094] (Measurement Method 2: Measurement of Oligonucleotide Purity) Oligonucleotide purity was measured using HPLC. The HPLC measurement conditions are shown in Table A2 below.

[0095]

[0096] <Synthesis of CPG-supported dimer> Sequence (J): 5'-UmsUm-3' (based on ST.25 format) (5'-TmsTm-3' (based on ST.26 format)) (SEQ ID NO: J) 2mer In the above sequence, Um represents 2'-O-methyluridine (ST.25 format), Tm represents 2'-O-methyluridine (ST.26 format), and s represents a phosphorothioate bond (PS bond).

[0097] The structure of the dimer of sequence (J) supported on CPG is shown in formula (J1), where the circle shown in formula (J1) is a schematic representation of CPG.

[0098] (Preparation Example 1) Using 54.82 μmol of 2'-OMe-U derivative CPG represented by formula (J2), the oligonucleotide represented by sequence (J) was automatically synthesized from the 3' to the 5' end using an AKTA Oligopilot Plus 100 (manufactured by GE Healthcare). The automated synthesis procedure involved first loading a dichloroacetic acid toluene solution onto the 2'-OMe-U derivative CPG to deprotect the trityl protecting group at the 5' position. Subsequently, a 2'-OMe-U amidite solution and a 5-benzylmercapto-1H-tetrazole solution were loaded onto the CPG, allowing a coupling reaction to proceed with the hydroxyl group at the 5' position. Subsequently, a 3-amino-1,2,4-dithiazole-5-thione (ADTT) solution was loaded as a thiolating agent to convert the phosphorous acid group to a phosphorothioate bond (PS bond). Subsequently, a phenoxyacetic anhydride solution and a 1-methylimidazole solution were used as capping solutions to cap reaction sites where the condensation reaction had not proceeded. Finally, the trityl protecting group (DMTr group) at the 5'-position was deprotected with a dichloroacetic acid toluene solution to synthesize a dimer of the sequence (J) supported on CPG.

[0099] (In the formula, the illustrated circle is a schematic representation of a CPG.)

[0100] Preparation of Oxidizing Solutions Example 1 63.45 mg of iodine was dissolved in 4.5 mL of pyridine and 0.5 mL of water. To the resulting solution, an additive (an aromatic hydrocarbon or aromatic heterocyclic compound whose conjugate acid has a pKa of less than 5) shown in Table S1 was added to the resulting solution at the concentration shown in Table S1 to prepare Oxidizing Solutions 1 to 33.

[0101]

[0102] Comparative Example 1: 63.45 mg of iodine was dissolved in 4.5 mL of pyridine and 0.5 mL of water. To the resulting solution, the additives shown in Table C1 were added to the concentrations shown in Table C1 to prepare oxidizing solutions C1 to C4.

[0103]

[0104] Reference Example 1: 1 μmol of the dimer of sequence (J) supported on the CPG prepared in Production Example 1 was cleaved from the CPG under ammonia water-ethanol conditions, and the reaction solution was evaporated under reduced pressure to obtain a dimer of sequence (J). The obtained dimer was analyzed by Measurement Method 1 to determine the proportion of phosphate conjugates (PO conjugates) (i.e., phosphate triesters) in which phosphorothioate bonds (PS bonds) were converted to phosphate bonds (PO bonds). The result was 0.176% in terms of HPLC area percentage. This was used as the initial value for the proportion of PO conjugates in the dimer of sequence (J).

[0105] Example 2 To 1 μmol of the dimer of sequence (J) supported on the CPG prepared in Production Example 1, 5 mL of each of the various oxidation solutions prepared in Example 1 was added, and the mixture was allowed to stand at room temperature for 8 hours. After standing, the oxidation solution was filtered, washed sequentially with pyridine and acetonitrile, and dried under reduced pressure. The dimer supported on the dried CPG was subjected to ammonia water-ethanol conditions to cleave the dimer from the CPG, and the reaction solution was evaporated under reduced pressure to obtain a dimer of sequence (J) treated with the oxidation solution. The obtained dimer was analyzed by Measurement Method 1, and the proportion of phosphorothioate conjugates (PS conjugates) and the proportion of phosphate conjugates (PO conjugates) in which the phosphorothioate linkages (PS linkages) were converted to phosphate linkages (PO linkages) were determined by HPLC area percentage. The initial value (0.176%) of the proportion of PO conjugates determined in Reference Example 1 was subtracted from the proportion of PO conjugates determined here, and the resulting value was divided by the proportion of PS conjugates to calculate the PS→PO conversion rate.

[0106] The PS → PO conversion rates when the oxidation solutions prepared in Example 1 were used are shown in [Table S2].

[0107]

[0108] (Comparative Example 2) The oxidizing solution prepared in Comparative Example 1 was used instead of the oxidizing solution prepared in Example 1, and the PS→PO conversion rate was calculated in the same manner as in Example 2. The PS→PO conversion rates when the oxidizing solution prepared in Comparative Example 1 was used are shown in Table C2.

