Chimeric antigen receptor for degrading inflammatory cytokine, and recombinant immune cell containing same

By using gene editing of chimeric antigen receptor CAR T cells, the problem of limited half-life of inflammatory cytokines in existing biotherapies has been solved, achieving long-term and efficient targeting and degradation of inflammatory factors, significantly improving disease symptoms, and achieving long-term therapeutic effects, especially in a rheumatoid arthritis model.

WO2025247154A1PCT designated stage Publication Date: 2025-12-04TSINGHUA UNIVERSITY
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/097175
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-05-27
Filing Date
2025-05-26
Publication Date
2025-12-04

AI Technical Summary

Technical Problem

Existing biological therapies, such as antibodies and decoy receptors, used to neutralize inflammatory cytokines have limited half-lives, require frequent administration, increase costs, cause side effects, and may lead to the development of anti-drug antibodies in patients, reducing treatment efficacy.

Method used

Develop chimeric antigen receptor CAR T cells, and use gene editing to enable them to specifically bind to and internalize inflammatory cytokines such as tumor necrosis factor. Utilize CAR T cells to target and degrade soluble factors in vivo for a long period of time, and use gene knockout or gene repression technology to reduce the expression of BCOR and ZC3H12A genes.

Benefits of technology

It enables CAR T cells to target and degrade inflammatory cytokines efficiently and over a long period in vivo, significantly reducing disease symptoms and providing long-term relief, such as demonstrating long-term and highly effective disease prevention and treatment in a rheumatoid arthritis model.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2025097175_04122025_PF_FP_ABST
    Figure CN2025097175_04122025_PF_FP_ABST
Patent Text Reader

Abstract

Provided in the present disclosure are a chimeric antigen receptor for degrading an inflammatory cytokine, and a recombinant immune cell containing same. Specifically, provided is a chimeric antigen receptor, comprising: an extracellular domain, wherein the extracellular domain specifically binds to a soluble factor, preferably an inflammatory cytokine, and more preferably a tumor necrosis factor; a transmembrane domain; and an intracellular signaling domain. Specifically, further provided in the present disclosure is a recombinant immune cell containing the chimeric antigen receptor. The chimeric antigen receptor provided in the present disclosure is a CAR molecule capable of effectively recognizing a soluble factor (such as a tumor necrosis factor, especially TNF-α). The immune cell / recombinant immune cell modified by the molecule can endocytose and degrade a soluble factor (such as TNF) in vitro and in vivo. Moreover, the genetically-modified targeted recombinant cell demonstrates efficacy in disease prevention, long-term high-efficiency treatment and curing a disease.
Need to check novelty before this filing date? Find Prior Art

Description

Chimeric antigen receptors for degrading inflammatory cytokines and recombinant immune cells containing them

[0001] Priority and related applications

[0002] This disclosure claims priority to Chinese Patent Application 202410668738.9, filed on May 27, 2024, entitled “Chimeric antigen receptor for degrading inflammatory cytokines and recombinant immune cells comprising the same,” the entire contents of which, including the appendices, are incorporated herein by reference. Technical Field

[0003] This disclosure belongs to the field of cell technology and relates to chimeric antigen receptors, recombinant immune cells, and their uses. More specifically, this disclosure relates to a chimeric antigen receptor for degrading inflammatory cytokines and recombinant immune cells comprising the receptor. Background Technology

[0004] Abnormal levels of soluble factors such as inflammatory cytokines are associated with many diseases. Neutralizing inflammatory mediators using biologics such as antibodies and decoy receptors is currently a primary approach in biological therapy. Although these biologics are clinically effective, their limited half-life necessitates repeated administration to maintain treatment effectiveness, increasing costs, reducing patient adherence, and impacting quality of life. For example, anti-tumor necrosis factor (TNF) antibodies, widely used to treat conditions such as rheumatoid arthritis (RA), Crohn's disease, and plaque psoriasis, require injections every two weeks, resulting in high annual costs. Repeated protein injections can also cause various side effects, such as injection site reactions and allergic reactions. Furthermore, patients may develop anti-drug antibodies, reducing treatment efficacy.

[0005] Unlike protein drugs, CAR T cells, as in vivo drugs, persist in the body for a longer period, providing long-term remission for cancer patients. Currently, the main mechanism of action of CAR T cells is to eliminate target cells, such as tumor cells. To our knowledge, no studies have yet attempted to use CAR T cells to target inflammatory cytokines for treatment, and there are no reports of CAR T cells degrading soluble molecules. Summary of the Invention

[0006] The problem the invention aims to solve

[0007] To address the aforementioned problems in the prior art, this disclosure provides a chimeric antigen receptor for degrading inflammatory cytokines, recombinant immune cells containing the chimeric antigen receptor, related biomaterials, compositions, and uses.

[0008] Solution for solving the problem

[0009] [1]. A chimeric antigen receptor comprising:

[0010] (A) An extracellular domain that specifically binds soluble factors, preferably, specifically binds inflammatory cytokines, and more preferably, specifically binds tumor necrosis factor.

[0011] (B) Transmembrane domain;

[0012] (C) Intracellular signal transduction domains;

[0013] Preferably, the extracellular domain comprises a polypeptide derived from the tumor necrosis factor receptor superfamily.

[0014] [2]. The chimeric antigen receptor according to [1], wherein the extracellular domain comprises a polypeptide derived from tumor necrosis factor receptor 1;

[0015] Preferably, the tumor necrosis factor receptor 1 comprises the amino acid sequence shown in SEQ ID NO:8.

[0016] [3]. The chimeric antigen receptor according to [1] or [2], wherein the chimeric antigen receptor further comprises a polypeptide derived from CD28, preferably, the CD28 comprising the amino acid sequence shown in SEQ ID NO:9; and / or,

[0017] The chimeric antigen receptor further comprises a polypeptide derived from CD3zeta, preferably CD3zeta comprising the amino acid sequence shown in SEQ ID NO:10.

[0018] [4]. The chimeric antigen receptor according to any one of [1] to [3], wherein the chimeric antigen receptor comprises one or more of the following sequences:

[0019] (a1) The amino acid sequence shown in SEQ ID NO:7;

[0020] (a2) An amino acid sequence having at least 80%, 82%, 85%, 87%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO:7, and having or partially having the function / activity of the amino acid sequence shown in SEQ ID NO:7;

[0021] (a3) An amino acid sequence in which one or more amino acid residues are extracted, added, substituted, deleted, or inserted in the amino acid sequence shown in SEQ ID NO:7, and which has or partially has the function / activity of the amino acid sequence shown in SEQ ID NO:7; or,

[0022] (a4) An amino acid sequence encoded by a nucleotide sequence hybridized under stringent conditions with a polynucleotide sequence encoding the amino acid sequence shown in SEQ ID NO:7, and the amino acid sequence having or partially having the function / activity of the amino acid sequence shown in SEQ ID NO:7, wherein the stringent conditions are moderately stringent, medium-high stringent, high stringent, or very high stringent.

[0023] [5]. A recombinant immune cell, wherein the recombinant immune cell contains a chimeric antigen receptor as described in any one of [1] to [4].

[0024] [6]. The recombinant immune cell according to [5] further comprises a gene regulation system capable of reducing or eliminating the expression and / or function of the BCOR gene and the ZC3H12A gene in the immune cell.

[0025] [7]. Recombinant immune cells according to [5] or [6], wherein the immune cells are derived from mammalian immune cells;

[0026] Optionally, the immune cells are selected from one or more of T cells, B cells, NK cells, mast cells, and tumor-infiltrating lymphocytes;

[0027] Preferably, the immune cells are selected from T cells or NK cells;

[0028] More preferably, the T cells are selected from CD4. + CD8 + T cells, CD8 + T cells, CD4 + T cells, effector T cells, suppressor T cells, primitive T cells, memory T cells, γ-δ T cells, α-β T cells, CD4+ - CD8 - One or more of double-negative T cells or NKT cells.

[0029] [8]. Recombinant immune cells according to any one of [5] to [7], wherein the gene regulation system is used to treat the BCOR gene and ZC3H12A gene in the recombinant immune cells by gene knockout technology, gene silencing technology, inactivation mutation technology, PROTAC technology or small molecule inhibitor.

[0030] [9]. A biomaterial, wherein the biomaterial comprises at least one of the following: b1) to b3):

[0031] b1) A polynucleotide encoding a chimeric antigen receptor as described in any of [1] to [4];

[0032] b2) A carrier containing the polynucleotides described in b1);

[0033] b3) Cells containing the carrier described in b2).

[0034]

[0010] . A composition comprising a chimeric antigen receptor as described in any one of [1] to [4], a recombinant immune cell as described in any one of [5] to [8], and / or a biomaterial as described in [9]; and optionally, a pharmaceutically acceptable carrier.

[0035]

[0011] . Use of the chimeric antigen receptor as described in any one of [1] to [4], the recombinant immune cells as described in any one of [5] to [8], and / or the biomaterials as described in [9] in the preparation of medicaments for the treatment and / or prevention of diseases or conditions;

[0036] The disease or symptom is selected from those related to soluble factors, preferably inflammatory cytokines, more preferably tumor necrosis factors, or those with soluble factors, preferably inflammatory cytokines, more preferably tumor necrosis factors as therapeutic targets.

[0037] Optionally, diseases associated with or targeting tumor necrosis factor include rheumatoid arthritis, intestinal inflammation (e.g., Crohn's disease, ulcerative colitis), dermatitis (e.g., plaque psoriasis, hidradenitis pustulosa), ankylosing spondylitis, psoriatic arthritis, juvenile idiopathic arthritis, uveitis, and non-radiological axial spondyloarthritis.

[0038]

[0012] . Use of the chimeric antigen receptor as described in any one of [1] to [4], the recombinant immune cells as described in any one of [5] to [8], and / or the biomaterial as described in [9] in the degradation of soluble factors or in the preparation of reagents for the degradation of soluble factors; preferably, the soluble factors comprise inflammatory cytokines; more preferably, the inflammatory cytokines comprise tumor necrosis factor.

[0039]

[0013] . A method for degrading soluble factors, comprising the step of contacting a chimeric antigen receptor as described in any one of [1] to [4], a recombinant immune cell as described in any one of [5] to [8], and / or a biological material as described in [9] with the soluble factors; preferably, the soluble factors comprise inflammatory cytokines; more preferably, the inflammatory cytokines comprise tumor necrosis factor.

[0040] The effects of the invention

[0041] In some embodiments of this disclosure, a chimeric antigen receptor (CAR) is provided, which is a CAR molecule that can effectively recognize soluble factors and inflammatory cytokines, such as tumor necrosis factor, especially TNF-α. Immune cells / recombinant immune cells (e.g., T cells / recombinant T cells) modified with this molecule can endocytose and degrade soluble factors and bind inflammatory cytokines, such as TNF, in vitro and in vivo.

[0042] In some embodiments of this disclosure, a recombinant immune cell is provided to edit T cells by gene knockout or gene repression, enabling them to form CAR T cells that target disease-related soluble factors and inflammatory cytokines (e.g., TNF) in vivo for a long period of time and with high efficiency through a chimeric receptor based on antibodies / receptors that bind soluble factors and inflammatory cytokines (e.g., tumor necrosis factor receptor 1, TNFR1), and to be used for the prevention and treatment of related diseases.

[0043] In some specific implementation schemes, in RA disease models, the genetically modified targeted recombinant cells provided in this disclosure have demonstrated efficacy in disease prevention, long-term and highly effective treatment, and cure of the disease. Attached Figure Description

[0044] Figure 1. TNFR1 CAR T cells expand in vitro upon TNF stimulation and then endocytose and degrade TNF.

[0045] Figure 1a shows the schematic diagram of the TNFR1 CAR design. Figure 1b shows the schematic diagram of the interaction between TNF and TNFR1 CAR. Figure 1c shows the schematic diagram of the co-expression vector of Thy1.1 tag and TNFR1 CAR. Figure 1d shows flow cytometry analysis demonstrating that TNFR1 CAR T cells simultaneously express Thy1.1 and TNFR1 CAR. Figure 1e shows flow cytometry analysis showing that RFP-TNF binds to TNFR1 CAR T cells but not to control HER2 CAR T cells. Figure 1f and g show the expression of CD69 on the indicated CAR T cells 24 hours after RFP-TNF stimulation. Figure 1f is a representative plot and g is statistical data (n = 3 independent experiments). Figure 1h shows the relative expansion of CAR T cells in the presence of the indicated TNF concentration. Representative data from 3 independent experiments are shown. Figure 1i shows the experimental design for TNFR1 CAR T cells to bind TNF in vitro. Figure 1 shows j and k, representative flow cytometry analyses of TNFR1 expression on the surface of TNFR1 CAR T cells after specified treatment (j) and statistical data (k). Figure 1 shows l and m, representative flow cytometry analyses of RFP signaling (TNF) in TNFR1 CAR T cells after specified treatment (l) and statistical data (m). In Figure 1, k and m represent independent experimental data for each group (n=3), presented as mean ± standard error (mean ± SEM), analyzed using one-way ANOVA multiple-comparisons test. In Figure 1, n and o represent the results of incubation on ice for 20 minutes (control, marked 0 hours) and incubation at 37°C for 24 hours (marked 24 hours). Immunofluorescence imaging was used to detect RFP-TNF localization in TNFR1 CAR T cells. n is a representative fluorescence imaging image, and o is the quantitative analysis of fluorescence signal plotted along the line in the displayed cells.