[0109]

[0110] The results shown in [Table S2] and [Table C2] confirm that the PS→PO conversion rate of dimers treated with the oxidizing solutions 1 to 34 of the present invention is reduced compared to the PS→PO conversion rate of dimers treated with the comparative oxidizing solution. Therefore, the oxidizing solution of the present invention can reduce the production of phosphate conjugates (PO conjugates) in which phosphorothioate bonds (PS bonds) are converted to phosphate bonds (PO bonds) in the oxidation reaction of nucleic acids having phosphorothioate bonds (PS bonds).

[0111] <Solid-phase synthesis of oligonucleotides> (Example 3) Sequence (K): 5'-AAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGsCsUsUsUsUm-3' (based on ST.25 format) (5'-AAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGsCsTsTsTsTm-3' (based on ST.26 format)) (SEQ ID NO: 10) 50mer In the above sequence, Um represents 2'-O-methyluridine (ST.25 format), Tm represents 2'-O-methyluridine (ST.26 format), and s represents a phosphorothioate bond (PS bond).

[0112] The oligonucleotide consisting of the above sequence (K) was synthesized from the 3' to 5' end by phosphoramidite solid-phase synthesis using 2'-OMe-uridine-loaded Controlled Pore Glass (CPG) as the solid support and an NTS M-4MX-E (manufactured by Nippon Techno Service Co., Ltd.) as the nucleic acid synthesizer. The synthesis was carried out on a 1 μmol scale. In addition, for the synthesis, an acetonitrile solution of PMM amidite disclosed in International Publication No. 2019 / 208571 was used as the phosphoramidite, a high-purity dichloroacetic acid toluene solution was used as the deblocking solution, a 5-benzylmercapto-1H-tetrazole solution was used as the coupling agent, a 50 mM iodine solution (water:pyridine:acetonitrile=6.25:43.75:50.00 (v / v / v)) containing the additives shown in Table S3 (aromatic hydrocarbons or aromatic heterocyclic compounds whose conjugate acids have a pKa of less than 5) was used as the oxidizing solution, a 3-amino-1,2,4-dithiazole-5-thione solution (ADTT solution) was used as the thiolating agent, and a phenoxyacetic anhydride solution and a 1-methylimidazole solution were used as the capping solution. The automated synthesis procedure involved feeding a dichloroacetic acid toluene solution to a CPG to deprotect the trityl protecting group at the 5' position. Subsequently, amidite solution and a 5-benzylmercapto-1H-tetrazole acetonitrile solution as a coupling agent were fed to the CPG to induce condensation at the 5' hydroxyl group. Subsequently, the aforementioned oxidizing solution or a thiolating agent (ADTT solution) was fed to convert the phosphite triester group to a phosphate triester group or a phosphorothioate bond. Subsequently, a phenoxyacetic anhydride solution and a 1-methylimidazole solution were used as capping solutions to cap reaction sites where the condensation reaction had not progressed. These steps were repeated a total of 49 times to synthesize a 50-mer oligonucleotide having the sequence shown in sequence (K) on a CPG support, after which the trityl protecting group at the 5' position was deprotected with a dichloroacetic acid toluene solution.Subsequently, the nucleic acid oligomer was released from the solid phase carrier using aqueous ammonia and ethanol on the CPG carrier carrying the 50-mer nucleic acid oligomer. The solid phase carrier was then removed by filtration, and the aqueous ammonia and ethanol were removed by drying under reduced pressure. Subsequently, the protecting group of the 2'-hydroxyl group was removed using a tetrabutylammonium fluoride dimethyl sulfoxide solution to obtain the desired nucleic acid oligomer. The purity of the resulting nucleic acid oligomer was measured using Measurement Method 2. The results are shown in Table S3.

[0113]

[0114] Comparative Example 3 Instead of a 50 mM iodine solution containing the additives shown in Table S3 (aromatic hydrocarbons or aromatic heterocyclic compounds whose conjugate acids have a pKa of less than 5), a 50 mM iodine solution containing the additives shown in Table C3 (water:pyridine:acetonitrile = 6.25:43.75:50.00 (v / v / v)) was used as the oxidizing solution, and the purity of the nucleic acid oligomer was measured in the same manner as in Example 3. The results are shown in Table C3.

[0115]

[0116] The results shown in Table S3 and Table C3 confirm that the purity of the nucleic acid oligomers produced using the oxidizing solution of the present invention is improved compared to the nucleic acid oligomers produced using the comparative oxidizing solution.

[0117] (Example 4) Sequence (L): 5'-AsUsAsACUCAAUUUGUAAAAAAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUsUsUsUm-3' (based on the ST.25 format) (5'-AsTsAsACTCAATTTGTAAAAAAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTsTsTsTm-3' (based on the ST.26 format)) (SEQ ID NO: 11) 100mer In the above sequence, Um represents 2'-O-methyluridine (ST.25 format), Tm represents 2'-O-methyluridine (ST.26 format), and s represents a phosphorothioate bond (PS bond).