[0046] Figure 2. TNFR1 CAR T cells do not proliferate in vivo.

[0047] Figure 2 shows that 16 days after TNFR1 CAR T cell infusion into B6 mice, Thy1.1-positive CAR T cells accounted for a significant proportion of CD8+ in the peripheral blood. + The percentage of T cells. Figure 2a shows a schematic diagram of the experimental design, b is a representative flow cytometry plot, and c is a statistical data plot (6 mice per group). Data are expressed as mean ± standard error (mean ± SEM) and are all tested using the two-tailed unpaired Student's t test.

[0048] Figure 3. Preparation of recombinant TNFR1 CAR-T cells with Bcor and / or Zc3h12a knocked out.

[0049] Figure 3a shows the experimental design, activating CD8. + T cells were transduced with a retrovirus carrying a TNFR1 CAR containing a specified sgRNA. 72 hours post-infection, DNA sequencing was used to examine gene editing of Bcor and Zc3h12a. Figure 3b shows the construction diagram of the control NT, Bcor, and / or Zc3h12a gene knockout TNFR1 CAR vector. Figure 3c shows the DNA sequencing results of the sgBcor and sgZc3h12a edited regions, demonstrating successful editing of the Bcor and / or Zc3h12a genes.

[0050] Figure 4. Knockout of BCOR and ZC3H12A TNFR1T (TNFR1T) BZ It expands and persists in mice.

[0051] Figure 4a and b show the percentage of Thy1.1-positive CAR T cells in the peripheral blood of B6 mice two weeks after the gene knockout TNFR1 T cells were reinfused, as indicated in the figure. + Flow cytometry plots (a) and (b) showing the percentage of T cells, with n = 6 mice per group. Data are expressed as mean ± standard error (mean ± SEM) and analyzed using one-way ANOVA multiple-comparisons test. In Figure 4, c and d represent TNFR1T cells. BZ After cell reinfusion into B6 mice for 14, 182, and 362 days, the percentage of Thy1.1-positive CAR T cells in the peripheral blood of CD8+ cells was significantly higher. + Flow cytometry representation of T cell percentage (c) and statistical data (d) (n=6 mice per group); e and f in Figure 4 represent TNFR1T BZ CD44 levels in peripheral blood of B6 mice 14, 182, and 362 days after cell reinfusion + CD62L + and CD44 + CD62L - Cells account for CD8 + The representative plot (e) and statistical plot (f) of the percentage of T cells, with n = 6 mice in each group. The data are expressed as mean ± standard error (mean ± SEM) and are presented using two-way ANOVA multiple-comparisons test.

[0052] Figure 5, TNFR1T BZ Cells provided long-term relief for rheumatoid arthritis mediated by female hTNF transgenic mice.

[0053] Figure 5a shows the experimental design of female hTNF transgenic mice before the onset of rheumatoid arthritis; Figure 5b shows the clinical scores of rheumatoid arthritis in hTNF transgenic mice and B6 mice receiving the specified treatment (n=6 mice per group); Figure 5c shows the weight data of hTNF transgenic mice and B6 mice receiving the specified treatment (n=6 mice per group); Figure 5d shows the grip strength data of hTNF transgenic mice and B6 mice receiving the specified treatment (n=6 mice per group); Figure 5e shows a photograph of the forepaw of hTNF transgenic mice and B6 mice at 20 weeks of age after receiving the specified treatment; Figure 5f shows a micro-computed tomography image of the forepaw of hTNF transgenic mice and B6 mice at 20 weeks of age after receiving the specified treatment. Figure 5g shows the experimental design of female hTNF transgenic mice after the onset of rheumatoid arthritis; Figure 5h shows the clinical scores of rheumatoid arthritis in hTNF transgenic mice and B6 mice receiving the specified treatment (n=6 mice per group). Figure 5i shows the grip strength data of hTNF transgenic mice and B6 mice that received the specified treatment (n=6 mice in each group); the data in Figure 5b, c, d, h, and i represent the mean ± standard error (mean±SEM) from two independent experiments, the p-value, ns indicates no significance, and the two-way ANOVA multiple-comparisons test is used.

[0054] Figure 6, TNFR1T BZ Cells provided long-term relief for rheumatoid arthritis mediated in male hTNF transgenic mice.

[0055] Figure 6a shows the experimental design for treating rheumatoid arthritis in male hTNF transgenic mice before the onset of the disease; Figure 6b shows the clinical scores of rheumatoid arthritis in hTNF transgenic mice and B6 mice receiving different treatments (n=6 mice per group); Figure 6c shows the grip strength of hTNF transgenic mice and B6 mice receiving different treatments (n=6 mice per group); Figure 6d shows the experimental design for treating rheumatoid arthritis in male hTNF transgenic mice after the onset of the disease; Figure 6e shows the clinical scores of rheumatoid arthritis in hTNF transgenic mice and B6 mice under different treatments (n=6 mice per group); Figure 6f shows the grip strength of hTNF transgenic mice and B6 mice receiving different treatments at 20 weeks (n=4 mice per group); Data in Figures 6b, c, e, and f are expressed as mean ± standard error (mean ± SEM); Figures 6b, c, and e show two-way ANOVA multiple-comparisons test.

[0056] Figure 7, TNFR1T BZCells internalize and degrade TNF via TNFR1 CAR.

[0057] Figure 7a shows TNFR1 or TNFR1T prepared by reinfusion into B6 mice and hTNF transgenic mice at 6 weeks of age. BZ Cells, serum hTNF levels at 22 weeks of age (n=5 mice per group); Figure 7b shows the experimental design of the TNF endocytosis assay; Figure 7c and d show TNFR1T levels after specified treatments. BZ Representative plots (c) and statistical data (d) of RFP signaling (TNF) in Figure 7 are presented as flow cytometry analysis. Data from each group (n=3) of independent experiments are presented as mean ± standard error (mean ± SEM). One-way ANOVA multiple-comparisons test was performed. Figures e and f in Figure 7 show incubation on ice for 20 minutes (control, marked 0 hours) and incubation at 37°C for 24 hours (marked 24 hours) for TNFR1T. BZ RFP-TNF localization was detected by immunofluorescence imaging. c is a representative fluorescence imaging image, and f is the quantitative analysis of the fluorescence signal drawn along the line in the displayed cells.

[0058] Figure 8, TNFR1T BZ A schematic diagram of TNF degradation. Detailed Implementation

[0059] [Terminology Definition]

[0060] In this specification, the range of values ​​referred to as "value A to value B" refers to the range including the endpoint values ​​A and B.

[0061] In this specification, the word "may" has two meanings: to perform a certain process and not to perform a certain process.

[0062] In this specification, "optional" or "optionally" means that the event or situation described below may or may not occur, and the description includes both the scenario in which the event occurs and the scenario in which the event does not occur.

[0063] In this specification, references to "some specific / preferred embodiments," "other specific / preferred embodiments," "implementation," etc., refer to specific elements (e.g., features, structures, properties, and / or characteristics) related to that embodiment, which are included in at least one of the embodiments described herein and may or may not be present in other embodiments. Furthermore, it should be understood that these elements may be combined in any suitable manner in various embodiments.

[0064] In this specification, the term "and / or" when used to connect two or more options should be understood to mean any one of the options or any two or more of the options.

[0065] According to this disclosure, the terms “polypeptide,” “protein,” and “peptide” are used interchangeably herein to refer to a polymeric form of amino acids of any length, including encoded and non-coding amino acids, chemically or biochemically modified or derived amino acids, and polypeptides having a similar peptide backbone.

[0066] According to this disclosure, the terms "nucleic acid molecule," "polynucleotide," "polynucleotide," and "nucleic acid" are used interchangeably to refer to a polymeric form of nucleotides of any length, whether deoxyribonucleotides or ribonucleotides, or analogs thereof. Polynucleotides can have any three-dimensional structure and can perform any known or unknown function. Non-limiting examples of polynucleotides include genes, gene fragments, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, control regions, isolated RNA of any sequence, nucleic acid probes, and primers. Nucleic acid molecules can be linear or circular.

[0067] According to this disclosure, the three-letter and single-letter codes for amino acids used are as described in J. biol. chem, 243, p3558 (1968).

[0068] According to this disclosure, an amino acid "addition" refers to the addition of an amino acid to the C-terminus or N-terminus of an amino acid sequence. According to this disclosure, an amino acid "deletion" refers to the deletion of one, two, or three or more amino acids from an amino acid sequence. According to this disclosure, an amino acid "insertion" refers to the insertion of an amino acid residue at an appropriate position in an amino acid sequence; the inserted amino acid residues may be all or partly adjacent to each other, or none of the inserted amino acids may be adjacent to each other.

[0069] According to this disclosure, an amino acid "substitution" refers to the replacement of an amino acid residue at a certain position in an amino acid sequence by another amino acid residue; wherein, "substitution" can be a conserved amino acid substitution.

[0070] According to this disclosure, "conservative modification," "conservative substitution," or "conservative replacement" refers to the replacement of an amino acid in a protein with another amino acid having similar characteristics (e.g., charge, side chain size, hydrophobicity / hydrophilicity, main chain conformation, and rigidity), such that it can be frequently altered without changing the protein's biological activity. Those skilled in the art will appreciate that, in general, the substitution of a single amino acid in a non-essential region of a polypeptide does not substantially alter its biological activity (see, for example, Watson et al. (1987), Molecular Biology of the Gene, The Benjamin / Cummings Pub. Co., p. 224, (4th edition)). Furthermore, the substitution of structurally or functionally similar amino acids is unlikely to impair biological activity. Exemplary conserved substitutions are described in the following "Exemplary Conservative Amino Acid Substitutions."

[0071] Exemplary amino acid conservative substitution

[0072] "Identity" refers to the sequence similarity between two polynucleotide sequences or two polypeptides. When positions in two compared sequences are occupied by the same base or amino acid monomer subunit—for example, if every position in two DNA molecules is occupied by adenine—then the molecules are homologous at that position. The percentage of identity between two sequences is a function of the number of matching or homologous positions shared by the two sequences divided by the number of positions compared, multiplied by 100%. For example, at optimal sequence alignment, if six out of ten positions in two sequences match or are homologous, then the two sequences are 60% homologous. Generally, comparisons are made when the highest percentage of identity is obtained by aligning the two sequences.

[0073] According to this disclosure, "moderate to very high stringency conditions" includes "moderate stringency conditions," "moderate to high stringency conditions," "high stringency conditions," or "very high stringency conditions," which describe the conditions for nucleic acid hybridization and washing. For guidance on performing hybridization reactions, see Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1–6.3.6, which is incorporated herein by reference. Aqueous and non-aqueous methods are described in that literature, and either can be used. For example, specific hybridization conditions are as follows: (1) Low-toughness hybridization conditions: 6× sodium chloride / sodium citrate (SSC) at about 45°C, then at at least 50°C, washed twice in 0.2× SSC, 0.1% SDS (for low-toughness conditions, the washing temperature can be increased to 55°C); (2) Medium-toughness hybridization conditions: 6× SSC at about 45°C, then at 60°C, washed once or more in 0.2× SSC, 0.1% SDS; (3) High-toughness hybridization conditions: 6× SSC at about 45°C, then at 65°C, washed once or more in 0.2× SSC, 0.1% SDS, preferably; (4) Very high-toughness hybridization conditions: 0.5M sodium phosphate, 7% SDS at 65°C, then at 65°C, washed once or more in 0.2× SSC, 1% SDS.

[0074] "Administration," "giving," and "treatment," when applied to animals, humans, experimental subjects, cells, tissues, organs, or biological fluids, refer to the contact of an exogenous drug, therapeutic agent, diagnostic agent, or composition with the animal, human, subject, cell, tissue, organ, or biological fluid. "Administration," "giving," and "treatment" can refer to, for example, therapeutic, pharmacokinetic, diagnostic, research, and experimental methods. Cellular treatment includes contact between a reagent and cells, as well as contact between a reagent and a fluid, wherein the fluid is in contact with the cells. "Administration," "giving," and "treatment" also mean the treatment of, for example, cells, by means of a reagent, diagnostic agent, conjugate composition, or by means of another cell in vitro and ex vivo. "Treatment," when applied to humans, veterinary, or research subjects, refers to therapeutic, preventative, or prophylactic measures, research, and diagnostic applications.

[0075] "Treatment" means administering an oral or topical therapeutic agent, such as recombinant immune cells comprising this disclosure, to a patient who has symptoms of one or more diseases, and the therapeutic agent is known to have a therapeutic effect on these symptoms. Typically, a therapeutic agent is administered in a treated patient or population in an amount that effectively relieves symptoms of one or more diseases, whether by inducing the regression of such symptoms or inhibiting their progression to any clinically measurable extent. The amount of therapeutic agent that effectively relieves any specific disease symptom (also referred to as the "therapeuticly effective amount") can vary depending on a variety of factors, such as the patient's disease state, age, and weight, and the drug's ability to produce the desired therapeutic effect in the patient. Whether the disease symptoms have been relieved can be evaluated using any clinical test that a physician or other healthcare professional typically uses to assess the severity or progression of the symptoms.

[0076] In this specification, the term "prevention" refers to preventive treatment for subjects who currently do not have or have not had any disease but are at risk of developing it, or who have had a disease in the past but are currently not at risk of relapse. In some implementations, subjects have a higher risk of developing a disease or a higher risk of disease relapse compared to the average healthy member of the subject population.