[0118] The oligonucleotide consisting of the above sequence (L) was synthesized from the 3' to 5' end by phosphoramidite solid-phase synthesis using 2'-OMe-uridine-loaded Controlled Pore Glass (CPG) as the solid support and an NTS M-4MX-E (manufactured by Nippon Techno Service Co., Ltd.) as the nucleic acid synthesizer. The synthesis was carried out on a 1 μmol scale. In addition, for the synthesis, an acetonitrile solution of PMM amidite disclosed in International Publication No. 2019 / 208571 was used as the phosphoramidite, a high-purity dichloroacetic acid toluene solution was used as the deblocking solution, a 5-benzylmercapto-1H-tetrazole solution was used as the coupling agent, a 50 mM iodine solution (water:pyridine:acetonitrile=6.25:43.75:50.00 (v / v / v)) containing the additives shown in Table S4 (aromatic hydrocarbons or aromatic heterocyclic compounds whose conjugate acids have a pKa of less than 5) was used as the oxidizing solution, a 3-amino-1,2,4-dithiazole-5-thione solution (ADTT solution) was used as the thiolating agent, and a phenoxyacetic anhydride solution and a 1-methylimidazole solution were used as the capping solution. The automated synthesis procedure involved feeding a dichloroacetic acid toluene solution to a CPG to deprotect the trityl protecting group at the 5' position. Subsequently, amidite solution and a 5-benzylmercapto-1H-tetrazole acetonitrile solution as a coupling agent were fed to the CPG to induce condensation at the 5' hydroxyl group. Subsequently, the aforementioned oxidizing solution or a thiolating agent (ADTT solution) was fed to convert the phosphite triester group to a phosphate triester group or a phosphorothioate bond. Subsequently, a phenoxyacetic anhydride solution and a 1-methylimidazole solution were used as capping solutions to cap reaction sites where the condensation reaction had not progressed. These steps were repeated a total of 99 times to synthesize a 100-mer oligonucleotide of the sequence shown in sequence (L) on a CPG support, after which the trityl protecting group at the 5' position was deprotected with a dichloroacetic acid toluene solution.Subsequently, the nucleic acid oligomer was released from the solid phase carrier using aqueous ammonia and ethanol on the CPG carrier carrying the 100-mer nucleic acid oligomer. The solid phase carrier was then removed by filtration, and the aqueous ammonia and ethanol were removed by drying under reduced pressure. Subsequently, the protecting group of the 2'-hydroxyl group was removed using a tetrabutylammonium fluoride dimethyl sulfoxide solution to obtain the desired nucleic acid oligomer. The purity of the resulting nucleic acid oligomer was measured using Measurement Method 2. The results are shown in Table S4.

[0119]

[0120] Comparative Example 4 Instead of a 50 mM iodine solution containing the additive shown in Table S4 (an aromatic hydrocarbon or aromatic heterocyclic compound whose conjugate acid has a pKa of less than 5), a 50 mM iodine solution containing the additive shown in Table C4 (water:pyridine:acetonitrile=6.25:43.75:50.00 (v / v / v)) was used as the oxidizing solution, and the purity of the nucleic acid oligomer was measured in the same manner as in Example 4. The results are shown in Table C4.

[0121]

[0122] The results shown in [Table S4] and [Table C4] confirm that the purity of the nucleic acid oligomers produced using the oxidizing solution of the present invention is improved compared to the nucleic acid oligomers produced using the comparative oxidizing solution.

[0123] The present invention provides an efficient method for producing a nucleic acid oligomer, and is expected to improve the purity of the nucleic acid oligomer produced by the method.

[0124] SEQ ID NOs: 1 to 11 in the sequence listing represent the base sequences of the oligonucleotides produced according to the production method of the present invention.

Claims

1. Formula (I): (In the formula, G 1 and G 2 are each independently the same or different and represent a protecting group for a hydroxyl group, B a represents a nucleic acid base which may be protected with a protecting group, R represents a protected hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group, Q' represents a methylene group bonded to the 4' carbon atom of ribose, an ethylene group bonded to the 4' carbon atom of ribose, or an ethylidene group bonded to the 4' carbon atom of ribose, and the bond marked with * represents a bond to the 3' end of the nucleic acid. (In the formula, G 1 , G 2 , B a , R and * are as defined above.) A method for producing a nucleic acid having at least one phosphorothioate bond, comprising the step of reacting a precursor having a phosphite triester bond represented by the formula:

2. An aromatic hydrocarbon or aromatic heterocyclic compound having a conjugate acid pKa of less than 5, represented by the formula (A): [In the formula, Y 1 , Y 2 , Y 3 , Y 4 , Y 5 , and Y 6 are each independently the same or different and represent a hydrogen atom, a C1-C6 chain hydrocarbon group optionally having one or more substituents selected from Group A, a C3-C8 alicyclic hydrocarbon group, a tri(C1-C6 alkyl)silyl group, a halogen atom, a hydroxyl group, a C1-C6 alkoxy group (the C1-C6 alkoxy group optionally having one or more halogen atoms), C(O)R 11 , sulfanyl group, C1-C6 alkylsulfanyl group, phenylsulfanyl group, amino group, C1-C6 alkylamino group, C2-C6 dialkylamino group, cyano group, nitro group, phenyl group, 1,2-epoxyethyl group, (C1-C6 alkyl)carbonyloxy group, (C1-C6 alkyl)carbonylamino group, diphenylphosphinyl group, diphenylphosphinthioyl group, or pyridyl group. 1 and Y 2 and optionally form a ring together with the carbon atoms to which they are bonded, and the ring represents a C3-C8 alicyclic hydrocarbon, a 3- to 8-membered heterocyclyl, succinimide, N-hydroxysuccinimide, or benzene, and the ring may be substituted with one or more halogen atoms.] 2) a 6-membered aromatic heterocyclic compound optionally having one or more substituents selected from Group B {the 6-membered aromatic heterocyclic compound contains only one or more nitrogen atoms as heteroatoms constituting the ring. Two adjacent carbon atoms constituting the 6-membered aromatic heterocyclic compound may form another ring containing those two carbon atoms as ring-constituting atoms, and the ring represents a C3-C8 alicyclic hydrocarbon or a 3- to 8-membered non-aromatic heterocycle, and the ring may be substituted with one or more halogen atoms.}, or 3) a 5-membered aromatic heterocyclic compound optionally having one or more substituents selected from group C {the 5-membered aromatic heterocyclic compound contains, as heteroatoms constituting the ring, one or more heteroatoms selected from the group consisting of a nitrogen atom, an oxygen atom, and a sulfur atom. Two adjacent atoms among the carbon atoms or nitrogen atoms constituting the 5-membered aromatic heterocyclic compound may form another ring containing them as ring-constituting atoms, and the ring represents a C3-C8 alicyclic hydrocarbon, benzene, or a 3- to 8-membered heterocyclyl, and the ring may be substituted with one or more halogen atoms. Group A: a group consisting of a halogen atom, a hydroxyl group, a cyano group, a nitro group, a C1-C6 alkoxy group optionally substituted with one or more halogen atoms, a carboxy group, a tri(C1-C6 alkyl)silyl group, a C3-C8 alicyclic hydrocarbon group, a phenyl group, and a 3- to 8-membered heterocyclyl group; Group B: a C1-C6 open chain hydrocarbon group optionally having one or more substituents selected from Group A, a C3-C8 alicyclic hydrocarbon group, a tri(C1-C6 alkyl)silyl group, a halogen atom, a hydroxyl group, an alkoxy group {the alkoxy group optionally has one or more halogen atoms}, C(O)R 11 , a sulfanyl group, a C1-C6 alkylsulfanyl group, a phenylsulfanyl group, an amino group, a C1-C6 alkylamino group, a C2-C6 dialkylamino group, a cyano group, a nitro group, a phenyl group, a 1,2-epoxyethyl group, a (C1-C6 alkyl)carbonyloxy group, a (C1-C6 alkyl)carbonylamino group, and a pyridyl group; Group C: a C1-C6 chain hydrocarbon group optionally having one or more substituents selected from Group A, a C3-C8 alicyclic hydrocarbon group, a tri(C1-C6 alkyl)silyl group, a halogen atom, a hydroxyl group, an alkoxy group {the alkoxy group optionally has one or more halogen atoms}, C(O)R 11 the group consisting of a sulfanyl group, a C1-C6 alkylsulfanyl group, a phenylsulfanyl group, an amino group, a C1-C6 alkylamino group, a C2-C6 dialkylamino group, a cyano group, a nitro group, a phenyl group, a 1,2-epoxyethyl group, a (C1-C6 alkyl)carbonyloxy group, a (C1-C6 alkyl)carbonylamino group, and a pyridyl group; R 11 represents a C1-C6 alkyl group, a C1-C6 alkoxy group, a hydroxyl group, or NR 12 R 13 represents R 12 and R 13 are each independently the same or different and represent a C1-C6 alkyl group optionally substituted with one or more halogen atoms or a hydrogen atom.

3. The method according to claim 2, wherein the aromatic hydrocarbon or aromatic heterocyclic compound having a conjugate acid pKa of less than 5 is a compound represented by formula (A).

4. An aromatic hydrocarbon or aromatic heterocyclic compound having a conjugate acid pKa of less than 5 is a compound represented by formula (A), and Y 1 , Y 2 , Y 3 , Y 4 , Y 5 , and Y 6 are each independently the same or different and are a hydrogen atom, a methyl group, an ethyl group, a propyl group, an isopropyl group, a butyl group, a sec-butyl group, a tert-butyl group, a cyclopentyl group, a cyclohexyl group, a vinyl group, a propenyl group, an isopropenyl group, a hydroxymethyl group, a hydroxyethyl group, a hydroxypropenyl group, a cyanomethyl group, a methoxymethyl group, a hydroxyl group, a methoxy group, an ethoxy group, a sulfanyl group, a methylsulfanyl group, a carboxy group, an amido group, an amino group, a methylamino group, an ethylamino group, a dimethylamino group, a diethylamino group, a cyano group, a phenylsulfanyl group, a nitro group, a phenyl group, a benzyl group, an acetyl group, an acetoxy group, a trifluoromethyl group, a trifluoromethoxy group, a diphenylphosphinyl group, a diphenylphosphinthioyl group, or a halogen atom; and Y 1 and Y 2 and the carbon atoms to which they are attached may form a ring, which may be substituted with one or more halogen atoms, and which is cyclopentane, cyclohexane, cyclopentene, cyclohexene, succinimide, N-hydroxysuccinimide, dihydropyran, pyridine, pyridazine, pyrimidine, pyrazine, triazine, pyrrole, furan, thiophene, pyrazole, oxazole, isoxazole, thiazole, isothiazole, or benzene.