[0077] An "effective dose" includes a dose sufficient to improve or prevent the symptoms or condition of a medical condition. An effective dose also means a dose sufficient to allow or facilitate diagnosis. The effective dose for a particular patient or veterinary subject can vary depending on factors such as the condition to be treated, the patient's overall health, the route and dosage of administration, and the severity of side effects. An effective dose can be the maximum dose or administration regimen that avoids significant side effects or toxicity.

[0078] In this specification, "therapeutic effective amount" is an amount sufficient to provide therapeutic benefit in the treatment of a condition or sufficient to delay or minimize one or more symptoms associated with a condition. A therapeutic effective amount refers to the amount of a therapeutic agent, alone or in combination with other therapies, that provides therapeutic benefit in the treatment of a condition. The term "therapeutic effective amount" may include amounts that improve overall therapy; reduce or avoid symptoms, signs, or causes of a condition; and / or enhance the therapeutic efficacy of another therapeutic agent.

[0079] In this specification, "preventive effective amount" is an amount sufficient to prevent the condition or one or more symptoms associated with the condition, or to prevent its recurrence. A preventive effective amount refers to the amount of a therapeutic agent, alone or in combination with other agents, that provides preventive benefit in preventing the condition. The term "preventive effective amount" may also include amounts that improve overall prevention or enhance the preventive efficacy of another preventive agent.

[0080] In this specification, "pharmaceutical composition" or "composition" means containing one or more recombinant immune cells as described herein, as well as other components such as physiological / pharmaceutical-grade carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration to a living organism, thereby promoting the absorption of the active ingredient and the exertion of its biological activity.

[0081] In this specification, the term "pharmaceutical acceptable" (or "pharmacologically acceptable", "medicinal") means a molecular entity or composition that, when appropriate, does not produce an adverse reaction, allergic reaction, or other adverse reaction when administered to animals or humans. As used herein, the term "pharmaceutical acceptable carrier" includes any and all solvents, dispersion media, coatings, antimicrobial agents, isotonic agents and absorption delay agents, buffers, excipients, binders, lubricants, gels, surfactants, etc., that can be used as a medium for pharmaceutically acceptable substances.

[0082] The terms "BCOR gene" and "Bcor gene" can be used interchangeably unless otherwise specified. The "BCOR gene" refers to the BCOR gene of any target subject.

[0083] The terms “ZC3H12A gene” and “Zc3h12a gene” can be used interchangeably unless otherwise specified. The “ZC3H12A gene” refers to the “ZC3H12A gene” of any target subject.

[0084] "Subject" or "host" refers to a human or non-human animal, including mammals. Examples include primates (such as humans and monkeys), cattle, sheep, goats, alpacas, horses, dogs, cats, rabbits, rats, and mice. "Subject" or "host" can be therapeutic or non-therapeutic. "Subject" or "host" includes experimental animal models or animals used to produce biomolecules expressing therapeutic diseases; these are "non-therapeutic hosts" or "non-therapeutic subjects."

[0085] [Detailed Description of the Invention]

[0086] This disclosure provides a chimeric antigen receptor, recombinant immune cells, related biomaterials, compositions, and uses. The recombinant immune cells are created by editing T cells through gene knockout or gene repression, enabling them to form CAR T cells that highly and long-term target disease-related soluble factors and inflammatory cytokines (e.g., tumor necrosis factor receptor 1) in vivo via a chimeric receptor based on antibodies / receptors that bind soluble factors and inflammatory cytokines (e.g., TNF). These CAR T cells are used for the prevention and treatment of related diseases. For example, in a RA disease model, these genetically modified targeting recombinant cells have demonstrated long-term, highly effective treatment and disease-curing efficacy.

[0087] Chimeric antigen receptor (CAR)

[0088] In some aspects disclosed herein, a chimeric antigen receptor is provided, comprising:

[0089] (A) An extracellular domain that specifically binds to soluble factors, preferably, specifically binds to inflammatory cytokines, more preferably, specifically binds to tumor necrosis factors;

[0090] (B) Transmembrane domain;

[0091] (C) Intracellular signal transduction domains.

[0092] In some specific embodiments, this disclosure provides a chimeric antigen receptor comprising:

[0093] (a) A polypeptide derived from the tumor necrosis factor receptor superfamily;

[0094] (b) Peptides derived from CD28; and,

[0095] (c) Peptides derived from CD3zeta.

[0096] (Extracellular domain)

[0097] In the context of biochemistry, soluble factors refer to molecules or compounds that can dissolve in an organism and exert specific biological functions. These factors play a crucial role in maintaining life processes or regulating various physiological functions within an organism. They include proteins, polypeptides, nucleic acids, metabolites, and other biomolecules such as cytokines, growth factors, hormones, enzymes, signaling molecules, and metabolic molecules. These biosoluble factors play important roles in biological processes such as intercellular communication, growth and development, immune regulation, and metabolic regulation.

[0098] In the context of public discourse, inflammatory cytokines refer to biomolecules produced or involved in regulating the inflammatory process during inflammation. Inflammatory cytokines include various cytokines, chemical mediators, and cell surface receptors, all of which play crucial roles in regulating inflammatory responses. The production and release of inflammatory cytokines are typically part of the body's physiological response to infection, injury, or other stimuli, aiming to eliminate pathogens, repair tissue damage, and restore tissue function. These include cytokines, chemokines, and reactive proteins.

[0099] In some embodiments, the soluble factor or the inflammatory cytokine includes tumor necrosis factor.

[0100] In some embodiments, the tumor necrosis factor includes one or more of TNF-α and TNF-β. In some embodiments, the tumor necrosis factor includes TNF-α. In some more preferred embodiments, the tumor necrosis factor is TNF-α.

[0101] In some implementations, the extracellular domains that specifically bind soluble factors and inflammatory cytokines may include antibodies or antigen-binding fragments thereof that specifically recognize and bind the corresponding soluble factors and inflammatory cytokines, or receptors.

[0102] In existing technologies, the main working mechanism of CAR T cells is to eliminate target cells, such as tumor cells. This disclosure innovatively discovers that immune cells / recombinant immune cells (e.g., T cells / recombinant T cells) modified with the CAR molecules provided herein can endocytose and degrade soluble factors and bind to inflammatory cytokines in vitro and in vivo, thereby exerting factor-related disease prevention and treatment effects.

[0103] In some embodiments, the extracellular domain comprises a polypeptide derived from the tumor necrosis factor receptor superfamily. In some embodiments, the extracellular domain comprises a polypeptide derived from tumor necrosis factor receptor 1. In some specific embodiments, the extracellular domain comprises a full-length tumor necrosis factor receptor 1 polypeptide as a target recognition domain.

[0104] In some specific embodiments, the amino acid sequence of the full-length polypeptide of tumor necrosis factor receptor 1 is shown in SEQ ID NO:8. The tumor necrosis factor receptor 1 used as part of the extracellular domain in the chimeric antigen receptor provided in this disclosure can simultaneously recognize human TNF-α and mouse TNF-α.

[0105] In some embodiments, the extracellular domain further includes the juxtamembrane terminus of CD28, i.e., the juxtamembrane terminus of CD28 is combined with the full-length polypeptide derived from the aforementioned tumor necrosis factor receptor 1 molecule as the target recognition structure as the extracellular domain (extracellular segment).

[0106] (Transmembrane domain)

[0107] In some embodiments, the transmembrane domain comprises a transmembrane domain derived from the following proteins: the α, β or ζ chain of the T cell receptor, CD28, CD3e, CD45, CD4, CD5, CD8a, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137 and CD154.

[0108] In some specific implementations, the transmembrane domain includes a transmembrane domain derived from CD28.

[0109] (Intracellular signal transduction domain)

[0110] In some embodiments, intracellular signaling domains may include primary intracellular signaling domains. Example primary intracellular signaling domains include those derived from molecules responsible for primary or antigen-dependent stimulation. In one embodiment, intracellular signaling domains may include co-stimulatory intracellular domains. Example co-stimulatory intracellular signaling domains include those derived from molecules responsible for co-stimulatory signals or antigen-independent stimulation. For example, in the case of CAR-T, the primary intracellular signaling domain may contain a cytoplasmic sequence of a T cell receptor, and the co-stimulatory intracellular signaling domain may contain a cytoplasmic sequence from a co-receptor or co-stimulatory molecule.

[0111] In some implementations, the primary intracellular signaling domain may contain a signaling motif, referred to as an immune receptor tyrosine-based activation motif or ITAM. Examples of primary cytoplasmic signaling sequences containing ITAMs include, but are not limited to, those derived from CD3-ζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d, DAP10, and DAP12.

[0112] In this disclosure, “ζ” or alternatively “ζ chain”, “CD3-ζ”, “TCR-ζ” or “CD3 zeta” is defined as a protein provided with GenBank accession number BAG36664.1, or an equivalent residue from a non-human species (e.g., mouse, rabbit, primate, rodent, monkey, ape, etc.), and “ζ-stimulatory domain” or alternatively “CD3-ζ-stimulatory domain” or “TCR-ζ-stimulatory domain” is defined as an amino acid residue from the cytoplasmic domain of the ζ chain sufficient to functionally transmit the initial signal necessary for T cell activation.

[0113] In this disclosure, "co-stimulatory molecules" refer to homologous binding partners on T cells that specifically bind to co-stimulatory ligands, thereby mediating co-stimulatory responses of T cells, such as, but not limited to, proliferation. Co-stimulatory molecules are cell surface molecules other than antigen receptors or their ligands required for an effective immune response. Co-stimulatory molecules include, but are not limited to, MHC class I molecules, BTLA and Toll ligand receptors, as well as OX40, CD2, CD27, CD28, CDS, ICAM-1, LFA-1 (CD11a / CD18), and 4-1BB (CD137).

[0114] The intracellular signal transduction domain of a costimulatory molecule can be the intracellular portion of that molecule. Costimulatory molecules can be represented by the following protein families: TNF receptor proteins, immunoglobulin-like proteins, cytokine receptors, integrins, signal transduction lymphocyte-activating molecules (SLAM proteins), and activated NK cell receptors. Examples of such molecules include CD27, CD28, 4-1BB (CD137), OX40, GITR, CD30, MyD88, CD40, ICOS, BAFFR, HVEM, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, SLAMF7, NKp80, CD160, B7-H3, and ligands that specifically bind to CD83, etc.

[0115] In some specific implementations, the intracellular domains of CD28 and CD3 zeta are combined as the intracellular signal transduction domain (the intracellular region of signal transduction) of the CAR.

[0116] In this disclosure, the design of the CD28 molecule as an extracellular hinge segment (or juxtamembrane end or extracellular segment / extracellular domain; as part of an extracellular structural domain), a transmembrane segment (transmembrane structural domain / transmembrane structural region), and an intracellular segment (as part of an intracellular signal transduction structural domain) results in a chimeric antigen receptor-mediated signal transduction level that is stronger (compared to other designs) and a more significant killing ability, leading to higher clearance efficiency of target cells. In some specific embodiments of this disclosure, the amino acid sequence of the CD28 molecule is shown in SEQ ID NO:9.

[0117] In this disclosure, the intracellular CD3zeta segment used in the intracellular signal transduction domain contains three ITAM motifs to maximize signal levels. In some specific embodiments of this disclosure, the amino acid sequence of the CD3zeta molecule is shown in SEQ ID NO:10.

[0118] (TNFR1 chimeric antigen receptor)

[0119] In some preferred embodiments of this disclosure, a TNFR1 chimeric antigen receptor (TNFR1 CAR) is provided, which is a CAR molecule that can effectively recognize TNF-α. Immune cells / recombinant immune cells (e.g., T cells / recombinant T cells) modified with this molecule can internalize and degrade TNF in vitro and in vivo.

[0120] In some embodiments, the chimeric antigen receptor comprises one or more of the following sequences:

[0121] (a1) The amino acid sequence shown in SEQ ID NO:7;

[0122] (a2) An amino acid sequence having at least 80%, 82%, 85%, 87%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in SEQ ID NO:7, and having or partially having the function / activity of the amino acid sequence shown in SEQ ID NO:7;

[0123] (a3) An amino acid sequence in which one or more amino acid residues are extracted, added, substituted, deleted, or inserted in the amino acid sequence shown in SEQ ID NO:7, and which has or partially has the function / activity of the amino acid sequence shown in SEQ ID NO:7; or,

[0124] (a4) An amino acid sequence encoded by a nucleotide sequence hybridized under stringent conditions with a polynucleotide sequence encoding the amino acid sequence shown in SEQ ID NO:7, and the amino acid sequence having or partially having the function / activity of the amino acid sequence shown in SEQ ID NO:7, wherein the stringent conditions are moderately stringent, medium-high stringent, high stringent, or very high stringent.

[0125] <Biomaterials>

[0126] In some aspects, this disclosure provides a biomaterial, wherein the biomaterial comprises at least one of the following b1) to b3):

[0127] b1) Encodes a polynucleotide for the chimeric antigen receptor as described above;

[0128] b2) A carrier containing the polynucleotides described in b1);

[0129] b3) Cells containing the carrier described in b2).

[0130] In some embodiments, a polynucleotide is provided that encodes the chimeric antigen receptor disclosed herein.