5. An aromatic hydrocarbon or aromatic heterocyclic compound having a conjugate acid pKa of less than 5 is a compound represented by formula (A), and Y 1 , Y 2 , Y 3 , Y 4 , Y 5 , and Y 6 are each independently the same or different and are a hydrogen atom, a methyl group, an ethyl group, a propyl group, an isopropyl group, a butyl group, a sec-butyl group, a tert-butyl group, a vinyl group, a propenyl group, an isopropenyl group, a hydroxypropenyl group, a hydroxyl group, a methoxy group, a phenylsulfanyl group, a carboxy group, or a chlorine atom; and Y 1 and Y 2 and may form a ring together with the carbon atom to which they are attached, and the ring is cyclopentene, N-hydroxysuccinimide or benzene.

6. The production method according to claim 2, wherein the aromatic hydrocarbon or aromatic heterocyclic compound having a conjugate acid pKa of less than 5 is a 6-membered aromatic heterocyclic compound optionally having one or more substituents selected from Group B {the 6-membered aromatic heterocyclic compound contains only one or more nitrogen atoms as heteroatoms constituting the ring. Two adjacent carbon atoms constituting the 6-membered aromatic heterocyclic compound may form another ring containing those two carbon atoms as ring-constituting atoms, and the ring represents a C3-C8 alicyclic hydrocarbon or a 3- to 8-membered non-aromatic heterocycle, and the ring may be substituted with one or more halogen atoms.} 7. The aromatic hydrocarbon or aromatic heterocyclic compound having a conjugate acid pKa of less than 5 is pyridine, pyridazine, pyrimidine, pyrazine, or triazine {the pyridine, pyridazine, pyrimidine, pyrazine, and triazine are those of Group B 1 The method according to claim 6, wherein the pyridine, the pyridazine, the pyrimidine, the pyrazine, and the triazine are each independently selected from the group consisting of: two adjacent carbon atoms constituting the pyridine, the pyridazine, the pyrimidine, the pyrazine, and the triazine may form another ring containing those two carbon atoms as ring-constituting atoms, and the ring represents cyclopentane, cyclohexane, cyclopentene, cyclohexene, or dihydropyran, and the ring may be substituted with one or more halogen atoms; 1 The group consisting of a methyl group, an ethyl group, a propyl group, an isopropyl group, a butyl group, a sec-butyl group, a tert-butyl group, a cyclopentyl group, a cyclohexyl group, a vinyl group, a propenyl group, an isopropenyl group, a hydroxymethyl group, a hydroxyethyl group, a hydroxypropenyl group, a cyanomethyl group, a methoxymethyl group, a hydroxyl group, a methoxy group, an ethoxy group, a sulfanyl group, a methylsulfanyl group, a carboxy group, an amido group, an amino group, a dimethylamino group, a diethylamino group, a cyano group, a phenylsulfanyl group, a nitro group, a phenyl group, a benzyl group, an acetyl group, an acetoxy group, a trifluoromethyl group, a trifluoromethoxy group, and a halogen atom.

8. The aromatic hydrocarbon or aromatic heterocyclic compound having a conjugate acid pKa of less than 5 is pyridine, pyridazine, pyrimidine, pyrazine, or triazine {the pyridine, pyridazine, pyrimidine, pyrazine, and triazine are those of Group B 2 The method according to claim 6, wherein two adjacent carbon atoms constituting the pyridine, the pyridazine, the pyrimidine, the pyrazine, and the triazine may form another ring containing them as ring-constituting atoms, and the ring represents cyclopentene, and the ring may be substituted with one or more halogen atoms. 2 The group consisting of a methyl group, an ethyl group, a propyl group, an isopropyl group, a butyl group, a sec-butyl group, a tert-butyl group, a vinyl group, a propenyl group, an isopropenyl group, a hydroxypropenyl group, a hydroxyl group, a methoxy group, a phenylsulfanyl group, a carboxy group, and a chlorine atom.

9. The production method according to claim 2, wherein the aromatic hydrocarbon or aromatic heterocyclic compound having a conjugate acid pKa of less than 5 is a 5-membered aromatic heterocyclic compound optionally having one or more substituents selected from Group C (the 5-membered aromatic heterocyclic compound contains, as heteroatoms constituting the ring, one or more heteroatoms selected from the group consisting of nitrogen atoms, oxygen atoms, and sulfur atoms. Two adjacent carbon atoms or nitrogen atoms constituting the 5-membered aromatic heterocyclic compound may form another ring containing them as ring-constituting atoms, and the ring represents a C3-C8 alicyclic hydrocarbon or a 3- to 8-membered heterocyclyl, and the ring may be substituted with one or more halogen atoms.).