[0131] The polynucleotides disclosed herein can be in the form of DNA or RNA. The DNA form includes cDNA, genomic DNA, or artificially synthesized DNA. The DNA can be single-stranded or double-stranded. The DNA can be a coding strand or a non-coding strand.

[0132] The polynucleotides encoding the chimeric antigen receptor disclosed herein include: a coding sequence that encodes only the chimeric antigen receptor; a coding sequence for the chimeric antigen receptor and various additional coding sequences; a coding sequence for the chimeric antigen receptor (and optional additional coding sequences); and a non-coding sequence.

[0133] The term "polynucleotide encoding a chimeric antigen receptor" can include a polynucleotide encoding the chimeric antigen receptor or it can include additional coding and / or non-coding sequences.

[0134] This disclosure also relates to polynucleotides that hybridize with the above-described sequences and have at least 50%, preferably at least 70%, and more preferably at least 80% identity between the two sequences. This disclosure particularly relates to polynucleotides that hybridize with the polynucleotides described herein under stringent conditions. These stringent conditions are moderately stringent, medium-high stringent, high stringent, or very high stringent conditions.

[0135] In some embodiments, an expression vector is provided that contains the polynucleotides of this disclosure.

[0136] In some embodiments, a cell is provided that contains the expression vector of this disclosure.

[0137] In some specific implementation schemes, the cells are immune cells. The source and types of these immune cells can be found in the detailed description of related immune cells in the recombinant immune cell section below.

[0138] <Recombinant Immune Cells>

[0139] In some aspects of this disclosure, a recombinant immune cell is provided, said recombinant immune cell comprising:

[0140] (i) one or more structures for adoptive cell therapy;

[0141] (ii) Gene regulatory systems capable of reducing or eliminating the expression and / or function of the BCOR gene and the ZC3H12A gene in immune cells;

[0142] The structure-specific binding soluble factor used for adoptive cell therapy is preferably specifically binding to inflammatory cytokines, and more preferably specifically binding to tumor necrosis factor.

[0143] (Immune cells)

[0144] In some implementations, the recombinant immune cells are immune cells derived from mammals.

[0145] The mammals mentioned include, but are not limited to, primates (such as humans and monkeys), cattle, sheep, goats, alpacas, horses, dogs, cats, rabbits, rats, mice, etc.

[0146] In this disclosure, there are no specific limitations on the types of immune cells. In some embodiments, the immune cells are selected from one or more of T cells, B cells, NK cells, mast cells, and tumor-infiltrating lymphocytes. In some preferred embodiments, the immune cells are selected from T cells or NK cells. In some specific embodiments, the T cells are selected from CD4+ cells. + CD8 + T cells, CD8 + T cells, CD4 + T cells, effector T cells, suppressor T cells, primitive T cells, memory T cells, γ-δ T cells, α-β T cells, CD4+ - CD8 - One or more of double-negative T cells or NKT cells. In some preferred embodiments, the T cells are CD8+ cells. + T cells.

[0147] In some specific implementations, the recombinant immune cells are recombinant T cells.

[0148] The recombinant T cells described above do not contain the BCOR gene and the ZC3H12A gene, or the biological functions of the BCOR gene products and the ZC3H12A gene products of the recombinant T cells are suppressed.

[0149] The recombinant T cells mentioned above are formed by knocking out the BCOR gene and ZC3H12A gene of the target T cells and modifying them with chimeric antigen receptor (e.g., TNFR1 CAR) molecules to form the final version of recombinant T cells.

[0150] In the aforementioned recombinant T cells, the target T cells are CD8 cells. + T cells or other types of T cells.

[0151] As will be detailed later, in the above-mentioned recombinant T cells, the knockout refers to knocking out the BCOR gene and ZC3H12A gene of the target T cell by CRISPR-Cas9 or other methods, or inhibiting the function of the BCOR gene product and ZC3H12A gene product by other methods.

[0152] In the aforementioned recombinant T cells, the target sequence targeting the BCOR gene when knocking out the BCOR gene in the target T cells using the CRISPR-Cas9 method is SEQ ID NO:3; the target sequence targeting the ZC3H12A gene when knocking out the ZC3H12A gene in the target T cells using the CRISPR-Cas9 method is SEQ ID NO:4. Further, the recombinant cells are constructed by introducing a vector containing the target sequence targeting the BCOR gene during knockout, the target sequence targeting the ZC3H12A gene, and an expression of the TNFR1 CAR structure into the target T cells. More specifically, the recombinant cells are constructed by introducing pMIG-hU6-sgBcor-hU6-sgZc3h12a-EFS-Thy1.1-P2A-TNFR1-CAR into the target CD8+. + Cells obtained from T cells. For example, the target is CD8. + T cells were derived from the spleen of Cas9 transgenic mice (from Jaxson Laboratory, #026430), specifically CD8 cells. + T cells.

[0153] (Gene regulatory system)

[0154] The recombinant immune cells contain a gene regulatory system capable of reducing or eliminating the expression and / or function of the BCOR and ZC3H12A genes in immune cells, thereby reducing or eliminating the expression and / or function of the BCOR and ZC3H12A genes in the recombinant immune cells. Exemplarily, the recombinant T cells do not contain the BCOR and ZC3H12A genes, or the biological functions of the BCOR and ZC3H12A gene products of the recombinant T cells are suppressed.

[0155] Exemplary information regarding the BCOR gene and the ZC3H12A gene can be found in Table 1 below.

[0156] Table 1. Information on BCOR and ZC3H12A genes.

[0157] Specifically, in this disclosure, the human BCOR gene (Gene ID: 54880, updated May 29, 2022, https: / / www.ncbi.nlm.nih.gov / gene / 54880) and the mouse Bcor gene (Gene ID: 71458, updated May 22, 2022, https: / / www.ncbi.nlm.nih.gov / gene / 71458) encode the cellular transcriptional repressor BCOR. The human ZC3H12A gene (Gene ID: 80149, updated May 22, 2022, https: / / www.ncbi.nlm.nih.gov / gene / 80149) and the mouse Zc3h12a gene (Gene ID: 230738, updated May 22, 2022, https: / / www.ncbi.nlm.nih.gov / gene / 230738) encode the protein ZC3H12A, which is involved in mRNA degradation in cells. All of the above genes are incorporated into this disclosure by reference.

[0158] In this disclosure, there are no particular limitations on the methods used by the gene regulation system to reduce or eliminate the expression and / or function of the BCOR and ZC3H12A genes. Exemplarily, in some embodiments, the gene regulation system may employ gene knockout technology, gene silencing technology, inactivation mutation technology, PROTAC technology, or small molecule inhibitors to treat the BCOR and ZC3H12A genes in the recombinant immune cells.

[0159] In some embodiments, compared with unmodified or control immune cells (without a gene regulation system), the gene regulation system in the recombinant immune cells of this disclosure reduces the expression or function of the BCOR gene and the ZC3H12A gene in the immune cells by at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100%, respectively.

[0160] In some specific embodiments, the gene regulation system disclosed herein uses gene knockout technology, gene silencing technology, inactivation mutation technology, or small molecule inhibitors to treat the BCOR gene and ZC3H12A gene in the recombinant immune cells.

[0161] In some implementations, the gene knockout technologies used include CRISPR / Cas technology, artificial zinc finger nucleases (ZFN) technology, transcription activator-like effector (TALE) technology, or TALE-CRISPR / Cas technology.

[0162] In some implementations, the gene regulation system comprises nucleic acid molecules and enzyme proteins, wherein the nucleic acid molecules are guide RNA (gRNA) molecules, and the enzyme proteins are Cas proteins or Cas orthologs.

[0163] In some embodiments, the enzyme protein is selected from Cas9, Cas12a, Cas12b, Cas13a, Cas13b, Cas13c, Cas13e, or Cas13f proteins or their orthologs.

[0164] In some implementations, the gene regulation system of this disclosure includes:

[0165] (i) The targeting domain sequence in the BCOR gene-directing RNA (gRNA) complexes with the first Cas endonuclease protein to form the first ribonucleoprotein (RNP) complex; and;

[0166] (ii) The targeting domain sequence in the ZC3H12A gene guide RNA (gRNA) is combined with the second Cas endonuclease protein to form a second ribonucleoprotein (RNP) complex.

[0167] In some implementations, the first ribonucleoprotein (RNP) complex and the second ribonucleoprotein (RNP) complex may be introduced into immune cells simultaneously, sequentially, or sequentially.

[0168] In some embodiments, in the gene regulation system of this disclosure, the nucleic acid binding segment of the BCOR gene guide RNA (gRNA) binds to a target DNA sequence having at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the DNA sequence encoded by the subject's BCOR gene (e.g., NCBI Gene ID: 54880 or NCBI Gene ID: 71458); and the nucleic acid binding segment of the ZC3H12A gene guide RNA (gRNA) binds to a target DNA sequence having at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the DNA sequence encoded by the subject's ZC3H12A gene (e.g., NCBI Gene ID: 80149 or NCBI Gene ID: 230738).

[0169] In some specific embodiments, in the gene regulation system disclosed herein, the targeting domain of the guide RNA (gRNA) targeting the BCOR gene contains the sequence ACTGGGCAATACCGCAACAG (SEQ ID NO:3) or a sequence having at least 85%, 90%, or 95% identity with SEQ ID NO:3; the targeting domain of the guide RNA (gRNA) targeting the ZC3H12A gene contains the sequence CTAGGGGAATTGGTGAAGCA (SEQ ID NO:4) or a sequence having at least 85%, 90%, or 95% identity with SEQ ID NO:4.

[0170] (Structure used for adoptive cell therapy)

[0171] In some embodiments, the recombinant immune cells described in this disclosure include one or more structures for adoptive cell therapy.

[0172] In some implementations, the corresponding structures for adoptive cell therapy are chimeric antigen receptor (CAR) structures, T-cell antigen receptor (TCR) structures, receptor-binding-based structures, or synthetic T-cell receptor and antigen receptor (STAR). For a description of STAR, see WO2020029774A1 and Yue Liu et al. Chimeric STAR receptors using TCR machinery mediate robust responses against solid tumors. Sci Transl Med. 2021 Mar 24; 13(586):eabb5191. doi:10.1126 / scitranslmed.abb5191.

[0173] In some embodiments, the structure used for adoptive cell therapy is a chimeric antigen receptor (CAR) structure. In some specific embodiments, the structure used for adoptive cell therapy is the chimeric antigen receptor provided above in this disclosure.

[0174] In some implementations, the recombinant immune cells described herein can be detected in the peripheral blood of the subjects at least 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 9 months, 12 months, 18 months, 2 years, 5 years, 10 years, 20 years, or 40 years after administration.

[0175] In some implementations, after administering the medication to the subject for at least 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 9 months, or 12 months, the proportion of the recombinant immune cells described in this disclosure relative to the total amount of similar immune cells is not less than 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%.

[0176] In other embodiments, after administering the medication to the subject for at least 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 9 months, or 12 months, the proportion of recombinant immune cells described in this disclosure relative to the total number of peripheral blood cells is selected from 1%-35%, 3-30%, or 3-20%; the specific value can be any value within the above range, including but not limited to 1%, 3%, 5%, 10%, 15%, 20%, 25%, 30%, or 35%.

[0177] In other embodiments, the recombinant immune cells of this disclosure exhibit increased or prolonged cell viability compared to unmodified immune cells. In such embodiments, the result is an increase in the number of recombinant immune cells of this disclosure present after a given time period compared to unmodified immune cells. For example, in some embodiments, the recombinant immune cells of this disclosure remain viable and persist for 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.5, 3, 3.5, 4, 4.5, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, or more times longer than unmodified immune cells.

[0178] <Preparation Methods of Recombinant Immune Cells>

[0179] In some aspects, this disclosure provides a method for preparing the above-mentioned recombinant immune cells, the method comprising:

[0180] (i) the step of introducing a structure for adoptive cell therapy into immune cells; and,

[0181] (ii) The steps of introducing gene regulatory systems into immune cells.

[0182] (Steps for introducing gene regulatory systems into immune cells)

[0183] In some embodiments, the gene regulation system can reduce or eliminate the expression and / or function of the BCOR and ZC3H12A genes. Optionally, the gene regulation system may employ gene knockout, gene silencing, inactivation mutation, or small molecule inhibitors to treat the BCOR and ZC3H12A genes in immune cells.

[0184] In some implementations, the gene knockout technology includes CRISPR / Cas technology, artificial zinc finger nucleases (ZFN) technology, transcription activator-like effector (TALE) technology, or TALE-CRISPR / Cas technology.

[0185] In some implementations, the CRISPR / Cas technology is selected from CRISPR-Cas3, CRISPR-Cas9, CRISPR-Cas12, CRISPR-Cas13, CRISPR-CasX, or CRISPR-IscB systems. For example, a description of the CRISPR-CasX system can be found in Liu JJ et al., Nature, 2019 or https: / / doi.org / 10.1016 / j.molcel.2022.02.002. A description of the CRISPR-IscB system can be found in Han Altae-Tran et al., Science 374, Vol 374, Issue 6563, 57-65 (2021). DOI:10.1126 / science.abj6856.

[0186] In some implementations, the CRISPR / Cas technology is specifically selected from CRISPR-Cas9, CRISPR-Cas12a, CRISPR-Cas12b, CRISPR-Cas13a, CRISPR-Cas13b, CRISPR-Cas13c, CRISPR-Cas13e, or CRISPR-Cas13f systems.