10. The aromatic hydrocarbon or aromatic heterocyclic compound having a conjugate acid pKa of less than 5 is selected from the group consisting of pyrrole, furan, thiophene, pyrazole, 1,2,3-triazole, 1,2,4-triazole, tetrazole, oxazole, isoxazole, thiazole, isothiazole, 1,2,5-oxadiazole, 1,2,3-oxadiazole, and 1,3,4-thiadiazole. (The pyrrole, furan, thiophene, pyrazole, 1,2,3-triazole, 1,2,4-triazole, tetrazole, oxazole, isoxazole, thiazole, isothiazole, 1,2,5-oxadiazole, 1,2,3-oxadiazole, and 1,3,4-thiadiazole are selected from the group consisting of group C, C, D, E, F ... 1 The method according to claim 9, wherein the pyrrole, the furan, the thiophene, the pyrazole, the 1,2,3-triazole, the 1,2,4-triazole, the tetrazole, the oxazole, the isoxazole, the thiazole, the isothiazole, the 1,2,5-oxadiazole, the 1,2,3-oxadiazole, and the 1,3,4-thiadiazole are each independently selected from the group consisting of 1,2,5-oxadiazole, 1,2,3-oxadiazole, and 1,3,4-thiadiazole. Two adjacent carbon atoms or nitrogen atoms constituting the pyrrole, the furan, the thiophene, the pyrazole, the 1,2,3-triazole, the 1,2,4-triazole, the tetrazole, the oxazole, the isoxazole, the thiazole, the isothiazole, the 1,2,5-oxadiazole, the 1,2,3-oxadiazole, and the 1,3,4-thiadiazole may form another ring containing them as ring-constituting atoms, and the ring represents cyclopentane, cyclohexane, cyclopentene, cyclohexene, dihydropyran, or benzene, and the ring may be substituted with one or more halogen atoms. 1 The group consisting of a methyl group, an ethyl group, a propyl group, an isopropyl group, a butyl group, a sec-butyl group, a tert-butyl group, a vinyl group, a propenyl group, an isopropenyl group, a hydroxypropenyl group, a hydroxy group, a methoxy group, a phenylsulfanyl group, a carboxy group, and a chlorine atom.

11. The aromatic hydrocarbon or aromatic heterocyclic compound having a conjugate acid pKa of less than 5 is selected from the group consisting of pyrrole, furan, thiophene, pyrazole, oxazole, isoxazole, thiazole, and isothiazole (the pyrrole, furan, thiophene, pyrazole, oxazole, isoxazole, thiazole, and isothiazole are selected from the group consisting of group C). 2 The method according to claim 9, wherein the pyrrole, the furan, the thiophene, the pyrazole, the oxazole, the isoxazole, the thiazole, and the isothiazole are each independently selected from the group consisting of cyclopentene, benzene, ... 2 The group consisting of a methyl group, an ethyl group, a propyl group, an isopropyl group, a butyl group, a sec-butyl group, a tert-butyl group, a cyclopentyl group, a cyclohexyl group, a vinyl group, a propenyl group, an isopropenyl group, a hydroxymethyl group, a hydroxyethyl group, a hydroxypropenyl group, a cyanomethyl group, a methoxymethyl group, a hydroxy group, a methoxy group, an ethoxy group, a thiol group, a methylthio group, a carboxy group, an amido group, an amino group, a dimethylamino group, a diethylamino group, a cyano group, a phenylsulfanyl group, a nitro group, a phenyl group, a benzyl group, an acetyl group, an acetoxy group, a trifluoromethyl group, a trifluoromethoxy group, and a halogen atom.

12. The process according to claim 1, wherein the aromatic hydrocarbon or aromatic heterocyclic compound having a conjugate acid with a pKa of less than 5 is toluene, cinnamyl alcohol, phenol, 2,4-dimethylphenol, 3-methoxyphenol, ethyl salicylate, 4,6-di-tert-butyl-m-cresol, 4-sec-butyl-2,6-di-tert-butylphenol, 2-tert-butyl-4,6-dimethylphenol, anisole, benzoic acid, phenyl sulfide, chlorobenzene, indene, naphthalene, benzo[b]thiophene, N-hydroxyphthalimide, quinoline, 2,3-benzofuran, indole, pyrrole, thiophene, thiazole, triphenylphosphine oxide, triphenylphosphine sulfide, 2-methylfuran, 5-methylisoxazole, ethyl 4-oxazolecarboxylate, or 2-methoxy-3-methylpyrazine.

13. Aromatic hydrocarbons or aromatic heterocyclic compounds whose conjugate acids have a pKa of less than 5 are included in the group P 5 2. The method according to claim 1, wherein the compound is a phenol optionally substituted with one or more substituents selected from the group consisting of: 5 : The group consisting of methyl, butyl, and methoxy groups.