[0187] In some implementations, CRISPR / Cas technology uses guide RNA (gRNA) and Cas endonuclease targeting the BCOR gene, and guide RNA (gRNA) and Cas endonuclease targeting the ZC3H12A gene.

[0188] In some implementations, the CRISPR / Cas technology guide RNA (gRNA) includes, simultaneously or separately, a guide RNA (gRNA) targeting the BCOR gene and a guide RNA (gRNA) targeting the ZC3H12A gene.

[0189] This disclosure provides guide RNA (gRNA) for directing site-modified peptides to specific target nucleic acid sequences. The gRNA contains a nucleic acid targeting region and a protein-binding region. The nucleic acid targeting region of the gRNA contains a nucleotide sequence complementary to a sequence in the target nucleic acid sequence. Therefore, the nucleic acid targeting region of the gRNA interacts with the target nucleic acid in a sequence-specific manner via hybridization (i.e., base pairing), and the nucleotide sequence of the nucleic acid targeting region determines the location within the target nucleic acid where the gRNA will bind. The nucleic acid targeting region of the gRNA can be modified (e.g., through genetic engineering) to hybridize with any desired sequence within the target nucleic acid sequence.

[0190] The protein-binding segment of the guide RNA interacts with a site-directed modifying polypeptide (e.g., a Cas protein) to form a complex. The guide RNA then directs the bound polypeptide to a specific nucleotide sequence within the target nucleic acid via this nucleic acid-targeting segment. The protein-binding segment of the guide RNA contains two complementary nucleotide fragments that form a double-stranded RNA double helix.

[0191] In some embodiments, gRNA comprises two separate RNA molecules. In such embodiments, each of the two RNA molecules contains a complementary nucleotide segment, such that the complementary nucleotides of the two RNA molecules hybridize to form a double-stranded RNA duplex of a protein-binding segment. In some embodiments, gRNA comprises a single RNA molecule (single guide RNA, sgRNA).

[0192] The specificity of the gRNA to the target locus is mediated by the sequence of a nucleic acid-binding region comprising approximately 20 nucleotides complementary to a target nucleic acid sequence within the target locus. In some embodiments, the corresponding target nucleic acid sequence is approximately 20 nucleotides in length. In some embodiments, the nucleic acid-binding region of the gRNA sequence disclosed herein is at least 90% complementary to the target nucleic acid sequence within the target locus. In some embodiments, the nucleic acid-binding region of the gRNA sequence disclosed herein is at least 95%, 96%, 97%, 98%, or 99% complementary to the target nucleic acid sequence within the target locus. In some embodiments, the nucleic acid-binding region of the gRNA sequence disclosed herein is 100% complementary to the target nucleic acid sequence within the target locus. In some embodiments, the target nucleic acid sequence is an RNA target sequence. In some embodiments, the target nucleic acid sequence is a DNA target sequence.

[0193] In some implementations, the target nucleic acid sequence within the target locus must be altered. For example, the target nucleic acid sequence may change because the Cas protein used changes and the new Cas protein has a different PAM. This specification provides numerous examples of target nucleic acid sequences for gRNAs in the specifications and tables provided herein. Any of these target nucleic acid sequences can be altered by moving the target nucleic acid sequence at the 5' or 3' end within the target locus of a given gene. In some implementations, the target nucleic acid sequence is moved at the 5' or 3' end within the target locus of a given gene by up to 100 bp. In other embodiments, the target nucleic acid sequence moves at a 5' or 3' bp at the target locus within a given gene (e.g., the human or mouse BCOR gene and / or ZC3H12A gene as described in Table 1) for up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, or 95 bp.

[0194] In some implementations, the nucleic acid-binding segment of the BCOR gene guide RNA (gRNA) binds to a target DNA sequence having at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the DNA sequence encoded by the subject's BCOR gene (e.g., NCBI Gene ID: 54880 or NCBI Gene ID: 71458); the nucleic acid-binding segment of the ZC3H12A gene guide RNA (gRNA) binds to a target DNA sequence having at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the DNA sequence encoded by the subject's ZC3H12A gene (e.g., NCBI Gene ID: 80149 or NCBI Gene ID: 230738).

[0195] In some implementations, the nucleic acid-binding segment of the ZC3H12A gene-guided RNA (gRNA) binds to a target DNA sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% identity with a DNA sequence defined by a set of genomic coordinates shown in Table 7 or Table 8 of WO2020163365A2. Alternatively, the nucleic acid-binding segment of the ZC3H12A-targeting gRNA molecule binds to a target DNA sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% identity with a target DNA sequence shown in Tables 16 and 17 of WO2020163365A2.

[0196] In some implementations, the targeting domain of the guide RNA (gRNA) targeting the BCOR gene comprises the sequence ACTGGGCAATACCGCAACAG (SEQ ID NO:3) or a sequence having at least 85%, 90%, or 95% identity with SEQ ID NO:3; the targeting domain of the guide RNA (gRNA) targeting the ZC3H12A gene comprises the sequence CTAGGGGAATTGGTGAAGCA (SEQ ID NO:4) or a sequence having at least 85%, 90%, or 95% identity with SEQ ID NO:4.

[0197] (The steps involved in introducing structures for adoptive cell therapy into immune cells)

[0198] In some embodiments, the step of introducing a structure for adoptive cell therapy into immune cells involves introducing a sequence of a CAR structure, TCR structure, or other adoptive cell therapy-appropriate structure carrying a target. As previously mentioned, the target may be a soluble factor, preferably an inflammatory cytokine, and more preferably a tumor necrosis factor.

[0199] In some embodiments, the tumor necrosis factor includes one or more of TNF-α and TNF-β. In some embodiments, the tumor necrosis factor includes TNF-α. In some more preferred embodiments, the tumor necrosis factor is TNF-α.

[0200] In some embodiments, the structure used for adoptive cell therapy is a chimeric antigen receptor (CAR) structure. In some specific embodiments, the structure used for adoptive cell therapy is the chimeric antigen receptor provided above in this disclosure.

[0201] (Import Method)

[0202] In this disclosure, there are no particular limitations on the methods for introducing structures for adoptive cell therapy, gene regulatory systems, and biomolecules for treating diseases. For example, nucleotides carrying structures, gene regulatory systems, or biomolecules for treating diseases that can express the structure for adoptive cell therapy, are introduced into immune cells using techniques known to those skilled in the art.

[0203] In some embodiments, the vector used is a viral vector, a viral-like vector, or a non-viral vector. In some embodiments, a recombinant vector containing polynucleotides encoding one or more components of the structure, gene regulatory system described herein for adoptive cell therapy (e.g., components of a gene regulatory system for reducing or eliminating the expression and / or function of the BCOR gene and ZC3H12A gene in immune cells, such as sgRNA, Cas protein, etc.) and / or biomolecules for treating the disease is a viral vector. Suitable viral vectors include, but are not limited to, viral vectors based on: vaccinia virus, poliovirus, adenovirus, adeno-associated virus, SV40, herpes simplex virus, human immunodeficiency virus, retroviral vectors (e.g., murine leukemia virus, spleen necrosis virus, and vectors derived from retroviruses, such as Rous sarcoma virus, Harvey sarcoma virus, avian leukosis virus, lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus). Suitable non-viral vectors are selected from transposons, lipid nanoparticles, liposomes, exosomes, attenuated bacteria, or virus-like particles.

[0204] In some embodiments, a polynucleotide sequence encoding one or more components of a structure, gene regulatory system, and / or a biomolecule for treating a disease, as described herein for adoptive cell therapy, is operatively linked to a control element, such as a transcriptional control element, like a promoter. The transcriptional control element may be functional in eukaryotic cells (e.g., mammalian cells) or prokaryotic cells (e.g., bacterial or archaea cells). In some embodiments, a polynucleotide sequence encoding one or more components of a structure, gene regulatory system, and / or a biomolecule for treating a disease, as described herein, is operatively linked to multiple control elements that allow the polynucleotide to be expressed in both prokaryotic and eukaryotic cells. Depending on the cell type and gene regulatory system used, any of many suitable transcriptional and translational control elements (including constitutive and inducible promoters, transcriptional enhancer elements, transcriptional terminators, etc.) can be used in the expression vector.

[0205] In some embodiments, non-limiting examples of suitable eukaryotic promoters (promoters that function in eukaryotic cells) include those from cytomegalovirus (CMV) immediate early, herpes simplex virus (HSV) thymidine kinase, early and late SV40, long terminal repeat (LTR) sequences from retroviruses, and mouse metallothionein-1. The selection of suitable vectors and promoters is entirely within the capabilities of those skilled in the art. Expression vectors may also contain a ribosome-binding site for translation initiation and a transcription terminator. Expression vectors may also include appropriate sequences for amplifying expression. Expression vectors may also contain nucleotide sequences encoding a protein tag (e.g., a 6xHis tag, a hemagglutinin tag, green fluorescent protein, etc.) that fuses with a site-directed modified polypeptide, thereby producing a chimeric polypeptide.

[0206] In some embodiments, the method for preparing recombinant immune cells disclosed herein includes the step of introducing an expression vector into the recombinant immune cells. Methods for introducing polynucleotides and recombinant expression vectors into host cells are known in the art, and any known method can be used to introduce components of a gene regulatory system into cells. Suitable methods include, for example, viral or bacteriophage infection, transfection, conjugation, protoplast fusion, lipid transfection, electroporation, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran-mediated transfection, liposome-mediated transfection, particle gun technology, calcium phosphate precipitation, direct microinjection, nanoparticle-mediated nucleic acid delivery, microfluidic delivery methods, etc. Furthermore, cells can be introduced by administering non-viral delivery media such as transposons, nanoparticles (e.g., lipid nanoparticles), liposomes, exosomes, attenuated bacteria, or virus-like particles.

[0207] (Other steps)

[0208] In some embodiments, the method for preparing recombinant immune cells provided in this disclosure further includes the step of obtaining immune cells. In principle, there are no particular limitations on the method for obtaining immune cells in this disclosure. For example, peripheral blood mononuclear cells can be isolated from the peripheral blood of a subject, and immune cells of a specific phenotype can be separated using techniques such as magnetic bead sorting or flow cytometry sorting.

[0209] In some embodiments, the method for preparing recombinant immune cells provided in this disclosure further includes a step of culturing recombinant immune cells. In principle, there are no particular limitations on the method for culturing immune cells in this disclosure. In some embodiments, recombinant immune cells can be implanted into a subject for expansion, and the expanded recombinant immune cells can be obtained in vivo. The recombinant immune cells obtained from the expansion of a first-generation subject can be used for the subject's autologous treatment or for allogeneic treatment of other subjects. In some embodiments, the immune cells are the subject's own immune cells or allogeneic immune cells.

[0210] <Composition>

[0211] In other aspects, this disclosure provides a composition for treating a disease. In some embodiments, "composition" refers to an formulation of genetically regulated and / or modified recombinant immune cells, chimeric antigen receptors, and / or biological materials provided in this disclosure, which can be administered or delivered to a subject or cells. A "therapeutic composition" or "pharmaceutical composition" (which may be used interchangeably herein) is a composition comprising genetically regulated and / or modified recombinant immune cells, chimeric antigen receptors, and / or biological materials provided in this disclosure, which can be administered to a subject to treat a specific disease or condition.

[0212] In some embodiments, the therapeutic composition comprises the recombinant immune cells described in any of the above embodiments. In some embodiments, the therapeutic composition comprises the chimeric antigen receptor described in any of the above embodiments. In some embodiments, the therapeutic composition comprises the biological material described in any of the above embodiments.

[0213] In some alternative embodiments, the composition for treating the disease also includes a pharmaceutically acceptable carrier.

[0214] <Methods for treating diseases or symptoms and methods for degrading soluble factors and inflammatory cytokines>

[0215] In some embodiments, this disclosure provides a method for treating a disease or condition in a subject in need. The method includes administering to the subject the recombinant immune cells described in any of the above embodiments, the chimeric antigen receptor described in any of the above embodiments, the biomaterial described in any of the above embodiments, and / or the composition described in any of the above embodiments.

[0216] In some embodiments, this disclosure provides the recombinant immune cells, the chimeric antigen receptor, the biomaterial, and / or the composition described in any of the above embodiments for the treatment and / or prevention of diseases or conditions in subjects.

[0217] In some embodiments, the disease or condition includes diseases associated with or targeting soluble factors, preferably inflammatory cytokines, more preferably tumor necrosis factor (TNF), particularly those associated with TNF-α. In some specific embodiments, the diseases associated with or targeting tumor necrosis factor (TNF) include rheumatoid arthritis, intestinal inflammation (e.g., Crohn's disease, ulcerative colitis), dermatitis (e.g., plaque psoriasis, hidradenitis suppurativa), ankylosing spondylitis, psoriatic arthritis, juvenile idiopathic arthritis, uveitis, and non-radiological axial spondyloarthritis.

[0218] In some more specific implementations, diseases associated with or targeting tumor necrosis factor (TNF) include rheumatoid arthritis.

[0219] In some embodiments, this disclosure provides a method for degrading soluble factors and inflammatory cytokines, comprising the steps of the recombinant immune cells described in any of the above embodiments, the chimeric antigen receptor described in any of the above embodiments, the biomaterial described in any of the above embodiments, and / or applying the composition described in any of the above embodiments to contact the soluble factors and inflammatory cytokines.

[0220] In some implementations, the contact can be performed in vivo or in vitro.

[0221] In some embodiments, the inflammatory cytokine includes tumor necrosis factor (TNF). In some embodiments, the tumor necrosis factor includes one or more of TNF-α and TNF-β. In some embodiments, the tumor necrosis factor includes TNF-α. In some more preferred embodiments, the tumor necrosis factor is TNF-α.

[0222] <Pharmaceutical Uses and Other Uses>

[0223] In some respects, this disclosure provides an use in preparing a medicine.

[0224] In some embodiments, this disclosure provides the use of the recombinant immune cells, chimeric antigen receptors, biomaterials, and / or the composition described in any of the above embodiments in the preparation of a medicament for treating and / or preventing a disease or condition in a subject in need.

[0225] In some embodiments, the disease or condition includes diseases associated with or targeting soluble factors, preferably inflammatory cytokines, more preferably tumor necrosis factor (TNF), particularly those associated with TNF-α. In some specific embodiments, the diseases associated with or targeting tumor necrosis factor (TNF) include rheumatoid arthritis, intestinal inflammation (e.g., Crohn's disease, ulcerative colitis), dermatitis (e.g., plaque psoriasis, hidradenitis suppurativa), ankylosing spondylitis, psoriatic arthritis, juvenile idiopathic arthritis, uveitis, and non-radiological axial spondyloarthritis.

[0226] In some more specific implementations, diseases associated with or targeting tumor necrosis factor (TNF) include rheumatoid arthritis.

[0227] In some embodiments, this disclosure provides the use of the recombinant immune cells, chimeric antigen receptors, biomaterials, and / or the composition described in any of the above embodiments in degrading inflammatory cytokines or in preparing reagents for degrading inflammatory cytokines.

[0228] In some embodiments, the inflammatory cytokine includes tumor necrosis factor (TNF). In some embodiments, the tumor necrosis factor includes one or more of TNF-α and TNF-β. In some embodiments, the tumor necrosis factor includes TNF-α. In some more preferred embodiments, the tumor necrosis factor is TNF-α.

[0229] Example

[0230] The embodiments of the present invention will be described in detail below with reference to examples. However, those skilled in the art will understand that the following examples are for illustrative purposes only and should not be considered as limiting the scope of the invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer are followed. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0231] Example 1: Preparation of recombinant TNFR1 CAR-T cells with Bcor and / or Zc3h12a knocked out

[0232] 1) Construction of TNFR1 CAR vector

[0233] As shown in Figures 1a and 1c, this embodiment designed and constructed a retrovirus-based TNFR1 CAR expression vector, namely pMIG-EFS-Thy1.1-P2A-TNFR1-CAR (SEQ ID NO:11): the TNFR1-CAR structure (SEQ ID NO:7) includes the extracellular domain (amino acids 1-212) of mouse TNF receptor 1 (TNFR1), the CD28 transmembrane / intracellular domain and the CD3ζ chain; Thy1.1 is a marker protein for easy detection and CAR T cell purification.

[0234] 2) Construction of HER2 CAR vector

[0235] The only difference from “1) Construction of TNFR1 CAR vector” is that the nucleotide sequence encoding the extracellular domain (amino acids 1-212) of mouse TNF receptor 1 (TNFR1) in the pMIG-EFS-Thy1.1-P2A-TNFR1-CAR vector is replaced with the nucleotide sequence encoding the variable region of HER2 single-chain antibody (SEQ ID NO:5), i.e., pMIG-EFS-Thy1.1-P2A-HER2-CAR.

[0236] 3) Construction of EGFR CAR vector

[0237] The only difference from “1) Construction of TNFR1 CAR vector” is that the nucleotide sequence encoding the extracellular domain (amino acids 1-212) of mouse TNF receptor 1 (TNFR1) in the pMIG-EFS-Thy1.1-P2A-TNFR1-CAR vector is replaced with the nucleotide sequence encoding the extracellular binding region of EGFR (SEQ ID NO:6), i.e., pMIG-EFS-Thy1.1-P2A-EGFR-CAR.

[0238] 4) Construction of TNFR1 CAR vectors with Bcor or / and Zc3h12a gene knockout

[0239] In this embodiment, retrovirus-based sgRNA expression vectors were constructed based on CAR expression vectors, namely pMIG-hU6-sgNT-EFS-Thy1.1-P2A-TNFR1-CAR, pMIG-hU6-sgBcor-EFS-Thy1.1-P2A-TNFR1-CAR, pMIG-hU6-sgZc3h12a-EFS-Thy1.1-P2A-TNFR1-CAR, and pMIG-hU6-sgBcor-hU6-sgZc3h12a-EFS-Thy1.1-P2A-TNFR1-CAR;

[0240] As shown in Figure 3b, where:

[0241] The vector pMIG-hU6-sgNT-EFS-Thy1.1-P2A-TNFR1-CAR (SEQ ID NO:1), wherein positions 263-282 are random sequences that do not target any gene (SEQ ID NO:2), serving as a control without knocking out any gene;

[0242] The vector pMIG-hU6-sgBcor-EFS-Thy1.1-P2A-TNFR1-CAR is obtained by replacing positions 263-282 of SEQ ID NO:1 with the nucleotide sequence shown in SEQ ID NO:3, while keeping the other sequences unchanged. The nucleotide sequence shown in SEQ ID NO:3 is the target sequence recognition region for knocking out Bcor with sgBcor.

[0243] The vector pMIG-hU6-sgZc3h12a-EFS-Thy1.1-P2A-TNFR1-CAR is obtained by replacing positions 263-282 of SEQ ID NO:1 with the nucleotide sequence shown in SEQ ID NO:4, while keeping the other sequences unchanged. The nucleotide sequence shown in SEQ ID NO:4 is the target sequence recognition region of sgZc3h12a used to knock out Zc3h12a.

[0244] The vector pMIG-hU6-sgBcor-hU6-sgZc3h12a-EFS-Thy1.1-P2A-TNFR1-CAR is obtained by replacing positions 242-261 of SEQ ID NO:1 with the target sequence recognition region of mouse sgBcor for knocking out Bcor (SEQ ID NO:3), and positions 663-682 with the target sequence recognition region of mouse sgZc3h12a for knocking out Zc3h12a (SEQ ID NO:4), which is used to simultaneously knock out mouse Bcor and mouse Zc3h12, while keeping other sequences unchanged.

[0245] All vectors were obtained through whole-genome synthesis.

[0246] The sgRNAs used above are shown in Table 2 below:

[0247] Table 2 Target sequence recognition regions of sgRNA

[0248] The corresponding gene was successfully edited, as shown in Figure 3c.

[0249] 5) Initial CD8 + T cell isolation and activation

[0250] Initial CD8 groups were isolated from the spleen of Cas9 transgenic mice (from Jaxson Laboratory, #026430) using a magnetic bead sorting method. + T cells, cells are arranged in 10 6Cells were seeded at a density of 1 μg / ml anti-CD3 antibody (CD3ε, BioXcell#BE0001-1) into 12-well cell culture dishes, and 2 ml of RPMI 1640 medium (containing 5% fetal bovine serum and interleukin-2) was added. At the same time, 1 μg / ml anti-CD28 antibody (BioXcell#BE0015-1) was added for in vitro activation. The cells were then incubated in a 5% CO2 incubator at 37°C for 36 hours before viral infection.

[0251] 6) Construction of TNFR1 CAR T cells

[0252] The steps are shown in Figure 3a:

[0253] (1) Preparation of retroviruses

[0254] 10 6 Plat-E cells (Cell Biolabs #RV-101) were cultured adherently for 24 hours. Then, 20 μg of the TNFR1 CAR expression vector pMIG-EFS-Thy1.1-P2A-TNFR1-CAR prepared in step 1 and 60 μg of the packaging plasmid pCL-Eco (purchased from Addgene #12371) were co-transfected using the calcium phosphate precipitation method. 48 hours after transfection, the supernatant containing the packaging virus was harvested. The viral supernatant was filtered through a 0.45 μm filter membrane to remove dead cell impurities, yielding the retroviral supernatant, which is the retrovirus carrying the TNFR1 CAR.

[0255] (2) Retroviral infection

[0256] After 36 hours of in vitro culture activation, 1×10⁻⁶ of the culture in step 4) was added. 6 Quantity CD8 + T cells were mixed with 1 ml of the retrovirus supernatant obtained in step (1) and centrifuged at 2000g for 2 hours at room temperature. Then, they were incubated in a CO2 incubator for 4 hours, and then replaced with 2 ml of fresh RPMI 1640 medium (containing 5% fetal bovine serum and 2 ng / ml interleukin-2) and cultured for a longer period (this time is recorded as the post-infection time). Thy1.1 positive cells (Thy1.1-biotin, BioLegend#202510) were sorted by flow cytometry to obtain TNFR1 CAR-T cells, abbreviated as TNFR1T cells.

[0257] 7) Construction of TNFR1 CAR T cells with Bcor or / and Zc3h12a gene knockout

[0258] The only difference from “5) Construction of TNFR1 CAR T cells” is that “pMIG-EFS-Thy1.1-P2A-TNFR1-CAR” is replaced with an sgRNA expression vector that knocks out the corresponding gene, such as “pMIG-hU6-sgBcor-hU6-sgZc3h12a-EFS-Thy1.1-P2A-TNFR1-CAR”, “pMIG-hU6-sgBcor-EFS-Thy1.1-P2A-TNFR1-CAR”, “pMIG-hU6-sgZc3h12a-EFS-Thy1.1-P2A-TNFR1-CAR”, and “pMIG-hU6-sgNT-EFS-Thy1.1-P2A-TNFR1-CAR” without knocking out the specific gene. All other steps remain the same. Ultimately, this yields TNFR1 CAR-T cells that simultaneously knock out Bcor and Zc3h12a (denoted as sgBcor / Zc3h12a), abbreviated as TNFR1T. BZ The other three cell types were named sgBcor-TNFR1T cells, sgZc3h12a-TNFR1T cells, and sgNT-TNFR1T cells, respectively.

[0259] 8) Construction of HER2 CAR T cells

[0260] The only difference from “5) Construction of TNFR1 CAR T cells” is that “pMIG-EFS-Thy1.1-P2A-TNFR1-CAR” is replaced with “pMIG-EFS-Thy1.1-P2A-HER2-CAR”, and named as: HER2 CAR T cells.

[0261] 9) Construction of EGFR CAR T cells

[0262] The only difference from “5) Construction of TNFR1 CAR T cells” is that “pMIG-EFS-Thy1.1-P2A-TNFR1-CAR” is replaced with “pMIG-EFS-Thy1.1-P2A-EGFR-CAR”, and named as: EGFR CAR T cells.

[0263] Example 2: TNFR1 CAR T cells (TNFR1T) expand in vitro upon TNF stimulation and are capable of TNF endocytosis.

[0264] 1) Detection of TNFR1T amplification after TNF stimulation in vitro

[0265] The method was the same as in Example 1, constructing TNFR1 CAR T cells (TNFR1T, referred to as TNFR1 CAR in Figure 1) and HER2 CAR T cells (referred to as HER2 CAR in Figure 1). As shown in Figure 1d, flow cytometry analysis using co-staining with anti-Thy1.1 and anti-TNFR1 antibodies (Invitrogen, MA5-17899) showed that TNFR1T cells expressed Thy1.1 and TNFR1 on their surface, with HER2 CAR T cells serving as a control. The results showed that TNFR1 T cells expressed both Thy1.1 and TNFR1, while HER2 CAR T cells expressed only Thy1.1. As shown in Figure 1e, in the in vitro binding assay, the RFP-TNF fusion protein (RFP molecule GenBank: CAH64892.1; TNF molecule GenBank: AAA40462.1) specifically bound to TNFR1T cells, but not to HER2 CAR T cells. These data indicate that TNFR1 CAR is expressed on T cells and binds to soluble TNF. As shown in Figures 1f and g, in the TNF endocytosis study, supernatant containing TNF-RFP was co-incubated with TNFR1T cells on ice for 20 min, followed by washing with FACS buffer to remove unbound TNF, and then incubation at 37°C for 24 h. Cells were subsequently analyzed using FACS to measure fluorescence intensity over time, thereby quantifying endocytosed TNF and aiding in understanding its dynamics. After incubation with soluble TNF, TNFR1T cells exhibited upregulation of CD69, a marker of T cell activation, indicating that soluble TNF can activate TNFR1T cells. Consistently, TNF enhanced the expansion of TNFR1T cells, while having no effect on HER2 CAR T cells (Figure 1h). These data suggest that soluble TNF can specifically activate and promote the expansion of TNFR1T. It has been reported in the literature (Proc Natl Acad Sci US A. 1991; 88(7): 2830-4.) that mouse TNFR1 can also recognize human TNF. It is expected that soluble human TNF (hTNF) can also specifically activate and promote the amplification of TNFR1T, which was demonstrated in subsequent Example 5.

[0266] 2) Detection of TNFR1 CAR and TNF degradation capacity by fluorescence-activated cell sorting

[0267] The method was the same as in Example 1, constructing TNFR1 CAR T cells (i.e., TNFR1T, abbreviated as TNFR1 CAR in Figure 1) and EGFR CAR T cells (abbreviated as EGFR CAR in Figure 1). The experimental procedure is shown in Figure 1i. Anti-TNFR1 antibody or RFP-TNF (RFP and TNF fusion protein) was incubated with TNFR1 CAR T or EGFR CAR T cells on ice for 20 minutes, followed by washing three times with flow cytometry buffer (1XPBS / 0.5% BSA) to remove unbound anti-TNFR1 antibody or TNF. Cells were then incubated at 0°C or 37°C for 24 hours to allow degradation. Subsequently, FACS was used to analyze the cells to measure TNFR1 expression and changes in fluorescence intensity over time, thereby quantifying the degradation of TNFR1 CAR and TNF.