14. The method according to any one of claims 1 to 13, wherein the content of the aromatic hydrocarbon or aromatic heterocyclic compound having a conjugate acid with a pKa of less than 5 in the oxidation solution is 0.02 wt % to 30 wt %.

15. The method of any one of claims 1 to 13, wherein the content of the aromatic hydrocarbon or aromatic heterocyclic compound having a conjugate acid with a pKa of less than 5 in the oxidation solution is 0.1 wt % to 20 wt %.

16. The method according to any one of claims 1 to 13, wherein the content of the aromatic hydrocarbon or aromatic heterocyclic compound having a conjugate acid with a pKa of less than 5 in the oxidation solution is 0.1 wt % to 5 wt %.

17. The method according to any one of claims 1 to 13, wherein the concentration of iodine in the oxidizing solution is 1 mM to 500 mM.

18. The method according to any one of claims 1 to 13, wherein the concentration of iodine in the oxidizing solution is 20 mM to 200 mM.

19. An oxidizing solution for nucleic acid synthesis comprising an aromatic hydrocarbon or aromatic heterocyclic compound whose conjugate acid has a pKa of less than 5, iodine, pyridine, and water.

20. An aromatic hydrocarbon or aromatic heterocyclic compound having a conjugate acid pKa of less than 5 is represented by the formula (A): [In the formula, Y 1 , Y 2 , Y 3 , Y 4 , Y 5 , and Y 6 are each independently the same or different and represent a hydrogen atom, a C1-C6 chain hydrocarbon group optionally having one or more substituents selected from Group A, a C3-C8 alicyclic hydrocarbon group, a tri(C1-C6 alkyl)silyl group, a halogen atom, a hydroxyl group, a C1-C6 alkoxy group (the C1-C6 alkoxy group optionally having one or more halogen atoms), C(O)R 11 , sulfanyl group, C1-C6 alkylsulfanyl group, amino group, C1-C6 alkylamino group, C2-C6 dialkylamino group, cyano group, nitro group, phenyl group, 1,2-epoxyethyl group, (C1-C6 alkyl)carbonyloxy group, (C1-C6 alkyl)carbonylamino group, diphenylphosphinyl group, diphenylphosphinthioyl group, or pyridyl group. 1 and Y 2 and optionally form a ring together with the carbon atoms to which they are bonded, and the ring represents a C3-C8 alicyclic hydrocarbon, a 3- to 8-membered heterocyclyl, succinimide, N-hydroxysuccinimide, or benzene, and the ring may be substituted with one or more halogen atoms.] 2) a 6-membered aromatic heterocyclic compound optionally having one or more substituents selected from Group B {the 6-membered aromatic heterocyclic compound contains only one or more nitrogen atoms as heteroatoms constituting the ring. Two adjacent carbon atoms constituting the 6-membered aromatic heterocyclic compound may form another ring containing those two carbon atoms as ring-constituting atoms, and the ring represents a C3-C8 alicyclic hydrocarbon or a 3- to 8-membered non-aromatic heterocycle, and the ring may be substituted with one or more halogen atoms.}, or 3) a 5-membered aromatic heterocyclic compound optionally having one or more substituents selected from group C {the 5-membered aromatic heterocyclic compound contains, as heteroatoms constituting the ring, one or more heteroatoms selected from the group consisting of a nitrogen atom, an oxygen atom, and a sulfur atom. Two adjacent carbon atoms or nitrogen atoms constituting the 5-membered aromatic heterocyclic compound may form another ring containing them as ring-constituting atoms, and the ring represents a C3-C8 alicyclic hydrocarbon or a 3- to 8-membered heterocyclyl, and the ring may be substituted with one or more halogen atoms.

20. The oxidizing solution for nucleic acid synthesis according to claim 19, wherein the oxidizing solution is selected from the group consisting of: Group A: a halogen atom, a hydroxyl group, a cyano group, a nitro group, a C1-C6 alkoxy group optionally substituted with one or more halogen atoms, a carboxy group, a tri(C1-C6 alkyl)silyl group, a C3-C8 alicyclic hydrocarbon group, a phenyl group, and a 3-8 membered heterocyclyl group; Group B: a C1-C6 open chain hydrocarbon group optionally having one or more substituents selected from Group A, a C3-C8 alicyclic hydrocarbon group, a tri(C1-C6 alkyl)silyl group, a halogen atom, a hydroxyl group, an alkoxy group {the alkoxy group optionally has one or more halogen atoms}, C(O)R 11 , a sulfanyl group, a C1-C6 alkylsulfanyl group, an amino group, a C1-C6 alkylamino group, a C2-C6 dialkylamino group, a cyano group, a nitro group, a phenyl group, a 1,2-epoxyethyl group, a (C1-C6 alkyl)carbonyloxy group, a (C1-C6 alkyl)carbonylamino group, and a pyridyl group; Group C: a C1-C6 chain hydrocarbon group optionally having one or more substituents selected from Group A, a C3-C8 alicyclic hydrocarbon group, a tri(C1-C6 alkyl)silyl group, a halogen atom, a hydroxyl group, an alkoxy group {the alkoxy group optionally has one or more halogen atoms}, C(O)R 11 the group consisting of a sulfanyl group, a C1-C6 alkylsulfanyl group, an amino group, a C1-C6 alkylamino group, a C2-C6 dialkylamino group, a cyano group, a nitro group, a phenyl group, a 1,2-epoxyethyl group, a (C1-C6 alkyl)carbonyloxy group, a (C1-C6 alkyl)carbonylamino group, and a pyridyl group; R 11 represents a C1-C6 alkyl group, a C1-C6 alkoxy group, a hydroxyl group, or NR 12 R 13 represents R 12 and R 13 are each independently the same or different and represent a C1-C6 alkyl group optionally substituted with one or more halogen atoms or a hydrogen atom.