[0268] As shown in Figures 1j and k, TNFR1T cells, rather than EGFR CAR T cells, expressed TNFR1, and after incubation at 37°C for 24 hours, the anti-TNFR1 antibody signal was significantly reduced. As shown in Figures 1l and m, TNFR1T cells, rather than EGFR CAR T cells, bound TNF. Compared with cells maintained at 0°C, TNFR1T cells showed significantly reduced TNF fluorescence after incubation at 37°C for 24 hours, indicating that the TNFR1 CAR and TNF on the surface of TNFR1T cells are degraded or detached after TNF endocytosis.

[0269] 3) Immunofluorescence confocal microscopy analysis of TNFR1T endocytosis capacity

[0270] In the control group, TNFR1T cells were incubated in complete T cell culture medium containing RFP-TNF at 0°C for 24 h to allow RFP-TNF to bind to TNFR1 CAR T cells. In the experimental group, TNFR1 CAR T cells were incubated in complete T cell culture medium containing RFP-TNF at 37°C for 24 h. They were then washed three times with flow cytometry buffer. After labeling the surface CD8a of TNFR1 CAR T cells with anti-CD8a-FITC antibody at 4°C, TNFR1 CAR T cells were coated onto poly-L-lysine-containing slides. As shown in Figure 1 (n and o), immunofluorescence confocal microscopy analysis showed that in the experimental group, TNF-RFP was internalized within TNFR1 CAR T cells.

[0271] Example 3: TNFR1 CAR T cells (TNFR1T) do not proliferate in vivo.

[0272] Figure 2a shows the cell reinfusion process: from Cas9 + CD8 isolates from spleen and lymph nodes of transgenic mice +T cells were activated with anti-CD3 and CD28 antibodies for 24 hours to obtain activated CD8. + T cells; then, retroviruses obtained by transfecting pMIG-EFS-Thy1.1-P2A-TNFR1-CAR were used to infect activated CD8 cells. + T cells were used to obtain recombinant cells named TNFR1-CAR T cells (method as in Example 1). These cells, obtained 24 hours after infection, were then intravenously transfused into C57BL / 6j(B6) mice, as follows:

[0273] Six- to eight-week-old B6 mice weighing 20-25g were divided into two groups: the PBS group (n=6) and the TNFR1-CAR T cell group (n=6).

[0274] PBS group: The group that received PBS injections;

[0275] TNFR1-CAR T group: The TNFR1-CAR T cells prepared by the method in Example 1 were prepared into a cell suspension with PBS and reinfused into each mouse in the TNFR1-CAR T group via the tail of the mouse.

[0276] Sixteen days later, flow cytometry was used to detect TNFR1-CAR T cells in mice.

[0277] However, as shown in Figures 2b and c, TNFR1T cells were not detectable in the blood or any other organs of immune-normal B6 mice, indicating that they did not expand in vivo.

[0278] Example 4: TNFR1T cells lacking BCOR and ZC3H12A (TNFR1T BZ It expands and persists in the body.

[0279] The method is the same as 4), 6), and 7) in Example 1 to obtain sgNT-TNFR1T cells, sgBcor-TNFR1T cells, sgZc3h12a-TNFR1T cells, and TNFR1T cells. BZ Cells. The cells obtained 24 hours after infection were transfused into B6 mice via the tail vein, as follows:

[0280] Six- to eight-week-old B6 mice weighing 20-25g were randomly divided into five groups: PBS group (n=6), sgNT group (n=6), sgBcor group (n=6), sgZc3h12a group (n=6), and TNFR1T group (n=6). BZ Group (6 animals).

[0281] PBS group: The group that received PBS injections;

[0282] sgNT group: sgNT-TNFR1T cells prepared by the method in Example 1 were prepared into a cell suspension with PBS and reinfused into each mouse in the sgNT group via the tail of the mouse.

[0283] sgBcor group: sgBcor-TNFR1T cells prepared by the method in Example 1 were prepared into a cell suspension with PBS and reinfused into each mouse in the sgBcor group by tail reinfusion.

[0284] sgZc3h12a group: sgZc3h12a-TNFR1T cells prepared by the method in Example 1 were prepared into cell suspension with PBS and reinfused into each mouse in the sgZc3h12a group by tail reinfusion.

[0285] TNFR1T BZ (sgBcor / Zc3h12a) group: TNFR1T prepared by the method in Example 1 was used. BZ Cells were prepared into a cell suspension using PBS and reinfused into TNFR1T cells via mouse tail. BZ Each mouse in the group;

[0286] Two weeks after reinfusion, the levels of TNFR1T or TNFR1T in the peripheral blood of each mouse were analyzed by flow cytometry using anti-CD8 antibody and Thy1.1 antibody. BZ Cells account for a certain percentage of total CD8 + The proportion of T cells, i.e., the amount of TNFR1T or TNFR1T being monitored in the blood. BZ Cell proliferation and persistence.

[0287] The results are shown in Figures 4a and 4b. TNFR1T sgRNAs in PBS, knockout non-targeted controls (sgNT), Bcor (sgBcor), or Zc3h12a (sgZc3h12a) showed negligible amplification in vivo. In contrast, TNFR1T sgRNAs with simultaneous knockout of Bcor and Zc3h12a (TNFR1T) showed negligible amplification. BZ The TNFR1T cells exhibited significant amplification and persistence (Figure 4a, b, c, and d), reflecting the characteristics of TNFR1T. BZ The synergistic role of cells in in vivo expansion and persistence. Long-term monitoring shows that TNFR1T... BZ It persists in the body for at least one year and maintains a relatively stable percentage in the blood (Figure 4c and d). As shown in Figure 4e and f, two weeks after infusion, TNFR1T BZ Exhibiting a typical effector T cell phenotype (CD44) + CD62L - Six months to one year later, the central memory phenotype (CD44) + CD62L + TNFR1T BZThe percentage of effect memory phenotype (CD44) increased, while the effect memory phenotype (CD44) + CD62L - TNFR1T BZ The decrease indicates that its trajectory is similar to the differentiation of normal memory T cells.

[0288] Example 5 TNFR1T BZ Cells provided long-term relief for rheumatoid arthritis mediated by hTNF transgenic mice.

[0289] 1) hTNF-induced rheumatoid arthritis model and its clinical RA score

[0290] Human TNF transgenic mice carrying a modified human TNF gene, resulting in significant TNF overexpression (hTNF transgenic), developed chronic inflammatory arthritis with a 100% incidence rate, closely related to human pathology. These mice spontaneously exhibited joint inflammation in the forelimbs and hindlimbs at approximately 8-12 weeks of age, with the condition gradually worsening with age. These mice displayed spontaneous arthritis characterized by claw deformities, joint swelling, and deformities. Clinical RA scores were measured weekly across all groups, with scores assigned according to specific criteria: 2 points for each claw deformity, 2 points for each joint swelling, and 2 points for each joint deformity, for a maximum total of 24 points. The scoring system categorized changes as follows: no change (0 points), mild claw or joint deformity / swelling (1 point), and severe deformity or swelling (2 points).

[0291] Female hTNF transgenic mice typically exhibit RA clinical scores after 12 weeks (Figure 5b and h), while male hTNF transgenic mice typically exhibit RA clinical scores after 7 weeks (Figure 6b and e). Therefore, this disclosure describes the reinfusion of TNFR1T in four scenarios: before and after onset in females, and before and after onset in males. BZ To assess its therapeutic effect.

[0292] 2) Infusion of TNFR1T before the onset of rheumatoid arthritis mediated by female hTNF transgenic mice BZ It can prevent the onset of rheumatoid arthritis.

[0293] The method used in Example 1 was the same as that used to obtain TNFR1T cells and TNFR1T cells. BZ Cells. The cells obtained 24 hours after infection were intravenously injected into hTNF transgenic mice via the tail vein, as follows:

[0294] As shown in flowchart 5a, 5-week-old female B6 and hTNF transgenic (Taconic Biosciences, Cat#1006) mice with similar body weights were divided into three groups: the B6 group (6 B6 mice), the TNFR1T group (6 hTNF transgenic mice), and the TNFR1T group.BZ Group (6 hTNF transgenic mice).

[0295] TNFR1T group: TNFR1T cells prepared by the method in Example 1 were prepared into a cell suspension with PBS and reinfused into each mouse in the TNFR1T group by tail reinfusion.

[0296] TNFR1T BZ Group: TNFR1T prepared by the method in Example 1 BZ Cells were prepared into a cell suspension using PBS and reinfused into TNFR1T cells via mouse tail. BZ Each mouse in the group;

[0297] RA clinical scores, mouse weight, and grip strength were then monitored weekly. Microcomputed tomography analysis was performed. Bone samples were preserved in 4% glutaraldehyde (PFA) solution in phosphate-buffered saline. Tomographic images of the PFA-treated bone samples were acquired using a vivaCT40 scanner (Scanco, Bassersdorf, Switzerland).

[0298] As shown in Figures 5b, c, and d, female hTNF transgenic mice typically develop RA after 12 weeks, including increased RA clinical scores, weight loss, and weakened grip strength. As shown in Figure 5b, TNFR1T was reinfused at 5 weeks of age. BZ Cells, but not TNFR1T cells, prevented the development of RA. As shown in Figure 5c, TNFR1T cells were reinfused. BZ Cellular rescuing partially restored the reduced weight gain in hTNF transgenic mice, while TNFR1T did not. As shown in Figures 5d, e, and f, TNFR1T... BZ Instead of TNFR1T, TNFR1T consistently prevented joint deformities in hTNF transgenic mice. BZ The weakened grip strength of hTNF transgenic mice was restored to near-wild-type levels.

[0299] 3) TNFR1T BZ Therapeutic effects of hTNF transgenic mice on rheumatoid arthritis

[0300] The method used in Example 1 was the same as that used to obtain TNFR1 T cells and TNFR1 T cells. BZ Cells. The cells obtained 24 hours after infection were intravenously injected into hTNF transgenic mice via the tail vein, as follows:

[0301] As shown in the flowchart in Figure 5, six 8-week-old female B6 (B6 group) mice with similar body weights and 12 hTNF transgenic mice were monitored weekly for RA clinical scores.

[0302] At 18 weeks, hTNF transgenic mice were randomly assigned to two groups based on their RA clinical score and grip strength: the TNFR1T group (n=6) and the TNFR1T group. BZ Group (6 animals).

[0303] TNFR1T group: TNFR1T cells prepared by the method in Example 1 were prepared into a cell suspension with PBS and reinfused into each mouse in the TNFR1T group by tail reinfusion.

[0304] TNFR1T BZ Group: TNFR1T prepared by the method in Example 1 BZ Cells were prepared into a cell suspension using PBS and reinfused into TNFR1T cells via mouse tail. BZ Each mouse in the group.

[0305] Subsequently, RA clinical scores and grip strength were monitored weekly.

[0306] As shown in h and i in Figure 5, TNFR1T or TNFR1T was reinfused at 18 weeks of age. BZ Cells, compared to TNFR1T cells, TNFR1T BZ More effectively inhibiting the development of RA, consistently, TNFR1T BZ It limited the trend of weakened grip strength in hTNF transgenic mice and showed some degree of recovery.

[0307] 4) Reinfusion of TNFR1T before the onset of rheumatoid arthritis in male hTNF transgenic mice BZ It can prevent the onset of rheumatoid arthritis.

[0308] The method used in Example 1 was the same as that used to obtain TNFR1T cells and TNFR1T cells. BZ Cells. The cells obtained 24 hours after infection were intravenously injected into hTNF transgenic mice via the tail vein, as follows:

[0309] As shown in flowchart 6a, 5-week-old male B6 and hTNF transgenic mice with similar body weights were divided into three groups: the B6 group (6 B6 mice), the TNFR1T group (6 hTNF transgenic mice), and the TNFR1T group. BZ Group (6 hTNF transgenic mice).

[0310] TNFR1T group: TNFR1T cells prepared by the method in Example 1 were prepared into a cell suspension with PBS and reinfused into each mouse in the TNFR1T group by tail reinfusion.

[0311] TNFR1T BZ Group: TNFR1T prepared by the method in Example 1 BZCells were prepared into a cell suspension using PBS and reinfused into TNFR1T cells via mouse tail. BZ Each mouse in the group;

[0312] Subsequently, RA clinical scores and mouse weight and grip strength were monitored weekly.

[0313] As shown in Figures 6b and c, male hTNF transgenic mice typically develop RA after 7-8 weeks, including increased RA clinical scores, weight loss, and weakened grip strength. As shown in Figure 6b, TNFR1T was reinfused at 5 weeks of age. BZ Cells, but not TNFR1T cells, prevented the development of RA. As shown in Figure 6c, TNFR1T BZ Instead of TNFR1T, it restored the weakened grip strength of hTNF transgenic mice to near-wild-type levels.

[0314] 5) TNFR1T BZ Therapeutic effects of rheumatoid arthritis mediated in male hTNF transgenic mice

[0315] The method used in Example 1 was the same as that used to obtain TNFR1 T cells and TNFR1 T cells. BZ Cells. The cells obtained 24 hours after infection were intravenously injected into hTNF transgenic mice via the tail vein, as follows:

[0316] As shown in flowchart d in Figure 6, six 5-week-old male B6 (B6 group) mice with similar body weights and 12 hTNF transgenic mice were monitored weekly for RA clinical scores.

[0317] At week 8, hTNF transgenic mice were randomly assigned to two groups based on their RA clinical score and grip strength: the TNFR1T group (n=6) and the TNFR1T group. BZ Group (6 animals).

[0318] TNFR1T group: TNFR1T cells prepared by the method in Example 1 were prepared into a cell suspension with PBS and reinfused into each mouse in the TNFR1T group by tail reinfusion.

[0319] TNFR1T BZ Group: TNFR1T prepared by the method in Example 1 BZ Cells were prepared into a cell suspension using PBS and reinfused into TNFR1T cells via mouse tail. BZ Each mouse in the group.

[0320] Subsequently, RA clinical scores and grip strength were monitored weekly.

[0321] As shown in Figures 6e and 6f, TNFR1T or TNFR1T were reinfused at 8 weeks of age. BZCells, compared to TNFR1T cells, TNFR1T BZ More effectively inhibiting the development of RA, consistently, TNFR1T BZ It limited the trend of weakened grip strength in hTNF transgenic mice and showed some degree of recovery.

[0322] Example 6 TNFR1T BZ Cells internalize and degrade TNF via TNFR1 CAR.

[0323] 1) TNFR1T BZ Significantly reduced serum hTNF levels in hTNF transgenic mice

[0324] Six-week-old male B6 and hTNF transgenic mice of similar body weight were divided into three groups: the B6 group (5 B6 mice), the TNFR1T group (5 hTNF transgenic mice), and the TNFR1T group. BZ Group (5 hTNF transgenic mice).

[0325] TNFR1T group: TNFR1T cells prepared by the method in Example 1 were prepared into a cell suspension with PBS and reinfused into each mouse in the TNFR1T group by tail reinfusion.

[0326] TNFR1T BZ Group: TNFR1T prepared by the method in Example 1 BZ Cells were prepared into a cell suspension using PBS and reinfused into TNFR1T cells via mouse tail. BZ Each mouse in the group;

[0327] At 22 weeks of age, serum hTNF levels were assessed using the BD Cytometric Bead Array (CBA) system (BD Biosciences, Cat#551811). Blood samples collected from mice were first incubated at room temperature for 20 minutes, then centrifuged at 2000 rpm for 10 minutes at 4°C. The resulting supernatant was carefully transferred to a new tube and centrifuged again at 2000 rpm for 10 minutes at 4°C. Freshly collected serum samples were immediately subjected to the CBA assay according to the BD CBA protocol to measure serum hTNF levels.

[0328] The results are shown in Figure 7a, TNFR1T BZ It significantly reduced serum hTNF levels in hTNF transgenic mice, bringing them close to wild-type levels, while TNFR1T did not have this effect.

[0329] 2) TNFR1T BZ Endocytosis and degradation of TNF

[0330] TNFR1T detection by fluorescence-activated cell sorting BZ Internalization capacity. The experimental procedure is shown in Figure 7b, where RFP-TNF (a fusion protein of TNF and RFP) is combined with TNFR1T. BZ Cells were incubated on ice for 20 minutes, then washed three times with flow cytometry buffer (1×PBS / 0.5% BSA) to remove unbound TNF, and then incubated at 37°C for 24 or 48 hours to allow endocytosis. Cells were subsequently analyzed using FACS to measure changes in fluorescence intensity over time, thus quantifying endocytosed TNF. TNFR1T was observed in cells held on ice compared to those held on ice. BZ The RFP signal decreased significantly after incubation at 37°C for 24 hours and further decreased after 48 hours (see Figure 7c and d), indicating that RFP-TNF was degraded or detached after endocytosis.

[0331] Immunofluorescence confocal microscopy analysis of TNFR1T BZ Endocytosis capacity. The method is the same as that used for TNFR1T prepared in Example 1. BZ Cells were reinfused into 6-week-old hTNF transgenic mice, and TNFR1T was isolated from the spleen of the mice 22 weeks later. BZ Cells. In the control group, TNFR1T was used. BZ In a complete T-cell culture medium containing RFP-TNF, place on ice for 20 minutes to allow RFP-TNF to react with TNFR1T. BZ Cell-cell binding. In the experimental group, TNFR1T... BZ T cells were incubated in complete culture medium containing RFP-TNF at 37°C for 24 hours. They were then washed three times with flow cytometry buffer. TNFR1T cells were labeled with anti-CD8-FITC antibody at 4°C. BZ After CD8 on the cell surface, TNFR1T BZ Cells were coated on a glass slide containing poly-L-lysine. As shown in Figures 7e and 7f, immunofluorescence confocal microscopy analysis revealed that in the experimental group, TNF-RFP was internalized within TNFR1T cells. BZ In cells. As shown in the schematic diagram in Figure 8, these data indicate that TNFR1T is expressed. BZ The TNFR1 CAR on the surface can endocytose and degrade TNF, thus explaining the reinfusion of TNFR1T BZ It significantly reduced the level of TNF in hTNF transgenic mice.

[0332] In summary, simultaneous knockout of Bcor and Zc3h12a of TNFR1T (TNFR1T) BZ It exhibits significant amplification and persistence, and has significant preventive and therapeutic effects in rheumatoid arthritis mediated by both female and male hTNF transgenic mice.

[0333] The sequences involved in this disclosure are as follows:

[0334] pMIG-hU6-sgNT-EFS-Thy1.1-P2A-TNFR1-CAR (SEQ ID NO: 1):

[0335] In SEQ ID NO:1: (1) uppercase + underline indicates Thy1.1 sequence; (2) uppercase bold + underline indicates sgNT sequence, i.e. SEQ ID NO2; (3) lowercase + single underline indicates TNFR1 extracellular domain sequence; (4) uppercase + single underline indicates CD28 extracellular domain and transmembrane region sequence; (5) uppercase + double underline indicates CD3ζ segment.

[0336] The corresponding sequence of the HER2 single-chain antibody variable region gene fragment (SEQ ID NO:5):

[0337] EGFR corresponding sequence (SEQ ID NO:6):

[0338] The amino acid sequence of TNFR1 CAR (SEQ ID NO:7)

[0339] In SEQ ID NO:7, (1) the single underline is the TNFR1 extracellular domain sequence, i.e., SEQ ID NO:8; (2) the wavy line is the CD28 domain, i.e., SEQ ID NO:9; (3) the double underline is the CD3ζ domain, i.e., SEQ ID NO:10; (4) the “EF” between the TNFR1 extracellular domain and the CD28 domain is the connecting sequence.

[0340] In SEQ ID NO:11: (1) uppercase + underline indicates EFS element; (2) uppercase + underline indicates Thy1.1 sequence; (3) uppercase + underline indicates P2A; (4) lowercase + underline indicates TNFR1 extracellular domain sequence; (5) uppercase + underline indicates CD28 extracellular domain and transmembrane region sequence; (6) uppercase + double underline indicates CD3ζ segment.

[0341] The various embodiments of the present invention have been described above. These descriptions are exemplary and not exhaustive, nor are they limited to the disclosed embodiments. Many modifications and variations will be apparent to those skilled in the art without departing from the scope and spirit of the described embodiments. The terminology used herein is chosen to best explain the principles, practical application, or technical improvements to the embodiments in the market, or to enable others skilled in the art to understand the embodiments disclosed herein.

Claims

1. A chimeric antigen receptor, comprising: (A) an extracellular domain that specifically binds to a soluble factor, preferably, specifically binds to an inflammatory cytokine, more preferably, specifically binds to tumor necrosis factor; (B) a transmembrane domain; (C) an intracellular signaling domain; Preferably, the extracellular domain comprises a polypeptide derived from the tumor necrosis factor receptor superfamily.

2. The chimeric antigen receptor of claim 1, wherein, The extracellular domain comprises a polypeptide derived from tumor necrosis factor receptor 1; Preferably, the tumor necrosis factor receptor 1 comprises an amino acid sequence as set forth in SEQ ID NO:

8.

3. The chimeric antigen receptor of claim 1 or 2, wherein, The chimeric antigen receptor further comprises a polypeptide derived from CD28, preferably, the CD28 comprises an amino acid sequence as set forth in SEQ ID NO: 9; and / or, The chimeric antigen receptor further comprises a polypeptide derived from CD3 zeta, preferably, the CD3 zeta comprises an amino acid sequence as set forth in SEQ ID NO:

10.

4. The chimeric antigen receptor of any one of claims 1-3, wherein, The chimeric antigen receptor comprises one or more of the following sequences: (a1) an amino acid sequence as set forth in SEQ ID NO: 7; (a2) an amino acid sequence that is at least 80%, 82%, 85%, 87%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence as set forth in SEQ ID NO: 7, and which has or partially has the function / activity of the amino acid sequence as set forth in SEQ ID NO: 7; (a3) an amino acid sequence that truncates, adds, substitutes, deletes or inserts 1 or more amino acid residues in the amino acid sequence as set forth in SEQ ID NO: 7, and which has or partially has the function / activity of the amino acid sequence as set forth in SEQ ID NO: 7; or, (a4) an amino acid sequence encoded by a nucleotide sequence that hybridizes to a polynucleotide sequence encoding the amino acid sequence as set forth in SEQ ID NO: 7 under stringent conditions, and which has or partially has the function / activity of the amino acid sequence as set forth in SEQ ID NO: 7, the stringent conditions being medium stringency conditions, medium-high stringency conditions, high stringency conditions or very high stringency conditions.

5. A recombinant immune cell, wherein, The recombinant immune cell comprises the chimeric antigen receptor of any one of claims 1-4.

6. The recombinant immune cell of claim 5, wherein, The recombinant immune cell further comprises a gene regulation system capable of reducing or eliminating the expression and / or function of the BCOR gene and the ZC3H12A gene in the immune cell.

7. The recombinant immune cell of claim 5 or 6, wherein, The immune cell is derived from a mammal; Optionally, the immune cell is selected from one or more of a T cell, a B cell, an NK cell, a mast cell, a tumor infiltrating lymphocyte; Preferably, the immune cell is selected from a T cell or an NK cell; More preferably, the T cells are selected from CD4 + CD8 + T cells, CD8 + T cells, CD4 + T cells, effector T cells, suppressor T cells, naive T cells, memory T cells, gamma-delta T cells, alpha-beta T cells, CD4 - CD8 - one or more of double negative T cells or NKT cells.

8. The recombinant immune cells according to any one of claims 5 to 7, wherein, The gene regulation system employs a gene knockout technique, a gene silencing technique, an inactivation mutation technique, a PROTAC technique or a small molecule inhibitor to treat the BCOR gene and the ZC3H12A gene in the recombinant immune cell.

9. A biomaterial, wherein, The biological material comprises at least one of the following b1) to b3): b1) a polynucleotide encoding the chimeric antigen receptor according to any one of claims 1 to 4; b2) a vector comprising the polynucleotide according to b1); b3) a cell comprising the vector according to b2).

10. A composition comprising the chimeric antigen receptor according to any one of claims 1 to 4, the recombinant immune cell according to any one of claims 5 to 8 and / or the biological material according to claim 9; and, optionally, a pharmaceutically acceptable carrier.

11. Use of the chimeric antigen receptor according to any one of claims 1 to 4, the recombinant immune cell according to any one of claims 5 to 8 and / or the biological material according to claim 9 for the manufacture of a medicament for the treatment and / or prevention of a disease or disorder; wherein, the disease or disorder is selected from a disease associated with or having tumor necrosis factor as a therapeutic target soluble factor, preferably an inflammatory cytokine, more preferably tumor necrosis factor; optionally, the disease associated with or having tumor necrosis factor as a therapeutic target includes rheumatoid arthritis, intestinal inflammation (e.g. Crohn's disease, ulcerative colitis), dermatitis (e.g. plaque psoriasis, hidradenitis suppurativa), ankylosing spondylitis, psoriatic arthritis, juvenile idiopathic arthritis, uveitis, non-radiographic axial spondyloarthritis.

12. Use of the chimeric antigen receptor according to any one of claims 1 to 4, the recombinant immune cell according to any one of claims 5 to 8 and / or the biological material according to claim 9 for degrading a soluble factor or for the manufacture of a reagent for degrading a soluble factor; preferably, the soluble factor comprises an inflammatory cytokine; more preferably, the inflammatory cytokine comprises tumor necrosis factor.

13. A method of degrading a soluble factor, comprising the step of contacting the chimeric antigen receptor according to any one of claims 1 to 4, the recombinant immune cell according to any one of claims 5 to 8 and / or the biological material according to claim 9 with the soluble factor; preferably, the soluble factor comprises an inflammatory cytokine; more preferably, the inflammatory cytokine comprises tumor necrosis factor.

Citation Information

Patent Citations

  • Chimeric antigen receptors and methods of use

    CN108779162A

  • Gene-regulating compositions and methods for improved immunotherapy

    CN112040987A

  • Methods of enhancing immune cell persistence

    CN116103240A

  • Gene-regulating compositions and methods for improved immunotherapy

    US20190284553A1

  • Nucleic acid constructs for co-expression of chimeric antigen receptor and transcription factor, cells containing and therapeutic use thereof

    US20220025001A1