21. A precursor having a phosphite triester bond represented by formula (II) at the 5' end is prepared by converting a precursor represented by formula (4): (In the formula, G 1 represents a protecting group for a hydroxyl group, 2 are each independently the same or different and represent a hydroxyl-protecting group; a are each independently the same or different and represent a nucleobase which may be protected with a protecting group; R are each independently the same or different and represent a protected hydroxyl group, hydrogen atom, fluorine atom, methoxy group, 2-methoxyethyl group, or OQ' group; Q' are each independently the same or different and represent a methylene group bonded to the 4' carbon atom of ribose, an ethylene group bonded to the 4' carbon atom of ribose, or an ethylidene group bonded to the 4' carbon atom of ribose; Y are each independently the same or different and represent an oxygen atom or a sulfur atom; n represents an integer of 1 to 300; X represents OZ, W represents an OV group, and V represents a protecting group for a hydroxyl group, or X represents an R group, and W represents a group represented by OZ; and Z is a group having a structure consisting of a solid phase support and a linking group. When n is an integer of 2 or more, the nucleic acid compound represented by formula (4) may have a non-nucleotide linker incorporated in place of at least one nucleotide between the 5'-terminal and 3'-terminal nucleotides. (In the formula, G 1 , G 2 , B a , R, n, W, X, and Y are as defined above, and a non-nucleotide linker may be incorporated in place of a nucleotide as defined in formula (4).

22. A nucleic acid represented by formula (5) optionally elongated by the phosphoramidite method to form a nucleic acid represented by formula (5'): (In the formula, G 2 , B a , R, X and W are as defined for formula (5), 5 represents a protecting group for a hydroxyl group or a hydrogen atom, m is an integer satisfying m≧n, and Y's are each independently the same or different and represent an oxygen atom or a sulfur atom, provided that at least one Y is an oxygen atom; (In the formula, G 5 , R and m are as defined above; B c are each independently the same or different and represent a nucleic acid base; 4 represents a hydrogen atom, an alkali metal ion, an ammonium ion, an alkylammonium ion, or a hydroxyalkylammonium ion; each Y is independently the same or different and represents an oxygen atom or a sulfur atom, and at least one Y is an oxygen atom; X represents a hydroxyl group and W represents an OV group, where V represents a protecting group for a hydroxyl group, or X represents an R group and W represents a hydroxyl group. (In the formula, m, Y, G 4 and B c are as defined above, each R' is independently the same or different and represents a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group, each Q' is independently the same or different and represents a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position of ribose, or an ethylidene group bonded to the carbon atom at the 4' position of ribose, and X 10 and W 10 each independently represents a hydroxyl group, or X 10 represents an R' group, and W 10 The method of claim 21 , further comprising the step of preparing a deprotected nucleic acid represented by the formula:

23. The method of any one of claims 1 to 18 or 21 to 22, wherein the nucleic acid is a ribonucleoside (RNA).

24. The nucleic acid is a ribonucleoside (RNA) and its 2' protecting group is represented by formula (12): (wherein q represents an integer of 0 to 5; R a and R b are each independently the same or different and represent a methyl group, an ethyl group, or a hydrogen atom, the bond marked with an * is attached to the oxygen atom of the hydroxyl group at the 2' position of ribose, and E W represents an electron-withdrawing group.

25. q is 0 or 1, and R a and R b are independently the same or different and are a methyl group or a hydrogen atom; E w The method according to claim 24, wherein is a cyano group.

26. The method of any one of claims 1 to 18 or 21 to 22, wherein when the nucleic acid is a ribonucleoside (RNA) and R is a protected hydroxyl group, the protecting group is selected from the group consisting of a 2'-tert-butyldimethylsilyl (TBDMS) group, a 2'-bis(2-acetoxyethoxy)methyl (ACE) group, a 2'-(triisopropylsilyloxy)methyl (TOM) group, a 2'-(2-cyanoethoxy)ethyl (CEE) group, a 2'-(2-cyanoethoxy)methyl (CEM) group, and a 2'-para-tolylsulfonylethoxymethyl (TEM) group.

27. The method of any one of claims 1 to 18 or 21 to 26, wherein the nucleic acid is a ribonucleoside (RNA) having a chain length of 40 or more.

Images